UNIVERSITA’ DEGLI STUDI DI PARMA
Do o a o di Rice ca in
BIOTECNOLOGIE E BIOSCIENZE
CICLO XXXV
Unlocking he hidden po en ial o gene ic di e si y o imp o e du um whea
ole an o hea s ess
Coo dina o e:
Chia .mo P o . Ma co Ven u a
Supe iso e:
Chia .mo P o . Nelson Ma mi oli
Do .ssa Michela Janni
Tu o e:
Chia .ma P o .ssa Elena Maes i Candida o: Nadia Pale mo
2019/2020-2021/2022
UNIVERSITY OF PARMA
Ph.D. in Bio echnology and Biosciences
XXXV COURSE
Unlocking he hidden po en ial o gene ic di e si y o imp o e du um whea
ole an o hea s ess
Coo dina o :
P o . Ma co Ven u a
Supe iso :
P o . Nelson Ma mi oli
D . Michela Janni
Tu o :
P o . Elena Maes i
Candida e: Nadia Pale mo
2019/2020-2021/2022
Index
Abs ac 1
1. INTRODUCTION 3
1.1 G eenhouse E ec s and Global Wa ming ........................................................................ 3
1.1.1 Clima e changes: global empe a u e ise .................................................................. 4
1.1.2 High empe a u e impac on ag icul u e .................................................................... 5
1.2 Whea ................................................................................................................................ 7
1.2.1 Whea p oduc ion ...................................................................................................... 7
1.2.2 Whea li e cycle ......................................................................................................... 9
1.2.3 Whea allopolyploidiza ion...................................................................................... 10
1.3 Hea s ess on plan s ...................................................................................................... 12
1.3.1 Hea damage and ROS p oduc ion .......................................................................... 12
1.3.2 Hea s ess e ec s on whea de elopmen ............................................................... 13
1.3.3 Plan adap a ion s a egies o hea s ess.................................................................. 15
1.3.4 Hea esilience ......................................................................................................... 16
1.4 Molecula mechanisms o Hea ole ance ...................................................................... 19
1.4.1. Signal ansduc ion ................................................................................................. 19
1.4.2 Hea Shock Fac o s (HSF) ....................................................................................... 19
1.4.3 Hea -Shock P o eins (HSPs), mas e Playe s o Hea S ess Tole ance ................ 21
1.4.3.1 HSP100s ........................................................................................................... 23
1.4.3.2 HSP90s ............................................................................................................. 24
1.4.3.3 HSP70s ............................................................................................................. 24
1.4.3.4 HSP60s ............................................................................................................. 25
1.4.3.5 Small HSPs ....................................................................................................... 25
1.4.3.6 sHSP26 ............................................................................................................. 27
1.5 Hea esilience ................................................................................................................ 28
1.5.1 Gene ic di e si y and b eeding o cope clima e changes and hea s ess ................ 28
1.5.2 TILLING and EcoTILLING .................................................................................... 29
1.5.3 Pheno yping ............................................................................................................. 29
2. AIM OF THE PROJECT 33
3. MATERIAL AND METHODS 34
3.1 EcoTILLING and de ec ion o na u al a ia ion in TdHsp26-A1 and TdHsp26-B1 in
du um whea geno ypes ........................................................................................................ 34
3.1.1 Plan ma e ial ........................................................................................................... 34
3.1.2 DNA ex ac ion and gene a ge ing ......................................................................... 35
3.1.3 Bioin o ma ics analysis o he NGS da a ................................................................ 37
3.1.4 KASP Assay ............................................................................................................ 37
3.1.5 P omo e unc ional mo i s in Silico analysis ......................................................... 39
3.2 Hea s ess expe imen s .................................................................................................. 39
3.2.1 Plan g ow h and hea s ess condi ions o sho - e m HS ...................................... 39
Seedlings expe imen .................................................................................................... 39
Tille ing expe imen ..................................................................................................... 39
An hesis expe imen ..................................................................................................... 40
3.3 Pheno ypic analysis ........................................................................................................ 43
3.3.1 Mo phological analysis ........................................................................................... 43
3.3.2 Biochemical analysis ............................................................................................... 45
Malondialdehyde (MDA) con en ................................................................................ 45
De e mina ion o Hyd ogen pe oxide H2O2 ................................................................. 45
3.3.3 Physiological measu emen s ................................................................................... 46
Pho osyn hesis: Pho osys em II (PSII) e iciency: F /Fm ........................................... 46
T anspi a ion: S oma al Resis ance ( S) and s oma al conduc ance (gs) ....................... 46
Canopy empe a u e: In a ed Lea Tempe a u e (IR) and Canopy Dep ession
Tempe a u e (CTD) ...................................................................................................... 46
Rela i e Wa e Con en (RWC) .................................................................................... 48
3.3.4 Yield ai s ............................................................................................................... 48
3.3.5 S ess indices ........................................................................................................... 49
3.4 TdHsp26-A1 and TdHsp26-B1 gene exp ession ............................................................. 49
3.4.1 Sample collec ion .................................................................................................... 49
3.4.2 RNA ex ac ion and cDNA e o ansc ip ion ......................................................... 50
3.4.3 Quan i a i e Real Time PCR (q PCR) ..................................................................... 50
3.5. Da a analysis ................................................................................................................. 51
4. RESULTS AND DISCUSSION 52
4.1 Ma e ials and App oaches used o disco e no el na u al a iabili y o inc ease hea
s ess esilience .................................................................................................................... 52
4.2 EcoTILLING app oach o disco e he na u al a iance in TdHsp26-A1 and TdHsp26-
B1 in du um whea geno ypes ............................................................................................... 53
4.2.1 SNPs iden i ica ion in TdHSp26 genes .................................................................... 53
4.2.2 SNPs localiza ion and hea s ess expe imen ......................................................... 55
4.2.3 E ec s o SNPs on TdHsp26 p omo e ................................................................... 58
4.3 Does he gene ic a ia ion iden i ied in TdHsp26 sequence impac on he hea s ess
esponse? .............................................................................................................................. 61
4.3.1 Hea s ess esponse in seedling s age ..................................................................... 61
Mo phological ai s ..................................................................................................... 61
MDA con en ................................................................................................................ 63
TdHsp26-A1 and -B1 gene exp ession du ing hea s ess in seedlings s age ............... 66
4.3.2 The hea s ess esponse in ille ing s age ............................................................... 67
4.3.2.1 Mo phological ai s ......................................................................................... 67
4.3.2.2 Physiological ai s ........................................................................................... 68
S ess indices ................................................................................................................ 71
4.3.2.3 An ioxidan ac i i y and ROS accumula ion .................................................... 72
4.3.2.4 TdHsp26-A1 and TdHsp26-B1 gene exp ession analysis du ing hea s ess in
ille ing s age ................................................................................................................ 73
4.3.2.5 Yield ai s ........................................................................................................ 74
4.3.3 SSD lines cha ac e iza ion o hea s ess esilience ............................................... 75
4.3.4 Discussion on he hea s ess esponse o du um whea lines in seedling and
ille ing s age .................................................................................................................... 77
4.3.5 The hea s ess esponse a e p olonged hea s ess in an hesis phase ................... 79
4.3.5.1 Mo phological ai s ......................................................................................... 79
4.3.5.2 Physiological ai s ........................................................................................... 83
4.3.5.3 MDA con en .................................................................................................... 88
4.3.5.4 TdHsp26-A1 and TdHsp26-B1 gene exp ession analysis du ing hea s ess in
an hesis s age ................................................................................................................ 89
4.3.5.5 Yield ai s ........................................................................................................ 89
4.3.6 Discussion o he p olonged hea s ess esponse in an hesis phase........................ 91
5. DISCUSSION AND CONCLUSIONS 95
6. SUPPLEMENTARY MATERIAL 98
7. ACKNOWLEDGMENTS 101
REFERENCES 102

1
Abs ac
Acco ding o he In e go e nmen al Panel on Clima e Change epo , he a e age
global empe a u e will inc ease by 0.5 o 4°C in he 21s cen u y, leading o a educ ion in
c op yields.
Whea is one o he wo ld's oldes and mos widesp ead ood c ops and an impo an
componen o he human die ; i is e y sensi i e o hea s ess (HS), and i is conside ed ha
o e e y 1°C inc ease in a e age empe a u e du ing he ep oduc i e phase, whea
p oduc ion is es ima ed o dec ease by 6%.
Mo eo e , he as inc eases in ood demand due o popula ion g ow h mus be
conside ed. A s a egy o o e come he ongoing clima e change is o unde s and he
mo phological and physiological ai s associa ed wi h ole ance o high empe a u es o
p oduce c ops mo e ole an o abio ic s esses.
Possible app oaches o succeed in main aining high c op yields include (i) he
exploi a ion o na u al and induced mu a ions; (ii) he exploi a ion o a ailable gene ic
esou ces o p oduce new gene ic ma e ial ha is mo e ole an o HS and ela ed seconda y
s esses; (iii) imp o e he abili y o iden i y a ailable sou ces o esilience; and (i )
de eloping new selec ion echniques.
The in ol emen o sHsp26 in he hea s ess esponse was analyzed, by dissec ing he
na u al mu a ions o TdHsp26 in some du um geno ypes belonging o a ge mplasm collec ion.
A a ge en ichmen PCR o NGS ollowed by KASP analysis was used o de e mine
he SNPs p esen on he gene o in e es in he di e en geno ypes analyzed; a o al o 17
haplo ype combina ions we e ound.
A pheno yping analysis was pe o med on he a ge geno ypes subjec ed o he mal
s ess in h ee di e en phases o whea de elopmen : seedlings (Z10), accession (Z31) and
an hesis (Z65) Biochemical, mo phological, and physiological ai s we e eco ded du ing he
expe imen and con as ing geno ypes we e iden i ied and selec ed h ough he expe imen s.
Cul i a ed a ie ies we e also included in he ials.
On he basis o he esul s ob ained SSD69 and SSD397 we e inally iden i ied as
pu a i e ole an and suscep ible o hea s ess.
2
These esul s suppo he impo ance o plan pheno yping o he iden i ica ion o
supe io geno ypes unde hea s ess.
3
1. INTRODUCTION
1.1 G eenhouse E ec s and Global Wa ming
Ea h's a mosphe e is a mix u e o gases called g eenhouse gasses (GHG), and i e ains
hea like he walls o a g eenhouse.
Sola adia ion passes h ough he a mosphe e unimpeded, hea ing he ea h's su ace. In
u n, he ene gy is e-emi ed as in a ed, much o which is abso bed by CO2 and wa e apo
in he a mosphe e. The la e ac s as a "blanke " o he igh hickness, abso bing he
app op ia e sola ene gy o main ain a global a e age empe a u e adequa e o li e. Wi hou
his na u al g eenhouse e ec , he a e age su ace empe a u e would all o abou -21°C,
much less han he cu en 14°C (Ande son, Hawkins, and Jones 2016). Gasses ha con ibu e
o he g eenhouse e ec include: Ca bon dioxide (CO2), me hane (CH4), Ni ous oxide (NO2)
and Chlo o luo oca bons (CFCs) (Kweku e al. 2018).
Many o hese come om na u al p ocesses, such as:
- e apo a ion, which adds wa e apo o he a mosphe e;
- espi a ion o animals o plan s, which con ibu es ca bon dioxide;
- decomposi ion esul ing in he elease o me hane (‘The G eenhouse E ec and Ou
Plane Na ional Geog aphic Socie y’ 2022).
The sha p inc ease in g eenhouse gasses o e he pas 100 yea s has been caused by
an h opogenic ac i i ies (Kazancoglu, Ozbil ekin-Pala, and Ozkan-Ozen 2021).
Main playe s in inc easing g eenhouse gasses a e ossil uel combus ion, de o es a ion,
logging, and ag icul u al ac i i ies (Wang e al. 2021).
1) Fossil uels, such as coal, oil, and na u al gas bu ning a e he main sou ce o ene gy
o elec ici y, hea ing, and anspo a ion, as well as o he manu ac u e o a wide ange o
p oduc s, om s eel o plas ics. This p ocess causes he elease o g eenhouse gasses
(pa icula ly CO2) a high a es.
2) De o es a ion se iously con ibu es o he inc ease in g eenhouse gasses. Du ing
pho osyn hesis, plan s, and ees s o e ca bon (C) and elease oxygen (O2) in o he ai . Due o
de o es a ion and logging, ca bon is eleased as CO2. Acco ding o he Food and Ag icul u e
4
O ganiza ion o he Uni ed Na ions (FAO, 2006), de o es a ion eleases be ween 25–30% o
GHGs annually (Al-Yasi i and Géczi 2021).
3) Ag icul u e plays a key ole in g eenhouse gas emission, he global ood sys em
esponsible o 21-37% o annual emissions and gene a es a ound hal o all an h opogenic
me hane emissions and a ound h ee-qua e s o an h opogenic N2O (Lynch e al. 2021).
The s ong inc ease in g eenhouse gasses due o all he abo e ac i i ies has esul ed in
he global wa ming e ec ha has been so a de ined as “ he inc ease in he su ace a e age
empe a u e o he ea h” because o he inc ease in he concen a ion o g eenhouse gasses
(Al-Ghussain 2019).F om 1990 o 2019, he inc ease in global wa ming is 45% (US EPA
2022).
1.1.1 Clima e changes: global empe a u e ise
Global wa ming has d as ic consequences on changes in he wo ld clima e, leading o
an inc ease in he equency and in ensi y o hea wa es and d ough s, as well as o he abio ic
s ess condi ions such as looding, salini y, and eezing (Bigo e al. 2018).
In Oc obe 2018, he In e go e nmen al Panel on Clima e Change (IPCC) eleased a
special epo on global wa ming, highligh ing ha a e age global empe a u es ha e inc eased
by abou 1Cº since p e-indus ial imes (Figu e 1). Fu he mo e, in ha epo i was poin ed
ou ha a e age global empe a u es a e inc easing by abou 0.2°C e e y decade (‘IPCC —
In e go e nmen al Panel on Clima e Change’ 2018). In addi ion, in he pape i is p edic ed ha
a e age global wa ming will likely each 1.5°C be ween 2030 and 2052 conside ing he a e o
cu en an h opogenic g eenhouse gas (GHG) emissions (Ogunbode, Do an, and Böhm 2020).
Acco ding o clima e models (D iedonks e al. 2015) and he epo om he
In e go e nmen al Panel on Clima e Change, he wo ld mean empe a u e will ise by 0.5 o
4°C in he wen y- i s cen u y (Hansen e al. 2016; Zandalinas, F i schi, and Mi le 2021).
11
Du um whea (DW), T i icum u gidum L. ssp. Du um (Des .) Husn., genome BBAA,
e ol ed om domes ica ed emme whea (DEW), T. u gidum ssp. dicoccum (Sch ank ex
Schübl.) Thell. DEW i sel de i ed om wild emme whea (WEW), T.
u gidum ssp. dicoccoides (Kö n. ex Asch. & G aebn.) Thell., in he Fe ile C escen abou
10,000 yea s ago. Al hough he ea lies e idence o DW da es back o 6,500–7,500 yea s ago
(Macca e i e al. 2019). Ins ead, T i icum aes i um L. de i ed om a polyploidiza ion e en
be ween T i icum u gidum ssp. du um (AABB genome) and Aegilops auschii (DD genome)
(Le y and Feldman 2022).
Allopolyploidy o he whea genome is one o he key ac o s in whea success as a
global s aple c op. The p esence o wo o h ee copies o a gene may con e g ea e plas ici y
and hus allow adap a ion o changing en i onmen al condi ions (The In e na ional Whea
Genome Sequencing Conso ium (IWGSC) e al. 2014).
The i s s ep o exploi he gene ic po en ial o whea was he comple e assembly o
i s genome, which ook a long ime o comple e, as he la ge size o he genome (16 Gb o T.
aes i um and 12 Gb o T. u gidum) and he high sequence simila i y be ween subgenomes
and he abundance o epe i i e elemen s (abou 85% o he genome) hampe ed ea ly a emp s
a assembly (The In e na ional Whea Genome Sequencing Conso ium (IWGSC) e al. 2014).
In 2017, bo h e aploid and hexaploid whea genomes we e made a ailable (A ni e
al. 2017; Zimin e al. 2017).
Nex Gene a ion Sequencing (NGS) echnologies a e also p o iding mo e
oppo uni ies o s udy gene s uc u e and exp ession. He i able a ia ion in he
genome ha unde lies impo an ag onomic ai s can be iden i ied mo e apidly and
sys ema ically (Jia e al. 2017).
The comp ehensi e sequencing o hese whea genomes wi h he help o NGS
echnology is a miles one o whea biology and p o ides esou ces o unc ional whea
genomics. Howe e , o link pheno ypic ai s o unc ional genes, whea esea che s a e
wo king on addi ional pla o ms and echnical esou ces, such as mu an lib a ies, comple e
cDNA clones, and SNP mic oa ays (Jia e al. 2017).

12
1.3 Hea s ess on plan s
1.3.1 Hea damage and ROS p oduc ion
Hea s ess a ec s se e al physiological p ocesses o he plan , such as:
pho osyn hesis, espi a ion, anspi a ion, memb ane he mos abili y, and osmo ic egula ion.
Among all, memb ane dys unc ion is he main physiological consequence o plan
exposu e o HS. Unde high empe a u e condi ions, he kine ic ene gy and mo emen o
biomolecules ac oss memb anes inc eases, which causes weakening o chemical bonds,
leading o disin eg a ion o memb ane lipids esul ing in inc eased luidi y (Jaconis e al.
2021).
Pho osyn hesis is ano he p ocess ha is g ea ly impai ed by hea , causing se e e
epe cussions on he plan (Hawo h e al. 2018). Unde HS condi ions, pho ochemical
eac ions in he hylakoid lamellae and ca bon me abolism in he chlo oplas s oma a e
subjec o damage (Hu, Ding, and Zhu 2020). Hea s ess causes hylakoid memb anes o
up u e, he eby inhibi ing he ac i i ies o elec on anspo e s and memb ane-associa ed
enzymes, educing he a e o pho osyn hesis. Among chlo oplas memb ane p o ein
complexes, PSII is he mos sensi i e a ge o hea s ess. I can de ach om he memb ane,
due o inc eased memb ane luidi y, esul ing in impai men o i s in eg i y and a ec ing
pho osyn he ic elec on ans e (Ma hu , Ag awal, and Jajoo 2014). Pho osyn he ic elec on
anspo and ATP syn hesis a e se e ely impai ed i PSII su e s se e e he mal damage (
Wang e al. 2018, 2).
Ano he componen o he pho osyn he ic appa a us ha is a ec ed by he mal s ess
is he Rubisco enzyme, which, unde non-s ess condi ions, is esponsible o he ixa ion o
abou 1011 ons o a mosphe ic CO2 (Galmés e al. 2013). I ac s in he Cal in-Benson-
Bassham cycle, ca alyzing he ca boxyla ion o he 5-ca bon-a om suga ibulose-1,5-
bisphospha e (RuBP), ( Wang e al. 2018). A mode a ely ele a ed empe a u es, Rubisco
ac i ase (RCA) ac i i y is inhibi ed, esul ing in he mal inac i a ion o Rubisco ac i i y.
Unde high empe a u es, he s abili y o he Rubisco ac i a ing chape one enzyme dec eases,
esul ing in he inhibi ion o pho osyn hesis (Pe domo e al. 2017).
All hese al e a ions lead o inc eased concen a ions o eac i e oxygen species
(ROS). ROS a e no mally p oduced in plan cells, pa icula ly in he chlo oplas he ollowing
a e o med: hyd ogen pe oxide (H2O2), supe oxide, hyd oxyl adicals (-OH) and 1O2 du ing
13
pho osyn hesis (Asada 2006; Kho ob ykh e al. 2020). ROS p oduc ion occu s du ing
exci a ion ene gy ans e in he an enna complex o PSII and du ing elec on anspo in he
eac ion cen e o PSII (Suzuki e al. 2012; Pospíšil 2016). In pa icula , 1O2 is o med
h ough exci a ion ene gy ans e , while he supe oxide anion adical (O2 --), H2O2 and -OH
a e o med h ough elec on anspo (Pospíšil and P asad 2014). Unde s ess condi ions,
due o mal unc ion o PSII and he Cal in cycle ROS syn hesis inc ease, leading o lipid
pe oxida ion and cell memb ane damage (Nelson e al. 2014).
Unde non-s ess condi ions, a balance exis s be ween ROS p oduc ion and emo al,
known as edox homeos asis (Ca e zan, Casassola, and B amme 2016). When ROS
p oduc ion exceeds he cell abili y o eco e , he cell is subjec ed o a s ess known as
oxida i e s ess (Figu e 5). The HS-induced inc ease in ROS p oduc ion causes a change in
memb ane po en ial (depola iza ion), lipid pe oxida ion, p o ein oxida ion, nuclea acid
damage, obs uc ion o enzyme unc ion, and ac i a ion o p og ammed cell dea h (Sa i a
S i as a a and Dubey 2011).
Fig 5. E ec s o hea s ess on plan s ( ep oduced om J. Zhao e al. 2020).
1.3.2 Hea s ess e ec s on whea de elopmen
Whea is e y sensi i e o hea s ess (Ak e and Ra iqul Islam 2017), and c op g ow h
is signi ican ly impai ed depending on he se e i y and iming o he s ess. High empe a u e
a ec s almos all s ages o whea g ow h and de elopmen , including seed ge mina ion, oo
and lea eme gence, s em g ow h, lowe ing ini ia ion, pollina ion, e iliza ion, seed yield and
14
seed quali y (Bu a e al. 2020). Op imal empe a u es o whea g ow h and de elopmen a e
shown in Table 1.
The ep oduc i e and g ain- illing s ages a e he mos sensi i e o hea s ess, and
plan s a e less likely o eco e i s essed a his c i ical s age (Ba low e al. 2015; Aiqing e
al. 2018). In ac , high empe a u es du ing he ep oduc i e s ages can cause pollen s e ili y,
s e ile o ules, dec eased e iliza ion, and abo ed lowe s (P asad and Djanagui aman 2014)
which ul ima ely educe g ain numbe s and yield. G ain size is also educed due o sho e
du a ion o he iling pe iod and ea ly senescence (Shi delmoghanloo e al. 2016), whe eas
g ain quali y dec eases (Nu all e al. 2015; Ullah e al. 2020) wi h an inc ease in he
pe cen age o sh i eled/b oken g ains (also called sc eens) (Fe ei a e al. 2012). Fo each 1°C
inc ease in mean empe a u e du ing he ep oduc i e phase, g ain p oduc ion is es ima ed o
dec ease by 6% ( Chen e al. 2020).
Table 1. Op imal empe a u e equi emen s o whea a di e en g ow h s ages om (Khan e al.
2020)
S ages
Op imum
Tempe a u e (°C)
Minimum
Tempe a u e (°C)
Maximum
Tempe a u e (°C)
Seed ge mina ion
20-25 ± 1.2
3.5-5.5 ± 0.44
35 ± 1.02
Roo g ow h
17.2 ± 0.87
3.50 ± 0.73
24.0 ± 1.21
Shoo g ow h
18.5 ± 1.90
4.50 ± 0.76
20.1 ± 0.64
Lea ini ia ion
20.5 ± 1.25
1.50 ± 0.52
23.5 ± 0.95
Te minal spikele
16.0 ± 2.30
2.50 ± 0.49
20.0 ±1.60
An hesis
23.0 ± 1.75
10.0 ±1.12
26.0 ± 1.01
G ain illing du a ion
26.0 ± 1.53
13.0 ± 1.45
30.0 ± 2.13
Howe e , e en he ea ly s ages o g ow h can be se e ely a ec ed by high
empe a u es. Fo example, g ow h and de elopmen begin wi h seed ge mina ion, which
equi es op imal empe a u e and humidi y. The ge mina ion index and po en ial a e educed
unde high empe a u es ( Liu e al. 2019).
High empe a u e also hea ily a ec s he oo ing o whea seedlings in he ea ly
ege a i e s ages o he c op; i he empe a u e is high, he e is a educ ion in oo g ow h,
shoo s, g een lea a ea, and he numbe o e ec i e shoo s pe plan ( Gup a e al. 2013).
15
A be e unde s anding o he mo phological and physiological ai s associa ed wi h
HS ole ance would allow de ense measu es agains hea s ess o be de ined (Janni e al.
2018; Lang idge and Reynolds 2021).
1.3.3 Plan adap a ion s a egies o hea s ess
Plan s ha e h ee main adap a ion s a egies o hea esis ance: hea ole ance (HT), hea
escape (HE) and hea a oidance (HA) (Shanke , Bhanu, and Maheswa i 2020); almos all o
he adap i e ai s ha enable he plan o coun e ac s ess a e encapsula ed in he e m Hea
Resilience (Figu e 6).
1) Hea ole ance is he abili y o he plan o esis and wi hs and con inuous exposu e o
ho condi ions wi h a a ying deg ee o plan damage, he less he g ea e he
ole ance. The e m includes mobiliza ion o hea shock p o eins, ac i a ion o he
an ioxidan sys em, induc ion o memb ane he mos abili y and pho op o ec i e
me aboli es (Wahid e al. 2007).
2) Hea a oidance is he abili y o plan s o a oid he e ec s o hea by main aining
issue homeos asis and enzyme ac i i y he eby coun e ing hea ; sho e m a oidance
includes lea olling o change in lea posi ion, change in lipidic memb ane
composi ion, and cooling as he esul o anspi a ion and apid wa e up ake
(Sangee a S i as a a e al. 2012).
3) Hea escape is he abili y o he plan o escape hea -like condi ions by adjus ing i s
phenology, de elopmen al plas ici y, g ow h pa e n so ha i s c i ical physiological
s age ha can be a ec ed by hea escapes i (Shanke , Bhanu, and Maheswa i 2020).
16
Fig 6. Hea esilience and he p ocesses leading o hea s ess in plan s ( om Shanke e al., 2020).
1.3.4 Hea esilience
To achie e "ze o hunge " among he sus ainable de elopmen goals and ensu e ood
secu i y, c ops mus be imp o ed especially unde changing clima ic condi ions (Janni e al.
2020). To do his, scien is s mus be able o p oduce c ops ha a e esis an o abio ic s esses;
his in ol es he use o ad anced echnical echniques such as high- h oughpu geno yping
and pheno yping and genome edi ing (Hickey e al. 2019).
Con en ional plan b eeding s a egies based on pheno ypic selec ion and quali a i e
gene ics we e used in he pas (Se ia and Se ia 2018). Howe e , popula ion g ow h esul ing
in inc eased demand o ood has esul ed in he sea ch o eli e cul i a s ha a e mo e
adap able o ongoing changes. The mechanisms o esponding o a ious s esses a e e y
complex and unde s anding he mechanisms ha egula e he a ious esponses is c ucial in
o de o con inue wi h he sea ch o cul i a s ha can adap o s esses.
Ad ances in "omics" echnologies, pa icula ly genomics, ansc ip omics,
p o eomics, me abolomics, and phenomics allowed o moni o ac o s and ai s ha in luence
c op g ow h and yield in esponse o en i onmen al h ea s ( Soda 2015;Se ia and Se ia 2018).
- Genomics. Nex -gene a ion sequencing echniques ha e accele a ed ad ances in
c op unc ional genomics s udies (Li e al. 2018). Nume ous genes ha e been iden i ied in
plan s ha con ol key ag onomic ai s, especially unde abio ic s esses ( Sha ma e al. 2017;
Wen e al. 2021). Genome-wide associa ion s udy (GWAS) has been applied o link ai s o
hei unde lying gene ics. Many associa ion s udies ha e been conduc ed on a ious c ops,
such as whea unde hea s ess (Rong Zhou e al. 2022).
- T ansc ip omics. In ecen yea s, RNA-seq (RNA sequencing) wi h nex -gene a ion
sequencing echniques has enabled mo e accu a e cha ac e iza ion o he ansc ip ome han
mic oa ay. Mic oRNAs (miRNAs), ci cula RNAs (ci cRNAs) and long ncRNAs (lncRNAs)
also play key oles in he esponse o abio ic s esses. These ncRNAs, including miRNA,
ci cRNA and lncRNA, a e conside ed an eme ging a ge o c op imp o emen (Rong Zhou
e al. 2022). I is o conside able impo ance o s udy plan ansc ip ome esponses a
indi idual cell le el because di e en cell ypes a e known o play di e en biological oles in
plan g ow h and de elopmen . Single-cell RNA-sequencing (scRNA-seq) is a high- esolu ion

17
app oach o s udy he unc ional genomes and ansc ip ional ac i i y o plan s a he single-
cell le el (Rich-G i in e al. 2020), which helps scien is s explo e plan he e ogenei y wi hin
cell ypes. A signi ican di e ence in some genes has been ound among A abidopsis haliana
(L.) Heynh. cell ypes unde hea s ess, al hough he hea shock p o ein esponse domina es
gene exp ession in di e en cell ypes (Jean-Bap is e e al. 2019).
- P o eomics. P o eins, like gene p oduc s, can di ec ly play oles in c op esponse o
hea s ess. A numbe o p o eins in ol ed in c op hea ole ance ha e been iden i ied using
p o eomics ( Zhao e al. 2016; Lu e al. 2017; Mu e al. 2017) as o example he s udy
conduc ed by Lu e al. (2017) which led o he iden i ica ion o 258 he mo-p o ein eac i e in
whea ha we e playing a ole in egula ing edox, chlo ophyll syn hesis, p o ein u no e and
ca bon ixa ion (Lu e al. 2017).
- Me abolomics. I p o ides an e icien me hod o cha ac e izing hea ole ance in
plan s and me abolome composi ion and dynamics in a ious cul u es o hea s ess ha e been
iden i ied using me abolomics (Cheb olu e al. 2016; Paupiè e e al. 2017). O e all,
me abolomics is equi ed o comple e knowledge o o he omics and o de elop models o
he sys em as a whole (Paupiè e e al. 2017), which can con ibu e o hea ole ance ligh ing
by he appea ance ha o he omics canno co e .
- Phenomics. O e he pas decade, plan phenomics has made imp essi e p og ess,
de eloping no el senso s and imaging echniques o a wide ange o ai s, o gans and
si ua ions (Ta dieu 2017). Phenomics also cha ac e ized he plas ici y o he plan phenome
when exposed o a ange o en i onmen al condi ions by cap u ing and in e p e ing a
mul idimensional ma ix o unc ional and a chi ec u al a iables measu ed a di e en scales
(o gan, plan , canopy), de elopmen al s ages and en i onmen al scena ios (Danzi e al. 2021).
The in eg a ion o genomics, ansc ip omics, p o eomics, me abolomics, and
phenomics da a no only allowed o explain a ious biological p ocesses (Rong Zhou e al.
2022), bu ga e inno a i e ools o igh he g owing challenges o clima e change on c ops
(Janni e al. 2020), esul ing in he de elopmen o new high-yield a ie ies wi h inc eased
hea ole ance and adap a ion o clima e change. Mul i-omics can acili a e echnique-assis ed
b eeding, gene ic enginee ing, and genome edi ing and hus accele a e c op imp o emen .
Cu en da a indica e ha a leas wo di e en gene ic sys ems can p o ec plan s om
he o he wise le hal e ec s o hea s ess: (i) a se ies o Mendelian HS genes ac ing possibly
18
in a dominan o semi-dominan way; and (ii) a small numbe o QTLs which allow plan
g ow h and ep oduc ion unde di e en s ess condi ions (Janni e al. 2020).
19
1.4 Molecula mechanisms o Hea ole ance
1.4.1. Signal ansduc ion
The plasma memb ane ac s as he i s senso o he mal s ess; he change in plasma
memb ane luidi y causes cyclic nucleo ide calcium channels (CNGCs) con olled by
nucleo ide cyclases o open, causing Ca2+ o mo e in o he cy osol om he nuclea
memb ane (Mi le , Finka, and Goloubino 2012).
Ca2+ ions a e associa ed wi h p o ein calmodulin 3 (CaM3) du ing HS; he Ca2+- CaM3
complex in e ac s wi h calcium/calmodulin-binding p o ein kinase 3 (CBK3) and phospha ase
PP7 o ansduce cy osol hea -s ess esponse (HSR) signals om he cy osol o he nucleus
by modula ing phospho yla ion and de-phospho yla ion o HSFA1, espec i ely (Ohama e al.
2017). Hea Shock Fac o s (HSFs) a e encoded by la ge gene amilies wi h a iable
exp ession and unc ions and a e componen s o complex signaling sys ems ha con ol
esponses no only o high empe a u es, bu also o a ange o abio ic s esses such as cold,
d ough , hypoxic condi ions, soil salini y, oxic mine als, s ong i adia ion, and pa hogen
h ea s (And ási, Pe kó-Szand ne , and Szabados 2021).
Signal ansduc ion also occu s wi h inc eased le els o Inosi ol-1,4,5- iphospha e
(IP3), h ough he phosphoinosi ide signaling pa hway, which esul s in Ca2+ in lux in o he
cy oplasm om in acellula Ca2+ pools such as he endoplasmic e iculum (ER) and acuole
du ing HS (Ohama e al. 2017).
ROS also con ibu e o signal ansduc ion wi h he accumula ion o ni ic oxide (NO),
which induces CaM3 ac i a ion (Rengang Zhou e al. 2009).
1.4.2 Hea Shock Fac o s (HSF)
As men ioned in he p e ious pa ag aph, signal ansduc ion leads o he ac i a ion o
Hea Shock Fac o s, HSFs.
HSFs play a c ucial ole in he esponse o high empe a u es in plan s. They a e he
ac i a o s o p oduc ion o hea shock p o eins, which in u n a e majo playe s in he hea
s ess esponse (Liao e al. 2022).
Gene ally, plan HSFs p o eins sha e a well-conse ed s uc u e cha ac e ized by 3
main domains. The N- e minal DNA-binding domain (DBD) is cha ac e ized by a cen al
helix- u n-helix mo i ha speci ically binds o hea s ess elemen s (HSEs) in a ge
20
p omo e s and subsequen ly ac i a es ansc ip ion o s ess-inducible genes (Scha 2012).
The oligome iza ion domain (OD) wi h a bipa i e pa e n o hyd ophobic amino acid esidues
(HR-A/B egion) is linked o he DBD by a lexible linke . The C- e minal ac i a ion domains
o plan HSFs a e cha ac e ized by sho pep ide mo i s (AHA mo i s), which in many cases
a e c ucial o ac i a o unc ion (Meng e al. 2016).
Despi e many conse ed ea u es, HSF amily membe s show a s ong di e si ica ion
o exp ession pa e ns and unc ions wi hin he HSF amily ( Chen e al. 2018).
In whea , 56 TaHs membe s we e iden i ied, classi ied in o classes A, B and C (Xue
e al. 2014).
When plan s expe ience hea s ess, Hs A1s induce he exp ession o HSPs by binding
he HSE in he co esponding p omo e DNA sequence. The HSEs a e cen al inucleo ide
sequences, 5′-nGAAn-3′ o 5′-nTTCn-3′, wi h al e na ing o ien a ion, sepa a ed by wo
nucleo ides (A o a ullah e al. 2018). In addi ion, Hs A1s ac i a e TFs, igge ing a
ansc ip ional cascade composed o a ious TFs, including Hs As (Hs A1e, Hs A2, Hs A3,
Hs A7a and Hs A7b), Hs Bs (Hs B1, Hs B2a and Hs B2b), DREB2A and MBF1c ( Liu and
Cha ng 2013).
The HSF in e ac s wi h he ROS sys em ac i a ed, no only by he signal cascade
ini ia ed by signal ansduc ion, bu also by he accumula ion o hyd ogen pe oxide (H2O2)
molecules (Kollis e al. 2019).
The s udy by Pe ez-Salamo e al., showed ha a subse o Hs s genes is up- egula ed
by ea men s ha gene a e ROS (Pé ez-Salamó e al. 2014).
The mechanism o sensing is no well unde s ood. Func ion o HSFs migh be a ec ed
by he p esence o H2O2, as he la e can s abilize HSF ime s h ough e e sible oxida ion
o Cys esidues and o ma ion o Cys-Cys bonds ( Mille and Mi le 2006).
In addi ion, se e al s udies ha e shown ha he HSE egion o Hs s does no in e ac
only wi h Hea shock p o eins (HSPs). S o ozhenko e al. (1998) showed ha Hs B1 cloned
om oma o binds he HSE o he asco ba e pe oxidase 1 (apx1) gene by ac i a ing i s
ansc ip ion unde HS in a abidopsis (S o ozhenko e al. 1998). An apx wi h a simila HSE
mo i was up egula ed a e exposu e o ice seedlings o 42°C (Sa o e al. 2001).
Thus, Hs s can d i e he p oduc ion o key egula o y elemen s in plan de ense
agains hea s ess: he HSPs and enzymes wi h sca enge ac i i y such as: asco ba e
pe oxidase (APX), supe oxide dismu ase (SOD), ca alase (CAT) (D iedonks e al. 2015).
27
1.4.3.6 sHSP26
The sHsp26 gene amily in du um whea was isola ed and cha ac e ized by Comas i
e al.2018, exploi ing a TILLING app oach. Fou pu a i e TaHsp26 genes, namely TaHsp26-
A1, -A2, -A3, and -B1 we e e ie ed in he du um whea genome (Comas i e al. 2018). The
h ee A genome loci a e localized on he sho a m o ch omosome 4A, while he single B
genome locus is mapped on 4BL. The gene's opog aphy is shown in Figu e 10 (Comas i e
al. 2018).
Fig 10. TdHsp26 gene s uc u es. The conse ed N- e minal M D (Me hionine- ich Domain)
amphipa hic a-helix is highligh ed in ligh g ay and he ACD in da k g ay. The exon/in on junc ions
a e indica ed om (Comas i e al. 2018) .
In silico analyses placed hese p o eins in he chlo oplas , hanks o he p esence o a
chlo oplas T ansi Pep ide (cTP).
TdHsp26 genes we e di e en ly egula ed upon di ec hea s ess and especially a e
acclima ion. TdHsp26-A1 showed he highes up egula ion ollowing di ec hea s ess and
TdHsp26-B1 he highes one when he hea s ess was imposed a e acclima ion. This
p omp ed us o ocus on TdHsp26-A1 and -B1 genes in his esea ch hesis.

28
1.5 Hea esilience
1.5.1 Gene ic di e si y and b eeding o cope clima e changes and hea s ess
Clima e change is s ongly a ec ing c op yields and he inc easing wo ld's
popula ion, he de elopmen o imp o ed c ops mo e ole an o he ongoing changes is
needed o ensu e ood secu i y and sa e y (Kholo á e al. 2021).
Thus, unde s anding he mechanisms o hea ole ance, based on gene ics and
physiology, is c i ical o achie ing his goal. The knowledge gained will be used o de elop
hea - ole an cul i a s sui able o sus ainable g ow h unde hea s ess condi ions
(Shanmuga el e al. 2021).
Possible app oaches o main ain high c op yields a e (i) exploi ing na u al and induced
mu a ions; (ii) ha nessing a ailable gene ic esou ces o p oduce new gene ic ma e ial mo e
ole an o HS and ela ed seconda y s esses; (iii) imp o ing he abili y o sc een and iden i y
a ailable sou ces o esilience; and (i ) de eloping new b eeding echniques (Janni e al.
2020).
Much o he genomic in o ma ion is p o ided by sequencing, highligh ing he
p esence o millions o Single nucleo ide polymo phisms (SNPs), bu esequencing o di e se
ge mplasm (including wild species) also con ibu es. The SNPs a e he mos common o m
o DNA sequence a ia ion be ween alleles, in se e al plan species. The disco e y and
applica ion o SNPs inc eased ou knowledge abou gene ic di e si y and p o ided a be e
unde s anding on c op imp o emen (Mo gil e al. 2020).
Mode n b eeding selec ion me hods ha e been based on imp o emen o eli e lines
which ha e a na ow gene ic base; his limi s he gene ic pool which b eede s can exploi o
he p oduc ion o new a ie ies eady o ace he p edic ed clima e changes o adap a ion o
new cul i a ion a eas (Pignone e al. 2015).
Ge mplasm esou ces could help mi iga e he e ec s o clima e change on ag icul u al
p oduc ion (B anla d e al. 2020).
He e, we explo ed he na u al gene ic di e si y wi hin he sHsp26 gene amily in a
collec ion o du um whea geno ypes, mainly land aces, o iden i y no el sou ces o gene ic
di e si y o b eeding. The du um whea ge mplasm collec ion was de eloped by Pignone e
al, in 2015 in CNR o and consis s o 452 geno ypes o igina ed in abou 40 di e en wo ld
coun ies. (Pignone e al. 2015). F om his collec ion, 33 geno ypes we e chosen o hei
29
po en ial abio ic s ess ole ance ai s (Danzi e al. 2019; 2022) and quali ies (Janni e al.
2018).
P e ious wo ks ha e epo ed he success in exploi ing na u al di e si y o disco e no el
use ul ai s and QTL o abio ic s ess ole ance mainly d ough .
Allele mining app oach was used o ind SNPs in he sHsp26 gene. Allele mining is
use ul o iden i ying nucleo ide a ia ion in a genomic egion (candida e gene) associa ed
wi h pheno ypic a ia ion o a ai . In his way, he equency, ype and ex en o he
occu ence o new haplo ypes and he esul ing pheno ypic a ia ions can be assessed (
Kuma e al. 2010).
1.5.2 TILLING and EcoTILLING
To mee he demand o inc eased p oduc ion o ood c ops i is necessa y o in oduce
new selec ion s a egies ha accele a e he de elopmen o plan s ha a e adap ed o he
changing en i onmen . The use o induced mu a ions, combined wi h mode n genomics ools,
is an e ec i e s a egy o iden i y and manipula e genes o c op imp o emen . The high-
h oughpu TILLING (Ta ge ing Induced Local Lesions IN Genomes) me hodology iden i ies
mu a ions in mu agenized popula ions, while EcoTILLING iden i ies SNPs wi hin a na u al
popula ion and associa es hese a ia ions wi h ai s o b eeding in e es . The main ad an age
o hese echniques as a " e e se gene ics" s a egy is ha hey can be applied o any species,
ega dless o genome size and ploidy le el (Ba kley and Wang 2008).
Ge mplasm collec ions can be use ul esou ces o esea che s o TILLING and
EcoTILLING expe imen s, p o iding so much gene ic in o ma ion and/o o acqui e he
ma e ial needed o a s udy. On he o he hand, TILLING could be applied in
associa ion/collabo a ion wi h ge mplasm eposi o ies o de elop mu an lines ha ha e
ad an ageous cha ac e is ics o b eede s ( Wang e al. 2017).
P e ious wo k epo ed he e icacy o TILLING and ECOTILLING in p oducing and
selec ing no el ma e ial o he upcoming needs o whea b eeding (Ses ili e al. 2010; Chen
e al. 2012; Comas i e al. 2018; I shad e al. 2020).
1.5.3 Pheno yping
Plan s espond o abio ic s esso s in a dynamic and complica ed manne , bo h
e e sibly and i e e sibly. Plan abio ic eac ions ha e been s udied physiologically,
30
biochemically, cellula ly, and molecula ly, e ealing in ica e cellula esponses o abio ic
s esso s. Howe e , pheno yping emains a co ne s one o plan b eeding. Despi e ad ances
in gene ics and he applica ion o molecula echnologies in c op esea ch (Reynolds e al.
2020), c op b eeding s ill elies hea ily on he exp ession o g ain yield and a hand ul o
ag onomically impo an ai s o making selec ions and de ining comme cial p oduc s.
The pheno ype is he unc ional body o a plan , o med du ing plan g ow h and
de elopmen . I depends on he dynamic in e ac ion be ween he gene ic backg ound and he
physical wo ld in which he plan de elops. These in e ac ions de e mine plan pe o mance
and p oduc i i y measu ed as accumula ed biomass and comme cial yield and esou ce use
e iciency (Wa e al. 2020).
The e m "pheno yping" e e s o he applica ion o me hodologies and p o ocols o
measu e a speci ic ai ela ed o plan s uc u e o unc ion, wi h ai s anging om he cell
le el o he whole plan le el (Ca alho e al. 2021). In ecen decades, pheno yping has
de eloped as an essen ial ool o cha ac e izing an eno mous amoun o plan p ocesses,
unc ions, and s uc u es, mos ly by non-des uc i e image-based op ical analysis o plan
ai s. The e o e, plan pheno yping has s a ed o become a ool applicable o plan scien is s
o unde s and plan -en i onmen in e ac ion and o plan b eede s o selec desi able
geno ypes o hei speci ic ield o in e es , such as ole ance o abio ic s esses (Wa e al.
2020).
Technological imp o emen in he las decades in plan pheno yping has allowed he
in oduc ion o new non-in asi e ools, ensu ing a apid and ai h ul s uc u al pa ame e s’
ex ac ion (Zhang e al. 2016). In his con ex , c op pheno yping pla o ms a e conside ed a
alid solu ion (Chawade e al. 2016). Pheno yping pla o m-based app oaches enable high-
h oughpu , au oma ed and simul aneous mul iple-plan sc eening, esul ing in sa ing
p ocessing ime and imp o ed accu acy in he analysis o plan ai s (Acha jee e al. 2018).
Au oma ed pla o ms ha e been designed mainly o plan pheno yping in g ow h
chambe s o g eenhouses and combine obo ics, emo e senso s and da a analysis sys ems.
The d awbacks o mos ime-consuming pheno yping me hods in e ms o h oughpu
and s anda diza ion ha e been o e come, in ecen yea s, using image-based da a collec ion (
A aus, Buchaillo , and Ke au e 2022). Remo e sensing echnologies (Figu e 11), wi h he
espec i e con olle s and da a logge s ha complemen he imaging sys ems, a e usually
assembled in o wha a e e med as pheno yping pla o ms ( A aus e al. 2018). The use o
31
hese pla o ms allows o a mo e e icien and accu a e pheno yping wi h s able e o ac oss
all geno ypes, whe he as single plan s o in mic o-plo s. Howe e , cu en ly many o hese
pla o ms a e cos ly and/o no applicable on a wide scale. The e o e, he e is a s ongly
exp essed need by he c op b eeding communi y o de elop bo h s a e-o - he-a and cos -
e ec i e, easy o use, and nons a iona y (High Th oughpu Pheno yping Pla o ms (HTFP).
Wi hin he hand-held ca ego y o pla o ms, sma phones a e becoming an al e na i e
since hey may ca y ou di e en image s (e.g., RGB and he mal), da a managemen
ac i i ies and geo- e e encing unc ions (A aus e al. 2018; Sanchez-B agado e al. 2020).
Fig 11. Di e en Ca ego ies o G ound and Ae ial Pheno yping Pla o ms. G ound le el: hese include
om Handheld senso s (in his case jus a pe son holding a mobile), o Phenopoles, Phenomobiles,
S a iona y Pla o ms. F om 10 o 100 m: Unmanned Ae ial Vehicles, as d ones o di e en sizes and
compac ness, ixed-wind d one. F om 100 o 4000 m Manned Ae ial Vehicles as ai planes o
helicop e s. In he nea u u e di e en ca ego ies o sa elli es (Nanosa elli e, Mic osa elli e and
Sa elli es) om 50 o 700 km. ( ep oduced om A aus, Buchaillo , and Ke au e 2022).
Iden i ying he key ai s o pheno yping may esul in con e gen app oaches and in
pa icula he gene ic ad ance in whea o a wide ange o en i onmen al condi ions, has
been associa ed wi h a highe s oma al conduc ance (Roche 2015) and highe inal biomass.
32
To his end emo e sensing echniques such as in a ed he mome y o he mog aphy may be
deployed as p oxies o highe anspi a ion (Impollonia e al. 2022). G ea e biomass is also
conside ed as a key a ge ai o selec ion unde hea s ess, since ha es index is eaching
heo e ical maximum, an inc ease in biomass becomes a a ge . The mos canonical way o
assess biomass is by using LiDAR (Ligh De ec ion and Ranging) moun ed in an ae ial
pla o m o in a “phenomobile” (Madec e al. 2017). Howe e s ill oday he mos common
way o assess g een biomass is h ough ege a ion indices, ei he mul ispec al o RGB-
de i ed, gi en he common pe cep ion hese app oaches being mo e a o dable and easie o
use han he LiDAR (Pa ignani and Ochsne 2015, Figu e 11).
Recen ly, a di e en class o senso , e e ed o as a “bio is o ,” has been shown o be
able o de ec , in i o and in eal ime, he changes in he composi ion o he plan sap in a
g owing oma o (Solanum lycope sicum L.) plan ( Coppedè e al. 2017; Janni e al. 2019) ,
wi hou in e e ing wi h plan unc ions. Bio is o is an o ganic elec ochemical based
ansis o (OECT) ealized on ex ile h ead (Coppedè e al. 2017) and enables measu ing he
changes in ion concen a ion in he plan sap.
The pionee ing applica ion o bio is o in dico yledonous plan species, such as
oma o, success ully allowed de ec ion o changes occu ing in he plan sap composi ion
ollowing he day/nigh ci cadian cycle (Coppedè e al. 2017), as well as ea ly de ec ion o
plan s ess condi ions unde d ough ( Janni e al. 2019; Finco e al. 2022) and saline s ess in
monoco s (Janni e al. 2021). The co ela ions among bio is o senso esponse, changes in
ela i e humidi y, and apo p essu e de ici ha e been ecen ly demons a ed, p oposing he
bio is o as a no el senso o imp o e wa e use e iciency (Vu o e al. 2019).

33
2. AIM OF THE PROJECT
Clima e change and he ise in empe a u e se e ely hampe c op g ow h and
de elopmen . Se e al physiological d awbacks a ec c op yields, also causing a modi ica ion
in cul i a ed a eas. A he same ime, ood p oduc ion mus double by 2050 o mee he
demand o he wo ld’s g owing popula ion and inno a i e s a egies a e needed o help
comba hunge , which al eady a ec s mo e han 1 billion people in he wo ld. Whea is one o
he majo ce eal c ops wo ldwide, p o iding 20% o he o al die a y calo ies and p o eins
wo ldwide. FAO has p ojec ed a 43% inc ease in global demand o ce eals, including whea ,
by 2050, mainly om de eloping coun ies. To add ess hese needs, he a ailabili y o new
gene ic ma e ials exploi able in b eeding p og ams is manda o y o achie e hese goals.
The exploi a ion o he hidden in he gene ic di e si y con ained in ge mplasm
collec ions can be a key s a egy o achie e his goal. Small Hsps ep esen a good a ge o
imp o e hea esilience due o hei s ong in ol emen in he hea s ess esponse in plan s
and in pa icula in whea .
He e, an inno a i e app oach, based on cos -e ec i e a ge ed esequencing coupled
wi h low-cos pheno yping echniques was applied o a se o du um whea land aces o assess
and exploi a possible gene ic a ia ion wi hin he sHsp26 gene amily as a sou ce o new
imp o ed hea esilience.
Plan s ha e been subjec ed o hea s ess a di e en de elopmen al s ages and we
associa ed he di e en haplo ypes o TdHsp26 wi h he di e en esponses o he mal s ess,
inc easing he knowledge on he ole o TdHsp26 in he esponse o he mal s ess.
34
3. MATERIAL AND METHODS
3.1 EcoTILLING and de ec ion o na u al a ia ion in TdHsp26-A1 and
TdHsp26-B1 in du um whea geno ypes
3.1.1 Plan ma e ial
This s udy was conduc ed on 33 du um whea geno ypes as a co e se o a single seed
descen (SSD) du um whea collec ion, de eloped by IBBR-CNR in Ba i (Pignone e al.
2015) and selec ed on he basis o a pheno yping selec ion (Danzi e al. 2019; 2022). In
addi ion, 5 comme cial a ie ies (S e o, Sa agolla, Cappelli, Colosseo and K onos) we e
included as e e ences in he expe imen s. A lis o he geno ypes and hei geog aphic o igin
is p o ided in Table 2.
35
Table 2. Lis o geno ypes and coun y o o igin used o he allele mining app oach.
SSD En y
O igin
35
Alge ia
44
Tunisia
64
Mo occo
69
Mo occo
92
USA-ND No h Dako a
99
E hiopia
109
I aq
112
I aq
116
I aq
122
USA-ND No h Dako a
135
Tu key
171
Pe u
178
F ance
195
Saudi A abia
244
E hiopia
253
Cyp us
269
I an
278
Bulga ia
322
Tu key
325
Sy ia
335
I aq
343
I an
397
C e e
409
G ece
415
C e e
416
G ece
441
C e e
451
I aq
459
USA
487
G ece
494
G ece
499
511
Libya
Colosseo
I aly
K onos
USA
Cappelli
I aly
Sa agolla
I aly
S e o
I aly
Plan s we e g own in a g ow h chambe ill seedlings s age (Zadoks 10) a 16°C wi h a
pho ope iod o 18/6 day/nigh . DNA was ex ac ed as desc ibed in he nex sec ion (3.1.2).
3.1.2 DNA ex ac ion and gene a ge ing
Genomic DNA was ex ac ed wi h he GenElu e™ Plan Genomic DNA Minip ep Ki
(Sigma-Ald ich) om lea es issues o du um whea geno ypes and analyzed h ough allele
36
mining app oach ha combines a ge ed en ichmen PCR wi h nex gene a ion sequencing as
desc ibed in (Bu agni 2019). Genomic egion co esponding o TdHsp26-A1 (LT220905) and
TdHsp26-B1 (LT220911) (1171 bp and 2575 bp espec i ely) we e ampli ied by PCR o
iden i y SNPs in he selec ed geno ypes lis ed in Table 2 (Comas i e al. 2018). All he DNA
o he SSD geno ypes was kindly p o ided by IBBR-CNR (Ba i, I aly).
TdHsp26-A1 and TdHsp26-B1 ( o al 3.74 kb Mb) we e a ge ed by PCR wi h 3
homeologous-speci ic p ime pai s (PPs), 1 o TdHsp26-A1 (PP1 F:5’-
TGTTGGGCCTCCTGATCG-3’; R: 5’-AGCCTCAGATGCAGGGTAC) and 2 o TdHsp26-
B1 (PP2 F:5’-CAATTGGTTCGCACAAACAC-3’; R:5’-CCCTCCAGGCACGGATG-3’ and
PP3 F:5’-GACACTCTCTCGTTTCAATTCTC-3’; R:5’-GTTATCAGCTTCTTCCGGG-3’).
PCR was pe o med in 25 μL inal olume, using TaqDNA Polyme ase (New England
BioLabs, Hi chin, UK), 10–20 ng empla e DNA, 0.2 μmol/L o each o wa d and e e se
p ime s, 0.2 mmol/L o each dNTPs, 1X S anda d Taq Bu e (New England BioLabs).
PCR ampli ica ion wi h PP-2 was pe o med wi h ouch-down PCR as ollows: 1)
ini ial dena u a ion a 95°C o 2 min 2) 10 cycles a 94 C o 25 s, annealing a 66°C o 30 s
wi h a d op -0.5°C/cycle, elonga ion a 72°C o 1 min 30 s, 3) 35 cycles o 94°C o 25 s,
annealing a 61°C o 45 s, elonga ion a 72°C o 1 min 30 s, 4) 1 cycle a 72°C o 10 min.
PCR ampli ica ions wi h PP1-1 and PP-3 we e pe o med as ollows: 1) ini ial
dena u a ion a 95°C o 2 min 2) 35 cycles a 95°C o 30 s, annealing a 60°C o 60 s,
elonga ion a 72°C o 2 min, 3) 1 cycle a 72°C o 10 min. PCR p oduc s we e checked on
TAE aga ose gel o ensu e speci ic ampli ica ion o he a ge ed egion.
PCR p oduc s we e sequenced wi h BigDye™ Te mina o 3.1 Cycle Sequencing Ki
(The mo ishe Scien i ic, Wal ham, MA) acco ding o he manu ac u e ins uc ions.
As desc ibed in (Bu agni e al. 2018) 3 PCR eac ion o all 38 geno ypes we e
pe o med in 96 wells and hen pooled in 4 ubes as ollows:
• pool1 (SSD35, SSD92, SSD122, SSD171, SSD253, SSD269, SSD416, SSD487. SSD
494 and c . K onos),
• pool2 (SSD44, SSD109, SSD178, SSD322, SSD343, SSD397, SSD415, SSD511, c .
Colosseo),
43
3.3 Pheno ypic analysis
The lis o he pheno ypic analyses is epo ed in he ollowing scheme (Fig. 15).
Fig 15. Pheno ypic ai s conside ed du ing he expe imen al phases in all de elopmen al s ages.
3.3.1 Mo phological analysis
In seedlings expe imen he leng h o C1W and S1W seedlings o he a ious
geno ypes was measu ed using ImageJ So wa e (a ailable a h p:// sb.in o.nih.go /ij/
accessed on 20 Sep embe 2021; de eloped by Wayne Rasband, Na ional Ins i u es o Heal h,
Be hesda, MD, USA) (Figu e 16). Th ee eplica ions o each condi ion we e conside ed.

44
Fig 16. Images o he seedlings one week a e s essing a) con ol b) s essed. The images we e
analyzed using ImageJ so wa e.
In he ille ing expe imen , he plan heigh , numbe o culms, numbe o lea es one
week pos s ess.
Lea a ea and canopy o 3 plan s o bo h con ol and s ess plan s we e eco ded
be o e he s ess, 48hPS and 1WPS. The lea a ea has been calcula ed manually using he
ollowing o mula Lea a ea = Leng h x wid h x 0.75 (Kuzmano ić e al. 2014; Ahmad e al.
2015); while canopy (%) was measu ed using CANOPEO app (Pa ignani e al. 2015).
In he an hesis expe imen , conside ing he p olonged s ess, mo phological ai s we e
sco ed in ille ing (Zadoks 31), s em elonga ion (Zadoks 54) and spiking (Zadoks 72)
p ecisely a 30 DAT, 42 DAT and a 50 DAT. The numbe o lea es was de ec ed only a e
30 and 42 DAT, his is because a he end o elonga ion he a angemen o lea es changes
wi h he dea h o some and he o ma ion o new ones, which implies a loss o linea i y ha
occu s in ea lie s ages ins ead. Plan Heigh , ille numbe and lea es numbe we e measu ed
in 12 di e en plan s, 3 plan s o each po o each line.
45
3.3.2 Biochemical analysis
In seedlings and ille ing, samples we e collec ed a imes: T0, 4hPS, 1hPR, C1W and
S1W and 8 eplica es we e sampled o seedlings and ou in ille ing o each geno ype: he
pools we e immedia ely ozen wi h liquid ni ogen.
In an hesis sampling was pe o med one week a e lowe ing (1WAF), in he mo ning
a lowe empe a u es and in he a e noon a highe empe a u es. Pools o 6 spikes and six
lea es we e made conside ing wo lea es and wo spikes om 3 plan s o he same line we e
sampled and immedia ely placed in liquid ni ogen.
Malondialdehyde (MDA) con en
The e ec o hea s ess on memb ane lipid pe oxida ion was e i ied by quan i ying
he MDA con en . To de e mine he concen a ion o malondialdehyde (MDA) he
Thioba bi u ic Acid (TBA) es was used ollowing he p o ocol epo ed in Sen hilkuma e
al (2021)(Sen hilkuma , Ama esan, and Sanka ana ayanan 2021). 50 mg o lea es g ounded
in liquid ni ogen, 1mL 0.1% (w/ ) ichlo oace ic acid (TCA) has been added o p ecipi a e
he p o eins. The homogenized samples we e cen i uged a 14,000 g o 15 min.
Subsequen ly, 250 µL o he supe na an was added o 1000 µL o 20% (w/ ) TCA con aining
0.67% (w/ ) TBA. The mix u e was boiled a 95°C o 30 min in a wa e ba h and quickly
cooled in an ice ba h o 10 min o s op he eac ion. The mix u e has been cen i uged a
10,000 pm o 5 min and he supe na an was collec ed. The abso bance was ead a 532 and
600 nm and calcula e he concen a ion o MDA-TBA concen a ion based on he Ɛ alue
using a Va ian Ca y 50 spec opho ome e . Whe e, Ɛ is he coe icien abso bance (1.55 mM -
1 cm -1). The amoun o malondialdehyde is exp essed as nmol mg−1 FW.
(𝑀𝐷𝐴𝑠𝑡𝑟𝑒𝑠𝑠𝑒𝑑 − 𝑀𝐷𝐴𝑐𝑜𝑛𝑡𝑟𝑜𝑙)
𝑀𝐷𝐴𝑐𝑜𝑛𝑡𝑟𝑜𝑙 ×100
De e mina ion o Hyd ogen pe oxide H2O2
The Hyd ogen pe oxide (H2O2) concen a ions we e de e mined, in ille ing
expe imen , ollowing Veliko a e al. (2008) (Veliko a, Fa es, and Lo e o 2008), wi h some
modi ica ions. Lea issues (50 mg) we e homogenized in an ice ba h wi h 1mL 0.1% (w/ )
ichlo oace ic acid (TCA) The homogena e was cen i uged a 12,000 g o 15 min a 4°C.
Then 250 µL o he supe na an was added o 250 µL 10 mmol/L po assium phospha e bu e
46
(pH 7.0) and 500 µL 1mol/L KI and he supe na an held o 20 min a oom empe a u e,
a e which he abso bance was ead a 390 nm using a Va ian Ca y 50 spec opho ome e .
H2O2 con en was de e mined using he ex inc ion coe icien 0.28 μM−1cm−1 (Dong e al.
2014). The amoun was exp essed as nmol mg−1 FW.
3.3.3 Physiological measu emen s
Pho osyn hesis: Pho osys em II (PSII) e iciency: F /Fm
To e alua e he e ec o high empe a u es on pho osys em II, F /Fm was measu ed
using Fluo Pen FP110, in he an hesis expe imen . One measu emen pe plan was made o
a o al o 9 measu emen s. The eading was aken a e 15 min o da kness. The analyses we e
done a day 42 DAT (nea lowe ing) and one week a e lowe ing (1WAF), which was
eco ded o each geno ype. Fo each day, measu emen s we e aken a wo di e en imes o
he day in he mo ning om 8 o 10:30 am and in he a e noon om 2 o 4:30 pm o assess
he e ec s o high empe a u es on he a ious pa ame e s analyzed.
T anspi a ion: S oma al Resis ance ( S) and s oma al conduc ance (gs)
S oma al esis ance exp essed (sec cm-1) and s oma al conduc ance (mmol m⁻² s⁻¹)
we e measu ed in he ille ing and he an hesis expe imen espec i ely by using AP4
po ome e (Del a-T De ices).
In ille ing s oma al esis ance was acqui ed a he ollowing ime poin s: T0 (be o e
s ess), 4hPS (4 hou s pos s ess), 48hPS (48 hou s pos s ess) and inally a e one week
pos s ess in C1W and S1W. Th ee lag lea es om h ee plan s pe plo we e measu ed o
s oma al esis ance, six eadings pe lea .
In an hesis gs was measu ed. The measu emen s we e done a day 42 DAT and 1WAF
a wo di e en imes o he day, in he mo ning om 8 o 10:30 am and in he a e noon om
2:00 pm o 4:30 pm o assess he e ec s o high empe a u es on he conduc ance.
Canopy empe a u e: In a ed Lea Tempe a u e (IR) and Canopy Dep ession Tempe a u e
(CTD)
The mal imaging was applied using an in a ed he mal came a FLIR E75 o de ec he
canopy empe a u e du ing he s ess. The came a esolu ion is 320 x 240 pixels, he mal
47
sensi i i y lowe han 0.03° C, emissi i y used was 0.99. h ee pic u es. 3 pho os pe plan
we e acqui ed o each analysis.
In ille ing he measu emen s we e aken a he ollowing ime poin s T0 (be o e
s ess), 4hPS (4 hou s pos s ess) C1W and S1W. Th ee pic u es o each plan we e acqui ed.
In an hesis he measu emen s we e done a day 42 DAT (nea lowe ing), and one
week a e lowe ing a wo di e en imes o he day, in he mo ning om 8 o 10:30 am
and in he a e noon om 2 o 4:30 pm o assess he e ec s o high empe a u es on he
conduc ance. Two essels pe geno ype we e conside ed, o a o al o 12 pho os pe
geno ype.
The he mal images we e analyzed using R so wa e (R Co e Team, 2022) and he
The m-image package (h ps://c an. -p ojec .o g/web/packages/The mimage/index.h ml).
To segmen ege a ion om he backg ound, pu e ege a ion pixels we e classi ied by
applying a k-means clus e ing algo i hm on he mal images. The a e age canopy empe a u e
o each plan was ex ac ed om pu e ege a ion pixels. An example o a he mal image
clus e ing du ing he expe imen is shown in Figu e 17.
Once lea empe a u e was known, we calcula ed canopy he mal dep ession (CTD),
de ined as he di e ence be ween plan canopy empe a u e and ambien empe a u e, has
been ecognized as key ai o e alua e/compa e he esponse o geno ypes o low wa e use,
high empe a u es and o he en i onmen al s esses.
48
Fig 17. a) RGB image, b) he mal image acqui ed wi h he he mal came a FLIR 075, c) he mal
image wi h g adua ed scale, d) image clus e ed by he k-means algo i hm o plan segmen a ion.
Rela i e Wa e Con en (RWC)
The RWC con en was measu ed in lea es ollowing he p o ocol epo ed in Celik,
(Çelik, Ayan, and A ak 2017). Th ee lea es we e andomly collec ed o de e mine ela i e
wa e con en s wi hin each g oup. A e measu ing he esh weigh s (FW), lea es we e
placed in o he dis illed wa e o 12h in o de o ob ain u gid weigh . (DW) Following he
u gid weigh (TW) measu emen , lea es we e hea ed in a d y hea incuba o o 24h (80°C)
o ob ain d y weigh s. Rela i e wa e con en s (RWC) we e calcula ed acco ding o he
o mula as epo ed by Sma (Sma and Bingham 1974):
𝑅𝑊𝐶 = (𝐹𝑊 −𝐷𝑊)
(𝑇𝑊 −𝐷𝑊)∗100
3.3.4 Yield ai s
In he ille ing expe imen , he i s spike o con ol and s essed plan s o each
geno ype was analyzed o he:

49
- numbe o seeds pe spike.
- Ke nel Yields Pe Spike (KYPS), consis s o weighing he seeds ob ained om each
ea , he weigh is exp essed in g ams.
In an hesis we e measu ed:
- Spike Leng h (SL), o all spikes om he main culm, was measu ed om he base o
he achis o he ip o he e minal spikele , excluding he awns;
- G ain Yield pe plan , consis s o weighing he seeds ob ained om each plan , he
weigh is exp essed in g ams;
- numbe o seeds pe plan ;
- numbe o spikele s o all spikes a ising om he main culm.
3.3.5 S ess indices
To calcula e common s ess ole ance and suscep ibili y indices o a ious c op ai s,
he iPASTIC (The Plan Abio ic S ess Index Calcula o ) so wa e (Pou -Aboughada eh e al.
2019) was used. The indices acqui ed h ough iPASTIC a e he ollowing: ole ance index
(TOL), ela i e s ess index (RSI), mean p oduc i i y (MP), ha monic mean (HM), yield
s abili y index (YSI), geome ic mean p oduc i i y (GMP), s ess suscep ibili y index (SSI),
s ess ole ance index (STI) and yield index (YI). The p og am es ima es an A e age Sum
Ranks (ASR) o all indices o selec po en ially supe io geno ypes; he lowe is he ASR
alue, mo e ole an is he geno ype. The g ain yield pe plan , exp essed as he numbe o
seeds pe plan , was used o un iPASTIC was he yield o s essed and no s essed plan s o
each geno ype.
3.4 TdHsp26-A1 and TdHsp26-B1 gene exp ession
3.4.1 Sample collec ion
Fo he sho - e m s ess in seedlings and ille ing, lea ma e ial o gene exp ession
analysis was collec ed a imes T0, 4hPS and 1hPR.
Fo long- e m s ess, sampling, again o lea ma e ial, was done one week a e
lowe ing. The lowe ing ime o each geno ype was moni o ed, and sampling in a ge days.
Se en days pos he an he s emission, wo samplings we e done, one ea ly in he mo ning and
he second in he a e noon wi h he highes empe a u es.
50
3.4.2 RNA ex ac ion and cDNA e o ansc ip ion
Fo all expe imen s, RNA was ex ac ed wi h RNeasy Plan Mini Ki (Qiagen, Hilden,
Ge many) om all samples, and isualized on aga ose gel (1,2% aga ose w/ , 1X TAE
bu e , GelRed™ as Nucleic Acid gel s ain) o assess i s in eg i y.
Fo each condi ion, 1 μg o o al RNA samples ex ac ed om 100 mg o ozen issue
we e e o- ansc ibed in o cDNA wi h Quan iTec Re e se T ansc ip ion Ki (Qiagen)
acco ding o he manu ac u e ins uc ions.
3.4.3 Quan i a i e Real Time PCR (q PCR)
Real Time (RT) qPCR analysis was pe o med using CFX96 Touch Real-Time PCR
De ec ion Sys em (Bio ad). PCR eac ions we e se up in 10μL con aining 1μL o 1:10
dilu ion o cDNA, 0.25 nmol/L o gene-copy speci ic o wa d and e e se p ime s (Table 4)
A1-PT31F/A1-PT31R, B1-PT10F/B1-PT10R (Comas i e al. 2018). TdACT gene
(AB181991) was used as housekeeping.
Table 4. Lis o p ime s used o he Real ime qPCR
Ta ge
P ime
Fo wa d
P ime
Re e se
Fo wa d 5’ – 3’
Re e se 5’ – 3’
Amplicon
size (bp)
TdHsp26-A1
A1–
PT31F
A1–
PT31R
CCAGGCCCAGAACGCT
CCTCCTTcTCGTCCTCCATa
338
TdHsp26-B1
B1-PT10F
B1-PT10R
CGATGCGGCAGATGCTT
TGACGAGCGCGTCGC
211
TdACT
ACT-Fw
ACT-Re
CTTGTATGCCAGCGGTCG
AA
TGAGGAAGCGTGTATCCCTC
G
96-173
Fo he samples collec ed in seedlings and an hesis, we calcula ed exp ession le el
changes by ΔΔCT. S a ing om we ΔCT as CT a ge gene - ΔCTin e nal s anda d; ΔΔCT was
calcula ed as CT ea men - CTcon ol. Fo seedlings he CTcon ol is he sampling a T0, while o
he an hesis expe imen he CTcon ol is he sampling done in he mo ning S1W a e lowe ing.
Gene exp ession was conside ed ele an when old-change was g ea e han 2 (FC ≥ 2).
In he samples collec ed in he ille ing expe imen we applied semiquan i a i e RT-
PCR o Hsp26 gene exp ession. The amplicons we e loaded on a 1.2% aga ose gel. The
51
bands we e analyzed by ImageJ so wa e and no malized o he band o he housekeeping
genes.
3.5. Da a analysis
Fo he expe imen in seedlings: S uden -Tes was applied o analyze he di e ence
o plan heigh and o he analysis o da a inhe en o gene exp ession.
Fo da a analysis on MDA con en , ANOVA es wi h p- alue <0.05 was used using Pas 4.03
so wa e, he nex pos hoc used was Tukey's es .
In he ille ing expe imen : Lea A ea, numbe culms, Plan heigh , s oma al
esis ance, CTD and gene exp ession analysis we e analyzed by S uden -Tes .
In a ed Lea Tempe a u e, a e age sum o anks, H2O2 and MDA we e analyzed by ANOVA
es wi h p- alue <0.05 using Pas 4.03 so wa e, he nex pos hoc used was Tukey's es .
P incipal componen analysis (PCA) was pe o med using he R s a is ical so wa e e sion
4.2.1.
In An hesis expe imen : mo phological da a and gene exp ession da a we e analyzed
by ANOVA es wi h p- alue<0.05 using Pas 4.03 so wa e he nex pos hoc used was
Tukey's es . CTD, IR, MDA we e analyzed wi h S uden -Tes .
Co ela ion analysis was done by was pe o med using he R s a is ical so wa e e sion 4.2.1.
52
4. RESULTS AND DISCUSSION
4.1 Ma e ials and App oaches used o disco e no el na u al a iabili y o
inc ease hea s ess esilience
In 2018 Comas i and cowo ke s isola ed and cha ac e ized ou membe s o he
chlo oplas -localized small hea shock p o eins (sHSP) encoded by he sHsp26 gene amily. A
TILLING app oach in i o and in silico was used o iden i y no el alleles wi hin his amily.
The choice o he a ge genes used in his wo k was based on he known p o ec i e ole
played by sHSPs such as HSP26 o e pho osyn hesis and he syn hesis and
compa men aliza ion o key me aboli es in plan s challenged by high empe a u e s ess
(Maes i e al. 2002; Chauhan e al. 2012; Khu ana, Chauhan, and Khu ana 2013). The
TdHsp26 amily in du um whea was composed o ou unc ional genes, h ee mapping o he
4A ch omosome and one o he 4B genome homoeologue. TdHsp26 genes we e di e en ly
egula ed upon di ec hea s ess and especially a e acclima ion. TdHsp26-A1 showed he
highes up egula ion ollowing di ec hea s ess and TdHsp26-B1 he highes one when he
hea s ess was imposed a e acclima ion (Comas i e al., 2018).
The in i o ansc ip omic analysis was ex ended o o he issues and o s ess
condi ions by que ying he in silico ExpVIP da abase. Fo ins ance, TdHsp26 genes we e
s ongly up- egula ed by high empe a u e bu e en mo e by a combina ion o high
empe a u e and d ough , sugges ing a ole o sHSPs in bo h s ess esponses(Al-Whaibi
2011; Rampino e al. 2012; Khu ana, Chauhan, and Khu ana 2013).
Based on hese esul s and conside ing he s ong in ol emen o TdHsp26-A1 and
TdHsp26-B1 genes in egula ing he hea s ess esponse, in his hesis, we exploi ed he
na u al a ia ion ep esen ed in he du um whea ge mplasm collec ion, a ge ing TdHsp26-A1
and -B1 genes by using an EcoTILLING app oach o disco e no el sou ces o a iabili y o
inc ease he hea ole ance in du um whea .
59
Table 8. SNPs iden i ied in he p omo e egion and hei e ec s on he egula o y elemen s and unc ion. The SSD geno ypes ca ying he mu a ion in
he p omo e egion a e lis ed.
PROMOTER ANALYSIS
SNP IN TDHSP26-B1
Re e ence
sequence
Mu an sequence
E ec s on
P omo e
Role
Re e ence
SSD
SNP2
CAGGCA
CATGCA
Fo ma ion o
RYREPEATBNN
Requi ed o seed
speci ic exp ession
Ezcu a e
al., 2000
253
SNP4
GAAAAT
AAAAAT
Loss o
GT1CONSENSUS
Consensus GT-1 binding
si e in many ligh -
egula ed genes
Villain e al.,
1996
397,69
SNP6
GTGA
GTGG
Loss o
GTGANTG10
P ima y me abolism:
issue (la e pollen)
Roge s e al.,
2021
All geno ypes
excep o 322, 415
SNP25
CAAACTCG
CACACTCG
o ma ion o
DPBFCORED
plan male ep oduc i e
issue speci ic.
Ramkuma e
al., 2015
244

60
The e ec o mu a ions on he p o ein unc ion was also e i ied in silico h ough
SIFT so wa e (Ng and Heniko 2003).
I e u ns a numbe anging om 0 o 1 and is linked o he possible damage o he
p o ein unc ion. Amino acid subs i u ion is ha m ul when he sco e is < 0.05 and ole a ed i
he sco e is > 0.05. Wi hin he SNPs e ie ed, none o hose caused dele e ious mu a ions o
he p o ein unc ion, bu di e en alues we e assigned o he SNPs.
O g ea in e es a e SNP5 ound in exon I and SNP8 in exon II, bo h loca ed in
TdHsp26-A1, o he SNP o in e es is in exon II o he TdHsp26-B1gene, all SNPs cause
missense mu a ion (Table 9). O high in e es he SNP8 causing G196D subs i u ion in he α-
c ys allin domain, which is cha ac e ized by wo highly conse ed egions, (Bondino, Valle,
and en Ha e 2012), hus he p esence o a SNP in his egion sugges s a possible dele e ious
e ec on he p o ein unc ion.
SNP59 had he lowes ole ance alue 0.10 ollowed by SNP5 which was assigned a
alue o 0.23, while SNP8 despi e being in he α-c ys allin domain is he one he so wa e
assigned alue 1, hus ole able.
Table 9. Lis o SNPs in exons analyzed wi h SIFT
EXONS ANALYSIS
Gene
Mu a ion ype
E ec
Sco e Si
SSD
TDHSP26-A1
SNP5 MISSENSE
E73Q
0,23
64,69,92,112,116,122,135,171, 195,
253, 322, 325, 409, 415,441,
459,494,499
TDHSP26-A1
SNP8 MISSENSE
G196D
1
64,69,92,112,116, 122, 135, 171,
195,322, 325, 415, 451, 459, 499
TDHSP26-B1
SNP59 MISSENSE
M97V
0,10
112
Some o he analyzed geno ypes possess many o he lis ed mu a ions: SSD69 shows
SNPs 5,8 o TdHsp26-A1 gene, he SNPs 4,6 o TdHsp26-B1; SSD253 has SNPs 2,5 in
TdHsp26-A1 and SNP6 in TdHsp26-B1; SSD112 has SNP5,8 in TdHsp26-A1 and SNP6, 59 in
TdHsp26-B1.
61
The hypo hesis o a possible co ela ion be ween haplo ype combina ion in he
TdsHSp26 genes and he di e en pheno ypes in esponse o hea s ess, was o mula ed.
4.3 Does he gene ic a ia ion iden i ied in TdHsp26 sequence impac on he
hea s ess esponse?
4.3.1 Hea s ess esponse in seedling s age
Mo phological ai s
Plan heigh a e one week pos s ess was pe o med. Th ee di e en ends we e
obse ed SSD44, SSD64, SSD69, SSD109, SSD116, SSD171, SSD253, SSD278, SSD441,
SSD451, SSD487, SSD511 and K onos showed sho e plan s espec he con ol, indica ing a
s onge e ec o he hea s ess; SSD35, SSD92, SSD99, SSD112, SSD122, SSD244,
SSD269, SSD397, SSD409, SSD459, SSD494 and S e o show no di e ence be ween
s essed and con ol; SSD178, SSD195, SSD335, SSD415 and SSD322 showed highe
s essed plan s han con ols (Figu e 19).
62
Fig 19. Plan heigh (cm). S uden ’s - es was applied o each con ol and s essed sample *P<0.05; **P <0.01; ***P <0.001
63
MDA con en
The Malondialdehyde (MDA) con en was assessed in he selec ed lines being one o
he main b eakdown p oduc s o polyunsa u a ed a y acids in cell memb anes and as a good
p oxy o oxida i e s ess in plan s subjec ed o hea s ess condi ions (Figu e 20). Seedlings o
all geno ypes we e analyzed o he MDA con en . The MDA end showed an unusual
beha io in whea plan s exposed o hea s ess ha no mally inc eased du ing and unde he
s ess. He e, in se e al geno ypes: SSD35, SSD441, SSD451 and K onos showed a g adual
educ ion in MDA om T0 o 1hPR while all o he geno ypes showed a s ong and apid
dec ease a e 4h o hea s ess and a signi ican inc ease al eady a e one hou pos eco e y.
Con e sely, signi ican inc ease, consis en wi h he li e a u e, in he MDA was obse ed in
SSD 64 and SSD397 which espec i ely ha e an inc ease o 133,4% and 169,75%. SSD69
showed a limi ed and no signi ican inc ease in MDA con en a 1hPR o 11,59%, in
compa ison wi h T0.
64
Fig 20. Plo o MDA con en (nmol/FW(g)) in seedlings a e hea s ess exposu e. SE is included. The di e en alphabe ical le e s in supe sc ip
indica e he signi ican di e ences wi h he ANOVA es , p- alue < 0.05.

65
To be e e alua e he beha io o he MDA end, he MDA a io was calcula ed
(Table 10).
SSD92, SSD 112, SSD178, SSD253, SSD325, SSD335, SSD494 showed a signi ican
a ia ion in MDA con en wi h a consis en accumula ion o MDA a 1hPR (Table 10).
SSD35 showed a s ong a ia ion in MDA du ing he phases o hea s ess wi h almos a ull
eco e y a e one
week. K onos showed a p og essi e dec ease in MDA eaching he maximum a S1W, while
SSD69 and S e o, in e es ingly, showed no signi ican a ia ion in MDA immedia ely a e
he s ess and a e he eco e y (1hPR and S1W), suppo ing hei ole ance o hea s ess and
a possible ole link wi h he MDA a ia ion (Table 10).
Table 10. MDA a io calcula ed as con ol/s ess.
SSD
%T0/4HPS
%T0/1HPR
%C1W/S1W
35
-19.86%
-75.02%
9%
64
-23.22%
-14.54%
133.4%
69
-18.43%
-2.30%
11.59%
92
1.02%
49.28%
144.03%
112
-15.47%
10.66%
9.15%
178
-26.80%
7.47%
-0.31%
195
-44.73%
-31.14%
7.93%
244
-82.33%
-50.53%
2.67%
253
-5.22%
78.36%
-27.38%
335
0.23%
23.78%
-60.53%
397
-28.85%
-10.43%
169.75%
415
-76.86%
-60.27%
1.56%
441
-35.31%
-59.95%.
28.28%
451
-5.59%
-15.88%
26.26%
494
-1.12%
22.85%
38.02%
SVEVO
-38.52%
-6.95%
36.72%
KRONOS
-25.24%
-34.47%
25.30%
66
TdHsp26-A1 and -B1 gene exp ession du ing hea s ess in seedlings s age
Based on he esul s o plan heigh and MDA con en oge he wi h he haplo ype and
SNPs posi ion in he gene, SSD397 and SSD69 we e chosen o TdHsp26-A1 and -B1 gene
exp ession analysis.
Bo h TdHsp26-A1 and TdHsp26-B1 genes we e signi ican ly up egula ed in SSD69
ollowing hea s ess wi h a ange om 10.62 old a 4hPR o 6.62 old a 1hPR o TdHsp26-
A1 and om 9.32 old a 4hPR o 5.61 a 1hPR o TdHsp26-B1 (Figu e 21). SSD397 showed
a ema kable lowe gene exp ession o bo h genes. TdHsp26-A1 gene exp ession d ops om
4hPR o 1hPR om 2.84 o 1.2 old change. TdHsp26B1 was om 2.62 o -0.28 olds om
4hPS o 1hPR. Bo h lines show a highe exp ession o he TdHsp26-A1 gene han he
TdHsp26-B1 gene, in acco dance wi h wha was p e iously epo ed (Comas i e al. 2018).
Fig 21. Exp ession analysis o TdHsp26-A1 and TdHsp26-B1 in SSD69 and SSD397 geno ypes. The
induc ion le els a e measu ed as he old change (RQ) o he ea ed samples in espec o he con ols
and epo ed as log2(RQ) in he cha . Ba s indica e he s anda d e o . S uden ’s - es was applied
be ween 4hPS and 1hPR o each g oup. ***p <0.001.
Summa izing, in his i s expe imen , he e ec o sho (4h) hea s ess (38°C) on
plan s mo phologically (plan heigh ) and biochemically (MDA con en ) was e i ied, and
om he da a ob ained, wo geno ypes wi h con as ing pheno ypes o gene exp ession
analysis o TdHsp26-A1 and -B1 we e selec ed.
67
4.3.2 The hea s ess esponse in ille ing s age
Based on he esul s ob ained in seedlings s age and he posi ion o SNPs in he gene
o in e es 7 geno ypes, co esponding o 5 haplo ypes we e chosen o applying he hea
s ess in ille ing s age (Table 7). Two con as ing cul i a s, S e o and K onos, we e also
included as e e ence a ie ies.
4.3.2.1 Mo phological ai s
To pe o m he mo phological analysis, he lea es a ea was measu ed a 48hPS and
a e 1 week pos s ess since 4hPS i was no possible o de ec any mo phological di e ence,
while he numbe o culms and plan heigh we e measu ed 1 week pos s ess (Figu e 22).
Signi ican di e ences a e obse ed in lea a ea be ween s essed and con ols a S1W in
SSD415 and be ween C48h/S48 and C1W/S1W in K onos, wi h a educ ion in a ea in
s essed compa ed wi h con ols (Figu e 22a).
A S1W s essed SSD244 and SSD397 showed a signi ican educ ion (P< 0,05 and
P< 0,01) in plan heigh (Figu e 22c). A S1W K onos showed a educed numbe o culms,
while all o he geno ypes do no show any signi ican a ia ion in he numbe o culms
be ween s essed and con ol plan s (Figu e 22b).
Fig 22. Mo phological ai s analyzed in he ille ing expe imen a) Lea A ea, b) numbe culms, c)
Plan heigh . S uden ’s - es was applied. E o ba s a e epo ed and ep esen he s anda d e o . *P
<0.05, **P <0.01, ***P <0.001.
68
4.3.2.2 Physiological ai s
Plan anspi a ion
The s oma al esis ance ( s, sec x cm-1), is an e icien ai o es ima e he gas
exchange such as CO2 abso p ion ho oughly o he lea es and wa e loss wi h anspi a ion
depending on s oma a po e.
Unde hea s ess he s oma al esis ance is educed unde hea s ess. A 4hPS unde
hea s ess all geno ypes showed a educ ion in s oma al esis ance indica i e o inc eased
conduc ance (Figu e 23a), a 48hPS all geno ypes show esis ance equal o ha o he con ol
plan s, excep o SSD397, which s ill showed a educ ion in s oma al esis ance (Figu e 23b).
A S1W bo h geno ype 397 and S e o ha e lowe esis ance in he s essed plan s
han in he con ol (Figu e 23c)
75
Fig 29. Plo o he co ela ion o he numbe o seeds and he ke nel yield pe spike (g).
4.3.3 SSD lines cha ac e iza ion o hea s ess esilience
A p incipal componen s analysis (PCA) was pe o med o de e mine he mos
con ibu i e ag o-mo phological ai s explaining he di e ence encoun e ed in hea esilience
be ween lines. All a iables and s ages collec ed be o e s ess and a e 4h a 38°C and S1W
we e conside ed in he analysis (Figu e 30). The i s wo p incipal componen s explained
57.7% o he o al a ia ion.
In 4hPS con ols and s essed geno ypes a e co ec ly clus e ed in wo sepa a e g oups
highligh ing he e ec o he imposed hea ea men , bu in S1W, a di e en clus e iza ion
was obse ed. While con ol and s essed samples o SSD69 and SSD178 clus e ed eally
close o each o he suppo ing a possible hea ole ance o his geno ype, line SSD397 a e
sepa a e in he plo sugges ing a highe suscep ibili y. Mo eo e , RWC, SR and CTD a e
highly co ela ed a 4hPS, while mo phological ai s such as canopy and lea a ea a e shown
o be s ongly co ela ed (Figu e 30).
The clus e o mo phological ai s (numbe o culms, lea a ea, plan heigh and
numbe o lea es) sepa a ed by he physiological ai s (SR, in a ed empe a u e) a S1W,
u he suppo he alidi y o he pheno yping me hods applied o cha ac e ize he whea
s ess esilience in du um whea geno ypes (Figu e 30).
In bo h PCA plo s, in a ed empe a u e and CTD a e in e sely co ela ed as expec ed,
u he alida ing he app oach used (Figu e 30).

76
Fig 30. P incipal componen analysis (PCA) o he e ec o hea ea men in 7 SSD geno ypes. a) Biplo a 4hPS; b) Biplo S1W. RWC, Rela i e Wa e
Con en , CTD, Canopy Tempe a u e Dep ession, In a ed Lea Tempe a u e, SR, S oma al Resis ance, canopy, lea a ea, plan heigh , numbe culms,
numbe lea es (indi idual da a can be iewed in he Supplemen a y Figu e1).
77
4.3.4 Discussion on he hea s ess esponse o du um whea lines in seedling and ille ing
s age
Two main objec i es we e he a ge o he hea s ess expe imen pe o med in
ille ing s age: i) o cha ac e ize he pheno ype o he selec ed geno ypes unde hea s ess and
o e i y, whe he he e we e di e ences be ween seedlings and ille ing; ii) o iden i y ai s
ha could easily indica e whe he a geno ype is suscep ible o ole an o hea s ess.
Hea s ess in plan s is known o cause a educ ion in plan heigh (Hassan e al. 2020);
he e we iden i ied h ee di e en pheno ypes compa ing s essed and con ols: plan s wi h
dec ease heigh (41.93%), plan s highe han con ols (19.35%), and plan s showing no
signi ican di e ences unde s ess (38.71%).
Plan s exposed o hea s ess o en lead o he gene a ion o des uc i e ROS,
including single oxygen (1O2), supe oxide adical (O2−), hyd ogen pe oxide (H2O2), and
hyd oxyl adical (OH−) esponsible o gene a ing oxida i e s ess (Ma u ani e al. 2012;
Suzuki e al. 2012).
Oxida i e s ess no ably inc eased memb ane pe oxida ion and dec eased memb ane
he mo-s abili y in many plan s including whea (Sa icka and Šku e 2010) leading o he
accumula ion o MDA ha is conside ed a good indica o s o he damage o he cell
memb anes as epo ed in ice and maize (S. Kuma , Singh, and Nayya 2012) and so ghum
(Tan e al. 2011). In whea (Sa icka and Šku e 2010), inc eased MDA con en in all o gans o
whea seedlings was obse ed.
The exp ession o TdHsp26 seems o play a ole in he hea esponse educing MDA
accumula ion in seedlings o SSD69 indica ing a low oxida i e s ess damage. Be ween he
wo genes, TdHsp26-A1, showed a s ong inc ease in he ela i e exp ession a seedling s age
while lowe exp ession o TdHsp26-B1 a ian was obse ed. An hypo hesis o a link
be ween gene exp ession, MDA con en and hea ole ance was o mula ed. A sha p inc ease
o 100% in MDA was obse ed in SSD397 and a o al lack o exp ession o he TdHsp26-B1
gene. Con e sely, SSD69, showed no signi ican a ia ion in he MDA con en a 1 week a e
s ess (S1W) and a high exp ession o TdHsp26-B1.
In seedling, all lines showed a dec ease o MDA immedia ely a e he s ess (4hPS),
while a s ong inc ease was obse ed a S1W suppo ing he hypo hesis o Sa icka e al.
(2010). Con en ional beha io was obse ed in he ille ing s age o all lines excep o
SSD69 and S e o ha showed dec eased alues in MDA and H2O2 con en .
78
This led o hypo hesize a di ec ole o he exp ession in SSD du um whea gene ic
esou ces o TdHsp26-A1 and -B1 haplo ypes in leading a edox pe u ba ion in la e s age o
de elopmen as he ille ing s age ha was no obse ed in seedling s ages. This was
p e iously epo ed in ba ley (Ta a ima e al. 2022), whe e a lowe accumula ion o MDA
was obse ed and can play a c i ical ole in igge ing hea s ess signaling cascades and he
ansc ip ional e ec s o s ess ul high empe a u es ha e been shown o be a leas pa ially
media ed by ele a ed H2O2 le els.
In ille ing a educed H2O2 accumula ion and a co esponding educ ion in MDA
con en was obse ed in pu a i e hea ole an geno ype SSD69 while SSD397 showed
con en ional ends o H2O2 accumula ion and MDA con en a e hea s ess imposi ion.
Howe e , bo h genes we e o e exp essed in hea s ess condi ions.
This uncon en ional beha io o MDA and H2O2 sugges s a possible mechanism o
ac ion o he a ian s in TdHsp26.
MDA and H2O2 ai s a e con i med as good biochemical p oxy o hea s ess
ole ance oge he wi h he canopy empe a u e.
All oge he hese esul s sugges o SSD69 a educed oxida i e damage hus an
inc eased ole ance o hea s ess. SSD69 showed a se o pheno yping ai s suppo ing i s
inc eased hea ole ance.
A educed canopy empe a u e and inc eased CTD alues, suppo ha geno ypes wi h
highe CTD alues and a coole canopy empe a u e unde d ough s ess use mo e a ailable
soil mois u e o cool he canopy by anspi a ion ha ha e conc e e bene icial e ec s also on
hea ole ance. On he con a y, SSD397 showed highe alues o canopy empe a u e and
lowe CTD, suppo ing hei inabili y o p omo e he ac i a ion o he anspi a ion p ocess o
educe he e ec s o hea s ess. This was also demons a ed in he PCA (Figu e 30), whe e
CTD and canopy empe a u e ec o s a e in e sely co ela ed.
All oge he he esul s ob ained in seedlings and ille ing s ages unde sho e m
s ess allowed us o hypo hesize a possible link be ween he exp ession o TdHsp26-A1 and -
B1 a ian s and he cascade o physiological phenomena igge ed du ing he s ess (Figu e
31).
Howe e , he esul s ob ained we e no su icien o co ela e he pheno yping e ec s
obse ed wi h he speci ic SNPs. Only specula ions can be done in e ms o hea s ess
esponse wi h he geog aphical o igin o he wo geno ypes (Janni e al. 2018). SSD69
79
o igina ed in Mo occo while SSD397 o igina ed in C e e and showed di e en hea ole ance
oge he wi h di e en HMW glu enins composi ion (Janni e al. 2018).
Fig 31. Hypo hesize mechanism o he ole o TdHsp26 in he ROS cascade. Unde hea s ess, he
ROS and HSP cascade is ac i a ed. H+, hyd ogen molecule, adenosine diphospha e; ATP, adenosine
iphospha e; H2O, wa e ; ETC, elec on anspo chain; e-, elec on; Fd, e edoxin; PSII,
pho osys em II; O2, oxygen molecule; O2•−, supe oxide adical; SOD, supe oxide dismu ase; CAT,
ca alase; GPX, glu a hione pe oxidase; H2O2, hyd ogen pe oxide; (•-OH), hyd oxyl adical.
4.3.5 The hea s ess esponse a e p olonged hea s ess in an hesis phase
4.3.5.1 Mo phological ai s
To conc e ely demons a e he inc eased esilience o SSD69 and ole ance o SSD397
and o u he demons a e he e icacy o plan pheno yping in cha ac e izing hea s ess
esilience, hea s ess expe imen s we e pe o med in he an hesis phase. Two cul i a s we e
included as e e ence es s (Iu la o e al. 2016).
The g ow h s age a which hea s ess e en s occu has a signi ican impac on whea
g ain yield (Djanagui aman e al. 2020). E ec s o high empe a u e s ess du ing an hesis
and g ain illing pe iods on pho osyn hesis, lipids, and g ain yield in whea . A hea s ess a
32.0◦C educed yield pe plan by 29.0% and 44.0% a an hesis and du ing he g ain illing
pe iod, espec i ely. Due o he h ea o ood insecu i y, he e is a g owing impe a i e o
80
iden i y high-yielding whea cul i a s ha display esilience o he impac s o ising
empe a u es and main ain nu i ional and end-use quali y (Djanagui aman e al. 2020).
He e, a p olonged and ex emely se e e hea s ess was applied o mime he no mal
en i onmen al e en s occu ing in open ields in he inal s ages o whea de elopmen .
Based on p e ious esul s in seedling and ille ing he plan heigh and lea es numbe
we e sco ed (Figu e 32). The dynamic o plan g ow h was signi ican ly di e en be ween
lines (Figu e 33). SSD 69 and S e o showed a compa able end o de elopmen . A 25 DAT
SSD 69 and S e o showed a lowe plan canopy, plan heigh , educed numbe o lea es and
a sho e de elopmen cycle (Figu e 33b, d).
Yield ai s depend mainly on ille ing and lowe ing ime bo h a ec ing he numbe
o seeds and g ain yield (Table 11).
Fig 32. Plo s o mo phological ai s sco ed in he an hesis phase. a), d), g) plan heigh on days 30, 42,
50 DAT; b), e), h) he numbe s o culms on days 30, 42, 50 DAT; c), ) he numbe s o lea es 30 and
42 DAT. Values shown mean ± SE. The di e en alphabe ical le e s in supe sc ip indica e he
signi ican di e ences wi h he ANOVA es a a p- alue< 0.05.

81
Fig 33. G ow h and plan de elopmen s ages exp essed in Zadoks s ages o SSD397, SSD69, K onos
and S e o. DAT, Days a e T ansplan
13DAT
13DAT
30DAT 3
30DAT 34DAT 3
34DAT
42DAT
42DAT 5
50DAT
50DAT 5
S e o S e o
S e o
a)
b)
13DAT
13DAT
30DAT
30DAT 3
34DAT 3
34DAT
42DAT
42DAT
50DAT
50DAT
c)
d)
82
Table 11 Mo phological ai s and empe a u es eco ded in he an hesis expe imen .
K onos showed comple e ea eme gence a 34 DAT ollowed by S e o a 37 DAT,
SSD 69 a 42 DAT and SSD 397 a 48DAT.
In e ms o lowe ing ime SSD69 and S e o showed an ea lie lowe ing ime (48, 49
DAT). K onos showed a educed lowe ing ime o abou 2 days (46 DAT, Figu e 33a). SSD
397 showed a delay in lowe ing ime o abou 2 days (51 DAT, Figu e 33c, Table 11).
Mo eo e , SSD397 plan s showed a dense canopy, bigge numbe o lea es and
culms wi h a slowe g ow h dynamic. Fo example, plan g ow h (in e ms o heigh ) was
slow up o 42 DAT when i apidly inc eased om 36.42 ± 1.23 o 59.67 ± 1.44 a 50DAT
(Figu e 32). K onos had he as es de elopmen cycle and ma u a ion p ocess compa ed o
he o he lines.
K onos and S e o showed simila leng h o ime be ween ea eme gence and an hesis
(12 days) while SSD 397 showed he as es days o lowe ing (3days), SSD69 in e media e
leng h wi h 6 days (Tab. 11).
Fo SSD69 a s ayg een pheno ype unde hea s ess (Figu e 34) was hypo hesized. The
s ayg een pheno ype is an an agonis o senescence, chlo ophyll, and pho osyn he ic capaci y
o lea es we e main ained o p olonged, and is conside ed an indica o o hea ole ance
(Foka , Blum, and Nguyen 1998) and he plan con inues o p oduce ille s also when he i s
ea eaches ma u i y (Figu e 34). Compa ed wi h he s ayg een a ie ies, he yield and in e io
g ains o no-s ayg een cul i a we e much mo e in luenced by high- empe a u e s ess (Yang
e al. 2014).
83
Fig 34. S ayg een pheno ype in SSD69 (90 DAT, Z99,30 Augus 2022).
4.3.5.2 Physiological ai s
Unde hea s ess, he moni o ing o he egula ion o he anspi a ion mechanisms is
a possible s a egy o selec ing hea - ole an a ie ies. The s oma al conduc ance (gs) has
been eco ded.
Plan s unde high empe a u es cool hei canopies h ough anspi a ion, which occu s
h ough s oma a when soil wa e is a ailable. E icien ep oduc i e de elopmen equi es
highe gas exchanges, which occu h ough open s oma a, pu ing plan s in a cons an s uggle
o su i al agains ha sh en i onmen s (Huggins e al. 2018).
Highe gs is associa ed wi h be e pe o mance o ole an geno ypes unde s ess
condi ions (Saeidi and Abdoli 2015). Zhang and cowo ke s in hei s udy poin ed ou he
e ec s o di e en pe cen ages o ai humidi y on win e whea and ound ha hei mos
p oduc i e geno ypes had in common a s ong s oma al egula o y abili y in esponse o
changing ai humidi y (Zhang e al. 2020).
The plo shows he empe a u es eco ded du ing he measu emen s, acqui ed in wo di e en
days, mo ning and a e noon plo ed wi h he s oma al conduc ance (Figu e 35).
The highes empe a u es we e eco ded, as expec ed, du ing he a e noon.
SSD69 showed a educ ion in s oma al conduc ance be ween he i s wo poin s,
al hough he e is no a g ea a ia ion in empe a u e. The high conduc ance eco ded a 42
DAT is a ibu able o he high humidi y eco ded. Du ing hose su eys, he ela i e humidi y
84
was abou 48.3 %, he highes e e eco ded du ing ou analysis. Se e al s udies ha e shown
an inc eased s oma al conduc ance wi h inc eased humidi y (Zhang e al. 2020).
SSD69 and S e o showed i s ly a la ge a ia ion in he gs end and an inc ease in
co espondence o inc easing empe a u e, whe eas SSD397 and K onos showed opposi e
end in he s oma al conduc ance, suppo ing he occu ence o highe anspi a ion o
mi iga e he e ec s o inc eased empe a u e and allow o ensu e good yields and quali y.
Fig 35. S oma al conduc ance measu ed in he ou geno ypes unde in es iga ion. Measu emen s
we e made on wo di e en days (50 DAT and one week a e lowe ing speci ic o each SSD)
mo ning and a e noon; conduc ance was co ela ed wi h empe a u es eco ded a he ime o he
su ey. Values shown mean ± SE.
The analysis o he s oma al conduc ance in con as ing geno ypes (SSD69 and
SSD397) and a ie ies (S e o and K onos) shows ha he analysis o a physiological ai as
he a ia ion in gs is c i ical o ole a e he p olonged hea s ess.
The ole ance o SSD 69 and suscep ibili y o SSD 397 is u he suppo ed by he
analysis o key physiological p ocesses a ec ed by hea s ess in plan s.
The chlo ophyll luo escence pa ame e F /Fm e lec s he maximum quan um e iciency o
PSII pho ochemis y and has been widely used o ea ly s ess de ec ion in plan s (D. K.
Sha ma e al. 2015).
91
4.3.6 Discussion o he p olonged hea s ess esponse in an hesis phase
He e, he na u al en i onmen al summe condi ions, whe e he hea s ess is o en
p olonged du ing he en i e leng h o he du um whea de elopmen al s ages, was exploi ed in
po s mimicking he condi ions obse ed in he ield.
Plan s we e subjec ed o 90 days ( om ansplan o seed ma u i y) o a p olonged
hea s ess abo e 35°C we e eco ded o he en i e leng h o he expe imen .
The objec i e o his s udy was o i s ly iden i y he e ec o a p olonged hea s ess
du ing he en i e leng h o he plan g ow h cycle om seedling (Zadoks 10) o seed ma u i y
(Zadoks 99) on SSD geno ypes on yield componen s. Pho osyn hesis is he mos sensi i e
physiological e en leading o poo g ow h pe o mance in whea (Feng e al. 2014) as also
con i med in his expe imen . A majo e ec o hea s ess is he educ ion in pho osyn hesis
esul ing om dec eased plan heigh , impai ed pho osyn he ic machine y, educed
anspi a ion and educ ion in whea p oduc ion (Ash a and Ha is 2013; Ma hu , Ag awal,
and Jajoo 2014).
Hea s ess i s ly damages he complex phenomena o PSII and secondly, changes he
pho osyn he ic beha io . This is mani es ed when empe a u es exceeding 40°C dissocia e
he ligh ha es ing complex-II Chl a/b-p o eins om he PSII (Iwai e al. 2010). This was
cons an ly eached o he en i e leng h o he expe imen , mos ly in he a e noon. The index
F /Fm was app op ia e in selec ing mos e icien geno ypes in ou s udy, in ac , SSD69 and
S e o did no show a d op in F /Fm alues also in se e e hea s ess condi ions, suppo ing
ha highe F /Fm alues indica ed inc eased ole ance o hea s ess (Naga e al. 2015; Rong
Zhou e al. 2015; D. K. Sha ma e al. 2017).
P e ious s udy conduc ed by Sha ma e al. (2015), on T. aes i um used F /Fm as a
selec ion c i e ia o hea ole ance ( Sha ma e al. 2015).
CTD al hough epo ing low alues o SSD69 ha has been desc ibed as a s ayg een
pheno ype unde hea s ess as p e iously epo ed by (Kuma i e al. 2012), does no seem o
be highly e ec i e in he es en i onmen al condi ions o geno ype selec ion.
Plan s unde high empe a u es cool hei canopies h ough anspi a ion, which occu s
h ough s oma a when soil wa e is a ailable. E icien ep oduc i e de elopmen equi es
highe gas exchanges, which occu h ough open s oma a, pu ing plan s in a cons an s uggle
o su i al agains ha sh en i onmen s (Huggins e al. 2018). This has been alida ed also in
hese se e e condi ions, in ac , gs showed a good co ela ion wi h he empe a u e, highe in

92
he a e noon, sugges ing ha in p esence o hea s ess, an inc eased anspi a ion was
ope a ed o main ain plan unc ions.
Highe gs obse ed in he a e noon wi h almos 50°C was obse ed in SSD69 and can
be associa ed wi h be e pe o mance o ole an geno ypes unde s ess condi ions (Saeidi
and Abdoli 2015) leading o hypo hesize ha SSD69 and S e o had in common a s ong
s oma al egula o y abili y in esponse o inc easing empe a u es.
In ac , line SSD69 exhibi s la ge a ia ions in gs a ibu able o bo h empe a u e and
mois u e, and we obse e he same beha io in S e o. In lines SSD397 and K onos hey did
no show hese ai s, incen i izing he po en ial suscep ibili y o hese geno ypes.
Mille e al. 2009 ound ha hea s ess inc eased O2- p oduc ion in oo by 68% and
MDA con en in lea by 27% a he ea ly s ages, and 58% a he la e s age o seedling
de elopmen (Fe nie e al. 2022).
In e ms o yield, which a e he inal ai s o be conside ed, he abili y o SSD69 o
o e come he se e e hea s ess, despi e he slow and low o e all plan g ow h, was
con i med. SSD69 and S e o showed an inc eased es ima ed e ili y ha co esponds o an
inc eased g ain yield and numbe o seeds when compa ed wi h SSD397 ha p omo ed high
and as plan biomass g ow h bu a he end ailed in he ep oduc i e s age leading o low
yields and educed seed se .
The se e i y o g ain yield deple ion in whea c ops is highly dependen on he g ow h
s age a which hea s ess occu s.
Al hough all g ow h s ages a e suscep ible, hea s ess du ing he ep oduc i e phase
(an hesis and g ain illing) can pa icula ly hinde g ain de elopmen , causing ep oduc i e
s e ili y and signi ican educ ion in g ain numbe and yield (Fe nie e al. 2022).
SSD397 showed he mos delayed an hesis in compa ison wi h he o he geno ypes
es ed. This coupled wi h he ex emely high empe a u es eached ( min 21°C and max 58°C)
se e ely lowe ed g ain yield by educing g ain numbe pe plan as a consequence o a
ma ked lo e s e ili y (Kau and Behl 2010).
As obse ed in almos all lines, mo eo e , day/nigh high empe a u es o 31/20°C
may also cause sh inking o g ains esul ing om changing s uc u es o he aleu one laye
and cell endospe m, as esul ed in his expe imen (da a no shown) (Dias, Bagulho, and
Lidon 2008).
93
SSD69 showed, in ex emely se e e hea s ess condi ions, be e he mo ole ance han
SSD397 p obably because o i s inc eases in p e en ing p o ein deg ada ion and PSII epai ,
and oxida i e s ess esponse.
Based on he eal- ime esul s, a high di e ence be ween he wo geno ypes ha e been
obse ed. As S e o, known as ole an a ie y, SSD69 showed an highe exp ession o
TdHsp26-A1 wi h espec o TdHsp26-B1. SSD 397 ha showed a hea suscep ible pheno ype
unde hea s ess, showed no exp ession o TdHsp26-A1 bu good exp ession le els o
TdHsp26-B1. In SSD 69 he down egula ion o TdHsp26-B1 is linked wi h he dynamic
accumula ion o MDA in SSD 69 lea samples, leading o hypo hesize a co ela ion be ween
TdHSP26-A1 and he accumula ion o MDA unde hea s ess (Sec ion 4.3.5), and i s
in ol emen in he memb ane p o ec ion pa hway.
Based on hese esul s, in Figu e 42 we summa ized he o mula ed hypo hesis o
HSP26 in ol emen in he hea s ess esponse. Unde hea s ess condi ions, HSP26,
pa icipa e di ec ly and indi ec ly in he p o ec ion o PSII, he s oma a opening o main ain
high le els o anspi a ion and co esponding educ ion in empe a u e, and inally i is
in ol ed in p o ec ing he cell om ROS esul ing in he educ ion o MDA con en .
94
Fig 42. P oposed model o he in e ac ion be ween sHSP26 and a ious physiological componen s.
Red a ows mean dec ease, and g een a ows mean inc ease.
95
5. DISCUSSION AND CONCLUSIONS
Inc easing empe a u es and consequen changes in clima e ad e sely a ec plan
g ow h and de elopmen , esul ing in de as a ing loss o whea p oduc i i y. Inc eased global
mean empe a u es and equency o ex eme hea days pose a signi ican isk o he
p oduc i i y o whea c opping sys ems ( Sha ma e al. 2022) ha ely on op imal condi ions
be ween 12.0–22.0°C o a o able g ow h and de elopmen .
Fo each deg ee ise in empe a u e, whea p oduc ion is es ima ed o educe by 6%. A
de ailed o e iew o mo pho-physiological esponses o whea o hea s ess may help
o mula ing app op ia e s a egies o hea -s essed whea yield imp o emen .
To add ess hese challenges, new and inno a i e knowledge, esou ces, ools, and
me hods o acili a e b eeding a e needed (Paux e al. 2022).
The a ailabili y o high h oughpu genomic ools including single nucleo ide
polymo phism (SNP) a ays, high densi y molecula ma ke maps, and ull genome sequences
conc e ely help in accele a ing he a e age pheno ypic alues o c op plan s. On one hand, he
use o induced mu a ions coupled wi h mode n genomics ools is an e ec i e s a egy o
iden i ying and manipula ing genes o c op imp o emen . A success ul example is High-
h oughpu TILLING me hodology, which de ec s mu a ions in mu agenized popula ions.
On he o he hand, such powe ul ools a e essen ial o pe o m genome-wide
associa ion s udies, o implemen genomic and phenomic selec ion, and o cha ac e ize he
ichness o na u al wo ldwide di e si y (Paux e al. 2022).
In his ame, EcoTILLING iden i ies single nucleo ide polymo phisms (SNPs) wi hin
a na u al popula ion and associa es hese a ia ions wi h ai s o b eeding in e es . The main
ad an age o his “ e e se gene ics” s a egy is ha hey can be applied o any species
ega dless o genome size and ploidy le el (I shad e al. 2020).
Howe e , bo h echniques equi ed se e al ounds o backc oss in whea o s abilize
he genome by educing edundan mu a ion (in TILLING) and he d awbacks ai s
cha ac e ized in gene ic ma e ial as he land aces (in EcoTILLING).
He e, he ollowing ques ion has been aised: how he gene ic a ia ion in he
TdHsp26 genes in luenced he pe o mance o he SSD69 line du ing hea s ess occu ing in
di e en de elopmen al s ages?
96
Valida ion o he ela ionship be ween gene a ia ion and key mechanisms o plan
de elopmen egula ing inal yield has been pe o med.
Chlo ophyll luo escence pa ame e , canopy in a ed empe a u e (IR o CTD) and
plan pe o mance unde s ess ha e been demons a ed o be e ec i e pheno yping ai s and
good indica o s enabling he cha ac e iza ion and selec ion o a complex en i onmen al
esponse as hea s ess and in u n may di ec ly o indi ec ly aid in c op imp o emen o
s ess ole ance in he con ex o global clima e change.
In his wo k, we applied a p og essi e selec ion o du um whea land aces, in di e en
key de elopmen s ages, e ealing in inal ound o selec ion, a possible esilience o hea
s ess o SSD 69 and, as expec ed o S e o, and suscep ibili y o SSD 397 and o K onos
in he es ed condi ions.
Hea shock p o eins occu in esponse o high empe a u es, binding o dena u ed
p o eins as p o ec ion om agg ega ion, be o e acili a ing hei e o ma ion a e high
empe a u e ceases ( Kuma e al. 2022).
He e in he ame o di e en de elopmen al s ages o di e en geno ypes, we
obse ed ha TdHsp26-A1 and -B1 a e geno ypic and g ow h s age speci ic as hypo hesized
in p e ious s udies pe o med in b ead whea ( Kuma e al. 2018).
Especially in seedlings, we obse ed an al e a ion in he an ioxidan pa hway, le ing
hypo hesize o he hea esilien geno ype SSD69 a educed p oduc ion o H2O2 and he
consequence lowe p oduc ion o MDA, ha , in an hesis s age is no howe e linked wi h a
dec ease in yield.
In SSD 397 he con en ional mechanism o an ioxidan is main ained in all s ages,
wi h he consequence o an inc eased and as e biomass p oduc ion, an icipa ing he an hesis
bu a lowe e ili y encoun e ed.
SSD 69 pu in place a se o de ense mechanisms aimed a p ese ing inal yields,
unde se e e hea s ess, in bo h ille ing and an hesis. SSD 69 inc eased, in ille ing
expe imen , he canopy empe a u e dep ession known o be an impo an physiological
mechanism o sus aining g ain yield a e exposu e o hea s ess (Reynolds e al. 2020). In
high empe a u e and low humidi y condi ions, he mo ole an cul i a s exp essed mo e
e icien anspi a ion cooling, owing o g ea e s oma al conduc ance o he lea . SSD69 also
showed a s ayg een pheno ype indica ing i s abili y o o e come hea s ess and inc eased
yield.

97
Concluding, in his hesis we ha e success ully applied a combined geno ypic and
pheno ypic app oach ha leads o he iden i ica ion o wo con as ing du um whea
land aces, o which SSD69 showed supe io hea esilience cha ac e is ics wi h inc eased
yield pe o mance also in ex eme hea s ess condi ions.
A se o pheno yping ai s ha e been iden i ied as key ai s o he iden i ica ion o
hea esilience geno ypes, cons i u ing a oolbox use ul o u he analysis.
98
6. SUPPLEMENTARY MATERIAL
Suppl. Table1 SNPs iden i ied in he TdHsp26-A1 and TdHsp26-B1 sequence o he SSD
geno ypes, he wild ype nucleo ide is indica ed. The posi ion o he iden i ied SNP on he gene
elemen s is also epo ed.
99
EFFECTS
GAG/CAG(E73Q)
GAG/CAG(E73Q)
GAG/CAG(E73Q
GAG/CAG(E73Q)
GCC/GAC(G196)
GCC/GAC(G196)
GCC/GAC(G196D)
GCC/GAC(G196D)
ATG/GTG(M97V)
TYPE OF
MUTATION
MISSENSE
MISSENSE
MISSENSE
MISSENSE
MISSENSE
MISSENSE
MISSENSE
MISSENSE
MISSSENSE
POSITION ON
THE GENE
PROMOTOR
PROMOTOR
EXON1
EXON1
EXON1
EXON1
EXON2
EXON2
EXON2
EXON2
PROMOTOR
PROMOTOR
PROMOTOR
PROMOTOR
PROMOTOR
PROMOTOR
PROMOTOR
PROMOTOR
PROMOTOR
PROMOTOR
PROMOTOR
PROMOTOR
5UTR’
EXON2
ALLELE
FREQUENCY
14,83
6,80
68,52
29,31
46,37
80,65
68,52
30,02
46,32
80,47
7,57
11,54
21,41
14,79
5,48
96,18
98,92
94,14
99,79
4,72
4,63
5,17
5,09
46,37
SSD SNP
T
C
C
C
C
C
A
A
A
A
T
T
A
A
A
G
G
G
G
G
C
C
G
G
NUCLEOTIDE
WILDTYPE
G
G
G
G
G
G
G
G
G
G
G
A
G
G
G
A
A
A
A
C
G
A
A
A
REFERENCE
POSITION
2086
2102
2469
2469
2469
2469
2929
2929
2929
2929
597
633
1212
1250
1250
1287
1287
1287
1287
1570
1596
1647
1667
2180
SNP ID
SNP1
SNP2
SNP5
SNP5
SNP5
SNP5
SNP8
SNP8
SNP8
SNP8
SNP2
SNP3
SNP4
SNP5
SNP5
SNP6
SNP6
SNP6
SNP6
SNP18
SNP19
SNP25
SNP26
SNP59
POOL
LIB4
LIB1
LIB1
LIB2
LIB3
LIB4
LIB1
LIB2
LIB3
LIB4
LIB1
LIB1
LIB3
LIB3
LIB2
LIB3
LIB1
LIB2
LIB4
LIB3
LIB3
LIB3
LIB3
LIB4
GENE
TdHsp26-A1
TdHsp26-A1
TdHsp26-A1
TdHsp26-A1
TdHsp26-A1
TdHsp26-A1
TdHsp26-A1
TdHsp26-A1
TdHsp26-A1
TdHsp26-A1
TdHsp26-B1
TdHsp26-B1
TdHsp26-B1
TdHsp26-B1
TdHsp26-B1
TdHsp26-B1
TdHsp26-B1
TdHsp26-B1
TdHsp26-B1
TdHsp26-B1
TdHsp26-B1
TdHsp26-B1
TdHsp26-B1
TdHsp26-B1
100
Suppl. Figu e1. Mo phological and physiological ai s eco ded in ille ing s age. a) Canopy
b) Lea a ea, c) RWC, d) CTD, e) numbe o culms, ) plan heigh, g) numbe lea es, h)
In a ed Lea Tempe a u e. S uden ’s - es was applied. E o ba s a e epo ed and ep esen he
s anda d e o . *P <0.05, **P <0.01, ***P <0.001.
107
Be Dange ous’. A mosphe ic Chemis y and Physics 16 (6): 3761–3812.
h ps://doi.o g/10.5194/acp-16-3761-2016.
Hasan Md. K., Cheng Y., Kanwa M.K., Chu X.Y., Ahammed G.J. and Qi Z.Y. 2017.
‘Responses o Plan P o eins o Hea y Me al S ess—A Re iew’. F on ie s in Plan
Science 8 (Sep embe ): 1492. h ps://doi.o g/10.3389/ pls.2017.01492.
Hassan M. U., Cha ha M.U., Khan I., Cha ha M.B., Ba ban i L., Aame M., Iqbal M.M., e
al. 2020. ‘Hea S ess in Cul i a ed Plan s: Na u e, Impac , Mechanisms, and
Mi iga ion S a egies—a Re iew’. Plan Biosys ems - An In e na ional Jou nal
Dealing wi h All Aspec s o Plan Biology, Ma ch.
h ps://www. and online.com/doi/ ull/10.1080/11263504.2020.1727987.
Hawo h M., Belche C.M., Killi D., Dewhi s R.A., Ma e assi A., Raschi A. and Cen i o M.
2018. ‘Impai ed Pho osyn hesis and Inc eased Lea Cons uc ion Cos s May Induce
Flo al S ess du ing Episodes o Global Wa ming o e Mac oe olu iona y
Timescales’. Scien i ic Repo s 8 (1): 6206. h ps://doi.o g/10.1038/s41598-018-
24459-z.
Hickey L.T., Ha eez A.N., Robinson H., Jackson S.A., Leal-Be ioli S.C.M., Tes e M., Gao
C., Godwin I.D., Hayes B.J. and B ande Wul B.B.H. 2019. ‘B eeding C ops o Feed
10 Billion’. Na u e Bio echnology 37 (7): 744–54. h ps://doi.o g/10.1038/s41587-
019-0152-9.
Hu S., Ding Y. and Zhu C. 2020. ‘Sensi i i y and Responses o Chlo oplas s o Hea S ess in
Plan s’. F on ie s in Plan Science 11 (Ap il): 375.
h ps://doi.o g/10.3389/ pls.2020.00375.
Huggins T. D., Mohammed S., Sengodon P., Ib ahim A. M. H., Tilley M. and D. B. Hays.
2018. ‘Changes in Lea Epicu icula Wax Load and I s E ec on Lea Tempe a u e
and Physiological T ai s in Whea Cul i a s (T i icum Aes i um L.) Exposed o High
Tempe a u es du ing An hesis’. Jou nal o Ag onomy and C op Science 204 (1): 49–
61. h ps://doi.o g/10.1111/jac.12227.
Hýsko á V., Bělonožníko á K., Čeřo ská N., and Ryšla á H. 2021. ‘HSP70 Plays an
Ambiguous Role du ing Vi al In ec ions in Plan s’. Biologia Plan a um 65 (Ap il):
68–79. h ps://doi.o g/10.32615/bp.2021.001.
Iba K. 2002. ‘A CCLIMATIVE R ESPONSE TO T EMPERATURE S TRESS IN H IGHER
P LANTS: App oaches o Gene Enginee ing o Tempe a u e Tole ance’. Annual
Re iew o Plan Biology 53 (1): 225–45.
h ps://doi.o g/10.1146/annu e .a plan .53.100201.160729.
Impollonia G., C oci M., Blandiniè es H., Ma cone A. and Amaducci S. 2022. ‘Compa ison
o PROSAIL Model In e sion Me hods o Es ima ing Lea Chlo ophyll Con en and
LAI Using UAV Image y o Hemp Pheno yping’. Remo e Sensing 14 (22): 5801.
h ps://doi.o g/10.3390/ s14225801.
‘IPCC — In e go e nmen al Panel on Clima e Change’. 2018. 2018. h ps://www.ipcc.ch/.
I shad A., Guo H., Zhang S. Liu L. 2020. ‘TILLING in Ce eal C ops o Allele Expansion
and Mu a ion De ec ion by Using Mode n Sequencing Technologies’. Ag onomy 10
(3): 405. h ps://doi.o g/10.3390/ag onomy10030405.
Iu la o A., De Ca oli M., Sabella E., De Pascali M.R., Rampino P., De Bellis L., Pe o a C.,
e al. 2016. ‘D ough and Hea Di e en ially A ec XTH Exp ession and XET
Ac i i y and Ac ion in 3-Day-Old Seedlings o Du um Whea Cul i a s wi h Di e en
S ess Suscep ibili y’. F on ie s in Plan Science 7 (No embe ).
h ps://doi.o g/10.3389/ pls.2016.01686.

108
Iwai M., Yokono M., Inada N. and Minagawa J. 2010. ‘Li e-Cell Imaging o Pho osys em II
An enna Dissocia ion du ing S a e T ansi ions’. P oceedings o he Na ional Academy
o Sciences 107 (5): 2337–42. h ps://doi.o g/10.1073/pnas.0908808107.
Jaconis S. Y., Thompson A. J. E., Smi h S.L., T ima chi C., Co ee N.S., Bange M.P. and
Cona y W.C.. 2021. ‘A S anda dised App oach o De e mining Hea Tole ance in
Co on Using T iphenyl Te azolium Chlo ide’. Scien i ic Repo s 11 (1): 5419.
h ps://doi.o g/10.1038/s41598-021-84798-2.
Janni M., Cocozza C., B illi F., Pigna elli S., Vu o F., Coppede N., Be elli M. Cales ani D.,
Lo e o F. and Zappe ini A. 2021. ‘Real-Time Moni o ing o A undo Donax Response
o Saline S ess h ough he Applica ion o in Vi o Sensing Technology’. Scien i ic
Repo s 11 (1): 1–11. h ps://doi.o g/10.1038/s41598-021-97872-6.
Janni M., Cadonici S., Bonas U., G asso A., Dahab A. A. D., Visioli G., Pignone D., Ce io i
A. and Ma mi oli N. 2018. ‘Gene-Ecology o Du um Whea HMW Glu enin Re lec s
Thei Di usion om he Cen e o O igin’. Scien i ic Repo s 8 (1): 16929.
h ps://doi.o g/10.1038/s41598-018-35251-4.
Janni M., Coppede N., Be elli M., B iglia N., Pe ozza A., Summe e S., Vu o F., e al.
2019. ‘In Vi o Pheno yping o he Ea ly De ec ion o D ough S ess in Toma o’.
Plan Phenomics 2019. h ps://doi.o g/10.34133/2019/6168209.
Janni M., Gullì M., Maes i E., Ma mi oli M., Valliyodan B., Nguyen H.T. and Ma mi oli N.
2020a. ‘Molecula and Gene ic Bases o Hea S ess Responses in C op Plan s and
B eeding o Inc eased Resilience and P oduc i i y’. Jou nal o Expe imen al Bo any
71 (13): 3780. h ps://doi.o g/10.1093/jxb/e aa034.
Jean-Bap is e K., McFaline-Figue oa J.L., Alexand e C.M., Do i y M.W., Saunde s L., Bubb
K.L., T apnell C., Fields S., Quei sch C. and Cupe us J.T. 2019. ‘Dynamics o Gene
Exp ession in Single Roo Cells o A abidopsis Thaliana’. The Plan Cell 31 (5): 993–
1011. h ps://doi.o g/10.1105/ pc.18.00785.
Jia M., Guan J., Zhai Z., Geng S., Zhang X., Mao L. and Li A. 2017. ‘Whea Func ional
Genomics in he E a o nex Gene a ion Sequencing: An Upda e’. The C op Jou nal 6
(1): 7–14. h ps://doi.o g/10.1016/j.cj.2017.09.003.
Kado a Y. and Shi asu K. 2012. ‘The HSP90 Complex o Plan s’. Biochimica e Biophysica
Ac a (BBA) - Molecula Cell Resea ch 1823 (3): 689–97.
h ps://doi.o g/10.1016/j.bbamc .2011.09.016.
Ka ademi B. and Sa i-Kaplan G. 2016. ‘Hea Shock P o ein (HSP)’. Encyclopedia o
Signaling Molecules, 1–10. h ps://doi.o g/10.1007/978-1-4614-6438-9_101809-1.
Kau V. and Behl R. 2010. ‘(PDF) G ain Yield in Whea as A ec ed by Sho Pe iods o
High Tempe a u e, D ough and Thei In e ac ion du ing P e- and Pos -An hesis
S ages’. Resea chGa e. h ps://doi.o g/10.1556/CRC.38.2010.4.8.
Kazancoglu Y., Ozbil ekin-Pala M. and Ozkan-Ozen Y.D. 2021. ‘P edic ion and E alua ion
o G eenhouse Gas Emissions o Sus ainable Road T anspo wi hin Eu ope’.
Sus ainable Ci ies and Socie y 70: 102924. h ps://doi.o g/10.1016/j.scs.2021.102924.
Khan A., Ahmad M., Ahmed M. and Hussain I.M. 2020. ‘Rising A mosphe ic Tempe a u e
Impac on Whea and The mo ole ance S a egies’. Plan s 10 (1): 43.
h ps://doi.o g/10.3390/plan s10010043.
Kholo á J., U ban M.O., Cock J., A cos J., A naud E., Ay ekin D., Aze edo V., e al. 2021.
‘In Pu sui o a Be e Wo ld: C op Imp o emen and he CGIAR’. Edi ed by Ma hew
Reynolds. Jou nal o Expe imen al Bo any 72 (14): 5158–79.
h ps://doi.o g/10.1093/jxb/e ab226.
109
Kho ob ykh S., Ha u inne V., Ma ila H. and Tyys jä i E. 2020. ‘Oxygen and ROS in
Pho osyn hesis’. Plan s 9 (1): 91. h ps://doi.o g/10.3390/plan s9010091.
Khu ana N., Chauhan H. and Khu ana P. 2013. ‘Whea Chlo oplas Ta ge ed SHSP26
P omo e Con e s Hea and Abio ic S ess Inducible Exp ession in T ansgenic
A abidopsis Plan s’. PLoS ONE 8 (1): e54418.
h ps://doi.o g/10.1371/jou nal.pone.0054418.
Kollis H., Zandalinas S.I., Sengup a S., Nuhka M., Kangasjä i J. and Mi le R. 2019.
‘Rapid Responses o Abio ic S ess: P iming he Landscape o he Signal
T ansduc ion Ne wo k’. T ends in Plan Science 24 (1): 25–37.
h ps://doi.o g/10.1016/j. plan s.2018.10.003.
Kuma G. R., Sak hi el K., Sunda am R.M., Nee aja C.N., Balachand an S.M., Rani N.S.,
Vi ak ama h B.C. and Madha M.S. 2010. ‘Allele Mining in C ops: P ospec s and
Po en ials’. Bio echnology Ad ances 28 (4): 451–61.
h ps://doi.o g/10.1016/j.bio echad .2010.02.007.
Kuma M.V.G., Rane J., Singh A.K., Choudha y R.L., Raina S.K., Geo ge P., Ahe L.K. and
Singh N.P. 2017. ‘Canopy Tempe a u e Dep ession (CTD) and Canopy G eenness
Associa ed wi h Va ia ion in Seed Yield o Soybean Geno ypes G own in Semi-A id
En i onmen ’. Sou h A ican Jou nal o Bo any 113 (No embe ): 230–38.
h ps://doi.o g/10.1016/j.sajb.2017.08.016.
Kuma R.R., Goswami S., Singh K., Dubey K., Rai G.K., Singh B., Singh S. e al. 2018.
‘Cha ac e iza ion o No el Hea -Responsi e T ansc ip ion Fac o (TaHSFA6e) Gene
In ol ed in Regula ion o Hea Shock P o eins (HSPs) - A Key Membe o Hea
S ess-Tole ance Ne wo k o Whea ’. Jou nal o Bio echnology 279 (Oc obe ).
h ps://doi.o g/10.1016/j.jbio ec.2018.05.008.
Kuma S., Singh R. and Nayya H. 2012. ‘α-Tocophe ol Applica ion Modula es he Response
o Whea (T i icum Aes i um L.) Seedlings o Ele a ed Tempe a u es by Mi iga ion
o S ess Inju y and Enhancemen o An ioxidan s’. Jou nal o Plan G ow h
Regula ion 32 (2). DOI:10.1007/s00344-012-9299-z
Kuma V., Roy S., Kuma Behe a B. and Kuma Das B. 2022. ‘Hea Shock P o eins (Hsps) in
Cellula Homeos asis: A P omising Tool o Heal h Managemen in C us acean
Aquacul u e’. Li e 12 (11): 1777. h ps://doi.o g/10.3390/li e12111777.
Kuma i M., Pudake R. N., Singh V. P. and Joshi A. K. 2012. ‘Associa ion o S ayg een T ai
wi h Canopy Tempe a u e Dep ession and Yield T ai s unde Te minal Hea S ess in
Whea (T i icum Aes i um L.)’. Euphy ica, 190: 87–97
Kuzmano ić, L., Genna o A., Benede elli S, Dodd I.C., Qua ie S.A. and Ceoloni C. 2014.
‘S uc u al–Func ional Dissec ion and Cha ac e iza ion o Yield-Con ibu ing T ai s
O igina ing om a G oup 7 Ch omosome o he Whea g ass Species Thinopy um
Pon icum a e T ans e in o Du um Whea ’. Jou nal o Expe imen al Bo any 65 (2):
509–25. h ps://doi.o g/10.1093/jxb/e 393.
Kweku D., Bisma k O., Maxwell A., Desmond K., Danso K., O i-Mensah E., Quachie A. and
Ado maa B. 2018. ‘G eenhouse E ec : G eenhouse Gases and Thei Impac on Global
Wa ming’. Jou nal o Scien i ic Resea ch and Repo s 17 (6): 1–9.
h ps://doi.o g/10.9734/JSRR/2017/39630.
Laloum T., Ma ín G. and Duque P. 2018. ‘Al e na i e Splicing Con ol o Abio ic S ess
Responses’. T ends in Plan Science 23 (2): 140–50.
h ps://doi.o g/10.1016/j. plan s.2017.09.019.
110
Lang idge P. and Reynolds M. 2021. ‘B eeding o D ough and Hea Tole ance in Whea ’.
Theo e ical and Applied Gene ics 134 (6): 1753–69. h ps://doi.o g/10.1007/s00122-
021-03795-1.
Le y A.A. and Feldman M. 2022. 'E olu ion and o igin o b ead whea '. The Plan Cell 2022:
34: 2549–2. h ps://doi.o g/10.1093/plcell/koac130
Li Y., Xiao J., Chen L., Huang X., Cheng Z., Han B., Zhang Q. and Wu C. 2018. ‘Rice
Func ional Genomics Resea ch: Pas Decade and Fu u e’. Molecula Plan 11 (3):
359–80. h ps://doi.o g/10.1016/j.molp.2018.01.007.
Liao Y., Liu Z., Gichi a A.W., Yang M., Mbichi R.W., Meng L. and Wan T. 2022. ‘Deep
E alua ion o he E olu iona y His o y o he Hea Shock Fac o (HSF) Gene Family
and I s Expansion Pa e n in Seed Plan s’. Pee J 10 (Augus ): e13603.
h ps://doi.o g/10.7717/pee j.13603.
Lin M.Y., Chai K.H., Ko S.S., Kuang L.Y., Lu H.S. and Cha ng Y.Y. 2014. ‘A Posi i e
Feedback Loop be ween HEAT SHOCK PROTEIN101 and HEAT STRESS-
ASSOCIATED 32-KD PROTEIN Modula es Long-Te m Acqui ed The mo ole ance
Illus a ing Di e se Hea S ess Responses in Rice Va ie ies’. Plan Physiology 164
(4): 2045–53. h ps://doi.o g/10.1104/pp.113.229609.
Liu C., Sukuma an S., Cla e ie E., Sansaloni C., D eisigacke S. and Reynolds M. 2019.
‘Gene ic Dissec ion o Hea and D ough S ess QTLs in Phenology-Con olled
Syn he ic-De i ed Recombinan Inb ed Lines in Sp ing Whea ’. Molecula B eeding
39 (3): 34. h ps://doi.o g/10.1007/s11032-019-0938-y.
Liu H.C. and Cha ng Y.Y. 2013. ‘Common and Dis inc Func ions o A abidopsis Class A1
and A2 Hea Shock Fac o s in Di e se Abio ic S ess Responses and De elopmen ’.
Plan Physiology 163 (1): 276–90. h ps://doi.o g/10.1104/pp.113.221168.
Liu X., Zhao L., Li J., Duan L., Zhang K., Qiao X., Li W., Zheng C., Tang X. and Zhang H.
2021. ‘The Chlo oplas ic Small Hea Shock P o ein Gene K HSP26 Is Induced by
Va ious Abio ic S esses in Kos ele zkya Vi ginica’. In e na ional Jou nal o
Genomics 2021 (Feb ua y): 1–9. h ps://doi.o g/10.1155/2021/6652445.
Lu Y., Li R., Wang R., Wang X., Zheng W., Sun Q., Tong S., Dai S. and Xu S. 2017.
‘Compa a i e P o eomic Analysis o Flag Lea es Re eals New Insigh in o Whea
Hea Adap a ion’. F on ie s in Plan Science 8 (June).
h ps://doi.o g/10.3389/ pls.2017.01086.
Lubben T. H., Donaldson G.K., Vii anen P.V. and Ga enby’A.A.. 1989. ‘Se e a1 P o eins
Lmpo ed in o Chlo oplas s Fo m S able Complexes wi h he G oEL-Rela ed
Chlo oplas Molecula Chape one’, 1(12):1223-30. doi: 10.1105/ pc.1.12.1223.
Lynch J., Cain M., F ame D. and Pie ehumbe R. 2021. ‘Ag icul u e’s Con ibu ion o
Clima e Change and Role in Mi iga ion Is Dis inc F om P edominan ly Fossil CO2-
Emi ing Sec o s’. F on ie s in Sus ainable Food Sys ems 4 (Feb ua y): 518039.
h ps://doi.o g/10.3389/ su s.2020.518039.
Macca e i M., Ha is N.S., Twa dziok S.O., Pasam R.K., Gundlach H., Spannagl M.,
O manbeko a D., e al. 2019. ‘Du um Whea Genome Highligh s Pas Domes ica ion
Signa u es and Fu u e Imp o emen Ta ge s’. Na u e Gene ics 51 (5): 885–95.
h ps://doi.o g/10.1038/s41588-019-0381-3.
Madec S., Ba e F., De Solan B., Thomas S., Du a e D., Jezequel S., Hemme lé M., Gallian
Colombeau G. and Coma A. 2017. ‘High-Th oughpu Pheno yping o Plan Heigh :
Compa ing Unmanned Ae ial Vehicles and G ound LiDAR Es ima es’. F on ie s in
Plan Science 8 (No embe ). h ps://doi.o g/10.3389/ pls.2017.02002.
111
Maes i E., Klue a N., Pe o a C., Gulli M., Nguyen H.T. and Ma mi oli N. 2002.
‘Molecula Gene ics o Hea Tole ance and Hea Shock P o eins in Ce eals’. Plan
Molecula Biology 48 (5): 667–81. h ps://doi.o g/10.1023/A:1014826730024.
Ma u ani Y., Yamauchi Y., Kimu a Y., Mizu ani M. and Sugimo o Y. 2012. ‘Damage o
Pho osys em II Due o Hea S ess wi hou Ligh -D i en Elec on Flow: In ol emen
o Enhanced In oduc ion o Reducing Powe in o Thylakoid Memb anes’. Plan a 236
(2): 753–61. h ps://doi.o g/10.1007/s00425-012-1647-5.
Ma hu S., Ag awal D. and Jajoo A. 2014. ‘Pho osyn hesis: Response o High Tempe a u e
S ess’. Jou nal o Pho ochemis y and Pho obiology B: Biology 137 (Augus ): 116–
26. h ps://doi.o g/10.1016/j.jpho obiol.2014.01.010.
Ma iolo E., Liccia dello F., Lomba do G.M., Mu a o e G., and Anas asi U. 2017. ‘Vola ile
P o iling o Du um Whea Ke nels by HS–SPME/GC–MS’. Eu opean Food Resea ch
and Technology 243 (1): 147–55. h ps://doi.o g/10.1007/s00217-016-2731-z.
Medina E., Kim S.H., Yun M. and Choi W.G. 2021. ‘Recapi ula ion o he Func ion and Role
o ROS Gene a ed in Response o Hea S ess in Plan s’. Plan s 10 (2): 371.
h ps://doi.o g/10.3390/plan s10020371.
Meng G., Xiao M., Xiao M., De-Xu L., Zhen-Hui G. and Ming-Hui L. 2016. ‘The Plan Hea
S ess T ansc ip ion Fac o s (HSFs): S uc u e, Regula ion, and Func ion in Response
o Abio ic S esses’. F on ie s in Plan Science 7: 3.
h ps://doi.o g/10.3389/ pls.2016.001143.
Mille G., Schlauch K., Tam R., Co es D.T, To es M.A., Shulae V., Dangl J.L and
Mi le .R. 2009. ‘The Plan NADPH Oxidase RBOHD Media es Rapid Sys emic
Signaling in Response o Di e se S imuli’. Science Signaling 2 (84).
h ps://doi.o g/10.1126/scisignal.2000448.
Mille G. and Mi le R. 2006. ‘Could Hea Shock T ansc ip ion Fac o s Func ion as
Hyd ogen Pe oxide Senso s in Plan s?’ Annals o Bo any 98 (2): 279–88.
h ps://doi.o g/10.1093/aob/mcl107.
Mi le R., Finka A. and Goloubino P. 2012. ‘How Do Plan s Feel he Hea ?’ T ends in
Biochemical Sciences 37 (3): 118–25. h ps://doi.o g/10.1016/j. ibs.2011.11.007.
Mo gil H., Ge cek Y.C., Tulum I., Mo gil H., Ge cek Y.C. and Tulum I. 2020. Single
Nucleo ide Polymo phisms (SNPs) in Plan Gene ics and B eeding. The Recen
Topics in Gene ic Polymo phisms. In echOpen.
h ps://doi.o g/10.5772/in echopen.91886.
Mu Q., Zhang W., Zhang Y., Yan H., Liu K., Ma sui T., Tian X. and Yang P. 2017. ‘ITRAQ-
Based Quan i a i e P o eomics Analysis on Rice An he Responding o High
Tempe a u e’. In e na ional Jou nal o Molecula Sciences 18 (9): 1811.
h ps://doi.o g/10.3390/ijms18091811.
Naga S., Singh V. P., A o a A., Dhaka R. and Ramak ishnan S. 2015. ‘Assessmen o
Te minal Hea Tole ance Abili y o Whea Geno ypes Based on Physiological T ai s
Using Mul i a ia e Analysis’. Ac a Physiologiae Plan a um 37 (12): 257.
h ps://doi.o g/10.1007/s11738-015-2017-2.
Nelson C.J., Alexo a R., Jacoby R.P. and Milla A.H. 2014. ‘P o eins wi h High Tu no e
Ra e in Ba ley Lea es Es ima ed by P o eome Analysis Combined wi h in Plan a
Iso ope Labeling’. Plan Physiology 166 (1): 91–108.
h ps://doi.o g/10.1104/pp.114.243014.
Ne a-Sha i I., Isaacson T., Lu ie S. and Weiss D. 2005. ‘Dual Role o Toma o Hea Shock
P o ein 21: P o ec ing Pho osys em II om Oxida i e S ess and P omo ing Colo
112
Changes du ing F ui Ma u a ion’. The Plan Cell 17 (6): 1829–38.
h ps://doi.o g/10.1105/ pc.105.031914.
Ng P. C. and Heniko S. 2003. ‘SIFT: P edic ing Amino Acid Changes Tha A ec P o ein
Func ion’. Nucleic Acids Resea ch 31 (13): 3812. h ps://doi.o g/10.1093/na /gkg509.
Liliane T.N. and Cha les M.S. 2020. ‘Fac o s A ec ing Yield o C ops’. In Ag onomy -
Clima e Change and Food Secu i y, edi ed by Amanullah. In echOpen.
h ps://doi.o g/10.5772/in echopen.90672.
Nu all J.G., O’Lea y G.J., Panozzo J.F., Walke C.K., Ba low K.M. and Fi zge ald G.J. 2015.
‘Models o G ain Quali y in Whea —A Re iew’. Field C ops Resea ch 202: 136–45.
h ps://doi.o g/10.1016/j. c .2015.12.011.
Ogunbode C. A., Do an R. and Gisela Böhm. 2020. ‘Exposu e o he IPCC Special Repo on
1.5 °C Global Wa ming Is Linked o Pe cei ed Th ea and Inc eased Conce n abou
Clima e Change’. Clima ic Change 158 (3–4): 361–75.
h ps://doi.o g/10.1007/s10584-019-02609-0.
Ohama N., Sa o H., Shinozaki K. and Yamaguchi-Shinozaki K. 2017. ‘T ansc ip ional
Regula o y Ne wo k o Plan Hea S ess Response’. T ends in Plan Science 22 (1):
53–65. h ps://doi.o g/10.1016/j. plan s.2016.08.015.
Pandino G., Ma iolo E., Lomba do S., Lomba do G.M., and Mau omicale G. 2020. ‘O ganic
C opping Sys em A ec s G ain Chemical Composi ion, Rheological and Ag onomic
Pe o mance o Du um Whea ’. Ag icul u e 10 (2): 46.
h ps://doi.o g/10.3390/ag icul u e10020046.
a k C.J., and Seo Y.Su. 2015. ‘Hea Shock P o eins: A Re iew o he Molecula Chape ones
o Plan Immuni y’. The Plan Pa hology Jou nal 31 (4): 323–33.
h ps://doi.o g/10.5423/PPJ.RW.08.2015.0150.
Pa ignani A. and Ochsne T. E. 2015. ‘Canopeo: A Powe ul New Tool o Measu ing
F ac ional G een Canopy Co e ’. Ag onomy Jou nal 107 (6): 2312–20.
h ps://doi.o g/10.2134/ag onj15.0150.
Paupiè e M. J., Van Hape en P., Rieu I., Visse R.G.F., Tikuno Y.M. and Bo y A.G. 2017.
‘Sc eening o Pollen Tole ance o High Tempe a u es in Toma o’. Euphy ica 213 (6):
1–8. h ps://doi.o g/10.1007/s10681-017-1927-z.
Paux E., La a ge S., Bal ou ie F., De o y J., Cha me G., Alaux M., Pe che G., e al. 2022.
‘B eeding o Economically and En i onmen ally Sus ainable Whea Va ie ies: An
In eg a ed App oach om Genomics o Selec ion’. Biology 11 (1): 149.
h ps://doi.o g/10.3390/biology11010149.
Pea l L. H. and P od omou C. 2006. ‘S uc u e and Mechanism o he Hsp90 Molecula
Chape one Machine y’. Annual Re iew o Biochemis y 75 (1): 271–94.
h ps://doi.o g/10.1146/annu e .biochem.75.103004.142738.
Pe domo J. A., Capó-Bauçà S., Ca mo-Sil a E. and Galmés J. 2017. ‘Rubisco and Rubisco
Ac i ase Play an Impo an Role in he Biochemical Limi a ions o Pho osyn hesis in
Rice, Whea , and Maize unde High Tempe a u e and Wa e De ici ’. F on ie s in
Plan Science 8 (Ap il). h ps://doi.o g/10.3389/ pls.2017.00490.
Pé ez-Salamó I., Papdi C., Rigó G., Zsigmond L., Vilela B., Lumb e as V., Nagy I., e al.
2014. ‘The Hea Shock Fac o A4A Con e s Sal Tole ance and Is Regula ed by
Oxida i e S ess and he Mi ogen-Ac i a ed P o ein Kinases MPK3 and MPK6’. Plan
Physiology 165 (1): 319–34. h ps://doi.o g/10.1104/pp.114.237891.
Pignone D., De Paola D., Rapanà N. and Janni M. 2015. ‘Single Seed Descen : A Tool o
Exploi Du um Whea (T i icum Du um Des .) Gene ic Resou ces’. Gene ic

113
Resou ces and C op E olu ion 62 (7): 1029–35. h ps://doi.o g/10.1007/s10722-014-
0206-2.
Pospíšil P. 2016. ‘P oduc ion o Reac i e Oxygen Species by Pho osys em II as a Response o
Ligh and Tempe a u e S ess’. F on ie s in Plan Science 7 (Decembe ).
h ps://doi.o g/10.3389/ pls.2016.01950.
Pospíšil P. and P asad A. 2014. ‘Fo ma ion o Single Oxygen and P o ec ion agains I s
Oxida i e Damage in Pho osys em II unde Abio ic S ess’. Jou nal o Pho ochemis y
and Pho obiology B: Biology 137 (Augus ): 39–48.
h ps://doi.o g/10.1016/j.jpho obiol.2014.04.025.
Pou -Aboughada eh A., Youse ian M., Mo adkhani H., Vahed M.M., Poczai P. and Siddique
K.H.M. 2019. ‘I PASTIC: An Online Toolki o Es ima e Plan Abio ic S ess Indices:
I PASTIC o Es ima e Plan Abio ic S ess Indices’. Applica ions in Plan Sciences 7
(7): e11278. h ps://doi.o g/10.1002/aps3.11278.
P asad P. V. V. and Djanagui aman M. 2014. ‘Response o Flo e Fe ili y and Indi idual
G ain Weigh o Whea o High Tempe a u e S ess: Sensi i e S ages and Th esholds
o Tempe a u e and Du a ion’. Func ional Plan Biology 41 (12): 1261.
h ps://doi.o g/10.1071/FP14061.
P od omou C. 2016. ‘Mechanisms o Hsp90 Regula ion’. Biochemical Jou nal 473 (16):
2439–52. h ps://doi.o g/10.1042/BCJ20160005.
Ramkuma G., Madha M. S., Rama De i S. J. S., P asad M. S. and Ra ind a Babu V. 2015.
‘Nucleo ide Va ia ion and Iden i ica ion o No el Blas Resis ance Alleles o Pib by
Allele Mining S a egy’. Physiology and Molecula Biology o Plan s 21 (2): 301.
h ps://doi.o g/10.1007/s12298-015-0284-4.
Rampino P., Mi a G., Fasano P., Bo elli G.M., Ap ile A., Dalessand o G., De Bellis L. and
Pe o a C. 2012. ‘No el Du um Whea Genes Up-Regula ed in Response o a
Combina ion o Hea and D ough S ess’. Plan Physiology and Biochemis y 56
(July): 72–78. h ps://doi.o g/10.1016/j.plaphy.2012.04.006.
Reynolds M., Chapman S., C espo-He e a L., Mole o G., Mondal S., Pequeno D.N.L., Pin o
F., e al 2020. ‘B eede F iendly Pheno yping - ScienceDi ec ’. 2020. Plan Science.
295:110396. DOI: 10.1016/j.plan sci.2019.110396.
Ribei o M., Nunes F.M., Rod iguez-Quijano M., Ca illo J.M., B anla d G. and Ig ejas G.
2018. ‘Nex -Gene a ion The apies o Celiac Disease: The Glu en-Ta ge ed
App oaches’. T ends in Food Science & Technology 75: 56–71.
h ps://doi.o g/10.1016/j. i s.2018.02.021.
Rich-G i in C., S echemesse A., Finch J., Lucas E., O S. and Schä e P. 2020. ‘Single-Cell
T ansc ip omics: A High-Resolu ion A enue o Plan Func ional Genomics’. T ends
in Plan Science 25 (2). h ps://doi.o g/10.1016/j. plan s.2019.10.008.
Roche D. 2015. ‘S oma al Conduc ance Is Essen ial o Highe Yield Po en ial o C3 C ops’.
C i ical Re iews in Plan Sciences, July.
h ps://www. and online.com/doi/abs/10.1080/07352689.2015.1023677.
Roge s H. J., Ba e N., Combe J., Sulli an J., Swee man J., Swan C., Lonsdale D. M. and
Twell D. 2001. ‘Func ional Analysis o Cis-Regula o y Elemen s wi hin he P omo e
o he Tobacco La e Pollen Gene G10’. Plan Molecula Biology 45 (5): 577–85.
h ps://doi.o g/10.1023/A:1010695226241.
Ru sdo i G., Hä ma k J., Weide Y., Hebe H., Rasmussen M.I., We ne sson S., Respondek
M. e al. 2017. ‘S uc u al Model o Dodecame ic Hea -Shock P o ein Hsp21: Flexible
N-Te minal A ms In e ac wi h Clien P o eins While C-Te minal Tails Main ain he
114
Dodecame and Chape one Ac i i y’. Jou nal o Biological Chemis y 292 (19):
8103–21. h ps://doi.o g/10.1074/jbc.M116.766816.
Saeidi M. and Abdoli M. 2015. ‘E ec o D ough S ess du ing G ain Filling on Yield and
I s Componen s, Gas Exchange Va iables, and Some Physiological T ai s o Whea
Cul i a s’. Jou nal o Ag icul u al Science and Technology 17 (4): 885–98.
Saidi Y., Finka A. and Goloubino P. 2011. ‘Hea Pe cep ion and Signalling in Plan s: A
To uous Pa h o The mo ole ance’. New Phy ologis 190 (3): 556–65.
h ps://doi.o g/10.1111/j.1469-8137.2010.03571.x.
Sanchez-B agado R., Newcomb M., Chai i F., Condo elli G.E., Wa d R.W., Whi e J.W.,
Macca e i M., Tube osa R., A aus R.L. and Se e Molins M.D. 2020. ‘Ca bon
Iso ope Composi ion and he NDVI as Pheno yping App oaches o D ough
Adap a ion in Du um Whea : Beyond T ai Selec ion’. Ag onomy 10 (11): 1679.
h ps://doi.o g/10.3390/ag onomy10111679.
Sa o Y., Mu akami T., Funa suki H., Ma suba S., Sa uyama H. and Tanida M. 2001. ‘Hea
Shock-Media ed APX Gene Exp ession and P o ec ion agains Chilling Inju y in Rice
Seedlings’. Jou nal o Expe imen al Bo any 52(354):145-51.
Sa icka M. and Šku e N. 2010. ‘E Ec s o High Tempe a u e on Malondialdehyde Con en ,
Supe oxide P oduc ion and G ow h Changes in Whea Seedlings (T i icum Aes i um
L.)’. Ekologija 56(1). h ps://doi.o g/10.2478/ 10055-010-0004-x.
Scha K. D. 2012. ‘The Plan Hea S ess T ansc ip ion Fac o (Hs ) Family: S uc u e,
Func ion and E olu ion’. Biochimica e Biophysica Ac a, 16.
DOI: 10.1016/j.bbag m.2011.10.002
Sedagha meh M., Muelle -Roebe B. and Balazadeh S. 2016. ‘The Plas id Me allop o ease
F sH6 and Small Hea Shock P o ein HSP21 Join ly Regula e The momemo y in
A abidopsis’. Na u e Communica ions 7 (1): 12439.
h ps://doi.o g/10.1038/ncomms12439.
Seka an U., Lai L., Ussi i D.A.N., Kuma S. and Clay S. 2021. ‘Role o In eg a ed C op-
Li es ock Sys ems in Imp o ing Ag icul u e P oduc ion and Add essing Food
Secu i y – A Re iew’. Jou nal o Ag icul u e and Food Resea ch 5 (Sep embe ):
100190. h ps://doi.o g/10.1016/j.ja .2021.100190.
Sen hilkuma M., Ama esan N. and Sanka ana ayanan A. 2021. ‘Es ima ion o
Malondialdehyde (MDA) by Thioba bi u ic Acid (TBA) Assay’. Plan -Mic obe
In e ac ions, 103–5. h ps://doi.o g/10.1007/978-1-0716-1080-0_25.
Ses ili F., Bo icella E., Bedo Z., Phillips A. and La iand a D. 2010. ‘P oduc ion o No el
Allelic Va ia ion o Genes In ol ed in S a ch Biosyn hesis h ough Mu agenesis’.
Molecula B eeding 25 (1): 145–54. h ps://doi.o g/10.1007/s11032-009-9314-7.
Se ia R.C. and Se ia N. 2018. ‘The Omics Technologies and C op Imp o emen ’. 2018. C op
Imp o emen : S a egies and Applica ions. New Dehli: In e na ional Publishing House
P . L d, 1–18.
Shanke A. K., Bhanu D. and Maheswa i M. 2020. ‘Epigene ics and T ansgene a ional
Memo y in Plan s unde Hea S ess’. Plan Physiology Repo s 25 (4): 583–93.
h ps://doi.o g/10.1007/s40502-020-00557-x.
Shanmuga el P., Rajap akasam S., Chockalingam V., Ramasamy G., Thiyaga ajan K., and
Ma imu hu R. 2021. ‘B eeding Mechanisms o High Tempe a u e Tole ance in C op
Plan s’. In Plan B eeding - Cu en and Fu u e Views. In echOpen.
h ps://doi.o g/10.5772/in echopen.94693.
115
Sha ma D. K., Ande sen S.B., O osen C.O. and Rosenq is E. 2015. ‘Whea Cul i a s
Selec ed o High F /F m unde Hea S ess Main ain High Pho osyn hesis, To al
Chlo ophyll, S oma al Conduc ance, T anspi a ion and D y Ma e ’. Physiologia
Plan a um 153 (2): 284–98. h ps://doi.o g/10.1111/ppl.12245.
Sha ma D. K., To p A.M., Rosenq is E., O osen C.O. and Ande sen S.B. 2017. ‘QTLs and
Po en ial Candida e Genes o Hea S ess Tole ance Iden i ied om he Mapping
Popula ions Speci ically Seg ega ing o F /Fm in Whea ’. F on ie s in Plan Science
8 (Sep embe ): 1668. h ps://doi.o g/10.3389/ pls.2017.01668.
Sha ma R. K., Kuma S., Va a K., Bheemanahalli R., Dhillon J. and Reddy K.N. 2022.
‘Impac o Recen Clima e Change on Co n, Rice, and Whea in Sou heas e n USA’.
Scien i ic Repo s 12 (1): 1–14. h ps://doi.o g/10.1038/s41598-022-21454-3.
Shaw A. K., Bha dwaj P.K., Ghosh S., Roy S., Saha S., She pa A.R., Saha S.K. and Hossain
Z. 2016. ‘β-Aminobu y ic Acid Media ed D ough S ess Alle ia ion in Maize (Zea
Mays L.)’. En i onmen al Science and Pollu ion Resea ch 23 (3): 2437–53.
h ps://doi.o g/10.1007/s11356-015-5445-z.
Shi delmoghanloo H., Loh aseb I., Rabie H.S., B ien C., Pa en B. and Collins N.C. 2016.
‘Hea Suscep ibili y o G ain Filling in Whea (T i icum Aes i um L.) Linked wi h
Rapid Chlo ophyll Loss du ing a 3-Day Hea T ea men ’. Ac a Physiologiae
Plan a um 38 (8): 208. h ps://doi.o g/10.1007/s11738-016-2208-5.
Sma R.E. and G. E. Bingham. 1974. ‘Rapid Es ima es o Rela i e Wa e Con en ’. Plan
Physiology 53 (2): 258–60. h ps://doi.o g/10.1104/pp.53.2.258.
Soda N. 2015. ‘Omics S udy o Abio ic S ess Responses in Plan s’. Ad ances in Plan s &
Ag icul u e Resea ch 2 (1). h ps://doi.o g/10.15406/apa .2015.02.00037.
So eng R. J., Pe e son P.L., Romaschenko K., Da idse G., Zuloaga F.O., Judziewicz E.J.,
Filguei as T.S., Da is J.I. and Mo one O. 2015. ‘A Wo ldwide Phylogene ic
Classi ica ion o he Poaceae (G amineae): Phylogene ic Classi ica ion o he
G asses’. Jou nal o Sys ema ics and E olu ion 53 (2): 117–37.
h ps://doi.o g/10.1111/jse.12150.
S i as a a S., Pa hak A.D., Gup a P.S., Sh i as a a A.K. and S i as a a A.K. 2012.
‘Hyd ogen Pe oxide-Sca enging Enzymes Impa Tole ance o High Tempe a u e
Induced Oxida i e S ess in Suga cane’. Jou nal o En i onmen al Biology 33 (3):
657–61.
S i as a a S. and Dubey R. S. 2011. ‘Manganese-Excess Induces Oxida i e S ess, Lowe s
he Pool o An ioxidan s and Ele a es Ac i i ies o Key An ioxida i e Enzymes in
Rice Seedlings’. Plan G ow h Regula ion 64 (1): 1–16.
h ps://doi.o g/10.1007/s10725-010-9526-1.
S o ozhenko S., De Pauw P., Van Mon agu M., Inzé D. and Kushni S. 1998. ‘The Hea -
Shock Elemen Is a Func ional Componen o he A abidopsis APX1 Gene P omo e ’.
Plan Physiology 118 (3): 1005–14. h ps://doi.o g/10.1104/pp.118.3.1005.
Sun W., Van Mon agu M. and Ve b uggen N. 2002. ‘Small Hea Shock P o eins and S ess
Tole ance in Plan s’. Biochimica e Biophysica Ac a (BBA) - Gene S uc u e and
Exp ession 1577 (1): 1–9. h ps://doi.o g/10.1016/S0167-4781(02)00417-7.
Sung D.Y., Kaplan F. and Guy C.L. 2001. ‘Plan Hsp70 Molecula Chape ones: P o ein
S uc u e, Gene Family, Exp ession and Func ion’. Physiologia Plan a um 113 (4):
443–51. h ps://doi.o g/10.1034/j.1399-3054.2001.1130402.x.
Suzuki N., Kousse i zky S., Mi le R. and Mille G. 2012. ‘ROS and Redox Signalling in he
Response o Plan s o Abio ic S ess’. Plan , Cell & En i onmen 35 (2): 259–70.
h ps://doi.o g/10.1111/j.1365-3040.2011.02336.x.
116
Ta a ima W., Chuanchumkan C., Manee a ana ung oj P., T unja uen A., Thee akulpisu P.
and Dongsansuk A. 2022. ‘E ec o Hea S ess on Some Physiological and
Ana omical Cha ac e is ics o Rice (O yza sa i a L.) c . KDML105 Callus and
Seedling’. Biology 11, 1587. h ps:// doi.o g/10.3390/biology11111587.
Tadesse W. 2019. ‘Gene ic Gains in Whea B eeding and I s Role in Feeding he Wo ld’.
C op
B eeding, Gene ics and Genomics. h ps://doi.o g/10.20900/cbgg20190005.
Tan W., Meng Qw., B es ic M., Olso ska K. and Yang X. 2011. ‘Pho osyn hesis Is Imp o ed
by Exogenous Calcium in Hea -S essed Tobacco Plan s’. Jou nal o Plan Physiology
168 (17). h ps://doi.o g/10.1016/j.jplph.2011.06.009.
Ta dieu F. 2017. ‘Plan Phenomics, F om Senso s o Knowledge’. Cu en Biology 27 (15):
R770–83. h ps://doi.o g/10.1016/j.cub.2017.05.055.
‘The G eenhouse E ec and Ou Plane | Na ional Geog aphic Socie y’. 2022.
h ps://educa ion.na ionalgeog aphic.o g/ esou ce/g eenhouse-e ec -ou -plane .
The In e na ional Whea Genome Sequencing Conso ium (IWGSC), Maye K.F.X, Jane
Roge s, Doležel J., Pozniak C., E e sole K., Feuille C., e al. 2014. ‘A Ch omosome-
Based D a Sequence o he Hexaploid B ead Whea ( T i icum Aes i um ) Genome’.
Science 345 (6194): 1251788. h ps://doi.o g/10.1126/science.1251788.
Ul Haq S.,Khan A., Ali M., Kha an A.M., and Gai W.X. 2019. ‘Hea Shock P o eins:
Dynamic Biomolecules o Coun e Plan Bio ic and Abio ic S esses’. In e na ional
Jou nal o Molecula Sciences 20 (21): 5321. h ps://doi.o g/10.3390/ijms20215321.
Ullah S., B amley H., Mahmood T. and T e howan R. 2020. ‘The Impac o Emme Gene ic
Di e si y on G ain P o ein Con en and Tes Weigh o Hexaploid Whea unde High
Tempe a u e S ess’. Jou nal o Ce eal Science 95: 103052.
h ps://doi.o g/10.1016/j.jcs.2020.103052.
UNAFPA. 2022. ‘S a is ics’. UNAFPA. 2022. h ps://www.pas a-
una pa.o g/new /una pa/de aul .aspx?IDCONTENT=102.
Un e gasse A., Cu cu ache I., Ko essaa T., Ye J., Fai clo h B.C., Remm M. and Rozen S.G.
2012. ‘P ime 3—New Capabili ies and In e aces’. Nucleic Acids Resea ch 40 (15):
e115–e115. h ps://doi.o g/10.1093/na /gks596.
US EPA, OAR. 2015. ‘Clima e Change Indica o s: G eenhouse Gases’. Repo s and
Assessmen s. 16 Decembe 2015. h ps://www.epa.go /clima e-indica o s/g eenhouse-
gases.
Veliko a V., Fa es S. and Lo e o F. 2008. ‘Isop ene and Ni ic Oxide Reduce Damages in
Lea es Exposed o Oxida i e S ess’. Plan , Cell & En i onmen 31 (12): 1882–94.
h ps://doi.o g/10.1111/j.1365-3040.2008.01893.x.
Villain P., Mache R. and Zhou D.X. 1996. ‘The Mechanism o GT Elemen -Media ed Cell
Type-Speci ic T ansc ip ional Con ol’. The Jou nal o Biological Chemis y 271 (51).
h ps://doi.o g/10.1074/jbc.271.51.32593.
Vu o F., Janni M., Coppedè N., Gen ile F., Man edi R., Be elli M. and Zappe ini A. 2019.
‘De elopmen o an In Vi o Senso o Moni o he E ec s o Vapou P essu e De ici
(VPD) Changes o Imp o e Wa e P oduc i i y in Ag icul u e’. Senso s 19 (21): 4667.
h ps://doi.o g/10.3390/s19214667.
Wahid A., Gelani S., Ash a M. and Foolad M. 2007. ‘Hea Tole ance in Plan s: An
O e iew’. En i onmen al and Expe imen al Bo any 61 (3): 199–223.
h ps://doi.o g/10.1016/j.en expbo .2007.05.011.