Pe spec i e
Co-occu ence o en omopa hogenic nema odes and ea hwo ms enhances
endu ing biocon ol ac i i y and mic obial di e si y in a na u alized
plan -soil sys em
Ma yam Chelkha
a,b
, Rub´
en Blanco-P´
e ez
c
, Da id Laba ga
b
, Ma ía de To o
d
,
Jo ge Due˜
nas-He nani
b
, Kyle Wickings
a
, Raquel Campos-He e a
b,*
a
Depa men o En omology, Co nell Uni e si y, Co nell Ag iTech, 15 Cas le C eek D i e, Gene a 14456, NY, USA
b
Depa men o Vi icul u e, Ins i u o de Ciencias de la Vid y del Vino (ICVV, CSIC-Gobie no de La Rioja-Uni e sidad de La Rioja), Finca La G aje a, Log o˜
no 26007,
Spain
c
Soils, Biosys ems, and Ag o o es y Ecology Depa men , Misi´
on Biol´
ogica de Galicia (BMG-CSIC), Pon e ed a 36143, Spain
d
Genomics &Bioin o ma ics Co e Facili y, Cen e o Biomedical Resea ch o La Rioja (CIBIR), Log o˜
no 26006, Spain
HIGHLIGHTS GRAPHICAL ABSTRACT
•En omopa hogenic nema odes (EPNs)
and ea hwo ms (EW) in e ac ion poo ly
s udied.
•Adding EPN +EWs o EPN +cu aneous
exc e a (CEx) can modula e plan -soil
bio a sys em.
•EPN i ulence was highe in EWs and
CEx soils han in con ol a e 30 days.
•Bac e ial alpha di e si y was highe in
EPN o EPN +EW/CEx soils a e 30
days.
•Time e ealed o modula e he EPN +
EW/CEx in e ac ions in plan -soil
sys ems.
ARTICLE INFO
Keywo ds:
Eisenia e ida
Mic obiome
High h oughpu sequencing
Solanum lycope sicum
S eine nema el iae
Sus ainable ag icul u e
ABSTRACT
Soil ecosys ems hos di e se mic oo ganisms and auna essen ial o e es ial p ocesses, wi h ea hwo ms (EWs)
and en omopa hogenic nema odes (EPNs) playing c ucial oles. EWs enhance soil heal h by imp o ing ae a ion,
po osi y, and nu ien cycling, while EPNs, such as S eine nema and He e o habdi is, manage pes s by killing
insec s. This s udy aimed o assess he impac o EWs and hei de i a i es (cu aneous exc e a, CEx), alone o
combined wi h EPNs, on soil–plan dynamics, hypo hesizing ha hei co-occu ence would al e soil p ope ies,
bac e ial communi ies, EPN i ulence, and plan pe o mance. Using oma o plan s and ield soil, he s udy
in es iga ed di e en ea men s: con ol, EW (Eisenia e ida), EPN (S eine nema el iae), CEx, and combina ions o
EPN-EW and EPN-CEx, a wo and ou weeks pos -applica ion. Assessmen s included plan g ow h, EPN
in ec i i y, soil p ope ies, and bac e ial p o iling ia 16S RNA gene sequencing. Resul s showed no signi ican
impac on plan g ow h. Howe e , EPN i ulence dec eased a e 30 days when applied alone bu was main-
ained o enhanced when combined wi h EW o CEx. Combined applica ions o EPNs and CEx educed Mg and Ca
* Co esponding au ho .
E-mail add ess: [email p o ec ed] (R. Campos-He e a).
Con en s lis s a ailable a ScienceDi ec
Biological Con ol
jou nal homepage: www.else ie .com/loca e/ybcon
h ps://doi.o g/10.1016/j.biocon ol.2024.105685
Recei ed 26 Oc obe 2024; Recei ed in e ised o m 19 Decembe 2024; Accep ed 23 Decembe 2024
Biological Con ol 200 (2025) 105685
A ailable online 26 Decembe 2024
1049-9644/© 2024 The Au ho (s). Published by Else ie Inc. This is an open access a icle unde he CC BY-NC license (
h p://c ea i ecommons.o g/licenses/by-
nc/4.0/ ).
con en s, while o ganic ma e inc eased in he EPN-EW ea men . Bac e ial communi y changes we e obse ed
30 days pos -inocula ion, wi h inc eased alpha di e si y in co-applica ions o EPNs and EWs. The co-applica ion
o EPNs and EWs esul ed in bene icial impac s on soil p ope ies, EPN i ulence, and bac e ial di e si y. Timing
pos -inocula ion was c ucial in assessing hese e ec s, only de ec ing hose changes a e 30 days, sugges ing he
need o u he ex ended esea ch o unde s and he du a ion o hese changes. This s udy highligh s he
in ica e in e ac ions be ween EWs, EPNs, and plan -soil sys ems, emphasizing hei po en ial impac on plan
g ow h, soil nu ien dynamics, and soil o ganisms, highligh ing he impo ance o iming in e alua ing hese
in e ac ions.
1. In oduc ion
Soil, a non- enewable esou ce, is home o a signi ican po ion o he
Ea h’s biodi e si y (Wall, 2012; Fe ei a e al., 2022). I s inhabi an s,
including a chaea, bac e ia, oomyce es, ungi, nema odes, mi es,
sp ing ails, ea hwo ms, snails, e eb a es, and mo e, in e ac o p o-
ide essen ial ecosys em unc ions (Wall, 2012; Delgado-Baque izo
e al., 2020). These unc ions include main aining soil s uc u e, egu-
la ing hyd ological p ocesses, and decomposing o ganic ma e , di ec ly
impac ing nu ien cycles (Wall, 2012; Delgado-Baque izo e al., 2020).
Fu he mo e, om an ag icul u al s andpoin , soil biodi e si y plays a
c ucial ole in p omo ing plan g ow h and aiding in pes and disease
con ol by p o iding mechanisms o egula e hei popula ions, among
o he unc ions (Ga bach e al., 2014; Bomma co e al., 2018; F´
elix e al.,
2018). The e o e, p ese ing soil biodi e si y is essen ial o ensu ing
ood secu i y in a apidly changing wo ld (El Muj a e al., 2019).
Nume ous soil o ganisms imp o e c op heal h and yields in a ying
ways, o example, by limi ing damage caused by pes s and diseases,
enhancing wa e a ailabili y o nu ien in ake (Bomma co e al., 2018;
F´
elix e al., 2018; El Muj a e al., 2019). Wo ldwide dis ibu ed ea h-
wo ms (EWs), o ins ance, imp o e soil s uc u e, acili a e o ganic
ma e decomposi ion, and gene a e o ganic compounds (in hei
exc e a) ha ac as plan g ow h enhance s (Muscolo e al., 1999;
Eisenhaue &Scheu, 2008; Wall, 2012; Kos e al., 2017). EWs can also
con ibu e o modula ing soil bio a and he unc ions hey p o ide
(Byzo e al., 2007; Hoe ne e al., 2018; Bui ydai ˙
e e al., 2023; Fe lian
e al., 2024). Fo example, hei mo emen can enhance he dis ibu ion
o o he bene icial soil o ganisms, such as en omopa hogenic ungi and
nema odes (Shapi o-Ilan and B own, 2013). EW eeding ac i i y has also
been ound o con ibu e o he educ ion o plan -pa asi ic nema ode
popula ions (Dash e al., 1980; Boye e al., 2013), and hence, EWs can
play an impo an ole in p o ec ing plan oo s om hei a ack and
con ibu ing o secu ing c op yields.
One c yp ic bu possibly equal impo an playe o EWs is he bac-
e ia associa ed wi h he gu and he sec e ion o cu aneous exc e a
(CEx). O e all, he EW gu hos s a species-speci ic mic obial communi y
in luenced by habi a and en i onmen al condi ions (Ai a and Domí-
nguez, 2011; G´
omez-B and´
on e al., 2012). Oxygen and nu ien le els
play c ucial oles in shaping bac e ial composi ion wi hin he gu
compa ed o adjacen soils, a o ing anae obic and acul a i e anae obic
bac e ia like P o eobac e ia, Fi micu es, Bac e oide es, and Ac ino-
bac e ia (Ho n e al., 2003; D ake and Ho n, 2007). Indeed, i was
desc ibed ha he bac e ial communi y in he EW cas di e s om he
su ounding soils (Samped o and Whalen, 2007; Ai a e al., 2015, Ai a
e al., 2016), and hence, hei long- e m p esence could d i e bac e ial
composi ion. In addi ion, EWs sec e e ce ain subs ances, such as he
CEx, h ough do sal po es, which can include u ine, coelomic luid, and
mucus, con aining e en immune cells like coelomocy es wi h de ense
unc ions (Homa e al., 2008; San ocki e al., 2016). Coelomic luid has
been desc ibed o exhibi an imic obial and p o eoly ic p ope ies,
po en ially a ec ing soil o ganisms upon con ac (Dales and Kalaç,
1992; Bilej e al., 1995; Kasschau e al., 2007). In his line, Pla ˇ
sin e al.
(2017) demons a ed ha coelomic luids om ce ain EW species
inhibi he g ow h o phy opa hogenic ungi. Con e sely, sp ing ails
such as He e omu us ni idus ac i ely seek CEx om ea hwo ms,
sugges ing i s signi icance in hei habi a (Salmon and Ponge, 2001).
Hence, all EW ac ions (mo ing and eeding) and hei a ea o in luence,
he d ilosphe e, can modula e soil bio a and hei unc ions.
Simila ly, en omopa hogenic nema odes (EPNs) a e also well-known
bene icial soil o ganisms (Lacey e al., 2015), widesp ead in na u al and
ag icul u al soils (S ua e al., 2015; Campos-He e a e al., 2019). EPNs
occu in soils as a esis ance s age named in ec i e ju enile (IJ), capable
o ac i ely loca ing, pene a ing, and eleasing symbio ic bac e ia
(Xeno habdus o S eine nema and Pho o habdus o He e o habdi is), in
he insec hemocoel (Dillman e al., 2012; S ock, 2015). Inside he in-
sec , bo h nema odes and bac e ia p oduce by-p oduc s esponsible o
killing he hos wi hin 2–3 days (Dowds and Pe e s, 2002) and ep oduce
wi hin he cada e , p o ec ed by he emission o speci ic ola iles and
signals o a oid sca enge and sap ophy ic ac i i y (Gulcu e al., 2012;
Blanco-P´
e ez e al., 2019). Once he ood is deple ed, and he signal o
o e c oding a e p esen , a new coho o IJs inco po a es some bac e ia
inside and eme ges om he cada e , sea ching o new hos s (S ock,
2015).
In he ag icul u al con ex , inocula ion o biological con ol agen s
(e.g., EPNs) and bio e ilize s (e.g., EWs) can con ibu e o bene icial
unc ions ha suppo inc eased p oduc i i y (Be endsen e al., 2012).
Howe e , unde s anding he complex mul i ophic in e ac ions among
bene icial soil o ganisms and hei su ounding en i onmen is chal-
lenging bu c ucial o ad ancing he sus ainabili y o ag icul u al p ac-
ices. Rega ding EWs and EPNs, limi ed s udies ha e ocused on he
s udy o hei in e ac ions in soils. S ill, i is known ha he co-
occu ence o bo h soil o ganisms can enhance he EPN dispe sal and
i s i ulence agains insec pes , e en i species-speci ic (Shapi o e al.,
1995; Shapi o-Ilan and B own, 2013; Chelkha e al., 2021). Some
nega i e impac s ha e also been ound. Fo example, Campos-He e a
e al. (2006) con i med he ansi o IJs h oughou he diges i e ac o
EWs bu wi h limi ed su i al, and Chelkha e al. (2020) epo ed
educed EPN i ulence and ep oduc i i y a e co-occu ing wi h EWs.
The CEx p oduced by EWs migh also be ele an since ad e se e ec s on
EPN i ulence ha e been epo ed o some species-speci ic in e ac ions
(Chelkha e al., 2020, 2021; Fa o e e al., 2020). Howe e , mos o hese
s udies in ol e labo a o y app oaches using au ocla ed subs a es and
sho ime- ames which may limi insigh s in o EW-EPN in e ac ions
(Shapi o e al., 1995; Campos-He e a e al., 2006; Shapi o-Ilan and
B own, 2013; Chelkha e al., 2020, Chelkha e al., 2021). This signi ican
gap migh be add essed by explo ing EW-EPN co-occu ence wi hin
mo e na u alized and complex sys ems, such as hose in ol ing na u al
soils wi h hei bio a and li ing plan oo s.
This s udy aimed o in es iga e he impac o he co-occu ence o
EWs o hei CEx wi h EPNs on (i) plan pe o mance, (ii) nema ode
i ulence, (iii) soil physical–chemical p ope ies, and (i ) soil mic o-
bio a. We hypo hesized signi ican changes in he measu emen s o hese
a iables bu hen apidly e e ed o he o iginal condi ions. Two pos -
exposu e in e als—15 and 30 days— o explo e he empo al dynamics
we e e alua ed. The expe imen s we e pe o med on oma o plan s, a
well-es ablished model o s udying physiological p ocesses and disease
impac s (Díaz-Pend´
on e al., 2010; Gilbe son &Ba uman, 2013). This
choice also holds signi ican po en ial o in eg a ing EPN applica ions
in o below- and abo eg ound In eg a ed Pes Managemen (IPM) s a-
egies (Ba alla-Ca e a e al., 2010; Ga cia-del-Pino e al., 2013, 2018;
M. Chelkha e al. Biological Con ol 200 (2025) 105685
2
Lahi i and O , 2018; Campos-He e a e al., 2021). In his s udy, we
used na u al (no p e- ea ed o au ocla ed) soil om comme cial oma o
plan a ions o illus a e he changes in plan g ow h, soil abio ic p op-
e ies, and mic obio a. We selec ed bac e ial soil communi y p o illing
since hey play a c ucial ole in soil mic ohabi a s, con ibu ing signi -
ican ly o biogeochemical cycles in ol ing ca bon, ni ogen, sul u , and
phospho us (Long e al., 2016) and in luencing nu ien abso p ion by
al e ing oo s uc u e o physiology (Vessey, 2003). O e all, using a
holis ic app oach wi h mesocosms, we expec o un a el he in e ac ions
be ween hese bene icial soil o ganisms (EWs and EPNs) while co-
applied o de e mine whe he i is possible o enhance hei posi i e
e ec s wi hou comp omising o he soil p ope ies o plan
de elopmen .
2. Ma e ials and me hods
2.1. Expe imen al ma e ials and p epa a ion p ocedu es
A Clay Loam ex u e soil om a comme cial oma o c op plan a ion
(Coope a i a El Raso, Calaho a, La Rioja, Spain, 42.3188 N 1.9581 W)
wi h no p io EPN applica ion was collec ed in 2020 a wo di e en
imes: Ap il 22nd and May 14 h. A each sampling ime, app oxima ely
40 kg o soil (0–20 cm dep h) was e ie ed om andom loca ions,
combined in coole s, and s o ed a 4 ◦C o 2–3 days be o e expe imen
p ocedu es. The soil was manually homogenized, emo ing la ge ock
agmen s (>2–5 cm). I s physical–chemical cha ac e is ics we e: 39 %
sand, 30 % sil , 31 % clay, 3.5 % o ganic ma e (OM), C/N a io o 9, pH
7.6, and elec ical conduc i i y (EC) o 1.01 S/cm (La G aje a Regional
Labo a o y, La Rioja). Plas ic po s (11x11x11 cm) we e illed wi h 700 g
o esh soil om he co esponding mixed soil da e and main ained in a
g ow h chambe (22 ◦C, 16L:8D pho ope iod, and 60 % Rela i e Hu-
midi y, RH) o wo weeks o allow any possible oma o plan s and any
weed o eme ge om he soil seed bank. All eme ging plan s we e
manually emo ed. A his ime (T0), 50 g o soil om each po was
sa ed a −80 ◦C o u he analysis o he soil bac e ial communi y (see
sec ion 2.4).
Two comme cial oma o seeds (Solanum lycope sicum—Solanales:
Solanaceae— a . Moneymake ) (La Tienda Fi o Ag ícola, S.L.,
Cas ell´
on, Spain) we e plan ed pe plo illed wi h he expe imen al soil
and main ained in he same chambe condi ions. Once oma o plan s
eme ged, only one was kep pe po ( emo ing any addi ional eme ging
plan s i necessa y). Be o e ini ia ing he expe imen , he plan s we e
allowed o g ow o ou weeks and wa e ed e e y 2–3 days wi h 50 ml
o ap wa e o each a ege a i e s age (when de eloping h ee ue
lea es).
S eine nema el iae (Rhabdi ida: S eine nema idae) RM-107 (ITS e-
gion, GenBank accession numbe MW480131) — he p edominan EPN
species in Eu ope (Hominick, 2002) and commonly ound in na u al
habi a s and c ops, also in La Rioja (Campos-He e a e al., 2007, 2008;
Blanco-P´
e ez e al., 2022)—was used in his s udy. Nema odes we e
cul u ed a he Ins i u e o G ape ine and Wine Sciences (ICVV,
Log o˜
no, Spain) using he las ins a o Galle ia mellonella (Lepidop e a:
Py alidae) and s o ed a 14 ◦C un il use, wi h IJs ha es ed wo weeks
be o e each expe imen (Blanco-P´
e ez e al., 2022).
The EW species Eisenia e ida (Haplo axida: Lumb icidae), a model
o ganism wi h widesp ead dis ibu ion in soils (Hend ix e al., 2008),
was used o his s udy. Adul s o simila size (0.3–0.5 g and leng h
5.0–5.5 cm) ob ained om a comme cial sou ce (“O Minhoca io”, Ped o
Jos´
e Lanza, Lisbon, Po ugal) we e kep in labo a o y condi ions a
22–24 ◦C in he da k. Be o e he s a o each expe imen , EW we e
s a ed o 24 h in au ocla ed mois ened soil o p e en c oss-
con amina ion wi h hei cas s (Chelkha e al., 2021). F esh CEx we e
ob ained by exposing EWs o a pe oleum e he -sa u a ed a mosphe e
(El Ha i e al., 2001). The CEx equi alen o same amoun o EWs in
each expe imen was eco e ed in dis illed wa e o ensu e o p o ide 2
ml pe expe imen al uni (see sec ion 2.2) and kep on ice. Fo each
expe imen , esh CEx and new EW shipmen we e used.
2.2. Expe imen al design and ea men applica ion
The expe imen was di ided in o wo g oups (A and B) in a g ow h
chambe , wi h ea men s andomly alloca ed o each g oup ollowing a
spli -plo design (Supplemen a y da a 1,Fig. S1). T ea men s (n =8)
included: (i) nega i e con ol (C), (ii) ea hwo m (EW), (iii) EW cu a-
neous exc e a (CEx), (i ) en omopa hogenic nema odes (EPN), ( ) EPN
+EW, and ( i) EPN +CEx. In ea men s wi h EWs, h ee indi iduals
we e added pe po . Fo he CEx ea men s, 2 ml (equi alen o he
exc e a o h ee EWs) was added pe po and e-inocula ed a e one
week. Fo EPN ea men s, 3000 IJs pe po (equi alen o 25 IJs/cm
2
)
we e applied (Shapi o-Ilan e al., 2002). All po s we e co e ed wi h a
ab ic ne o con ain he EWs. Plan and soil e alua ions we e conduc ed
a e wo and ou weeks (T1 and T2, espec i ely), wi h ou plan s pe
ea men ( wo in each block, A and B) (Fig. S1). Expe imen al g ow h
chambe condi ions we e 24 ◦C day, 18 ◦C nigh , unde a 16L:8D
pho ope iod, and 60 % RH. All he po s we e wa e ed e e y 2–3 days
wi h 50 ml o ap wa e o ensu e he same condi ions. The expe imen
was conduc ed wice wi h new ma e ial, esh soil ( om each o he
sampling imes), and o ganism applica ions.
2.3. Plan esponse, i ulence analysis, ea hwo m su i al, and soil
cha ac e iza oin p ocedu es
We assessed plan mac onu ien con en s o measu e he plan
esponse, ocusing on o al Ni ogen con en as an indica o o s ess and
po en ial nu i ional de iciencies. Using a non-des uc i e op ical
senso , Dualex™ o ce A, Scien i ic (Ac ylab, Spain), we measu ed
chlo ophyll (CLR) and la onol (FLV) con en indices (Ce o ica e al.,
2012). Measu emen s we e aken in duplica e on each plan ’s ou h and
i h lea es. Each plan was ca e ully emo ed om he po , and he soil
was gen ly sepa a ed om he oo s, mixed wi h he es o he bulk soil
o each po , and sa ed o subsequen analysis. The oo s we e washed,
and he plan s we e d ied a 40 ◦C o one week o ob ain hei d y
weigh .
Simul aneously, 50 g o mixed soil was collec ed om each po and
s o ed a −80 ◦C o bac e ial soil communi y analysis (see sec ion 2.4).
Addi ionally, 200 g o mixed soil om po s wi h EPN applica ions we e
placed in plas ic con aine s and bai ed wi h en G. mellonella la ae o
e alua e EPN i ulence (Blanco-P´
e ez e al., 2022). Con aine s we e
kep a 22 ◦C and 60 % RH in da kness o ou days. Dead la ae we e
ans e ed o Whi e aps (Whi e, 1927) o con i m nema ode-induced
mo ali y. Su i ing la ae we e held o an addi ional 24 h o assess
la e mo ali y. Cada e s we e obse ed e e y 3–4 days o ensu e IJ
eme gence om la ae. Also, a he end o he expe imen , su i al o
he ea hwo ms in he co esponding ea men s we e con i med.
Comp ehensi e soil analyses we e conduc ed only o he ou -week
pos -applica ion (T2). An aliquo o 200 g o he mixed soil om each po
was sie ed o 2 mm and analyzed sepa a ely o pH (Millennia and
Ma kewi z, 2004), OM % (Walkley and Black, 1934), mac o-nu ien s
(N, P, and K), and oligo-nu ien s (Mg, Ca, and Na) (Eu o ins Ag o-
ambien al SA, ESA25244849).
2.4. Me a axonomical bac e ial communi y analysis: Lib a y p epa a ion
Fo each o he wo ials, we independen ly e alua ed h ee soil
samples pe ea men (T0, T1, and T2; s o ed a −80 ◦C) o soil bac-
e ial communi y analyses. DNA p ocedu es we e conduc ed using he
Powe Soil DNA isola ion ki (MO BIO Labo a o ies, San Diego bio ech
co ido , Ca lsbad, CA, USA). Fi s , 0.25 g o each soil sample was placed
in a Powe Bead ube. Then, ollowing he ki p o ocol, solu ion C1 o his
ki was added, and he samples we e homogenized wice wi h a high-
speed homogenize (speed 6.0 m/sec, adap e : QuickP ep, ime 40sec,
Lis ing ma ix A, Fas P ep-24™, MP Biomedicals). A e ha , DNA
M. Chelkha e al. Biological Con ol 200 (2025) 105685
3
ex ac ion was pe o med as desc ibed in he ki and s o ed a −20 ◦C
un il hei p ocessing o he bac e ial soil communi y cha ac e iza ion.
Fu he DNA analysis we e pe o med a he Cen e o Biomedical
Resea ch o La Rioja (CIBIR, Log o˜
no, La Rioja, Spain). Ini ial DNA
in eg i y and quan i y we e assessed by Capilla y Gel Elec opho esis
(F agmen Analyze , Genomic DNA Ki , Agilen Technologies) and
luo ime y (Qubi 3.0, dsDNA HS Assay ki , The mo Fishe Scien i ic,
MA, USA), espec i ely. NGS lib a ies we e p epa ed om 12.5 ng o
DNA acco ding o he 16S Me agenomic Sequencing Lib a y P epa a ion
p o ocol (Illumina, n.d.). The p ime s used ampli ied he V3-V4 egion
o he 16S RNA gene: 16S Amplicon PCR Fo wa d P ime =5
′
TCG
TCGGCAGCAGCGTCAGATGTGTAT AAGAGAGACAGCCTACGGGNGGC
WGCAG, and 16S Amplicon PCR Re e se P ime =5
′
GTCTCGTGGG
CTCGGAGATGTGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC.
The quali y o he lib a ies was assessed using F agmen Analyze
(dsDNA Reagen Ki , 35–5000 bp, Agilen Technologies). In addi ion,
he DNA concen a ion was p ecisely measu ed wi h a Qubi 3.0 luo-
ome e (dsDNA HS Assay ki , The mo Fishe Scien i ic, MA, USA). Li-
b a ies we e hen pooled equimola ly and sequenced on an Illumina
MiSeq pla o m employing a 300-cycle pai ed-end un. Fo quali y
assu ance, comme cial mock communi ies we e inco po a ed as in e nal
con ols in he inal sequencing un, including Con ol Gu (MSA-1006)
and Con ol Soil (MSA-3001) as mic obiome s anda ds, p ocessed
iden ically o he o he samples.
2.5. Bac e ial soil communi y analysis: Bioin o ma ic p ocedu es
Pos -analysis quali y assessmen was conduc ed using Fas QC
0.11.9 (Bab aham Ins i u e, 2023) and Mul iQC 1.9 (Ewels e al.,
2016). Subsequen ly, bioin o ma ic analysis was pe o med using he
Qiime2 2022.8 pipeline (Bolyen e al., 2019). The Illumina sequence
p o ided demul iplexed aw sequences, which we e hen impo ed in o
he Qiime2 pipeline and p ocessed using DADA2 (Nea ing e al., 2018;
P odan e al., 2020). This p ocess in ol ed se e al s eps: adap e and
p ime imming, noise il e ing, de eplica ion, pai ed- ead joining,
iden i ica ion o Amplicon Sequence Va ian s (ASVs) a 99 % sequencing
simila i y, and chime a emo al. Taxonomic assignmen was accom-
plished using he SILVA da abase ( e sion 132), p e- ained wi h he
V3-V4 ampli ica ion p ime s used du ing we -lab p ocessing a a 70 %
con idence le el wi h de aul pa ame e s. ASVs assigned o chlo oplas s
o A chaea we e excluded om u he analysis. Fea u e and axonomy
ables we e gene a ed in “biom”and “ s ” o ma s o subsequen
analysis. Sequence da a ( aw iles) ha e been uploaded o he GenBank
SRA da abase unde accession numbe s SAMN41943565-,
SAMN41943642 and he BioP ojec accession numbe is
PRJNA1126460.
2.6. S a is ical analysis
We employed linea mixed models (LMMs) and gene alized linea
mixed models (GLMMs) o assess he e ec o he ea men s (C, EW,
CEx, EPN, EPN +EW, and EPN +CEx), ime (T1 and T2), and hei
in e ac ion (all ixed ac o s) on EPN i ulence, plan esponse (plan d y
weigh , CLR and FLV indexes), soil p ope ies, bac e ial alpha biodi-
e si y indices (Chao1 and Shannon), and ASV de ec ions o speci ic
axa ela ed o biocon ol (Bacillus, Pseudomonas, and Xeno habdus). We
conduc ed goodness-o - i es s o de e mine he mos app op ia e dis-
ibu ion o he analyzed a iables (Table S1). We con olled o a i-
a ions wi hin ials by including his a iable as a andom ac o in each
model.
In he bac e ial soil communi y analysis, he acqui ed da a unde -
wen no maliza ion (To al Sum Scaling, TSS) and he es ima ion o
a e ac ion cu es, ela i e abundance, alpha-di e si y, and be a-
di e si y using Mic obiomeAnalys (Dha iwal e al., 2017; Chong
e al., 2020; Lu e al., 2023). We used he a e ac ion cu es o e alua e
sample quali y. Also, Chao1 ichness and Shannon di e si y (alpha-
di e si y) we e compu ed. The ela ionship be ween bac e ial commu-
ni ies was explo ed h ough B ay-Cu is me ics (be a-di e si y), ol-
lowed by Pe mu a ional Mul i a ia e Analysis o Va iance
(PERMANOVA) and isualiza ion using P incipal Coo dina e Analysis
(PCoA) plo s.
S a is ical analyses we e pe o med in R e sion 4.3.0 (R Co e Team,
2023). Goodness-o - i es s we e conduc ed using he i dis plus pack-
age in R (Deligne e-Mulle &Du ang, 2015). We an he GLM and
GLMM es s using he lme and glme unc ions, espec i ely, om he
lme4 package (Ba es e al., 2015). Pos -hoc analyses a P<0.05 signi -
icance le el we e pe o med using he es ima ed ma ginal means
(EMMeans) app oach wi h he emmeans unc ion (Len h, 2023). PER-
MANOVA was pe o med using he egan package. Di e si y indexes
we e ep esen ed in PCoAs and boxplo s a he ASV le el using he
ggplo 2 package.
3. Resul s
3.1. Plan esponse, i ulence analysis, ea hwo m su i al, and soil
cha ac e iza oin p ocedu es
No signi ican di e ences we e ound among ea men s o he plan
esponse pa ame e s e alua ed (plan d y weigh , CLR, and FLV indices)
bu o he de ec ion ime pos -applica ions (Supplemen a y da a 2,
Fig. S2 and Table S2). In con as , EPN i ulence dec eased signi ican ly
30 days pos -inocula ions when EPNs we e applied alone compa ed o
when hey we e applied in combina ion wi h EWs (Fig. 1). All ea h-
wo ms su i ed o he ea men s a e 30 days exposu e (da a no
shown). Rega ding soil p ope ies, we only ound signi ican di e ences
among ea men s o he pe cen age o o ganic ma e and Ca and Mg
con en s (Fig. 2 and Table 1;Supplemen a y da a 2,Fig. S3). Speci -
ically, OM% was signi ican ly highe o he combina ion o EPN +EW
han con ol and CEx ea men s (Fig. 2A), while Ca and Mg con en s
we e signi ican ly lowe o he combina ion o EPN +CEx compa ed o
con ol ea men s, and o Mg, also compa ed o CEx and EPN +CEx
ea men s (Fig. 2B,C).
3.2. Soil bac e ia communi y composi ion
A o al o 72 samples (36 om each independen ial) we e e alu-
a ed since all eached he quali y and quan i y s anda ds ollowed in he
CIBIR Genomics &Bioin o ma ics Co e Facili y. We ob ained
13,682,371 sequences a e he bioin o ma ics ea men o he aw
sequences (pai ed-end alignmen s, quali y e alua ions, including he
emo al o chime ic sequences and single ons). The minimum numbe
o sequences pe sample was 124,833, and he maximum was 233,177,
wi h a mean o 171,030 and a median o 170,130. We es ablished he
minimum numbe o sequences a 32,565, e aining 2,540,070 (55.9 %)
ea u es ac oss 76 samples a he speci ied sampling dep h. We iden i ied
19,174 dis inc bac e ial ASVs wi h assigned agmen s a ying
282–540 bp leng hs, a e aging 416 ±13 bp. The e was minimal a i-
abili y in he o al numbe o sequences among samples. The a e ac ion
cu es indica ed ha mos samples eached sa u a ion, making hem
op imal o u he analysis (Supplemen a y da a 2,Fig. S4). Finally, he
p esence o speci ic bac e ia axa in he gene a Bacillus, Pseudomonas,
and Xeno habdus was no a ec ed by any o he ea men s e alua ed,
no o he de ec ion ime pos -applica ions (Supplemen a y da a 2,
Fig. S5 and Table S3).
3.3. Soil bac e ial di e si y
We ound signi ican di e ences in alpha di e si y indices, Chao1
and Shannon, among ea men s and o hei in e ac ion wi h he
de ec ion ime pos -applica ions (Fig. 3 and Table 2). Speci ically, bo h
indices we e signi ican ly lowe o CEx applied alone han he con ol
15 days pos -inocula ions (Fig. 3). Simila pa e ns be ween indices we e
M. Chelkha e al. Biological Con ol 200 (2025) 105685
4
also obse ed 30 days pos -applica ions, wi h signi ican ly lowe alues
o con ol ea men s and no ably highe alues o EPNs combined
wi h EWs (Fig. 3). Fo he PCoAs based on he B ay-Cu is index,
al hough we ound simila signi icances o he in es iga ed ac o s as
o he alpha indices, no clea dis inc ions in clus e ing o ma ions o
bac e ial communi y composi ion we e obse ed among ea men s o
be ween T1 and T2 (Fig. 4).
4. Discussion
This s udy p o ided new insigh s in o how co-occu ing bene icial
soil o ganisms, such as EWs and EPNs, a ec nema ode i ulence and
abio ic and bio ic (mic obio a) soil cha ac e is ics wi hin a complex,
na u alized plan -soil sys em. Addi ionally, da a was collec ed a wo
in e als ollowing ea men exposu e —15 and 30 days— o ensu e a
comp ehensi e analysis. Ou indings e ealed ha , a e 30 days, EPN
ac i i y and mic obial di e si y we e enhanced when bo h bene icial
o ganisms co-occu compa ed o indi idual ea men s o no applica-
ions (con ol ea men ). These esul s sugges a po en ial long- e m
indi ec bene i o plan s, possibly media ed no only by bio ic
changes bu also by abio ic soil cha ac e is ics, such as he inc ease o
OM in he EW-EPN ea men . Howe e , in his ega d, no signi ican
di e ences we e obse ed in plan g ow h- ela ed me ics. Longe - e m
s udies as well as o he species combina ion o EW and EPN may be
necessa y o iden i y he possible speci ic d i e s p omo ing plan heal h
and c op p o ec ion a ec ed by he co-occu ence o EPNs and EWs o
hei CEx.
Di e se s udies examining he in e ac ion be ween EPNs and EWs,
including hei CEx, ha e shown con as ing esul s—posi i e, neu al,
o de imen al—depending on he species and expe imen al se up
(Campos-He e a e al., 2006; Shapi o-Ilan and B own, 2013; Chelkha
e al., 2020, 2021; Fa o e e al., 2020). Se e al s udies ha e employed
mic ocosms (e.g., Pe i dishes, ubes, 24-well pla es) wi h au ocla ed
subs a es and sho in e ac ion pe iods o ensu e con ac be ween o -
ganisms (Campos-He e a e al., 2006; Chelkha e al., 2020, Chelkha
e al., 2021). In con as , Fa o e e al. (2020) conduc ed a ield meso-
cosm expe imen wi hin wo c opping sys ems, e ealing ha EWs
enhanced EPN in ec ion a es, he eby boos ing hei biocon ol po en-
ial agains oo - eeding pes s. This inding aligns wi h ou obse a ions
o inc eased EPN i ulence when combined wi h EWs/CEx a e 30 days
Fig. 1. Nema ode i ulence assessed by insec la al mo ali y 15 and 30 days pos -applica ion o en omopa hogenic nema odes alone (EPN) o combined wi h
ea hwo ms (EPN +EW) o EW cu aneous exc e a (EPN +CEx). As e isks ep esen s a is ically signi ican di e ences o MIXED model es s a ** P<0.01 and * P
<0.05. Di e en le e s indica e s a is ically signi ican di e ences (P<0.05) o pai wise compa isons wi hin ea men s.
Fig. 2. Impac o he e alua ed ea men s on he soil p ope ies (A) pe cen age o o ganic ma e (OM) and nu ien con en s o (B) Ca and (C) Mg, measu ed 30 days
pos -applica ions. T ea men s: con ol (C), ea hwo m (EW), EW cu aneous exc e a (CEx), en omopa hogenic nema odes (EPN), and he combina ions EPN +EW and
EPN +CEx. Di e en le e s indica e s a is ically signi ican di e ences (P<0.05) o pai wise compa isons wi hin ea men s. S a is ical analysis de ails can be
ound in Table 1.
Table 1
Summa y o esul s om MIXED models es ing o he e ec s o he e alua ed
ea men s on soil p ope ies. As e isks ep esen s a is ically signi ican di -
e ences wi hin ea men s a ** P<0.01; n.s., no signi ican . Values a e
ep esen ed in Fig. 2 and Fig. S3.
T ea men s
Soil Va iables
χ
2
5
P
pH 3,55 n.s.
OM 15,90 **
N 2,07 n.s.
P 7,03 n.s.
K 1,02 n.s.
Ca 16.82 **
Mg 19,92 **
Na 6,61 n.s.
M. Chelkha e al. Biological Con ol 200 (2025) 105685
5
pos -exposu e. This posi i e in e ac ion migh be a ibu ed o EWs’
abili y o mix he soil, as Shapi o-Ilan and B own (2013) desc ibed.
Howe e , Fa o e e al. (2020) also epo ed ha EPNs a oided plan s
wa e ed wi h CEx, possibly due o ad e se e ec s on hei i ness
(Chelkha e al., 2020, Chelkha e al., 2021). Con e sely, we obse ed
high EPN i ulence main enance a e 30 days pos -exposu e o EWs o
hei CEx compa ed wi h he educ ion in he EPN-alone con ol in a
complex sys em, as Fa o e e al. (2020) designed. The na u al soil likely
bu e ed he nega i e impac on EPN i ulence in di ec exposu e ex-
pe imen s (Chelkha e al., 2020, 2021; Fa o e e al., 2020). Soil p op-
e ies like OM and clay con en can in e ac wi h o ganic compounds
(Lehmann and Klebe , 2015). A ecen s udy indica ed ha EW-CEx
comp ises p o eins, amino acids, ca bohyd a es, a y acids, poly-
saccha ides, alcohol, phenol, and es e o ganic subs ances (Huan e al.,
2023). All hese compounds in e ac wi h he soil ac ion and bio a
when pe o ming di e en unc ions (Tiedje e al., 1999; Kasschau e al.,
2007; Homa e al., 2008; Lehmann and Klebe , 2015; San ocki e al.,
2016), po en ially modi ying hei impac on EPNs. The e o e, di e -
ences in soil bio ic and abio ic composi ion migh explain he disc ep-
ancies be ween ou indings and hose o p e ious s udies (Chelkha
e al., 2020, 2021; Fa o e e al., 2020). Hence, addi ional s udies,
including di e en ypes o soil ( ex u e, o ganic ma e pe cen age,
e c.) de i ed om o he c ops wi h po en ially a ying soil bio a, a e
necessa y o ex end ou obse a ions o a mo e gene al applica ion.
Simila ly, EWs can signi ican ly al e o he soil bio a in di e se soil
biomes (e.g., d ilosphe e, hizosphe e, bulk soil) h ough hei mo e-
men and eeding ac i i ies (Ai a e al., 2015, 2016; Wang e al., 2017;
Hoe ne e al., 2018; Medina-Sauza e al., 2019, Medina-Sauza e al.,
2023). Howe e , al hough EW eeding can, o ins ance, dec ease bac-
e ial soil di e si y a e passing h ough hei gu , his e ec depends on
soil ype (Koubo ´
a e al., 2015). Ou esul s no ed a sligh dec ease in
bac e ial alpha di e si y in he EWs ea men s a e 15 days pos -
exposu e, bu i did no pe sis beyond 30 days. Fu he mo e, Ai a
e al. (2016) ound ha EWs can modula e he bac e ial composi ion o a
subs a e, sugges ing ha EWs selec and build hei cas mic obiome
om inges ed bac e ia. Time is a c i ical ac o in his p ocess, as seen in
e micompos ing sys ems whe e bac e ial di e si y ini ially inc eases
bu la e declines in ma u e e micompos s (Vi as e al., 2009). Spe-
ci ically, Gopal e al. (2017) obse ed an inc ease in alpha di e si y un il
he 75 h day, ollowed by a decline a e he 105 h day in ma u e e -
micompos . Ou indings a e consis en wi h hese obse a ions,
pa icula ly o he co-occu ence o EPNs and EWs, which exhibi ed
Fig. 3. Alpha di e si y indexes (A) Chao1 and (B) Shannon o bac e ial soil communi y analyses 15 and 30 days pos -applica ions. T ea men s: con ol (C),
ea hwo m (EW), EW cu aneous exc e a (CEx), en omopa hogenic nema odes (EPN), and he combina ions EPN +EW) and EPN +CEx. Di e en le e s indica e
s a is ically signi ican di e ences (P<0.05) o pai wise compa isons wi hin ea men s. S a is ical analysis de ails can be ound in Table 2.
Table 2
Summa y o esul s om MIXED models es ing o he e ec s o he e alua ed
ea men s on bac e ial alpha biodi e si y a 15 and 30 days pos -applica ion.
As e isks ep esen s a is ically signi ican di e ences wi hin ea men s a **
P<0.01 and *** P<0.001; n.s., no signi ican . Values a e ep esen ed in Fig. 3.
T ea men s (Tx) Time Tx * Time
Di e si y
index
χ
2
d P
χ
2
d P
χ
2
d P
Chao1 42.87 5 *** 0.42 1 n.
s.
29.26 5 ***
Shannon 17.71 5 ** >0.01 1 n.
s.
18.71 5 **
Fig. 4. P incipal componen analysis o he bac e ial be a di e si y displaying
g oups o associa ion by (A) ea men s: con ol (C), ea hwo m (EW), EW
cu aneous exc e a (CEx), en omopa hogenic nema odes (EPN), and he com-
bina ions EPN +EW) and EPN +CEx; and (B) ime (15 and 30 days pos -
applica ion). As e isks ep esen s a is ically signi ican di e ences a *** P
<0.001; n.s., no signi ican .
M. Chelkha e al. Biological Con ol 200 (2025) 105685
6
inc eased bac e ial alpha di e si y 30 days pos -applica ion. Howe e ,
we unde s and ha he leng h o he s udy was a limi a ion since 2 and 4
weeks seem o be oo sho o de ec hose in e ac ions. Hence,
ex ending he du a ion o ou s udy may ha e e ealed he poin a
which bac e ial di e si y begins o decline and, hus, a deepe unde -
s anding o he changes wi hin he soil-mic obio a-plan sys em.
While ou s udy sheds ligh on he impac o EPN applica ion on he
soil bac e ial communi y, he e is s ill much o be in es iga ed (de Na do
e al., 2006; Li e al., 2024), no ably o in e ac ions wi h o he soil
o ganisms such as EWs. We ound ha 15 days pos -EPN applica ion,
he e we e no signi ican changes in he soil bac e ial communi y. This
inding is consis en wi h Li e al. (2024) o bac e ial communi y, bu
also no ed changes in he ungal communi y associa ed wi h EPN
occu ence. Consequen ly, u u e esea ch should include ungal di-
e si y when examining he combined e ec s o EPNs and EWs/CEx o
p o ide a mo e comp ehensi e unde s anding o ecosys em dynamics.
Howe e , we obse ed inc eased bac e ial soil di e si y a e 30 days,
sugges ing ha hese changes equi e a longe ime ame. This e ec , in
any case, disag ees wi h de Na do e al. (2006), who epo ed no in-
c ease in soil mic obial biomass, espi a ion, o ni ogen pools 64 days
pos -applica ion o he EPN species S eine nema ca pocapsae. Besides
di e ences in soil ypes and EPN species in ol ed (S. ca pocapsae s.
S. el iae) o , o ins ance, he p esence o oma o oo s in ou sys em, he
disc epancies migh be a ibu ed o he indi ec measu emen me hods
used by de Na do e al. (2006) as opposed o he molecula app oach
based on HTS in ou s udy. No ably, we obse ed di e ences in he
bac e ial alpha di e si y be ween T0 (soil sampled be o e plan ing he
oma o seeds and applying any ea men and excluded om he analysis
o obse e ea men e ec s) and pos - ea men imes (T1 and T2).
Rega ding he a ge gene a o in e es in biocon ol —Pseudomonas,
Bacillus, and Xeno habdus (Lacey e al., 2015; Vicen e-Díez e al.,
2023)—we did no obse e di e ences among ea men s, e en hose
including EPNs hos ing he bac e ium Xeno habdus. I is impo an o
no e ha he soil bac e ia analysis was pe o med on 0.25 g o bulk soil
om each ea men . While his app oach was necessa y o ou s udy, i
could ha e educed he likelihood o aking a ep esen a i e sample o
EPN-associa ed bac e ia. Fu u e esea ch should conside la ge o mo e
ep esen a i e soil samples o unde s and be e he in e ac ions be-
ween EPNs, hei associa ed bac e ia, and he soil mic obial
communi y.
Besides p ese ing EPN i ulence and inc easing bac e ial alpha di-
e si y, he EPN-EW in e ac ions in ou s udy had minimal e ec s on
plan pa ame e s and only in speci ic ea men s o ce ain soil p op-
e ies. Since plan oo s abso b ni ogen and o he essen ial mac onu-
ien s suppo ing chlo ophyll p oduc ion and o he i al p ocesses
(Wall, 2012; Fa hi, 2022; Hussain Shah e al., 2024), we expec ed he
ea men s o a ec plan ai s. We employed he no el, non-des uc i e
Dualex™app oach o measu e plan g ow h and de elopmen o e
ime, speci ically a e 2 and 4 weeks. This sys em consis s o a p ecise
op ical echnique o assess ni ogen le els ha uses speci ic UV exci a-
ion beams o la onoids and chlo ophyll (T emblay e al., 2010, 2012;
O e beck e al., 2018). Cong uen wi h Becagli e al. (2021), we e-
po ed dec eased chlo ophyll le els o e ime, bu no signi ican ea -
men e ec s. Howe e , some s udies ound opposi e pa e ns, o
example, inc eased chlo ophyll le els o e ime when e alua ing he use
o e micompos as an o ganic e ilize (Jankauskien˙
e e al., 2022) o
speci ic bac e ia associa ed wi h EWs (Bane jee e al., 2019). This di -
e ence can be a ibu ed o he ex emely di e en condi ions be ween
soil unde ac i e e micompos ing ac ion (wi h a high densi y o EWs)
and na u al soil, as in es iga ed he ein. Con lic ing indings in his
espec highligh he dependence o EW-plan in e ac ions on mul iple
aspec s, such as soil ype, species in ol ed, and associa ed bio a. On he
o he hand, la onol con en s in lea es and o e all plan g ow h (e.g.,
d y weigh ) inc eased o e ime wi hou signi ican di e ences among
ea men s. Since Zhang e al. (2009) showed ha CEx signi ican ly
p omo es oma o seedling g ow h, he lack o di e ences in ou s udy
migh be due o a ia ions in oma o cul i a s, soil ype, and speci ic CEx
composi ions o di e se E. e ida popula ions. Fu he s udies, mainly in
long- e m esea ch, a e needed o iden i y he c i ical d i e s ela ed o
he e ec o EWs and hei de i a i es on plan g ow h. Rega ding EPN-
plan oo in e ac ions, p e ious s udies ha e shown ha plan oo a -
chi ec u e (De ma a e al., 2014) and chemical cues om oo -he bi o e
a acks (Rasmann e al., 2005; Tu lings e al., 2012) in luence EPN
occu ence and beha io . Ou s udy ound no e ec on chlo ophyll and
la onol con en s and plan g ow h a e one mon h o EPN exposu e.
Howe e , since only one s udy (Helms e al., 2019) has also di ec ly
explo ed he impac o EPNs on plan g ow h and de enses, mo e
esea ch is needed o unde s and EPN-plan in e ac ions in soils.
Ou s udy epo ed only signi ican a ia ion in plan nu ien
a ailabili y in speci ic pa ame e s, inc easing OM in he EPN-EW
ea men and dec easing Ca and Mg in he EPN-CEx ea men . These
esul s con as wi h he well-documen ed abili y o EWs o imp o e soil
e ili y and p o ide essen ial nu ien s such as N, K, and Ca (La elle
e al., 2016; Medina-Sauza e al., 2023). One plausible explana ion o
his disc epancy is ha he expe imen may equi e addi ional ime o
p oduce measu able changes in soil p ope ies ( an de Heijden e al.,
2008). As obse ed o he soil bac e ial communi y, signi ican di e -
ences among he ea men s became appa en only a e 30 days in ou
s udy. The e o e, we sugges conduc ing u he s udies wi h ex ended
obse a ion pe iods o 3–6 mon hs o comp ehensi ely assess he impac
o he e alua ed ea men s on soil p ope ies.
Achie ing he goals o sus ainable ag icul u e, as ou lined by he UN
and suppo ed by ini ia i es like he Eu opean G een Deal (Eu opean
Commission, 2020), equi es de eloping new bio ools o eplace
chemical e ilize s and pes icides. A comp ehensi e unde s anding o
he in e ac ions be ween bene icial o ganisms, soil, and c ops is essen-
ial o gaining public con idence and encou aging he adop ion o hese
bio echnologies. This s udy showed ha in e ac ions be ween bene icial
soil o ganisms, such as EPNs and EWs, a e complex, ime-dependen ,
and species-speci ic. Fu he esea ch is needed o ill knowledge gaps,
inco po a ing di e en augmen ed EWs and EPN species, soil ypes,
a ge soil o ganisms (bac e ia, ungi, mic oa h opods, nema odes,
e c.), c ops, and en i onmen s.
CRediT au ho ship con ibu ion s a emen
Ma yam Chelkha: W i ing –o iginal d a , Me hodology, In es i-
ga ion, Fo mal analysis, Concep ualiza ion. Rub´
en Blanco-P´
e ez:
W i ing – e iew &edi ing, In es iga ion, Fo mal analysis. Da id Lab-
a ga: W i ing – e iew &edi ing, Fo mal analysis. Ma ía de To o:
W i ing – e iew &edi ing, Fo mal analysis, Concep ualiza ion. Jo ge
Due˜
nas-He nani: W i ing – e iew &edi ing, Me hodology. Kyle
Wickings: W i ing – e iew &edi ing. Raquel Campos-He e a:
W i ing – e iew &edi ing, Supe ision, Funding acquisi ion, Fo mal
analysis, Concep ualiza ion.
Decla a ion o compe ing in e es
The au ho s decla e ha hey ha e no known compe ing inancial
in e es s o pe sonal ela ionships ha could ha e appea ed o in luence
he wo k epo ed in his pape .
Acknowledgmen s
We wan o hank he echnicians a Coope a i a El Raso om Cal-
aho a (La Rioja, Spain) o hei assis ance in loca ing a sui able ield
wi h oma oes o he expe imen . MC was suppo ed by Voca ional
T aining, Highe Educa ion and Scien i ic Resea ch, and he a el
assis ance associa ed wi h he g an CSIC I-COOP+2018 g an
(COOPA20231). RBP was inanced wi h a Juan de la Cie a con ac
JDC2022-048978-I unded by MCIN/AEI/ 10.13039/501100011033
and by “Eu opean Union Nex Gene a ionEU/PRTR”. DL was suppo ed
M. Chelkha e al. Biological Con ol 200 (2025) 105685
7
by an FPI-UR/CAR 2022 ellowship om he Uni e sidad de La Rioja
(Spain). JDH is suppo ed by he P og ama In es igo om he Go e n-
men o La Rioja and he “Eu opean Union Nex Gene a ionEU/PRTR.
This s udy was suppo ed by he CSIC I-COOP+2018 g an
(COOPA20231) and he Ins i u o de Es udios Riojanos g an (Resolu ion
N◦18/2020). This s udy o ms pa o he AGROALNEXT p og am and
was suppo ed by MCIN wi h unding om Eu opean Union Nex Ge-
ne a ionEU (PRTR-C17.I1).
Appendix A. Supplemen a y da a
Supplemen a y da a o his a icle can be ound online a h ps://doi.
o g/10.1016/j.biocon ol.2024.105685.
Re e ences
Ai a, M., Bybee, S., P´
e ez-Losada, M., Domínguez, J., 2015. Feeding on mic obiomes:
E ec s o de i i o y on he axonomic and phylogene ic bac e ial composi ion o
animal manu es. FEMS Mic obiol. Ecol. 91, 117. h ps://doi.o g/10.1093/ emsec/
i 117.
Ai a, M., Domínguez, J., 2011. Ea hwo m e ec s wi hou ea hwo ms: Inocula ion o
aw o ganic ma e wi h wo m-wo ked subs a es al e s mic obial communi y
unc ioning. PLoS One 6, e16354. h ps://doi.o g/10.1371/jou nal.pone.0016354.
Ai a, M., Olcina, J., P´
e ez-Losada, M., Domínguez, J., 2016. Cha ac e iza ion o he
bac e ial communi ies o cas s om Eisenia and ei ed wi h di e en subs a es. Appl.
Soil Ecol. 98, 103–111. h ps://doi.o g/10.1016/j.apsoil.2015.10.002.
Bane jee, A., Biswas, J.K., Pan , D., Sa ka , B., Chaudhu i, P., Rai, M., Mee s, E., 2019.
En e ic bac e ia om he ea hwo m (Me aphi e pos huma) p omo e plan g ow h
and emedia e oxic ace elemen s. J. En i on. Manage. 250, 109530. h ps://doi.
o g/10.1016/j.jen man.2019.109530.
Ba alla-Ca e a, L., Mo on, A., Ga cía-del-Pino, F., 2010. E icacy o en omopa hogenic
nema odes agains he oma o lea mine Tu a absolu a in labo a o y and g eenhouse
condi ions. BioCon ol 55, 523–530. h ps://doi.o g/10.1007/s10526-010-9284-z.
Ba es, D., M¨
achle , M., Bolke , B.M., Walke , S.C., 2015. Fi ing linea mixed-e ec s
models using lme4. J. S a . So w. 67, 1–48. h ps://doi.o g/10.18637/JSS.V067.
I01.
Becagli, M., Guglielmine i, L., Ca delli, R., 2021. E ec s o combined biocha and
e micompos solu ion on leacha e cha ac e iza ion and ni ogen balance om a
g eenhouse oma o (Solanum Lycope sicum) cul i a ion soil. Comm. Soil Sci. Plan
Anal. 52, 1879–1893. h ps://doi.o g/10.1080/00103624.2021.1900225.
Be endsen, R.L., Pie e se, C.M.J., Bakke , P.A.H.M., 2012. The hizosphe e mic obiome
and plan heal h. T ends Plan Sci. 17, 478–486. h ps://doi.o g/10.1016/j.
plan s.2012.04.001.
Bilej, M., B ys, L., Beschin, A., Lucas, R., Ve cau e en, E., Hanuˇ
so ´
a, R., De Bae selie , P.,
1995. Iden i ica ion o a cy oly ic p o ein in he coelomic luid o Eisenia oe ida
ea hwo ms. Immunol. Le . 45, 123–128. h ps://doi.o g/10.1016/0165-2478(94)
00248-P.
Blanco-P´
e ez, R., Bueno-Palle o, F.´
A., Vicen e-Díez, I., Ma co-Manceb´
on, V.S., P´
e ez-
Mo eno, I., Campos-He e a, R., 2019. Sca enging beha io and in e speci ic
compe i ion dec ease o sp ing i ness o he en omopa hogenic nema ode
S eine nema el iae. J. In e eb . Pa hol. 164, 5–15. h ps://doi.o g/10.1016/j.
jip.2019.04.002.
Blanco-P´
e ez, R., Vicen e-Díez, I., Ramos-S´
aez de Oje , J.L., Ma co-Manceb´
on, V.S.,
P´
e ez-Mo eno, I., Campos-He e a, R., 2022. O ganic i icul u e enhanced he
ac i i y o na i e en omopa hogenic nema odes in DOCa Rioja soils (No h o Spain).
Ag . Ecosys . En i on. 332, 107931. h ps://doi.o g/10.1016/j.agee.2022.107931.
Bolyen, E., Rideou , J.R., Dillon, M.R., Bokulich, N.A., Abne , C.C., Al-Ghali h, G.A.,
Alexande , H., Alm, E.J., A umugam, M., Asnica , F., Bai, Y., Bisanz, J.E.,
Bi inge , K., B ejn od, A., B islawn, C.J., B own, C.T., Callahan, B.J., Ca aballo-
Rod íguez, A.M., Chase, J., Cope, E.K., Da Sil a, R., Diene , C., Do es ein, P.C.,
Douglas, G.M., Du all, D.M., Du alle , C., Edwa dson, C.F., E ns , M., Es aki, M.,
Fouquie , J., Gaugli z, J.M., Gibbons, S.M., Gibson, D.L., Gonzalez, A., Go lick, K.,
Guo, J., Hillmann, B., Holmes, S., Hols e, H., Hu enhowe , C., Hu ley, G.A.,
Janssen, S., Ja musch, A.K., Jiang, L., Kaehle , B.D., Kang, K.B., Kee e, C.R., Keim, P.,
Kelley, S.T., Knigh s, D., Koes e , I., Kosciolek, T., K eps, J., Langille, M.G.I., Lee, J.,
Ley, R., Liu, Y.X., Lo ield, E., Lozupone, C., Mahe , M., Ma o z, C., Ma in, B.D.,
McDonald, D., McI e , L.J., Melnik, A.V., Me cal , J.L., Mo gan, S.C., Mo on, J.T.,
Naimey, A.T., Na as-Molina, J.A., No hias, L.F., O chanian, S.B., Pea son, T.,
Peoples, S.L., Pe as, D., P euss, M.L., P uesse, E., Rasmussen, L.B., Ri e s, A.,
Robeson, M.S., Rosen hal, P., Sega a, N., Sha e , M., Shi e , A., Sinha, R., Song, S.J.,
Spea , J.R., Swa o d, A.D., Thompson, L.R., To es, P.J., T inh, P., T ipa hi, A.,
Tu nbaugh, P.J., Ul-Hasan, S., an de Hoo , J.J.J., Va gas, F., V´
azquez-Baeza, Y.,
Vog mann, E., on Hippel, M., Wal e s, W., Wan, Y., Wang, M., Wa en, J., Webe , K.
C., Williamson, C.H.D., Willis, A.D., Xu, Z.Z., Zane eld, J.R., Zhang, Y., Zhu, Q.,
Knigh , R., Capo aso, J.G., 2019. Rep oducible, in e ac i e, scalable and ex ensible
mic obiome da a science using QIIME 2. Na . Bio echnol. 37, 852–857. h ps://doi.
o g/10.1038/s41587-019-0209-9.
Bomma co, R., Vico, G., Hallin, S., 2018. Exploi ing ecosys em se ices in ag icul u e o
inc eased ood secu i y. Glob. Food Sec. 17, 57–63. h ps://doi.o g/10.1016/j.
g s.2018.04.001.
Boye , J., Re e sa , G., La elle, P., Chabanne, A., 2013. In e ac ions be ween ea hwo ms
and plan -pa asi ic nema odes. Eu . J. Soil Biol. 59, 43–47. h ps://doi.o g/10.1016/
j.ejsobi.2013.10.004.
Bui ydai ˙
e, ˇ
Z., Lilja, M.A., Sapko a, R., Hansen, B.W., Ellegaa d-Jensen, L.,
Hend iksen, N.B., K ogh, P.H., Winding, A., 2023. Ea hwo ms shape p oka yo ic
communi ies and a ec ex acellula enzyme ac i i ies in ag icul u al soil. Eu . J.
Soil Biol. 115, 103474. h ps://doi.o g/10.1016/j.ejsobi.2023.103474.
Byzo , B.A., Khomyako , N.V., Kha in, S.A., Ku ako , A.V., 2007. Fa e o soil bac e ia
and ungi in he gu o ea hwo ms. Eu . J. Soil Biol. 43, 149–156. h ps://doi.o g/
10.1016/j.ejsobi.2007.08.012.
Campos-He e a, R., T igo, D., Gu i´
e ez, C., 2006. Pho esy o he en omopa hogenic
nema ode S eine nema el iae by he ea hwo m Eisenia e ida. J. In e eb . Pa hol.
92, 50–54. h ps://doi.o g/10.1016/j.jip.2006.01.007.
Campos-He e a, R., Escue , M., Lab ado , S., Robe son, L., Ba ios, L., Gu i´
e ez, C.,
2007. Dis ibu ion o he en omopa hogenic nema odes om La Rioja (No he n
Spain). J. In e eb . Pa hol. 95, 125–139. h ps://doi.o g/10.1016/j.
jip.2007.02.003.
Campos-He e a, R., G´
omez-Ros, J.M., Escue , M., Cuad a, L., Ba ios, L., Gu i´
e ez, C.,
2008. Di e si y, occu ence, and li e cha ac e is ics o na u al en omopa hogenic
nema ode popula ions om La Rioja (No he n Spain) unde di e en ag icul u al
managemen and hei ela ionships wi h soil ac o s. Soil Biol. Biochem. 40,
1474–1484. h ps://doi.o g/10.1016/j.soilbio.2008.01.002.
Campos-He e a, R., Blanco-P´
e ez, R., Bueno-Palle o, F.´
A., Dua e, A., Nolasco, G.,
Somme , R.J., Rod íguez Ma ín, J.A., 2019. Vege a ion d i es assemblages o
en omopa hogenic nema odes and o he soil o ganisms: e idence om he Alga e,
Po ugal. Soil Biol. Biochem. 128, 150–163. h ps://doi.o g/10.1016/j.
soilbio.2018.10.019.
Campos-He e a, R., Vicen e-Díez, I., Galeano, M., Chelkha, M., del Ma Gonz´
alez-
T ujillo, M., Puelles, M., Laba ga, D., Pou, A., Cal o, J., Belda, J.E., 2021.
In aspeci ic i ulence o en omopa hogenic nema odes agains he pes s
F ankliniella occiden alis (Thysanop e a: Th ipidae) and Tu a absolu a (Lepidop e a:
Gelechiidae). J. Nema ol. 53, 1–14. h ps://doi.o g/10.21307/jo nem-2021-102.
Ce o ica, Z.G., Masdoumie , G., Ghozlen, N.B., La ouche, G., 2012. A new op ical lea -
clip me e o simul aneous non-des uc i e assessmen o lea chlo ophyll and
epide mal la onoids. Physiol. Plan . 146, 251–260. h ps://doi.o g/10.1111/
j.1399-3054.2012.01639.x.
Chelkha, M., Blanco-P´
e ez, R., Bueno-Palle o, F.´
A., Amgha , S., El Ha i, A., Campos-
He e a, R., 2020. Cu aneous exc e a o he ea hwo m Eisenia e ida (Haplo axida:
Lumb icidae) migh hinde he biological con ol pe o mance o en omopa hogenic
nema odes. Soil Biol. Biochem. 141, 107691. h ps://doi.o g/10.1016/j.
soilbio.2019.107691.
Chelkha, M., Blanco-P´
e ez, R., Vicen e-Díez, I., Bueno-Palle o, F.´
A., Amgha , S., El
Ha i, A., Campos-He e a, R., 2021. Ea hwo ms and hei cu aneous exc e a can
modi y he i ulence and ep oduc i e capabili y o en omopa hogenic nema odes
and ungi. J. In e eb . Pa hol. 184, 107620. h ps://doi.o g/10.1016/j.
jip.2021.107620.
Chong, J., Liu, P., Zhou, G., Xia, J., 2020. Using Mic obiomeAnalys o comp ehensi e
s a is ical, unc ional, and me a-analysis o mic obiome da a. Na . P o oc. 15,
799–821. h ps://doi.o g/10.1038/s41596-019-0264-1.
Dales, R.P., Kalaç, Y., 1992. Phagocy ic de ence by he ea hwo m Eisenia oe ida agains
ce ain pa hogenic bac e ia. Comp. Biochem. Physiol. A Physiol. 101, 487–490.
h ps://doi.o g/10.1016/0300-9629(92)90499-G.
Dash, M.C., Senapa i, B.K., Mish a, C.C., 1980. Nema ode eeding by opical
ea hwo ms. Oikos 322–325.
De Na do, E.A.B., G ewal, P.S., McCa ney, D., S inne , B.R., 2006. Non- a ge e ec s o
en omopa hogenic nema odes on soil mic obial communi y and nu ien cycling
p ocesses: a mic ocosm s udy. Appl. Soil Ecol. 34, 250–257. h ps://doi.o g/
10.1016/j.apsoil.2006.01.004.
Delgado-Baque izo, M., Reich, P.B., T i edi, C., Eld idge, D.J., Abades, S., Al a o, F.D.,
Bas ida, F., Be he, A.A., Cu le , N.A., Galla do, A., Ga cía-Vel´
azquez, L., Ha , S.C.,
Hayes, P.E., He, J.Z., Hseu, Z.Y., Hu, H.W., Ki chmai , M., Neuhause , S., P´
e ez, C.A.,
Reed, S.C., San os, F., Sulli an, B.W., T i edi, P., Wang, J.T., Webe -G ullon, L.,
Williams, M.A., Singh, B.K., 2020. Mul iple elemen s o soil biodi e si y d i e
ecosys em unc ions ac oss biomes. Na . Ecol. E ol. 4, 210–220. h ps://doi.o g/
10.1038/s41559-019-1084-y.
Deligne e-Mulle , M.L., Du ang, C., 2015. i dis plus: an R package o i ing
dis ibu ions. J. S a . So w. 64 (4), 1–34. h ps://doi.o g/10.18637/jss. 064.i04.
De ma a, L., Hibba d, B.E., Bohn, M.O., Hil pold, I., 2014. The ole o oo a chi ec u e in
o aging beha io o en omopa hogenic nema odes. J. In e eb . Pa hol. 122, 32–39.
h ps://doi.o g/10.1016/j.jip.2014.08.002.
Dha iwal, A., Chong, J., Habib, S., King, I.L., Agellon, L.B., Xia, J., 2017.
Mic obiomeAnalys : A web-based ool o comp ehensi e s a is ical, isual and
me a-analysis o mic obiome da a. Nucleic Acids Res. 45, 180–188. h ps://doi.o g/
10.1093/na /gkx295.
Díaz-Pend´
on, J.A., Ca˜
niza es, M.C., Mo iones, E., Beja ano, E.R., Czosnek, H., Na as-
Cas illo, J., 2010. Toma o yellow lea cu l i uses: M´
enage `
a ois be ween he i us
complex, he plan and he whi e ly ec o . Mol. Plan Pa hol 11, 441–450. h ps://
doi.o g/10.1111/j.1364-3703.2010.00618.x.
Dillman, A.R., Chas on, J.M., Adams, B.J., Ciche, T.A., Good ich-Blai , H., S ock, S.P.,
S e nbe g, P.W., 2012. An en omopa hogenic nema ode by any o he name. PLoS
Pa hog. 8, e1002527. h ps://doi.o g/10.1371/jou nal.ppa .1002527.
Dowds, B.C.A., Pe e s, A., 2002. Vi ulence mechanisms. In: En omopa hogenic
Nema ology. CABI Publishing, Walling o d UK, pp. 79–98. h ps://doi.o g/10.1079/
9780851995670.0079.
M. Chelkha e al. Biological Con ol 200 (2025) 105685
8
D ake, H.L., Ho n, M.A., 2007. As he wo m u ns: The ea hwo m gu as a ansien
habi a o soil mic obial biomes. Re ue Mic obiol. 61, 169–189. h ps://doi.o g/
10.1146/annu e .mic o.61.080706.093139.
Eisenhaue , N., Scheu, S., 2008. Ea hwo ms as d i e s o he compe i ion be ween
g asses and legumes. Soil Biol. Biochem. 40, 2650–2659. h ps://doi.o g/10.1016/j.
soilbio.2008.07.010.
El Ha i, A., Saghi, M., Molina, J.A.E., Telle , G., 2001. P oduc ion d’une subs ance
hizog`
ene `
a e e similai e `
a celui de l’acide indole ac´
e ique pa le e de e e
Lumb icus e es is. Can. J. Zool. 79, 1911–1920. h ps://doi.o g/10.1139/cjz-79-11-
1911.
El Muj a , V., Mu˜
noz, N., Co mick, P.M., Pulleman, M., Ti onell, P., 2019. Role and
managemen o soil biodi e si y o ood secu i y and nu i ion; whe e do we s and?
Glob. Food Sec. 20, 132–144. h ps://doi.o g/10.1016/j.g s.2019.01.007.
Eu opean Commission, 2020. Communica ion om he Commission o he Eu opean
Pa liamen , he Council, he Eu opean Economic and Social Commi ee and he
Commi ee o he Regions. A Fa m o Fo k S a egy o a Fai , Heal hy and
En i onmen ally-F iendly. Eu opean Commission ood sys em COM/2020/381 inal.
Ewels, P., Magnusson, M., Lundin, S., K¨
alle , M., 2016. Mul iQC: summa ize analysis
esul s o mul iple ools and samples in a single epo . Bioin o ma ics 32,
3047–3048.
Fa hi, A., 2022. Role o ni ogen (N) in plan g ow h, pho osyn hesis pigmen s, and N use
e iciency: a e iew. Ag ic. Sos enible 28, 1–8.
Fa o e, S., Xiao, Z., Godschalx, A.L., R¨
ode , G., Tu lings, T.C.J., Le Bayon, R.C.,
Rasmann, S., 2020. Bio u ba ion by endogeic ea hwo ms acili a es
en omopa hogenic nema ode mo emen owa d he bi o e-damaged maize oo s.
Sci. Rep. 10, 21316. h ps://doi.o g/10.1038/s41598-020-78307-0.
F´
elix, G.F., Scholbe g, J.M.S., Cle mon -Dauphin, C., Cou nac, L., Ti onell, P., 2018.
Enhancing ag oecosys em p oduc i i y wi h woody pe ennials in semi-a id Wes
A ica. A me a-analysis. Ag on. Sus ainable De elop. 38, 57. h ps://doi.o g/
10.1007/s13593-018-0533-3.
Fe lian, O., Goldmann, K., Bonkowski, M., Dumack, K., Wube , T., Eisenhaue , N., 2024.
In asi e ea hwo ms shi soil mic obial communi y s uc u e in no he n No h
Ame ican o es ecosys ems. Iscience 27. h ps://doi.o g/10.1016/j.
isci.2024.108889.
Fe ei a, C.S.S., Sei ollahi-Aghmiuni, S., Des ouni, G., Ghaja nia, N., Kalan a i, Z., 2022.
Soil deg ada ion in he Eu opean Medi e anean egion: P ocesses, s a us and
consequences. Sci. To al En i on. 805, 150106. h ps://doi.o g/10.1016/j.
sci o en .2021.150106.
Ga bach, K., Milde , J.C., Mon eneg o, M., Ka p, D.S., DeCle ck, F.A.J., 2014.
Biodi e si y and Ecosys em Se ices in Ag oecosys ems. Encyclopedia o Ag icul u e
and Food Sys ems. 2, 21–40. h ps://doi.o g/10.1016/B978-0-444-52512-3.00013-
9.
Ga cia-del-Pino, F., Alabe n, X., Mo on, A., 2013. E icacy o soil ea men s o
en omopa hogenic nema odes agains he la ae, pupae and adul s o Tu a absolu a
and hei in e ac ion wi h he insec icides used agains his insec . BioCon ol 58,
723–731. h ps://doi.o g/10.1007/s10526-013-9525-z.
Gilbe son, R.L., Ba uman, O., 2013. Eme ging i al and o he diseases o p ocessing
oma oes: biology, diagnosis and managemen . In XII In e na ional Symposium on
he P ocessing Toma o. 971, 35–48. doi: 10.17660/Ac aHo ic.2013.971.2.
G´
omez-B and´
on, M., Lo es, M., Domínguez, J., 2012. Species-speci ic e ec s o epigeic
ea hwo ms on mic obial communi y s uc u e du ing i s s ages o decomposi ion
o o ganic ma e . PLoS One 7, e31895. h ps://doi.o g/10.1371/jou nal.
pone.0031895.
Gopal, M., Bhu e, S.S., Gup a, A., P abhu, S.R., Thomas, G.V., Whi man, W.B., Jangid, K.,
2017. Changes in s uc u e and unc ion o bac e ial communi ies du ing coconu
lea e micompos ing. An on. Leeuw. In . J. Gen. Mol. Mic obiol. 110, 1339–1355.
h ps://doi.o g/10.1007/s10482-017-0894-7.
Gulcu, B., Hazi , S., Kaya, H.K., 2012. Sca enge de e en ac o (SDF) om symbio ic
bac e ia o en omopa hogenic nema odes. J. In e eb . Pa hol. 110, 326–333.
h ps://doi.o g/10.1016/j.jip.2012.03.014.
Helms, A.M., Ray, S., Ma ulis, N.L., Kuzemchak, M.C., G isales, W., Tooke , J.F., Ali, J.G.,
2019. Chemical cues linked o isk: Cues om below-g ound na u al enemies
enhance plan de ences and in luence he bi o e beha iou and pe o mance. Func .
Ecol. 33, 798–808. h ps://doi.o g/10.1111/1365-2435.13297.
Hend ix, P.F., Callaham J ., M.A., D ake, J.M., Huang, C.Y., James, S.W., Snyde , B.A.,
Zhang, W., 2008. Pando a’s box con ained bai : he global p oblem o in oduced
ea hwo ms. Annu. Re . Ecol. E ol. Sys . 39, 593–613. h ps://doi.o g/10.1146/
annu e .ecolsys.39.110707.173426.
Hoe ne , K., Mona d, C., San onja, M., Cluzeau, D., 2018. Feeding beha iou o epi-
anecic ea hwo m species and hei impac s on soil mic obial communi ies. Soil Biol.
Biochem. 125, 1–9. h ps://doi.o g/10.1016/j.soilbio.2018.06.017.
Homa, J., Bzowska, M., Klimek, M., Ply ycz, B., 2008. Flow cy ome ic quan i ica ion o
p oli e a ing coelomocy es non-in asi ely e ie ed om he ea hwo m,
Dend obaena Vene a. De elop. Comp. Immunol. 32, 9–14. h ps://doi.o g/10.1016/
j.dci.2007.04.007.
Hominick, W.M., 2002. Biogeog aphy. In: En omopa hogenic Nema ology. CABI,
Walling o d, UK. doi: 10.1079/9780851995670.0035.
Ho n, M.A., Sch amm, A., D ake, H.L., 2003. The ea hwo m gu : An ideal habi a o
inges ed N2O-p oducing mic oo ganisms. Appl. En i on. Mic obiol. 69, 1662–1669.
h ps://doi.o g/10.1128/AEM.69.3.1662-1669.2003.
Huan, H., Wang, X., Chu, Z., Yu, X., Fan, T., Li, G., Xu, X., Zhen, Q., Sun, L., Dong, Z.,
Zha, S., 2023. Composi ional changes and ecological cha ac e is ics o ea hwo m
mucus unde di e en elec ical s imuli. Sci. Rep. 13, 2332. h ps://doi.o g/
10.1038/s41598-023-29125-7.
Jankauskien˙
e, J., Lauˇ
zik˙
e, K., Ka aliauskai ˙
e, D., 2022. E ec s o e micompos on
quali y and physiological pa ame e s o cucumbe (Cucumis sa i us L.) seedlings and
plan p oduc i i y. Ho icul u ae. 8, 1009. h ps://doi.o g/10.3390/
ho icul u ae8111009.
Kasschau, M.R., Ngo, T.D., Spe be , L.M., T an, K.L., 2007. Fo ma ion o ilopodia in
ea hwo m (Lumb icus e es is) coelomocy es in esponse o osmo ic s ess. Zoology
110, 66–76. h ps://doi.o g/10.1016/j.zool.2006.07.002.
Kos, M., Jing, J., Keesmaa , I., Decle ck, S.A.J., Wagenaa , R., Bezeme , T.M., 2017.
A e -li e e ec s: li ing and dead in e eb a es di e en ially a ec plan s and hei
associa ed abo e- and belowg ound mul i ophic communi ies. Oikos 126, 888–899.
h ps://doi.o g/10.1111/oik.03734.
Koubo ´
a, A., Ch oˇ
n´
ako ´
a, A., Piˇ
zl, V., S´
anchez-Monede o, M.A., Elho o ´
a, D., 2015. The
e ec s o ea hwo ms Eisenia spp. on mic obial communi y a e habi a dependen .
Eu . J. Soil Biol. 68, 42–55. h ps://doi.o g/10.1016/j.ejsobi.2015.03.004.
Lacey, L.A., G zywacz, D., Shapi o-Ilan, D.I., F u os, R., B ownb idge, M., Goe el, M.S.,
2015. Insec pa hogens as biological con ol agen s: Back o he u u e. J. In e eb .
Pa hol. 132, 1–41. h ps://doi.o g/10.1016/j.jip.2015.07.009.
Lahi i, S., O , D., 2018. Biological con ol in oma o p oduc ion sys ems: heo y and
p ac ice. In: Sus ainable Managemen o A h opod Pes s o Toma o. Academic P ess,
pp. 253–267. h ps://doi.o g/10.1016/B978-0-12-802441-6.00011-5.
La elle, P., Spain, A., Blouin, M., B own, G., Deca¨
ens, T., G imaldi, M., Jim´
enez, J.J.,
McKey, D., Ma hieu, J., Velasquez, E., Zange l´
e, A., 2016. Ecosys em enginee s in a
sel -o ganized soil: a e iew o concep s and u u e esea ch ques ions. Soil Sci. 181,
91–109. h ps://doi.o g/10.1097/SS.0000000000000155.
Lehmann, J., Klebe , M., 2015. The con en ious na u e o soil o ganic ma e . Na u e 528
(7580), 60–68. h ps://doi.o g/10.1038/na u e16069.
Len h, R. V. (2023). emmeans: Es ima ed Ma ginal Means, aka Leas -Squa es Means. R
package e sion 1.8.5. h ps://CRAN.R-p ojec .o g/package=emmeans.
Li, X., Yi, S., Chen, L., Ha eez, M., Zhang, Z., Zhang, J., Zhou, S., Dong, W., Huang, J.,
Lu, Y., 2024. The applica ion o en omopa hogenic nema ode modi ied mic obial
communi ies wi hin nes ing mounds o he ed impo ed i e an s, Solenopsis in ic a.
Sci. To al En i on. 912, 168748. h ps://doi.o g/10.1016/j.sci o en .2023.168748.
Long, P.E., Williams, K.H., Hubba d, S.S., Ban ield, J.F., 2016. Mic obial me agenomics
e eals clima e- ele an subsu ace biogeochemical p ocesses. T ends Mic obiol. 24,
600–610. h ps://doi.o g/10.1016/j. im.2016.04.006.
Lu, Y., Zhou, G., Ewald, J., Pang, Z., Shi i, T., Xia, J., 2023. Mic obiomeAnalys 2.0:
Comp ehensi e s a is ical, unc ional and in eg a i e analysis o mic obiome da a.
Nucleic Acids Res. 51, 310–318. h ps://doi.o g/10.1093/na /gkad407.
Medina-Sauza, R.M., ´
Al a ez-Jim´
enez, M., Delhal, A., Re e chon, F., Blouin, M.,
Gue e o-Analco, J.A., Ce d´
an, C.R., Gue a a, R., Villain, L., Ba ois, I., 2019.
Ea hwo ms building up soil mic obio a, a e iew. F on . En i on. Sci. 7, 81. h ps://
doi.o g/10.3389/ en s.2019.00081.
Medina-Sauza, R.M., Solís-Ga cía, I.A., Blouin, M., Villain, L., Gue a a, R., Ba ois, I.,
Re e chon, F., 2023. Mic oniches ha bo dis inc bac e ial communi ies a he soil-
plan -ea hwo m in e ace. Eu . J. Soil Biol. 118, 103531. h ps://doi.o g/10.1016/
j.ejsobi.2023.103531.
Muscolo, A., Bo alo, F., Gion iddo, F., Na di, S., 1999. Ea hwo m humic ma e
p oduces auxin-like e ec s on Daucus ca o a cell g ow h and ni a e me abolism. Soil
Biol. Biochem. 31, 1303–1311. h ps://doi.o g/10.1016/S0038-0717(99)00049-8.
Nea ing, J.T., Douglas, G.M., Comeau, A.M., Langille, M.G.I., 2018. Denoising he
Denoise s: An independen e alua ion o mic obiome sequence e o -co ec ion
app oaches. Pee J 6, e5364.
O e beck, V., Schmi z, M., Ta achnyk, I., Blanke, M., 2018. Iden i ica ion o ligh
a ailabili y in di e en swee che y o cha ds unde co e by using non-des uc i e
measu emen s wi h a DualexTM. Eu . J. Ag on. 93, 50–56. h ps://doi.o g/10.1016/
j.eja.2017.11.006.
Pla ˇ
sin, I., Velki, M., Eˇ
cimo i´
c, S., V andeˇ
ci´
c, K., ´
Cosi´
c, J., 2017. Inhibi o y e ec o
ea hwo m coelomic luid on g ow h o he plan pa asi ic ungus Fusa ium
oxyspo um. Eu . J. Soil Biol. 78, 1–6. h ps://doi.o g/10.1016/j.ejsobi.2016.11.004.
P odan, A., T ema oli, V., B olin, H., Zwinde man, A.H., Nieuwdo p, M., Le in, E., 2020.
Compa ing bioin o ma ic pipelines o mic obial 16S RNA amplicon sequencing.
PLoS One 15, e0227434. h ps://doi.o g/10.1371/jou nal.pone.0227434.
R Co e Team, 2023. R: A Language and En i onmen o S a is ical Compu ing. R
Founda ion o S a is ical Compu ing, Vienna, Aus ia h ps://www.R-p ojec .o g/.
Rasmann, S., K¨
ollne , T.G., Degenha d , J., Hil pold, I., Toep e , S., Kuhlmann, U.,
Ge shenzon, J., Tu lings, T.C.J., 2005. Rec ui men o en omopa hogenic nema odes
by insec -damaged maize oo s. Na u e 434, 732–737. h ps://doi.o g/10.1038/
na u e03451.
Salmon, S., Ponge, J.F., 2001. Ea hwo m exc e a a ac soil sp ing ails: Labo a o y
expe imen s on He e omu us Ni idus (Collembola: En omob yidae). Soil Biol.
Biochem. 33, 1959–1969. h ps://doi.o g/10.1016/S0038-0717(01)00129-8.
Samped o, L., Whalen, J.K., 2007. Changes in he a y acid p o iles h ough he diges i e
ac o he ea hwo m Lumb icus e es is L. Appl. Soil Ecol. 35, 226–236. h ps://
doi.o g/10.1016/j.apsoil.2006.04.007.
San ocki, M., Falniowski, A., Ply ycz, B., 2016. Res o a ion o expe imen ally deple ed
coelomocy es in ju enile and adul compos ing ea hwo ms Eisenia and ei, E. e ida
and Dend obaena ene a. Appl. Soil Ecol. 104, 163–173. h ps://doi.o g/10.1016/j.
apsoil.2015.08.022.
Shah, I.H., Jinhui, W., Li, X., Hameed, M.K., Manzoo , M.A., Li, P., Zhang, Y., Niu, Q.,
Chang, L., 2024. Explo ing he ole o ni ogen and po assium in pho osyn hesis
implica ions o suga : Accumula ion and ansloca ion in ho icul u al c ops. Sci.
Ho ic. 327, 112832. h ps://doi.o g/10.1016/j.scien a.2023.112832.
Shapi o, D.I., Tylka, G.L., Be y, E.C., Lewis, L.C., 1995. E ec s o ea hwo ms on he
dispe sal o S eine nema spp. J. Nema ol. 27, 21.
Shapi o-Ilan, D.I., B own, I., 2013. Ea hwo ms as pho e ic hos s o S eine nema
ca pocapsae and Beau e ia bassiana: implica ions o enhanced biological con ol.
Biol. Con ol 66, 41–48. h ps://doi.o g/10.1016/j.biocon ol.2013.03.005.
M. Chelkha e al. Biological Con ol 200 (2025) 105685
9