scieee Science in your language
[en] (orig)

Diversity of Anaplasma species and importance of mixed infections in roe deer from Spain

Author: Remesar Alonso, Susana; Prieto Lago, Alberto; García-Dios, David; López-Lorenzo, Gonzalo; Martínez Calabuig, Néstor; Díaz Cao, José Manuel; Panadero Fontán, Rosario; López Sández, Ceferino Manuel; Fernández Rodríguez, Gonzalo; Díez Baños, Pablo; Morrondo
Publisher: Wiley
Year: 2021
DOI: 10.1111/tbed.14319
Source: https://minerva.usc.es/bitstreams/b54df0d2-4fbc-4cab-954a-617b075b90a8/download
Recei ed: 30 Ap il 2021 Re ised: 24 Augus 2021 Accep ed: 4 Sep embe 2021
DOI: 10.1111/ bed.14319
ORIGINAL ARTICLE
Di e si y o Anaplasma species and impo ance o mixed
in ec ions in oe dee om Spain
Susana Remesa Albe o P ie o Da id Ga cía-Dios Gonzalo López-Lo enzo
Nés o Ma ínez-Calabuig José Manuel Díaz-Cao Rosa io Panade o
Ce e ino Manuel López Gonzalo Fe nández Pablo Díez-Baños
Pa ocinio Mo ondo Pablo Díaz
In es igación en Sanidad Animal: Galicia
(G upo INVESAGA), Facul ade de Ve e ina ia,
Uni e sidade de San iago de Compos ela,
Lugo, Spain
Co espondence
Albe oP ie o,Facul addeVe e ina ia, Pabel-
lónI,CampusUni e si a ios/n. 27002, Lugo,
Spain.
Email:[email p o ec ed]
Funding in o ma ion
SpanishRoeDee Associa ion,G an /Awa d
Numbe :2016-CL018;AsociacióndelCo zo
Español(ACE),Spain);P og amme o Consol-
ida ingandS uc u ingCompe i i eResea ch
G oups,G an /Awa dNumbe :GRC2019/04;
Xun adeGalicia,Spain
Abs ac
Al hough wildli e can ac as ese oi s o some Anaplasma species, s udies on he
p esence and dis ibu ion o Anaplasma spp. in wild ce ids a e mainly limi ed and
ocusedonzoono icspecies.Ino de oiden i y heAnaplasma speciesin oedee om
Spain and o de ec co-in ec ions, 224 spleen samples we e es ed o Anaplasma spp.
using a comme cial qPCR; posi i e samples we e u he cha ac e ized using gene ic
16S RNA p ime s and species-speci ic p ime s a ge ing he msp2 and g oEL genes.
Anaplasma DNA was de ec ed in he 50.9% o samples, and ou Anaplasma species
we e iden i ied. Anaplasma phagocy ophilum (43.8%) was p edominan , ollowed by
Anaplasma bo is (13.8%), Anaplasma cap a (5.8%) and Anaplasma o is (2.2%). In addi ion,
s ains simila o Anaplasma pla ys we e ound in nine animals. Mos posi i e oe dee
(71.9%) we e in ec ed wi h a single Anaplasma species, whe eas co-in ec ions wi h wo
(19.3%) o h ee (8.8%) Anaplasma species we e also ound. This s udy con i ms he
widesp ead occu ence o Anaplasma spp. in oe dee om Spain, being he i s epo
o A. pla ys-like s ains and A. cap a in his ce id; i is also he i s epo o A. cap a
in Spain. The de ec ion o Anaplasma species pa hogenic o humans and/o domes ic
animals in oe dee sugges s ha his ce id may play a ole in he syl a ic cycle o
hese bac e ia con ibu ing o he appea ance o clinical anaplasmosis cases. In addi-
ion, co-in ec ions a e common in oe dee e ealing ha Anaplasma species speci ic
PCR assays a e essen ial o a eliable iden i ica ion as well as o de e mining hei
eal p e alence.
KEYWORDS
Anaplasma bo is,Anaplasma cap a,Anaplasma o is,Anaplasma phagocy ophilum,Anaplasma pla ys,
oe dee
This is an open access a icle unde he e ms o he C ea i e Commons A ibu ion-NonComme cial License, which pe mi s use, dis ibu ion and ep oduc ion in any
medium, p o ided he o iginal wo k is p ope ly ci ed and is no used o comme cial pu poses.
© 2021 The Au ho s. T ansbounda y and Eme ging Diseases published by Wiley-VCH GmbH
e374 wileyonlinelib a y.com/jou nal/ bed T ansbound Eme g Dis. 2022;69:e374–e385.
REMESAR ET AL.e375
1INTRODUCTION
Obliga ein acellula bac e iao he amilyAnaplasma aceae ha ebeen
epo ed wo ldwide in wildli e (Ga cía-Pé ez e al., 2016). Among
hem, se e al species belonging o he genus Anaplasma a e con-
side ed ae iological agen s o a numbe o ick-bo ne diseases in
mammalian hos s (Dumle e al., 2001) including bo ine (Anaplasma
ma ginale, Anaplasma bo is and Anaplasma cen ale) and o ine anaplas-
mosis (Anaplasma o is), human g anulocy ic anaplasmosis and ick-
bo ne e e o uminan s (Anaplasma phagocy ophilum) and canine
anaplasmosis (Anaplasma pla ys) (Ba ilani e al., 2017;delaFuen e
e al., 2005). Up o now, only A. phagocy ophilum, A. cap a, A. o is and
A. pla ys a e conside ed zoono ic (A aga-Al a ado e al., 2014;B e-
i schwe d e al., 2014; H. Li, Zheng, e al., 2015).
The dis ibu ion o each Anaplasma species depends on se e al
ac o s, mainly he p esence o p ope ick ec o species as well
as sui able hos s and compe en ese oi s (Es ada-Peña & de la
Fuen e, 2014). In his ega d, i has been epo ed ha wildli e, espe-
cially ce ids, can ac as ese oi s o asymp oma ic ca ie s o some
Anaplasma species (A i , 2016; Ben Said e al., 2015; de la Fuen e e al.,
2008; O e zie e al., 2013; Renneke e al., 2013). In Spain, Ixodes
icinus, Rhipicephalus sanguineus s.l., Rhipicephalus bu sa,Haemaphysalis
punc a a and De macen o e icula us a e conside ed he main ec o s
o Anaplasma spp. (Dan as-To es, 2010; Koenen e al. 2013; Po illo
e al., 2011; Paloma e al., 2015). Howe e , no anso a ial ansmis-
sion o he pa hogen has been demons a ed in hei ec o s (Riki-
hisa, 2011), and hus wild animals may play an impo an ole in main-
aining he ecological cycle o hese bac e ia in na u e (Di Domenico
e al., 2016; Woldehiwe , 2010). In his ega d, wild ce ids such as oe
dee (Cap eolus cap eolus) and ed dee (Ce us elaphus), oge he wi h
o he domes ic uminan s,a econside ed he main ese oi so A. o is,
showingp e alencesusuallyhighe han 50% using molecula me hods
(de la Fuen e e al., 2008; Ga cía-Pé ez e al., 2016; Y. Q. Li, Yang, e al.,
2015; Renneke e al., 2013). Simila ly, A. phagocy ophilum has been
molecula ly iden i ied (6%–98%) in ed dee , oe dee and allow dee
(Dama dama) (Hulínská e al., 2004; Hapunik e al., 2011; O e zie e al.,
2013; Scha e al., 2011; Teodo owski e al., 2020; Zeman & Pecha,
2008). A. bo is is a species less equen ly ound (4%–15%) in oe dee ,
whi e- ailed dee (Odocoileus i ginianus), ed dee o sika dee (Ce us
nippon) (Ga cía-Pé ez e al., 2016; Jilin ai e al., 2009; Kawaha a e al.,
2006; Y. Q. Li, Yang, e al., 2015). In addi ion, i has been epo ed ha
dee can de elop a pe sis en in ec ion wi h A. ma ginale o A. cen ale;
he high se op e alences de ec ed e eal ha hese wild ungula es a e
equen ly in con ac wi h hese pa hogens (A i , 2016). In ecen yea s,
new Anaplasma species ha e been p oposed; A. cap a, i s epo ed in
goa s om China (H. Li, Zheng, e al., 2015), has also been de ec ed in
ed dee om F ance (Jouglin e al., 2019). Finally, a molecula in es i-
ga ion pe o med in China also iden i ied o ganisms simila o A. pla ys
in ed dee (9%) and sika dee (15%) (Y. Q. Li, Yang, e al., 2015). Un a -
elling he ole o wild uminan s as ese oi s o di e en Anaplasma
species is o majo impo ance o a p ope unde s anding o he epi-
demiology o hese bac e ia. Ne e heless, mos Anaplasma in es iga-
ions in wildli e a e ocused on ew Anaplasma species, mainly A. phago-
cy ophilum.
Molecula s udies on he dis ibu ion o Anaplasma spp. in wild
ce ids om Spain a e sca ce and es ic ed o some a eas (de la
Fuen e e al., 2008; Ga cía-Pé ez e al., 2016; Po illo e al., 2011). Fou
Anaplasma species we e p e iously de ec ed in oe dee om Spain. In
no he n a eas, A. phagocy ophilum was he mos p e alen (61%), ol-
lowed by A. o is (53%), A. bo is (3.81%) and A. cen ale (0.95%) (Ga cía-
Pé ez e al., 2016). Howe e , in sou he n a eas, only A. o is (53%) and
A. phagocy ophilum (18%) we e de ec ed (de la Fuen e e al., 2008).
The e o e, he objec i e o he p esen s udy was o de e mine he
p e alence o Anaplasma spp. in oe dee hun ed in ou ecological
a eas co e ing he geog aphical dis ibu ion o his wild ce id in Spain.
In addi ion, he molecula iden i ica ion o hese species, hei dis i-
bu ion h oughou he coun y and he p esence o co-in ec ions we e
assessed. Finally, he possible in luence o he age and sex o he ani-
mals on he p e alence o hese pa hogens was s udied.
2MATERIAL AND METHODS
2.1 Sample collec ion and p ese a ion
Amongs he wild ce ids in Spain, oe dee is he second mos abun-
dan and hun ed species, wi h a popula ion a ound 200,000 specimens
(Escude o e al., 2020); a ailable o icial sou ces showed ha 66,737
oe dee we e hun ed in 2018 in he coun y (MAPA, 2021). Be ween
2013 and 2020, he whole spleen o 224 oe dee om all he dis i-
bu ion a eas o his wild ce id in Spain (Figu e 1a) was collec ed du -
ing ield e isce a ion by he hun e s o he Spanish Roe Dee Associ-
a ion (Asociación del Co zo Español). Mos o hese samples (n=212)
we e included in a p e ious s udy on he molecula cha ac e iza ion o
A. phagocy ophilum in oe dee (Remesa e al., 2020). All samples we e
collec ed, classi ied and p ese ed as p e iously epo ed (Remesa
e al., 2020). The loca ion, age and sex o each dee we e eco ded. The
age was es ima ed on he basis o ee h analysis (Høye, 2006). Rega d-
ing he loca ion, ou ecological a eas (con inen al, Medi e anean,
moun ainous and oceanic) we e es ablished as p e iously desc ibed
(Mo ondo e al., 2017).
The app o al o he E hics Commi ee/Wel a e Au ho i y was no
equi ed since all samples we e collec ed pos -mo em.
2.2 DNA ex ac ion, de ec ion and iden i ica ion
o Anaplasma species
DNA ex ac ion om splenic issue was pe o med as p e iously
desc ibed (Remesa e al., 2020). De ec ion o Anaplasma spp. DNA
was pe o med in hose samples ha es ed nega i e o A. phagocy-
ophilum (124/212) in he p e ious s udy (Remesa e al., 2020)aswell
as in 12 new samples using a comme cial qPCR a ge ing he msp4
gene (EXOone Anaplasma spp., Exopol, Za agoza, Spain). qPCR was
e376 REMESAR ET AL.
FIGURE 1 Maps showing oe dee dis ibu ion in Spain (a) and he ou ecological a eas (b- ). Do s ep esen he p esence o Anaplasma spp.
(a), Anaplasma phagocy ophilum (b), Anaplasma bo is (c), Anaplasma cap a (d), Anaplasma o is (e) and Anaplasma pla ys-like ( )
pe o med in an Applied Biosys ems 7500 Fas Real-Time PCR Sys-
em (The mo Fishe Scien i ic, Massachuse s, USA) ollowing he man-
u ac u e ’s ins uc ions. All Anaplasma spp. qPCR posi i e samples, and
hose p e iously epo ed as posi i e o A. phagocy ophilum (Remesa
e al., 2020), we e u he es ed using a PCR a ge ing he 16S RNA
gene o Anaplasma spp. (Table 1). A p e iously sequenced A. phagocy-
ophilum sample and dis illed wa e we e included in each ampli ica ion
eac ion as posi i e and nega i e con ols, espec i ely. PCR p oduc s
we e sepa a ed by elec opho esis on 1.5% aga ose gels s ained wi h
RedSa e (iN RON Bio echnology, Sou h Ko ea) and hen isualized
using a Fluo -S Mul iImage (Bio-Rad Labo a o ies, Cali o nia, USA).
The ob ained 16S RNA p oduc s we e pu i ied and sequenced in bo h
senses on an ABI 3730xl (Applied Biosys ems, Fos e Ci y, Cali o nia,
USA) using a BigDye Te mina o 3.1 Cycle Sequencing Ki (Applied
Biosys ems) a he Sequencing and F agmen Analysis Uni o he
San iago de Compos ela Uni e si y (Spain). Sequences we e aligned
and edi ed using Ch omasP o (Technelysium, B isbane, Aus alia) and
consensus sequences we e compa ed wi h sequences a ailable om
REMESAR ET AL.e377
TABLE 1 P ime s and p o ocols used o de ec ion and iden i ica ion o Anaplasma spp
Gene a ge P ime name P ime sequence 5′-3′F agmen size Re e ence
16sRNA o Anaplasma spp. AnaplsppF AGA AGA AGT CCC GGC AAA CT 518 bp (Zobba e al., 2014)
AnaplR3 GAG ACG ACT TTT ACG GAT TAG CTC
msp2 o Anaplasma
phagocy ophilum
msp2-3F CCA GCG TTT AGC AAG ATA AGA G 334 bp (Zeidne e al., 2000)
msp2-3R GCC CAG TAA CAA CAT CAT AAG C
g oEL o Anaplasma bo is Ab g oELF1 GTTCGCAGTATTTTGCCAGT ≈500 pb (Guo e al., 2019)
Ab g oELR CTGCRTTCAGAGTCATAAATAC
Ab g oELF2 ATCTGGAAGRCCACTATTGAT
Ab g oELR CTGCRTTCAGAGTCATAAATAC
g oEL o Anaplasma o is Ao g oELF AGCAAAATAGCGCAATGCGTC 722 bp (Belkahia e al., 2019)
Ao g oELR TCAACTCTATCCTTAAGCTC
g oEL o Anaplasma cap a Ac g oELF1 GCGAGGCGTTAGACAAGTCCATT 1264/1087 bp (Jouglin e al., 2019)
Ac g oELR3 TCCAGAGATGCGAGCGTGTATAG
Ac g oELF2 TGCACTGCTGGTCCAAAGGGGCT
Ac g oELR2 CAACTTCGCTAGAGCCGCCAACC
g oEL o Anaplasma pla ys Ap g oELF ATGGTATGCAGTTTGATCGC 624/515 bp (Belkahia e al., 2019)
Ap g oELR1 TCTACTCTGTCTTTGCGTTC
Ap g oELF ATGGTATGCAGTTTGATCGC
Ap g oELR2 CATAGTCTGAAGTGGAGGAC
he GenBank da abase using he Basic Local Alignmen Sea ch Tool
(BLAST; h p://blas .ncbi.nlm.nih.go /Blas .cgi).
Fi e di e en species-speci ic PCR es s a ge ing he msp2 gene
o A. phagocy ophilum and he g oEL gene o A. bo is,A. cap a,A. pla ys
and A. o is we e also pe o med in all qPCR posi i e samples, including
hose p e iously posi i e o A. phagocy ophilum, in o de o de e mine
he p esence o co-in ec ions. All PCR p o ocols we e pe o med using
p e iously epo ed p o ocols (Table 1), including posi i e and nega i e
con ols in each un assay.
Unique pa ial sequences iden i ied in his s udy we e deposi ed in
GenBank unde accession numbe s MW759445-MW759459.
2.3 S a is ical analysis
The possible in luence o he ecological a ea as well as bo h he age
and sex o oe dee on he p e alence o A. phagocy ophilum and A. bo is
was analyzed using a logis ic eg ession; isk analysis could no be pe -
o med on o he Anaplasma species due o hei low p e alence. The
numbe o samples o each ca ego y is summa ized in Table 2; in o ma-
ion om six oe dee was incomple e, so hey we e no age-classi ied
and one animal could no be sexed. Fac o s we e elimina ed om he
ini ial model using a backwa d and o wa d condi ional me hod based
on Akaike in o ma ion c i e ion (AIC) alue un il he bes model was
buil . All pai wise in e ac ions we e e alua ed. Odds a io (OR) we e
compu ed by aising ‘e’ o he powe o he logis ic coe icien o e he
i s ca ego y o each ac o ( e e ence ca ego y). The logis ic analyses
and he AIC selec ion we e pe o med wi h glm() and s ep() unc ions
in he R so wa e (R Co e Team, 2020). Le el o signi icance was se a
p- alues <.05.
Phylogene ic analyses we e ca ied ou using M Bayes 3.2.7 so -
wa e (Ronquis e al., 2012) by Bayesian app oach wi h Ma ko
Chain Mon e Ca lo sampling (10,000,000 gene a ions sampling e e y
1000 s eps). A Hasegawa-Kishino-Yano (HKY+G) and a Gene al Time
Re e sible subs i u ion model (GTR+G), bo h wi h gamma-dis ibu ed
a e a ia ion ac oss si es we e used o he analysis o Anaplasma
16s RNA and A. bo is g oEL sequences, espec i ely. Bo h models
we e selec ed based on AIC alue using he ee so wa e jModel-
Tes .2.1.10 (Da iba e al., 2012; Guindon & Gascuel, 2003). T ees
we e isualized and edi ed in FigT ee 1.4.3 (h p:// ee.bio.ed.ac.uk/
so wa e/ ig ee/).
3RESULTS
Mos o he 224 analyzed oe dee we e males (n=157) and adul s
(n=167). Rega ding ecological a eas, he highes numbe o samples
o igina ed om he oceanic a ea (n=77), ollowed by Medi e anean
(n=55) and bo h moun ainous and con inen al a eas (n=46 om each
a ea) (Table 2).
Fi s , qPCR esul s showed ha 114 ou o 224 (50.9%) spleen sam-
ples we e posi i e o Anaplasma spp. Subsequen ly, ampli ica ion a
he 16S RNA gene was de ec ed in 103 ou o 114 Anaplasma spp.
posi i e samples (90.4%). Sequence analysis a his gene allowed he
e378 REMESAR ET AL.
TABLE 2 P e alence o Anaplasma species in oe dee om Spain when conside ing he hun ing loca ion, he age and sex o he oe dee
Hun ing loca ion Sex Age
Oceanic
(n=77)
(95% CI)
Moun ain
(n=46)
(95% CI)
Con inen al
(n=46)
(95% CI)
Medi e anean
(n=55)
(95% CI)
Female
(n=66)
(95% CI)
Male
(n=157)
(95% CI)
Unknown
(n=1)
(95% CI)
Young
(n=51)
(95% CI)
Adul
(n=167)
(95% CI)
Unknown
(n=6)
(95% CI)
P e alence o each Anaplasma species de ec ed on he o al numbe o animals
A. phagocy ophilum 61.04%
(49.22–71.74)
17.39%
(8.32–31.95)
28.26%
(16.45–43.68)
54.55%
(40.66–67.80)
37.88%
(26.47–50.70)
46.50%
(38.56–54.60)
0.00%
(0.00–94.53)
37.88%
(34.95–63.23)
46.50%
(36.13–51.59)
0.00%
(0.00–48.32)
A. bo is 10.39%
(4.91–19.97)
8.70%
(2.82–21.69)
10.87%
(4.07–24.36)
25.46%
(15.09–39.27)
10.61%
(4.73–21.23)
15.29%
(10.23–22.09)
0.00%
(0.00–94.53)
10.61%
(3.67–22.19)
15.29%
(10.10–21.50)
16.67%
(0.88–63.62)
A. o is 0.00%
(0.00–5.92)
0.00%
(0.00–21.69)
6.52%
(17.00–48.93)
3.64%
(0.63–13.60)
4.55%
(1.18–13.56)
1.27%
(0.22–5.00)
0.00%
(0.00–94.53)
4.55%
(1.53–17.23)
1.27%
(00.21–4.71)
0.00%
(0.00–48.32)
A. cap a 1.30%
(0.00–8.01)
0.00%
(0.00–21.69)
6.52%
(17.00–48.93)
16.36%
(8.20–29.30)
0.00%
(0.00–6.85)
8.28%
(4.66–14.03)
0.00%
(0.00–94.53)
0.00%
(0.10–11.79)
8.28%
(3.39–12.50)
0.00%
(0.00–48.32)
A. pla ys-like 0.00%
(0.00–5.92)
0.00%
(0.00–21.69)
2.17%
(0.11–12.97)
14.55%
(6.93–27.22)
0.00%
(0.00–6.85)
5.73%
(2.82–10.93)
0.00%
(0.00–94.53)
0.00%
(0.10–11.79)
5.73%
(2.24–9.55)
0.00%
(0.00–48.32)
P e alence o Anaplasma single species and coin ec ions de ec ed on he o al numbe o animals
A. phagocy ophilum 54.55%
(42.84–65.79)
13.04%
(5.42–26.95)
15.22%
(6.84–29.48)
21.82%
(12.25–35.36)
30.30%
(19.91–43.00)
29.94%
(23.03–37.84)
0.00%
(0.00–94.54)
35.29%
(22.80–50.00)
29.34%
(22.69–36.96)
0.00%
(0.00–48.32)
A. bo is 3.90%
(1.01–11.73)
4.35%
(0.76–16.04)
6.52%
(1.70–18.93)
1.82%
(0.00–10.99)
7.58%
(2.82–17.50)
2.55%
(0.82–6.81)
0.00%
(0.00–94.54)
3.92%
(0.68–14.59)
3.59%
(1.47–8.01)
16.67%
(0.88–63.52)
A. cap a 0.00%
(0.00–5.92)
0.00%
(0.00–9.60)
6.52%
(1.70–18.93)
5.45%
(1.12–16.07)
0.00%
(0.00–6.69)
3.82%
(1.56–8.50)
0.00%
(0.00–94.54)
1.96%
(0.10–11.79)
2.99%
(1.11–7.22)
0.00%
(0.00–48.32)
A. phagocy ophilum +A.
bo is
5.19%
(1.68–13.47)
4.35%
(0.76–16.04)
4.35%
(0.76–16.04)
7.27%
(2.36–18.43)
3.03%
(0.53–11.48)
6.37%
(3.27–11.72)
0.00%
(0.00–94.54)
5.88%
(1.53–17.23)
5.39%
(2.66–10.30)
0.00%
(0.00–48.32)
A. phagocy ophilum +A.
o is
0.00%
(0.00–5.92)
0.00%
(0.00–9.60)
6.52%
(1.70–18.93)
0.00%
(0.00–8.13)
4.55%
(1.18–13.56)
0.00%
(0.00–2.98)
0.00%
(0.00–94.54)
5.88%
(1.53–17.23)
0.00%
(0.00–2.80)
0.00%
(0.00–48.32)
A. phagocy ophilum +A.
pla ys-like
0.00%
(0.00–5.92)
0.00%
(0.00–9.60)
2.17%
(0.11–12.97)
9.09%
(3.40–20.71)
0.00%
(0.00–6.69)
3.82%
(1.56–8.50)
0.00%
(0.00–94.54)
1.96%
(0.10–11.79)
2.99%
(1.11–7.22)
0.00%
(0.00–48.32)
A. bo is +A. cap a 0.00%
(0.00–5.92)
0.00%
(0.00–9.60)
0.00%
(0.00–9.60)
1.82%
(0.09–10.99)
0.00%
(0.00–6.69)
0.64%
(0.03–4.03)
0.00%
(0.00–94.54)
0.00%
(0.00–8.73)
0.60%
(0.03–3.80)
0.00%
(0.00–48.32)
A. phagocy ophilum +A.
bo is +A. cap a
1.30%
(0.07–8.01)
0.00%
(0.00–9.60)
0.00%
(0.00–9.60)
7.27%
(2.36–18.43)
0.00%
(0.00–6.69)
3.18%
(1.18–7.66)
0.00%
(0.00–94.54)
0.00%
(0.00–8.73)
2.99%
(1.11–7.22)
0.00%
(0.00–48.32)
A. phagocy ophilum +A.
bo is +A. pla ys-like
0.00%
(0.00–5.92)
0.00%
(0.00–9.60)
0.00%
(0.00–9.60)
5.45%
(1.12–16.07)
0.00%
(0.00–6.69)
1.91%
(0.49–5.92)
0.00%
(0.00–94.54)
0.00%
(0.00–8.73)
1.80%
(0.47–5.58)
0.00%
(0.00–48.32)
A. phagocy ophilum +A.
o is +A. cap a
0.00%
(0.00–5.92)
0.00%
(0.00–9.60)
0.00%
(0.00–9.60)
1.82%
(0.09–10.99)
0.00%
(0.00–6.69)
0.64%
(0.03–4.03)
0.00%
(0.00–94.54)
0.00%
(0.00–8.73)
0.60%
(0.03–3.80)
0.00%
(0.00–48.32)
A. phagocy ophilum +A.
bo is +A. o is
0.00%
(0.00–5.92)
0.00%
(0.00–9.60)
0.00%
(0.00–9.60)
1.82%
(0.09–10.99)
0.00%
(0.00–6.69)
0.64%
(0.03–4.03)
0.00%
(0.00–94.54)
0.00%
(0.00–8.73)
0.60%
(0.03–3.80)
0.00%
(0.00–48.32)
To al 64.94%
(53.14–75.23)
21.74%
(11.45–36.76)
41.30%
(27.34–56.71)
63.64%
(49.51–75.86)
45.45%
(33.32–58.11)
53.50%
(45.40–61.44)
0.00%
(0.00–94.54)
54.90%
(40.45–68.61)
50.90%
(43.09–58.67)
16.67%
(0.88–63.52)
Abb e ia ion: CI, con idence in e al.

REMESAR ET AL.e379
FIGURE 2 Phylogene ic ee clus e ing o he pa ial 16S RNA gene o Anaplasma spp. The ee was ob ained using a Hasegawa-Kishino-Yano
wi h gamma-dis ibu ed a e a ia ion ac oss si es me hod (HKY+G) wi h he so wa e M Bayes 3.2.7 (Ronquis e al., 2012)byBayesian
app oach wi h Ma ko Chain Mon e Ca lo sampling (10,000,000 gene a ions sampling e e y 1000 s eps). The nucleo ide sequence o Eh lichia
canis was used as an ou g oup. Isola es iden i ied in his s udy (*)
iden i ica ion o i e Anaplasma species: A. phagocy ophilum (68/103),
A. bo is (11/103), A. cap a (11/103), A. o is (4/103) and A. pla ys-
like (9/103). Finally, and a e pe o ming he species-speci ic PCRs,
98 samples es ed posi i e o he msp2 gene o A. phagocy ophilum
(98/114) and 31 ampli ied h ough he s udy o he pa ial g oEL gene
o A. bo is (31/114). A low numbe o samples we e posi i e o A. cap a
(13/114) and A. o is (5/114) g oEL gene speci ic PCRs. All A. pla ys-like
samples we e nega i e o he PCR assay a ge ing he speci ic g oEL
gene o A. pla ys. Sequence analysis o he species-speci ic PCRs a he
msp2 and g oEL genes con i med species iden i ica ion in all 16S RNA-
posi i e samples excep hose iden i ied as A. pla ys-like.
All A. phagocy ophilum, A. bo is, A. cap a and A. o is 16S RNA
sequences showed a homology highe han 99.5% when compa ed o
e e ence sequences (Suppo ing In o ma ion Ma e ial 1)andwe e
clea ly sepa a ed in ou clades in he phylogene ic analysis o his
gene (Figu e 2). In addi ion, A. pla ys-like sequences we e g ouped in
a clade including A. pla ys and Candida us Anaplasma camelii e e ence
sequences (Figu e 2). Mos o hem (5/9) p esen ed a homology highe
han 99.5% wi h he A. pla ys sequence KX987336 ob ained om
icks in China (Lu e al., 2017). The o he ou A. pla ys-like samples
showed a homology highe han 99.4% when compa ed o sequences
iden i ied as Candida us Anaplasma camelii (MT510533) and A. pla ys
(MN266939) ob ained om camels and ca le in Kenya, espec i ely
(Kidambasi e al., 2020; Sang e al., 2006).
A. phagocy ophilum sequences ob ained h ough he s udy o msp2
gene we e iden ical o hose deposi ed in GenBank (Suppo ing In o -
ma ion Ma e ial 1). Howe e , A. bo is g oEL ob ained sequences
exhibi ed a 93%–97% homology when compa ed o he deposi ed
A. bo is sequences MH255909, MK340768, MK340781 MK340800
and MK340803 de ec ed in goa s and icks om China (Guo e al.,
2018). Finally, all A. cap a (5.8%; 13/224) and A. o is (2.2%; 5/224)
g oEL sequences showed a simila i y highe han 99.3% o A. cap a
(MH084718) and A. o is (MG869402) sequences ob ained om a ed
dee in F ance (Jouglin e al., 2019) and om a goa in China (Guo e al.,
2018), espec i ely.
When conside ing he o e all p e alences o each Anaplasma
species, he mos equen species was A. phagocy ophilum (43.8%;
98/224), ollowed by A. bo is (13.8%; 31/224), A. cap a (5.8%; 13/224)
and A. o is (2.2%; 5/224); Anaplasma pla ys-like mic oo ganisms we e
iden i ied in 4% o samples (9/224). In ec ions wi h a single Anaplasma
species we e p edominan , wi h A. phagocy ophilum in ec ions he
mos equen , ollowed by A. bo is and A. cap a in ec ions (Table 2).
The emaining Anaplasma-posi i e oe dee showed co-in ec ions
wi h wo o h ee di e en Anaplasma species. The combina ion o
e380 REMESAR ET AL.
TABLE 3 Logis ic eg ession model o he p e alence o Anaplasma spp.; A.phagocy ophilum; A. bo is and Anaplasma spp. co-in ec ions. Fac o s
we e emo ed ollowing he Akaike in o ma ion c i e ion alue un il he bes model was buil
Es ima e z-Value p-Value OR CI 95%
Anaplasma spp.
(In e cep ) 0.89475 2.220 .0265 2.4467287 1.12977872–5.5386893
Oceanica ea -----
Moun ainous a ea −1.86743 −4.269 1.96e-05 0.1545197 0.06289031–0.3532744
Con inen al a ea −0.88340 −2.231 .0257 0.4133771 0.18787941–0.8924070
Medi e anean a ea - - - - -
Moun ain a ea −1.90887 −3.884 .000103 0.1482478 0.05439368–0.3771746
Con inen al a ea −0.92483 −2.105 .035292 0.3965983 0.16509069–0.9298878
Anaplasma phagocy ophilum
(In e cep ) 0.7141 0.4013 .07519 2.0422583 0.94101393–4.5823094
Oceanica ea -----
Moun ainous a ea −1.9753 −4.289 1.79e-05 0.1387200 0.05310513–0.3283898
Con inen al a ea −1.2296 −2.996 .00274 0.2923980 0.12759746–0.6427744
Medi e anean a ea - - - - -
Moun ain a ea −1.7996 −3.523 .000426 0.1653665 0.05773717–0.4337461
Con inen al a ea −1.7996 −2.334 .019583 0.3485644 0.14046084–0.8312083
Anaplasma bo is
(In e cep ) −2.30777 −3.657 .000255 0.09948325 0.02514075–0.3075346
Oceanica ea -----
Medi e anean a ea 1.04792 2.007 .044790 2.85170011 1.05189758–8.3249287
Anaplasma spp. coin ec ions
(In e cep ) −0.23295 −0.310 .756305 0.7921971 0.17178867–3.3844292
Medi e aneana ea-----
Oceanic a ea −2.13901 −3.617 .000298 0.1177710 0.03319924–0.3488534
Moun ain a ea −2.51042 −3.017 .002554 0.0812342 0.01145065–0.3436545
Con inen al a ea −1.20123 −2.090 .036607 0.3008250 0.08979144–0.8790248
Abb e ia ions: CI, con idence in e al; OR, odds a io.
A. phagocy ophilum/A. bo is and A. phagocy ophilum/A. pla ys-like was
he mos p e alen dual co-in ec ions. Finally, he mos common iple
co-in ec ion was he associa ion o A. phagocy ophilum/A. bo is/A. cap a
(Table 2).
Using logis ic eg ession, signi ican di e ences in he p e alence
o A. phagocy ophilum and A. bo is we e only ound when conside -
ing he ecological a ea (Table 3). Thus, oe dee om oceanic a eas
showed a lowe p obabili y o being posi i e o A. phagocy ophilum
han hose om con inen al (OR =0.29) and moun ainous (OR =0.14)
a eas; he isk o being posi i ewas also lowe inanimals om Medi e -
anean a eas han in hose om con inen al (OR =0.35) and moun-
ainous a eas (OR =0.17) (Table 3). In addi ion, logis ic eg ession
showed ha oe dee om Medi e anean a eas p esen ed a p oba-
bili y o be posi i e o A. bo is 2.9- old highe han hose om oceanic
a eas (Table 3). Due o he low numbe o A. cap a, A. o is and A.
pla ys-like posi i e animals, isk analysis was no pe o med o hese
species.
4DISCUSSION
I has been demons a ed ha wild ungula es can play an impo an
ole in he epidemiology o some ick-bo ne pa hogens, mos ly ac -
ing as ca ie s (A i , 2016). In he pas yea s, changes in land use and
u baniza ion ha e led o an inc eased in e ac ion be ween wildli e and
humans and domes ic animals, inc easing he isk o ansmission o
hese pa hogens (Mackens ed e al., 2015). De ec ion and iden i ica-
ion o Anaplasma species p esen in wild ungula es is a majo goal o
assessing he ole o hese animals on hei epidemiology.
Ou da a e ealed ha Anaplasma in ec ions a e e y p e alen in
oe dee om Spain, ag eeing wi h p e ious molecula in es iga ions
pe o med in oe dee (65.7%–70.6%), ed dee (50%) and allow dee
(50%) om no he n a eas o he coun y (de la Fuen e e al., 2008;
Ga cía-Pé eze al., 2016). No iceablep e alence aluesha e also been
epo ed in o he wild ce id species om o he coun ies such as sika
dee om Japan (39.7%; Kawaha a e al., 2006) and China (50%; Y. Q.
REMESAR ET AL.e381
Li, Yang, e al., 2015). All hese da a demons a e ha Anaplasma in ec-
ions a e e y equen in ce ids, sugges ing ha hese wild animals
may ac as ese oi s o his pa hogen.
The esul s o his s udy show ha wild ce ids can be in ec ed by
a wide di e si y o Anaplasma species. In his ega d, h ee o he ou
Anaplasma species de ec ed (A. phagocy ophilum, A. bo is and A. o is)
ha e been p e iously epo ed in oe dee om Spain (de la Fuen e
e al., 2008; Ga cía-Pé ez e al., 2016). Inaddi ion, his is he i s epo
o A. cap a and A. pla ys-like s ains in Eu opean oe dee .
A. phagocy ophilum has been epo ed in a wide ange o animal
speciesaswellasinhumans(A i ,2016; S uen e al., 2013); ne e -
heless, no all A. phagocy ophilum s ains a e zoono ic since di e en
a ian s adap ed o pa icula geog aphical a eas and hos s ha e
been iden i ied (Jah a i e al., 2014). Ou esul s a e consis en wi h
p e ious in es iga ions demons a ing ha A. phagocy ophilum is e y
p e alen in oe dee om di e en Eu opean coun ies (A i , 2016;
Teodo owski e al., 2020). P e ious da a om oe dee in Spain showed
a high p e alence and a iabili y o A. phagocy ophilum s ains, demon-
s a ing ha his wild ungula e is a ese oi o hei own s ains as
well as some pa hogenic A. phagocy ophilum a ian s o humans and
domes ic animals (Remesa e al., 2020).
I is wo h no ing ha mos molecula in es iga ions on he p es-
enceo Anaplasma spp. in wild ungula es we e only ocused on A. phago-
cy ophilum because o i s zoono ic po en ial, so da a on he p e a-
lence o o he Anaplasma species is s ill limi ed. Ou esul s e ealed
ha A. bo is was he second mos p e alen Anaplasma species in he
sampled animals. This species is common in se e al domes ic animals,
being mo e p e alen in sheep and goa s (16%–43%) han in ca le
(≈4%) (Ben Said e al., 2015; Belkahia e al., 2015; Ceci e al., 2014;
Liue al.,2012; Nai e al., 2013; Ooshi o e al., 2008; Yang e al.,
2015). I was also iden i ied in a low- o-mode a e pe cen age (4%–
15%) o wild uminan s such as oe dee , whi e- ailed dee , ed dee
and sika dee (Ga cía-Pé ez e al., 2016; Kawaha a e al., 2006;Y.Q.
Li, Yang, e al., 2015), ag eeing wi h ou esul s. P e ious s udies ana-
lyzing he g oEL gene o A. bo is demons a ed a high gene ic in a-
species di e si y sugges ing he exis ence o di e en lineages (Guo
e al., 2018), as obse ed in a phylogene ic ee (Suppo ing In o -
ma ion Ma e ial 2); his ac may explain he pe cen ages o iden i y
be ween ou sequences and o he deposi ed A. bo is sequences (Sup-
po ing In o ma ion Ma e ial 1).
A. cap a and A. o is we e de ec ed in a low pe cen age o oe dee
om Spain. A. cap a was i s ly epo ed in goa s om China (H. Li,
Zheng, e al., 2015) and since hen i has been la gely de ec ed in
Asian coun ies; hus, i has been ound in sheep, ca le, Sibe ian oe
dee , dogs, icks and e en humans wi h p e alences anging om 6%
o 12% (Peng e al., 2018; Shi e al., 2019; Seo e al., 2020; Yang e al.,
2016). Ne e heless, a ecen in es iga ion also iden i ied his species
in some dee species such as ed dee (3.4%) and swamp dee (Ruce us
du aucelii) (14.3%) om F ance, being he i s epo o A. cap a ou -
side Asia (Jouglin e al., 2019); hese p e alence alues ag ee wi h ha
de ec ed in he p esen s udy. Thus, his is he i s epo o A. cap a
in Spain and he second epo in Eu ope. I is wo h no ing he sim-
ila i y o A. cap a and A. cen ale sequences a he 16S RNA gene, as
can be obse ed in Figu e 2, ha may lead o hei misiden i ica ion. In
ac , A. cen ale isola es de ec ed in dee om Japan by Kawaha a e al.
(2006) showed 16S RNA sequences iden ical o he A. cap a sequence
MH762077 (Guo e al., 2018), sugges ing ha molecula analysis a
mo e han one gene is equi ed in o de o achie e a eliable iden i-
ica ion o bo h species. In addi ion, A. o is was iden i ied in a limi ed
numbe o animals; his species has been de ec ed in sheep and goa s
om Sou he n Eu ope (I aly and Po ugal), Asia (Tu key, I an, I aq, Pak-
is an and China) and A ica (Kenya) wi h p e alence alues anging
om 37% o 87% (Ahmadi-hamedani e al., 2012; Khan e al., 2015;
Renneke e al., 2013; To ina e al., 2010; Yang e al., 2015). In con as ,
da a on he p e alence o A. o is in dee is limi ed and es ic ed o a
epo in sika dee (20%) and ed dee (32%) om China (Y. Q. Li, Yang,
e al., 2015). I has been also ound in a high pe cen age (53%) o oe
dee om Spain (de la Fuen e e al., 2008); he no iceable di e ences
obse ed when compa ed o ou da a may be ela ed o a decline in
he numbe o sheep ex ensi e a ms in Spain in he las decade (A i ,
2016). In ac , a 22.4% educ ion in he Spanish sheep popula ion was
epo ed in he las 10 yea s (Escude o e al, 2020).
In he pas yea s, s ains closely ela ed o A. pla ys ha e been iden-
i ied in se e al domes ic animals such as ca le, goa s, sheep, ca s and
camels(Ai Lbachae al.,2017; Belkahia e al., 2015; Dahmani e al.,
2015; H. Li, Zheng, e al., 2015; Y. Li, Chen, e al., 2015; Selmi e al.,
2019; Wei e al., 2020; Zobba e al., 2014) as well as ed dee and sika
dee om China (Y. Q. Li, Yang, e al., 2015). Molecula da a e ealed
pe cen ages o iden i y anging om 92% o 99% when compa ed o
canine A. pla ys sequences a 16S RNA and g oEL genes (Belkahia e al.,
2015). In his s udy, A. pla ys-like s ains we e de ec ed in nine animals,
mos o hem om he Medi e anean a ea (Figu e 1 ), being i s i s
epo in oe dee . I is also wo h no ing ha all posi i e A. pla ys-like
oe dee showed co-in ec ions wi h A. phagocy ophilum. I mus be con-
side ed ha only he 16S RNA gene was s udied since he esul s o all
samples we e nega i e when analyzed using an A. pla ys speci ic PCR
a ge ing he g oEL gene.These esul smigh indica e ha heses ains
may be mo e ela ed o he s ains p e iously de ec ed in camels han
o A. pla ys epo ed in dogs (Belkahia e al., 2015).
Riskanalysis showed ha hep e alenceo someAnaplasma species
was only in luenced by he ecological a ea (Figu e 1). A. phagocy-
ophilum and A. bo is showed a wide geog aphical dis ibu ion since
hey we e he only species de ec ed in all he s udied a eas (Fig-
u e 1b,c), al hough i could be he esul o hei high p e alences. The
signi ican di e ences obse ed in he p e alences o hese species a e
p obably ela ed o he dis ibu ion o hei majo ec o s (Remesa
e al., 2020). The p e alence o A. phagocy ophilum in oe dee (Fig-
u e 1b) was signi ican ly highes in a eas wi h oceanic clima e loca ed
in he no h o he coun y, whe e i s main ec o , Ixodes icinus,ismo e
abundan since i needs na ow diu nal empe a u e a ia ions and
high humidi y (Es ada-Peña, 2017; Pé ez-La o e e al., 1999); in ac ,
I. icinus is he mos equen ly epo ed ick species pa asi izing dee
om no he n oceanic a eas (Vázquez e al., 2011). In con as , icks o
he genus Rhipicephalus and Haemaphysalis, which a e conside ed he
main ec o s o A. bo is (A i , 2016), a e ecologically e y adap able and
ole a e di e en clima ic en i onmen s (Es ada-Peña e al., 2017).
e382 REMESAR ET AL.
In addi ion, p e ious s udies showed ha icks om he genus Rhipi-
cephalus a e e y common in ungula es om Medi e anean a eas o
Spain(Con e ase al.,2020; Ruíz-Fons e al., 2006).In hesameway,A.
cap a, A. o is and A. pla ys-like ha e also been epo ed in some species
o he genus Haemaphysalis and Rhipicephalus (de la Fuen e e al., 2007;
Guo e al., 2018; Yang e al., 2016),whichmayexplain hei highes
p e alences in con inen al and Medi e anean a eas.
In o ma ion abou Anaplasma co-in ec ions in dee is cu en ly lim-
i ed. In his ega d, i has been sugges ed ha in ec ions wi h a pa icu-
la Anaplasma species mayexcludein ec ionswi ho he Anaplasma spp.
(de la Fuen e e al., 2002; S uen e al., 2005). Ne e heless, he use o
species-speci ic p ime s in he p esen s udy allowed de e mining ha
Anaplasma co-in ec ions we e e y equen in oe dee since abou
30% o animals we e in ec ed wi h wo o h ee Anaplasma species.
These esul s a e consis en wi h he ac ha dee is usually highly
in es ed wi h icks, showing high p e alences o ick-bo ne pa hogens
(Po illo e al., 2011; Remesa e al., 2020; Vázquez e al., 2011). The
li le in o ma ion a ailable on Anaplasma co-in ec ions may be ela ed
o he equen use o gene ic PCR p o ocols in Anaplasma molecu-
la in es iga ions, allowing he selec i e ampli ica ion o he dominan
species (Ga cía-Pé ez e al., 2016; Yu e al., 2020) and hus masking co-
in ec ions. Ou esul s e eal ha pe o ming species-speci ic PCRs is
s ongly needed o de ec ing co-in ec ions as well as o achie ing a
eliableiden i ica ion o Anaplasma species, especially hoselessp e a-
len , and es ima ing hei eal p e alence.
5CONCLUSIONS
This s udy con i ms ha Anaplasma spp. is e y p e alen in oe dee
om Spain, being widesp ead in he dis ibu ion a ea o his ce id.
In addi ion, ou da a suppo ha oe dee can hos a wide di e si y
o Anaplasma species. This s udy also ep esen s he i s epo o A.
cap a and A. pla ys-like s ains in Spain. Since some Anaplasma species
de ec ed a e conside ed pa hogenic o domes ic animals (A. phagocy-
ophilum,A.bo is,A. o is and A. cap a) o e en zoono ic (A. cap a and A.
phagocy ophilum), ou esul s sugges ha oe dee may play an impo -
an ole in he syl a ic cycle o hese pa hogens con ibu ing o he
appea ance o clinical anaplasmosis cases in bo h domes ic animals
and humans. The majo ac o in luencing he p esence o A. phago-
cy ophilum and A. bo is was he geog aphical loca ion, which could be
ela ed o he p esence o hei main ec o s.
Finally, co-in ec ions wi h wo o h ee di e en Anaplasma species
a e equen in oe dee and mo e common han expec ed; he e o e,
using Anaplasma species speci ic PCR p o ocols is essen ial o a eli-
able iden i ica ion as well as o de e mining hei eal p e alence.
ACKNOWLEDGEMENTS
We would like o hank ACE hun e s and “O Ve al” Reco e y Cen e
o Wild Animals s a o hei ines imable collabo a ion in collec ing
samples. This esea ch was suppo ed by a p ojec g an awa ded by
he Spanish Roe Dee Associa ion (2016-CL018; Asociación del Co zo
Español (ACE), Spain), he P og amme o Consolida ing and S uc-
u ing Compe i i e Resea ch G oups (GRC2019/04; Xun a de Galicia,
Spain).
CONFLICT OF INTEREST
The au ho s decla e no con lic o in e es .
ETHICS STATEMENT
No animals we e culled o he pu pose o his s udy. All samples
we e ob ained pos -mo em and kindly p o ided by he Spanish Roe
Dee Associa ion (ACE). Animals we e hun ed in acco dance wi h
he Spanish Hun e Code: (h ps://www.boe.es/biblio eca_ju idica/
codigos/ab i _pd .php? ich=095_Codigo_de_Caza.pd ).
DATA AVAILABILITY STATEMENT
The da a ha suppo s he indings o his s udy a e a ailable in he
supplemen a y ma e ial o his a icle.
ORCID
Albe o P ie o h ps://o cid.o g/0000-0002-3211-3494
José Manuel Díaz-Cao h ps://o cid.o g/0000-0002-8119-7057
Pablo Díez-Baños h ps://o cid.o g/0000-0003-2445-1095
REFERENCES
Ahmadi-hamedani, M., Khaki, Z., Rahba i, S., & Ahmadi-hamedani, M.
A. (2012). Hema ological p o iles o goa s na u ally in ec ed wi h
Anaplasma o is in no h and no heas I an. Compa a i e Clinical Pa hol-
ogy,21, 1179–1182. h ps://doi.o g/10.1007/s00580-011-1257-9
Ai Lbacha, H., Alali, S., Zouagui, Z., El Mamoun, L., Rhalem, A., Pe i , E., Had-
dad,N.,Gandoin, C.,Boulouis, H.J.,&Mailla d,R. (2017).High p e alence
o Anaplasma spp. in small uminan s in Mo occo. T ansbounda y and
Eme ging Diseases,64, 250–263. h ps://doi.o g/10.1111/ bed.12366
A aga-Al a ado, C. M., Qu ollo, B. A., Pa a, O. C., Be ue a, M. A., Hega y,
B. C., & B ei schwe d , E. B. (2014). Case epo : Molecula e idence o
Anaplasma pla ys in ec ion in wo women om Venezuela. The Ame ican
Jou nal o T opical Medicine and Hygiene,91(6), 1161–1165. h ps://doi.
o g/10.4269/aj mh.14-0372
A i , F. A. (2016). Alpha p o eobac e ia o genus Anaplasma (Ricke siales:
Anaplasma aceae): Epidemiology and cha ac e is ics o Anaplasma
species ela ed o e e ina y and public heal h impo ance. Pa asi ology,
143(6), 659–685. h ps://doi.o g/10.1017/S0031182016000238
Ba ilani, M., De A cangeli, S., Balboni, A., & Dondi, F. (2017). Gene ic di e -
si y and molecula epidemiology o Anaplasma.In ec ion, Gene ics and
E olu ion: Jou nal o Molecula Epidemiology and E olu iona y Gene ics in
In ec ious Diseases,49, 195–211. h ps://doi.o g/10.1016/j.meegid.2017.
01.021
Belkahia, H., Ben Said, M., Sayahi, L., Albe i, A., & Messadi, L. (2015). De ec-
ion o no el s ains gene ically ela ed o Anaplasma pla ys in Tunisian
one-humped camels (Camelus d omeda ius). Jou nal o In ec ion in De el-
oping Coun ies,9(10), 1117–1125. h ps://doi.o g/10.3855/jidc.6950
Belkahia, H., Ben Said, M., Gh ibi, R., Selmi, R., Ben Aske , A., Yahiaoui,
M., Bous ih, M., Daaloul-Jedidi, M., & Messadi, L. (2019). Molecula
de ec ion, geno yping and phylogeny o Anaplasma spp. in Rhipicephalus
icks om Tunisia. Ac a opica,191, 38–49. h ps://doi.o g/10.1016/j.
ac a opica.2018.12.034
Ben Said, M., Belkahia, H., Ka aoud, M., Bous ih, M., Yahiaoui, M., Daaloul-
Jedidi,M., &Messadi, L.(2015).Fi s molecula su eyo Anaplasma bo is
in small uminan s om Tunisia. Ve e ina y Mic obiology,179(3–4), 322–
326. h ps://doi.o g/10.1016/j. e mic.2015.05.022
B ei schwe d , E. B., Hega y, B. C., Qu ollo, B. A., Sai o, T. B., Maggi, R.
G., Blan on, L. S., & Bouye , D. H. (2014). In a ascula pe sis ence o