scieee Science in your language
[en] (orig)

Maternal diet determines milk microbiome composition and offspring gut colonization in Wistar rats

Abstract

This article belongs to the Special Issue Maternal Nutritional Status and Gut Microbiome Composition.

Read accessible full text

Maternal diet determines milk microbiome composition and offspring gut colonization in Wistar rats

Author: Martínez-Oca, Paula,Alba, Claudio,Sánchez-Roncero, Alicia,Fernández-Marcelo, Tamara,Martín, M. Ángeles,Escrivá, Fernando,Rodríguez, Juan M.,Álvarez, Carmen,Fernández-Millán, Elisa
Publisher: Multidisciplinary Digital Publishing Institute
DOI: http://dx.doi.org/10.13039/501100004587
Source: https://digital.csic.es/bitstream/10261/342024/1/maternalrats.pdf
Ci a ion: Ma ínez-Oca, P.; Alba, C.;
Sánchez-Ronce o, A.;
Fe nández-Ma celo, T.; Ma ín, M.Á.;
Esc i á, F.; Rod íguez, J.M.; Ál a ez,
C.; Fe nández-Millán, E. Ma e nal
Die De e mines Milk Mic obiome
Composi ion and O sp ing Gu
Coloniza ion in Wis a Ra s. Nu ien s
2023,15, 4322. h ps://doi.o g/
10.3390/nu15204322
Academic Edi o : Ma loes
Dekke Ni e
Recei ed: 14 Sep embe 2023
Re ised: 7 Oc obe 2023
Accep ed: 9 Oc obe 2023
Published: 10 Oc obe 2023
Copy igh : © 2023 by he au ho s.
Licensee MDPI, Basel, Swi ze land.
This a icle is an open access a icle
dis ibu ed unde he e ms and
condi ions o he C ea i e Commons
A ibu ion (CC BY) license (h ps://
c ea i ecommons.o g/licenses/by/
4.0/).
nu ien s
A icle
Ma e nal Die De e mines Milk Mic obiome Composi ion and
O sp ing Gu Coloniza ion in Wis a Ra s
Paula Ma ínez-Oca 1,† , Claudio Alba 2,† , Alicia Sánchez-Ronce o 3, Tama a Fe nández-Ma celo 4,
Ma íaÁngeles Ma ín4,5 , Fe nando Esc i á3,4, Juan Miguel Rod íguez 2, Ca men Ál a ez 3,4
and Elisa Fe nández-Millán3,4,*
1Ins i u o de In es igación en Ciencias de la Alimen ación (CIAL), Campus de Excelencia Cien í ica,
Consejo Supe io de In es igaciones Cien í icas-Uni e sidad Au ónoma de Mad id (CSIC-UAM),
28049 Mad id, Spain; [email p o ec ed]
2Depa men o Nu i ion and Food Science, Facul y o Ve e ina y Sciences, Uni e si y Complu ense o
Mad id, 28040 Mad id, Spain; [email p o ec ed] (C.A.); jm [email p o ec ed] (J.M.R.)
3
Depa men o Biochemis y and Molecula Biology, Facul y o Pha macy, Complu ense Uni e si y o Mad id,
28040 Mad id, Spain; [email p o ec ed] (A.S.-R.); [email p o ec ed] (F.E.); [email p o ec ed] (C.Á.)
4Cen o de In es igación Biomédica en Red (CIBERDEM), ISCIII, 28029 Mad id, Spain;
[email p o ec ed] (T.F.-M.); [email p o ec ed] (M.Á.M.)
5Depa men o Me abolism and Nu i ion, Ins i u e o Food Science and Technology and Nu i ion (ICTAN),
Consejo Supe io de In es igaciones Cien í icas (CSIC), 28040 Mad id, Spain
*Co espondence: [email p o ec ed]
†These au ho s con ibu ed equally o his wo k.
Abs ac :
Mo he ’s milk con ains a unique mic obiome ha plays a ele an ole in o sp ing heal h.
We hypo hesize ha ma e nal malnu i ion du ing lac a ion migh impac he mic obial composi ion
o milk and a ec adequa e o sp ing gu coloniza ion, inc easing he isk o la e onse diseases.
Then, Wis a a s we e ed ad libi um (Con ol, C) ood es ic ion (Unde nou ished, U) du ing
ges a ion and lac a ion. A e bi h, o sp ing eces and milk s omach con en we e collec ed a
lac a ing day (L)4, L14 and L18. The V3–V4 egion o he bac e ial 16S RNA gene was sequenced
o cha ac e ize bac e ial communi ies. An analysis o be a di e si y e ealed signi ican dispa i ies
in mic obial composi ion be ween g oups o die a L4 and L18 in bo h milk, and ecal samples. In
o al, 24 phyla we e iden i ied in milk and 18 we e iden i ied in eces, wi h Fi micu es, P o eobac e ia,
Ac inobac e oido a and Bac e oido a collec i ely ep esen ing 96.1% and 97.4% o hose iden i ied,
espec i ely. A highe abundance o Pas eu ellaceae and Po phy omonas a L4, and o Gemella and En e-
ococcus a L18 we e egis e ed in milk samples om he U g oup. Lac obacillus was also signi ican ly
mo e abundan in ecal samples o he U g oup a L4. These mic obial changes comp omised he
numbe and a ie y o milk– eces o eces– eces bac e ial co ela ions. Mo eo e , inc eased o sp ing
gu pe meabili y and an al e ed exp ession o goble cell ma ke s TFF3 and KLF3 we e obse ed in
U pups. Ou esul s sugges ha al e ed mic obial communica ion be ween mo he and o sp ing
h ough b eas eeding may explain, in pa , he de imen al consequences o ma e nal malnu i ion
on o sp ing p og amming.
Keywo ds: milk mic obiome; me abolic p og amming; gu coloniza ion; ood es ic ion; lac a ion
1. In oduc ion
Ea ly li e ad e se e en s play an impo an ole in he e iology o many diseases. In
pa icula , lac a ion is conside ed a c i ical p og amming window, being a sensi i e pe iod
in which o es ablish neu al connec ions, beha io esponses and me abolic
ci cui s [1,2].
Acco ding o his, al e ed ma e nal nu i ion has been he mos ex ensi ely s udied p o-
g amming challenge o o sp ing me abolic diseases, including obesi y and ype 2 diabe es
(T2D) [
3
–
6
]. Unde op imal condi ions, ma e nal milk is ega ded he bes eeding sou ce o
neona es, p o iding all nu ien equi emen s o ensu e adequa e g ow h and ma u a ion.
Nu ien s 2023,15, 4322. h ps://doi.o g/10.3390/nu15204322 h ps://www.mdpi.com/jou nal/nu ien s
Nu ien s 2023,15, 4322 2 o 26
Howe e , a hypocalo ic o low-p o ein die du ing lac a ion can ha e a nega i e impac on
b eas milk p oduc ion [
7
], as well as on i s con en o nu ien s [
8
,
9
], and he milk in ake by
young pups [
8
–
10
], exe ing nega i e e ec s on hei de elopmen . O he s udies in oden s,
unde mode a e o mild calo ic es ic ion du ing lac a ion (a 20% es ic ion o ad libi um
eeding), ia me abolomic analysis, iden i ied changes in 29 me aboli es ela ed o a ious
me abolic pa hways [
11
]. The mechanisms by which b eas milk p og ams in an s o a low
o high isk o becoming obese o glucose in ole an a adul hood a e no ully de ined
bu his me abolic dys unc ion has been associa ed wi h al e ed insulin sensi i i y [
12
],
hepa ic glycogen me abolism [
13
], a dis up ed lep in p oduc ion p o ile [
14
] and damaged
hypo halamic ci cui s [
14
,
15
]. Mo eo e , we and o he s ha e also desc ibed ha ma e nal
ood es ic ion leads o al e ed in es inal ba ie ma u a ion and he al e ed unc ion o he
o sp ing [
4
,
16
,
17
], p omo ing he de elopmen o local o ex a-in es inal in lamma o y
e en s [16].
I is wo h no ing ha ma e nal milk composi ion e e s no only o essen ial nu ien s
(lipids, ca bohyd a es, p o eins, i amins o mine als) bu also o o he bioac i e ac o s,
such as ho mones (insulin o lep in), cy okines, immunoglobulins, and nume ous ypes
o oligosaccha ides, among o he s [
2
]. Fo a long ime hough o be a s e ile body luid,
nowadays i is widely accep ed ha b eas milk has also i s own mic obio a, able o in lu-
ence newbo ns’ immune sys ems [
18
]. The o igin o his mic obio a is s ill unce ain. One
hypo hesis sugges s ha , h ough he p ocess o b eas eeding, skin bac e ia may be ans-
e ed o b eas milk o di ec ly o he pe son lac a ing. Ano he hypo hesis sugges s ha a
signi ican milk e lux om he in an ’s o al ca i y h ough he nipple in o he mamma y
gland may also occu . Finally, an en e o-mamma y a icking model has been p oposed
as well [
19
]. Howe e , ega dless o he ou e ia which bac e ia en e he mamma y
gland, b eas milk cons i u es he key sou ce o mic obes o neona es’ gu coloniza ion.
Human s udies ha e e ealed ha he milk o heal hy women con ains a g ea di e si y o
bac e ia, bu wi h a co e o gene a including S ep ococcus and S aphylococcus, ollowed by
Lac obacillus,Bi idobac e ium and En e ococcus [
20
,
21
]. In e es ingly, he gene a S ep ococcus
and S aphylococcus, along wi h Bi idobac e ium, ha e been desc ibed as pionee anae obic
bac e ia colonizing he gu niche in he i s days o li e [
20
,
22
], demons a ing e ical
mo he - o-child bac e ial ans e h ough b eas eeding [
20
]. The b eas milk mic obiome
can a y depending on he phase o lac a ion we a e in, he ma e nal me abolic s a us o he
body mass index as well as he weigh gain she expe ienced du ing p egnancy o he ype
o deli e y [
23
,
24
]. In his ega d, i has been seen ha obese mo he s ha e a di e en and
less di e se milk mic obial composi ion han ha o no mal-weigh mo he s [
24
], which
is cha ac e ized by low le els o Bi idobac e ium bu high le els o S aphylococcus [
25
]. In
ag eemen , lowe le els o Bi idobac e ium ha e been epo ed in eces om obese child en
compa ed o hose o no mal weigh o he same age [
26
]. Mo eo e , animal s udies, includ-
ing ou s, ha e also demons a ed ha he die es ic ion o mo he s impac s milk mic obial
di e si y [
27
] and causes a shi in he composi ion o o sp ing gu mic obio a [
16
,
27
],
which p ecedes he onse o me abolic synd ome [
4
,
16
], sugges ing a causal ela ionship.
Thus, gi en he signi ican associa ion be ween mic obiome composi ion and me abolic
disease ou comes, he ma e nal die a y in luence on o sp ing disease de elopmen may
be pa ially explained by he die a y modula ion o milk mic obial componen s impac ing
he o sp ing gu ’s p ima y coloniza ion. Howe e , o ou knowledge, no s udies ha e
pe o med a de ailed cha ac e iza ion o he milk mic obiome du ing lac a ion in pa allel
o he s udy o he empo al p og ess o gu mic obial coloniza ion. The e o e, he p ima y
pu pose o his s udy is o de e mine he in luence o ma e nal die (a 65% ood es ic ion o
Wis a a s) on he milk mic obiome and whe he o no a ia ions in he milk mic obiome
a e ela ed o a ia ions in he neona e ecal mic obiome. To his end, he e we analyzed
longi udinal ma e nal milk and o sp ing ecal samples ia me a axonomic sequencing,
om a ew days a e bi h o he ime close weaning.
Nu ien s 2023,15, 4322 3 o 26
2. Ma e ials and Me hods
2.1. Animals and Die s
The Ins i u ional Animal Ca e and Use Commi ee o he Communi y o Mad id ap-
p o ed all me hods o his s udy (PROEX 349/15 and PROEX 215.8/21). The in es iga o s
we e acc edi ed, and he animal acili ies we e app o ed by he Gene al Adminis a ion
o Ag icul u e and Li es ock o he Au onomous Go e nmen o Mad id (Spain). Ten-
week-old Wis a a s, ob ained om Jan ie Labs (F ance), we e housed unde speci ic
pa hogen- ee and s anda d labo a o y condi ions (12:12 h ligh cycle; 21
◦
C) wi h ad
lib access o wa e and a no mal chow die (2.9 kcal/g; 12% a , 60% ca bohyd a es and
28% p o ein; A04, SAFE). A e 10 days o habi ua ion, emales we e housed wi h males
o e nigh , and wo weeks a e ma ing, p egnan a s we e andomly assigned o one o
he wo ea men g oups. The i s g oup was ed ad lib wi h he men ioned s anda d
chow die (con ol (C), n= 6), and he second g oup was 65% ood es ic ed du ing he las
hi d o ges a ion and pos na ally (unde nou ished (U), n= 6), as p e iously desc ibed [
16
].
To educe he e ec o li e size on pos na al g ow h and milk in ake, li e s we e made
uni o m a bi h, o eigh pups pe nu sing dam. Food es ic ion was main ained in he
mo he s du ing lac a ion, and pups we e sac i iced ia decapi a ion a 4, 14 and 18 days o
li e (L4, L14 and L18) o collec he di e en ypes o samples. The weigh gain o pups was
moni o ed h oughou lac a ion and he body and gas oin es inal sys em leng h ( om he
pylo us o he anus) we e measu ed o de e mine he nu i ional es ic ion e ec s on he
o gan sizes. This animal model is designed o moni o lac a ion un il L18, which is 5 days
be o e weaning, o p e en he pups om beginning o inges he mo he ’s chow die by
hemsel es and hus ensu e he e was no mixed die .
2.2. Sample Collec ion
Milk collec ion o i s mic obiological analysis was always conduc ed a he same ime
(9:00 a.m.) and unde s e ile condi ions. Al hough a dams p oduce copious amoun s o
milk ela i e ha p oduced by smalle oden s, he impac o long- e m ood es ic ion,
om mid-ges a ion h ough o lac a ion, signi ican ly limi ed he a ailabili y o milk om
mo he s’ b eas s. P io esea ch on oden s has sugges ed ha he composi ion o s omachal
milk is simila o ha o b eas milk [
28
], ep esen ing e ical ansmission be ween mo he
and child. Thus, a e sac i ice, he pups’ s omachs we e dissec ed, and he con en s we e
kep a 4
◦
C and immedia ely p ocessed. Likewise, ecal colonic con en was collec ed
asep ically om pups in o a s e ile ube, 0.5 mL o TE50 bu e (10 mM T is-HCl and 50 mM
EDTA, pH 8) was added, he mix u e was o exed un il i was homogeneous, and hen i
was ozen a
−
80
◦
C un il DNA ex ac ion and mic obial s udies we e pe o med. Fo gene
exp ession analysis, he dis al colon was opened longi udinally and cleansed wi h saline
solu ion. Fo his ological s udies, he colon was dissec ed and, main aining i s cylind ical
s uc u e and ecal con en , imme sed in Ca noy ixa i e solu ion.
2.3. Analy ical De e mina ions
Be o e sac i ice ia decapi a ion, he neona es we e weighed and hen blood samples
we e collec ed; hei se um was sepa a ed and s o ed ozen a
−
20
◦
C un il analysis. Se um
insulin and glucagon le els we e de e mined wi h a speci ic a insulin and glucagon
adioimmunoassay ki (LINCO Resea ch, Inc., Me ck Millipo e, S . Louis, MI, USA), in
acco dance wi h he manu ac u e ’s p o ocol. A sensi i i y o 0.1 ng/mL and o 20 pg/mL
was achie ed wi h o e nigh equilib ium using 100
µ
L o he se um samples, espec i ely.
The coe icien s o a ia ion wi hin and be ween assays we e 10% o insulin and 4.0 and
7.3% o glucagon, espec i ely. Se um glucose and lipid pa ame e s ( o al choles e ol and
iglyce ides) we e de e mined ia he enzyma ic colo ime ic glucose oxidase/pe oxidase
me hod (Biosys ems, Ba celona, Spain).
Nu ien s 2023,15, 4322 4 o 26
2.4. DNA Ex ac ion
2.4.1. Milk
The samples unde wen cen i uga ion a 4
◦
C o 15 min a a ela i e cen i ugal o ce
o 11,000
×
g. DNA was hen ex ac ed om he esul an pelle s using QIAamp DNA S ool
Mini Ki (Qiagen, Hilden, Ge many), in acco dance wi h he manu ac u e ’s guidelines,
albei wi h p e iously documen ed modi ica ions [
29
]. The ex ac ed DNA was elu ed
in 20
µ
L o nuclease- ee wa e and subsequen ly s o ed a
−
20
◦
C pending addi ional
analyses. The DNA concen a ion was es ima ed u ilizing NanoD op ND-1000 UV-Vis
Spec opho ome e (NanoD op Technologies, Wilming on, DE, USA). The DNA ex ac ion
and pu i ica ion p o ocol delinea ed abo e was also applied o wo nega i e con ol blanks,
which did no con ain any sample ma e ial.
2.4.2. Feces
The ozen ecal samples we e apidly hawed using a d y hea block se a 37
◦
C,
ollowed by o exing o achie e e-homogeniza ion. DNA was ex ac ed u ilizing QI-
Aamp Fas DNA S ool Mini Ki (Qiagen, Ge man own, MD, USA) in conjunc ion wi h
0.1 mm diame e zi conia/silica beads (BioSpec P oduc s, Inc., Ba les ille, OK, USA) and
a Fas P ep FP120A-115 homogenize (Qbiogene, Ca lsbad, CA, USA). Du ing each ound
o DNA ex ac ion, 500
µ
L o TE50 bu e om he same aliquo was used in he sample
and 500
µ
L o nuclease- ee wa e (Ambion, Wal ham, MA, USA) was used o nega i e
con ols. The ex ac ed DNA samples we e elu ed in 20
µ
L o ATE bu e , as p o ided in
he ex ac ion ki , and s o ed a −80 ◦C un il u he analysis.
2.5. DNA Quali y, Quan i ica ion, and Sequencing
DNA quali y and quan i ica ion we e assessed as p e iously desc ibed [
20
]. B ie ly,
he concen a ion o he DNA samples was de e mined using he Quan -iT PicoG een
eagen (The mo Fishe Scien i ic, Inc., Wal ham, MA, USA). Ampli ica ion a ge ed he
V3–V4 egion o he 16S RNA gene. Bo h nega i e and posi i e con ol PCR p oduc s we e
subjec ed o aga ose gel elec opho esis a 80 V o 30 min using 1% aga ose gel and TAE
(T is-Ace a e-EDTA) bu e . The gel was s ained wi h GelRed
™
(10X, Bio ium, F emon , CA,
USA) and isualized using Ul aCam Digi al Imaging Sys em (Bio-Rad, He cules, CA, USA).
Amplicon quali y was assessed wi h a QIAxcel DNA Sc eening ca idge (Qiagen, Hilden,
Ge many) in acco dance wi h he manu ac u e ’s guidelines. High- esolu ion capilla y
elec opho esis on a QIAxcel Ad anced Sys em (Qiagen) was employed o isualiza ion.
Samples demons a ing a peak a he desi ed amplicon size and minimal p ime dime
o ma ion we e deemed o be o su icien quali y.
Subsequen o p ima y PCR ampli ica ion ( he esul ing amplicons being app ox-
ima ely 450 bp in leng h), he indi idual amplicon lib a ies we e cha ac e ized using
Bioanalyze 2100 (Agilen Technologies, Palo Al o, CA, USA). The lib a ies we e hen
pooled in equimola concen a ions, ollowed by pu i ica ion and quan i ica ion. The p e-
cise concen a ion o he pooled sample was con i med ia eal- ime PCR (Kapa Biosys ems,
Wilming on, MA, USA). Finally, he pooled DNA samples unde wen sequencing on an
Illumina MiSeq ins umen , employing 2
×
300 bp pai ed-end ead sequencing a he
Genomics Uni o Pa que Cien í ico de Mad id, Spain.
In acco dance wi h manu ac u e speci ica ions, sequences unde wen demul iplexing
acili a ed by Illumina’s so wa e pla o m ( . 2.6.2.3). Subsequen bioin o ma ic anal-
ysis was conduc ed u ilizing Quan i a i e Insigh s in o Mic obial Ecology 2 (QIIME 2,
e sion 2022.2) in conjunc ion wi h R S a is ical Compu ing En i onmen ( e sion 3.5.1;
URL: h ps://www. -p ojec .o g/ accessed on 13 Janua y 2023). Fo he op imiza ion
o sequence in eg i y, he DADA2 algo i hm was employed unde speci ic pa ame e s:
o wa d eads we e unca ed pos -posi ion 295 while excising he ini ial 15 nucleo ides;
con e sely, e e se eads we e unca ed a posi ion 258 wi h he p elimina y 7 nucleo ides
elimina ed. This p ocedu e was implemen ed o ob ia e posi ions demons a ing a median
nucleo ide quali y sco e in e io o Q20. Taxonomic a ilia ion o indi idual amplicon
Nu ien s 2023,15, 4322 5 o 26
sequence a ian s (ASVs) was asce ained h ough he q2 ea u e classi ie , u ilizing a nai e
Bayes axonomic classi ica ion schema agains he SILVA 138.1 e e ence da abase. Las ly,
po en ial con aminan s we e iden i ied, isualized and pu ged om he da ase ia he
decon am package ( e sion 1.2.1), inco po a ing da a om wo nega i e con ol samples
o igo ous e i ica ion.
2.6. Me a axonomic Analysis o Bac e ial Mic obio a
A ma ix de ailing ASVs speci ic o each espec i e sample was sys ema ically gene -
a ed. The subsequen no maliza ion o bac e ial axa abundances was pe o med u ilizing
he o al sum scaling (TSS) me hod, whe e in each disc e e ASV coun was di ided by
he cumula i e lib a y size, he eby ende ing he ela i e p opo ion o indi idual ASV
coun s pe sample. Fo he examina ion o alpha di e si y, bo h Shannon and Richness
di e si y indices we e employed, acili a ed h ough he egan package wi hin R S a is ical
Compu ing En i onmen (Ve sion 2.5.6).
To p o ide a comp ehensi e assessmen o communi y s uc u e, be a di e si y was
analyzed using bo h B ay–Cu is and bina y Jacca d dissimila i y me ics. These me ics
se e o quan i y he composi ional dissimila i y be ween mic obial communi ies ac oss
samples. All compu a ions and s a is ical manipula ions we e execu ed wi hin he R
amewo k, ensu ing me hodological consis ency and analy ical igo .
2.7. Immuno luo escence S aining
The immuno luo escence s aining o igh junc ion p o ein zonula occludens-1 (ZO-1)
was pe o med on colonic sec ions as p e iously desc ibed [
16
]. B ie ly, a e being depa a -
inized and ehyd a ed, he an igens we e e ie ed wi h sodium ci a e bu e (10 mM
Na
3
C
6
H
5
O
7
and Tween-20 0.05%, pH 6) a 97
◦
C o 30 min. Non-speci ic backg ound
was blocked ia incuba ion wi h 2% BSA, 1% NGS and 0.2% T i on X-100 in PBS o 1 h a
oom empe a u e. Sec ions we e incuba ed o e nigh a 4
◦
C wi h abbi an i-ZO-1 (1:50,
The moFishe Scien i ic, Inc., Wal ham, MA, USA) and hen p obed in he da k wi h a
1:100 dilu ion o Alexa Fluo 488-conjuga ed goa an i- abbi IgG an ibody and a 1:1000
dilu ion o 10 mg/mL o DAPI solu ion (The mo Fishe Scien i ic, Wal ham, MA, USA)
o 1 h a oom empe a u e. Finally, he sec ions we e co e ed wi h P oLong Gold An-
i ade Moun an (In i ogen, The mo Fishe Scien i ic, Inc., Wal ham, MA, USA). Nega i e
con ol slides we e ob ained by incuba ing hem wi hou he p ima y an ibody bu wi h a
seconda y Alexa Fluo an ibody. Fo quan i ica ion, images we e cap u ed using a Leica
SP-2 AOBS con ocal mic oscope a 630
×
magni ica ion. A leas wo non-adjacen sec ions
o colon pe a we e s ained and ou images pe sec ion we e used. Two independen
expe imen s we e conduc ed, wi h 2–3 a s pe g oup in each expe imen . To measu e he
in ensi y o he s ained a ea, Fiji (ImageJ so wa e . 2.14.0) was employed [30].
2.8. Inne Mucus Laye Thickness Analysis
Samples om he dis al colon we e ha es ed and immedia ely p ese ed in Ca noy’s
ixa i e (d y me hanol: chlo o o m: glacial ace ic acid in he a io 60:30:10) as desc ibed
ea lie [
16
]. A e 4 h in Ca noy’s solu ion, he colons we e washed in d y me hanol and
e hanol 100% o 1 h, cleaned wi h xylene and embedded in pa a in wax. Then, he
Alcian blue pH 2.5 (AB) (AB-8GX, PanReac Applichem; Schi ’s eagen , VWR Chemicals)
s aining o 5
µ
m sec ions was pe o med. Only egions in which he mucus laye was
sandwiched be ween he epi helium on one side and luminal con en on he o he we e
used o measu emen s o hickness. Ca e was aken o conside only hose egions ha
ep esen ed egula hickness; 6 o 8 measu emen s we e aken pe image, a e aged o e
he o al usable a ea o he colon. His ological de e mina ions we e pe o med using a
ligh mic oscope (Eclipse 80i, Nikon, Tokyo, Japan) connec ed o a digi al came a (XCD-
U100CR, Sony, Tokyo, Japan). Mo phome ic cha ac e is ics we e analyzed using His olab
so wa e . 7.0 (Mic o ision Ins umen s, EVRY Cedex, F ance. Measu emen s we e always
single-blinded.

Nu ien s 2023,15, 4322 6 o 26
2.9. RNA Ex ac ion and Quan i a i e RT-PCR
To al RNA was ex ac ed om ozen colonic issues using TRIzol Reagen (In i ogen,
The mo Fishe Scien i ic, Inc., Wal ham, MA, USA) and e e se ansc ibed using a high-
capaci y cDNA e e se ansc ip ion ki (Applied Biosys ems, The moFishe Scien i ic,
Inc., Wal ham, MA, USA). Real- ime quan i a i e PCR analyses we e pe o med using
o wa d and e e se p ime s (Table 1) o de e mine he ela i e abundance o Muc2,T 1,
T 3 and Kl 3 genes. The compa a i e h eshold cycle me hod was used o calcula e ela i e
exp ession. The a ge gene alues we e no malized o he exp ession o he endogenous
e e ence (18S) (Table 1).
Table 1. Lis o p ime s (Sigma-Ald ich).
Gene Symbol Sequence (50–30)
MUC2 Muc2 AAGCCAGATCCCGAAACCAT
ATGGCCCCATTCACAACTGCC
TFF1 T 1 CAAGGTGACCTGTGTCCTC
CTTGCTGGTTCTCAATGACC
TFF3 T 3 GACTCCAGCATCCCAAATGT
GCAGATCAGGGGTGAGTGTT
KLF3 Kl 3 TCATGTACACCAGCCACCTG
TAGTCAGTCCTCTGTGGTTC
18S ARN Rps18 GTAACCCGTTGAACCCCATT
CCATCCAATCGGTAGTAGCG
2.10. S a ical and Bioin o ma ic Analyses
The dis ibu ion o he da a was ini ially assessed using he Shapi o–Wilk no mali y
es . Da a con o ming o a no mal dis ibu ion we e exp essed as he mean
±
s anda d
e o o he mean (SEM) o he mean alongside he 95% con idence in e al (95% CI). When
da a we e no no mally dis ibu ed, hey we e p esen ed as he median coupled wi h he
in e qua ile ange (IQR). Fo he compa ison o wo g oups, signi icance was assessed
using a 2- ailed S uden ’s - es o no mally dis ibu ed da a and Wilcoxon ank sum es s
o non-pa ame ic da a, wi h a signi icance le el se a p< 0.05 o all es s. Fo compa isons
in ol ing mo e han wo g oups, analysis o a iance (ANOVA) was used o no mally
dis ibu ed da a, whe eas he K uskal–Wallis es was employed o non-pa ame ic da a.
Pos hoc analyses included pai wise - es s o ANOVA and Wilcoxon ank sum es s wi h
con inui y co ec ion o he K uskal–Wallis es .
Fu he specialized analyses included he e alua ion o median ela i e abundances
o dominan axa using K uskal–Wallis es s o Wilcoxon ank es s, ollowed by app o-
p ia e mul iple compa ison co ec ions such as he Bon e oni me hod. Alpha di e si y
was measu ed using he Shannon di e si y index, which conside s bo h he numbe and
e enness o mic obial species. Be a di e si y was isualized h ough p incipal coo di-
na es analysis (PCoA) based on dis ance ma ices, wi h B ay–Cu is and bina y Jacca d
indices used o quan i a i e and quali a i e analyses, espec i ely. PERMANOVA wi h
999 pe mu a ions was pe o med o e eal s a is ically signi ican di e ences in be a di-
e si y
(p< 0.05).
Pea son ank co ela ion analyses we e conduc ed o e alua e po en ial
co ela ions be ween bac e ial gene a in milk and ecal samples, as well as wi hin ecal
samples alone. All s a is ical and bioin o ma ic analyses we e conduc ed using R so wa e,
combining e sion 3.3.2 and e sion 4.0.3 (R-p ojec , h p://www. -p ojec .o g, accessed
on 13 Janua y 2023), along wi h QIIME pipelines ( . 1.8.0).
3. Resul s
3.1. E ec o Nu i ional Res ic ion on he Biochemical P o ile o O sp ing Ra s du ing Lac a ion
Bo h nu i ional es ic ion and he pa icula me abolic adap a ions ha expe ience
he mo he du ing ges a ion and lac a ion may con ibu e o he ea ly p og amming o
an o sp ing. In his con ex , ma e nal ood es ic ion du ing he las hi d o p egnancy
Nu ien s 2023,15, 4322 7 o 26
esul ed in pups wi h a signi ican lowe body weigh a bi h compa ed o ha o C
newbo ns, bu wi hou s a is ical di e ences in he li e size and only a sligh endency o
inc ease in he male- o- emale a io (p= 0.09) (Table 2). Consis en wi h p e ious da a [
12
],
nu i ional es ic ed lac a ing a s (U) showed a signi ican educ ion in body weigh gain
compa ed o ha o C animals, eaching a di e ence o almos a 50% a he end o he
pe iod (L18) (Table 3). Simila ly, se um glucose, insulin and glucagon le els emained
signi ican ly lowe h oughou lac a ion in U animals. In he case o he se um lipid p o ile,
he e we e no di e ences be ween he wo g oups (C and U) a any age. Howe e , while
choles e ol and iglyce ides le els we e high in bo h C and U pups a he beginning o
lac a ion (L4), hese le els dec eased and became s able wi h inc easing age (Table 3).
Table 2. Cha ac e is ics o he li e s a bi h.
Con ol Unde nou ished
Newbo ns weigh (g) 6.16 ±0.14 5.69 ±0.09 **
Li e size 11.5 ±1.30 9.86 ±0.72
Numbe o male newbo ns 6.25 ±11.11 5.71 ±0.65
Numbe o emale newbo ns 5.25 ±0.63 4.00 ±0.67
Ra io males/ emales 1.23 ±0.24 1.88 ±0.25
Da a a e means
±
SEM (6–8 animals). S uden ’s analysis was used o e alua e di e ences be ween he wo
g oups. ** p< 0.01 compa ed o C g oup.
Table 3. Se um biochemical p o ile o he o sp ing du ing lac a ion.
Con ol Unde nou ished
L4 L14 L18 L4 L14 L18
Body weigh (g) 11.36 ±0.23 27.94 ±0.4 34.65 ±1.02
8.35
±
0.15 *** 16.5
±
0.41 ***
16.62 ±0.36 ***
Glycemia (mg/dL) 119.1 ±1.43 107.8 ±1.03 146.19 ±1.19
85.9
±
4.02 ***
85.3 ±5.29 ** 93.15 ±4.94 ***
Insulinemia (ng/mL) 0.67 ±0.06 0.70 ±0.08 0.78 ±0.17
0.29
±
0.04 ***
0.25 ±0.06 ** 0.36 ±0.09 *
Glucagonemia (pg/mL) 252.3 ±10.6 298 ±11.2 129.1 ±6.9
103.9
±
4.4 ***
97 ±1.3 *** 83.2 ±4.3 ***
Choles e ol (mg/dL) 154.66 ±4.11 127.48 ±5.81 119.95 ±4.5 144.38 ±3.28 119.62 ±4.51 116.86 ±5.2
T iglyce ides (mg/dL) 157.08 ±5.26 79.94 ±4.75 63.41 ±5.42 160.17 ±8.57 74.02 ±3.07 68.42 ±3.51
Da a a e mean
±
SEM (n= 6–8 animals). Biochemical and ho monal pa ame e s o con ol (C) and unde nou ished
(U) a s a 4, 14 and 18 days o lac a ion (L). S uden ’s analysis was used o e alua e di e ences be ween g oups
in e ms o nu i ional ype. * p< 0.05; ** p< 0.01; *** p< 0.001 compa ed o C g oup a he same age.
3.2. E ec o Ma e nal Die on he Milk and Gu Mic obiome o O sp ing h oughou Lac a ion
3.2.1. Me a axonomic Analysis o he Milk Samples
The compa a i e me a axonomic analysis o mic obial p o iles in milk samples, s a i-
ied acco ding o nu i ional s a us (C s. U) and days o lac a ion (L4, L14 and L18), was
conduc ed u ilizing 35 o he samples as delinea ed in Sec ion 2.5. F om hese 35 milk
samples, a cumula i e o al o 811,904 high-quali y il e ed sequences was ob ained. The
sequence coun pe sample oscilla ed be ween 12,569 and 33,787 (median [IQR]: 22,540
[18,872.5–28,013]), which could be clus e ed in o 2586 dis inc ASVs. The alpha di e si y
wi hin hese milk samples, i espec i e o whe he hey we e om C o U g oups, exhibi ed
compa able Richness and Shannon di e si y indices ac oss all ime poin s o lac a ion (L4,
L14 and L18), as depic ed in Figu e 1a,b.
Nu ien s 2023,15, 4322 8 o 26
Nu ien s 2023, 15, x FOR PEER REVIEW 8 o 26
wi hin hese milk samples, i espec i e o whe he hey we e om C o U g oups, exhib-
i ed compa able Richness and Shannon di e si y indices ac oss all ime poin s o lac a ion
(L4, L14 and L18), as depic ed in Figu e 1a,b.
Figu e 1. Mic obial alpha di e si y in milk samples exp essed by (a) he numbe o obse ed gene a
(gene a ichness) and (b) he Shannon index. Box plo s ep esen median and in e qua ile anges
oge he wi h maximum and minimum alues. K uskal–Wallis analysis was used o e alua e diffe -
ences be ween g oups (in e ms o lac a ional age and ype o die ). The Be a di e si y analysis o
milk samples was measu ed as (c) he p esence/absence (Binna y Jacca d me hod) o (d) he ela i e
abundance (B ay–Cu is simila i y analysis) o he diffe en species quan i ied in con ol g oups
(yellow: C4; o ange: C14; ed: C18) and unde nou ished g oups (ligh blue: U4; cyan blue: U14; da k
blue: U18). The alue gi en on each axis label ep esen s he pe cen age o he o al a iance ex-
plained by ha axis. Pe mano a analysis was used o e alua e diffe ences be ween g oups (in e ms
o lac a ional age and ype o die ). N = 5–6 pe condi ion. C: con ol; U: unde nou ished. L: lac a ion.
An analysis o be a di e si y was conduc ed o compa e he C and U g oups a each
designa ed lac a ional ime poin . Two-dimensional p incipal coo dina es analysis (2D-
PCoA) u ilizing Jacca d dis ance me ics p o ided a isual pla o m o assessing he ex-
en o sample clus e ing based on bo h nu i ional s a us and lac a ional s age. No ably,
dis inc clus e ing pa e ns eme ged a day 4 and day 18 (Figu e 1c), sugges ing a signi i-
can di e gence in mic obial p o iles be ween C and U coho s a hese sampling poin s.
Figu e 1.
Mic obial alpha di e si y in milk samples exp essed by (
a
) he numbe o obse ed
gene a (gene a ichness) and (
b
) he Shannon index. Box plo s ep esen median and in e qua ile
anges oge he wi h maximum and minimum alues. K uskal–Wallis analysis was used o e alua e
di e ences be ween g oups (in e ms o lac a ional age and ype o die ). The Be a di e si y analysis o
milk samples was measu ed as (
c
) he p esence/absence (Binna y Jacca d me hod) o (
d
) he ela i e
abundance (B ay–Cu is simila i y analysis) o he di e en species quan i ied in con ol g oups
(yellow: C4; o ange: C14; ed: C18) and unde nou ished g oups (ligh blue: U4; cyan blue: U14;
da k blue: U18). The alue gi en on each axis label ep esen s he pe cen age o he o al a iance
explained by ha axis. Pe mano a analysis was used o e alua e di e ences be ween g oups (in
e ms o lac a ional age and ype o die ). N = 5–6 pe condi ion. C: con ol; U: unde nou ished.
L: lac a ion.
An analysis o be a di e si y was conduc ed o compa e he C and U g oups a each
designa ed lac a ional ime poin . Two-dimensional p incipal coo dina es analysis (2D-
PCoA) u ilizing Jacca d dis ance me ics p o ided a isual pla o m o assessing he
ex en o sample clus e ing based on bo h nu i ional s a us and lac a ional s age. No ably,
dis inc clus e ing pa e ns eme ged a day 4 and day 18 (Figu e 1c), sugges ing a signi ican
di e gence in mic obial p o iles be ween C and U coho s a hese sampling poin s. This
obse a ion was subs an ia ed s a is ically ia a subsequen PERMANOVA analysis based
on Jacca d simila i y me ics, which e ealed signi ican di e ences in bac e ial composi ion
be ween he wo nu i ional g oups (p= 0.009 and p= 0.014). Addi ionally, a sepa a e PCoA
plo gene a ed using B ay–Cu is simila i y indices, which we e no malized ela i e o he
Nu ien s 2023,15, 4322 9 o 26
abundance o dis inc ASVs, demons a ed signi ican clus e ing p edica ed on nu i ional
s a us a L4 (p= 0.029), bu no a L14 o L18 (p> 0.05) (Figu e 1d).
A he axonomic le el, disce nible di e ences in bac e ial ela i e abundances we e
obse ed ela ed o die ype a speci ic ime poin s. Taxa belonging o he Fi micu es
and P o eobac e ia phyla domina ed in milk samples om bo h C and U animals. O he
phyla such as Bac e oido a and Ac inobac e oido a we e also p esen bu a a lowe ela-
i e abundance. Al hough Fi micu es showed a endency o dec ease and P o eobac e ia
showed a endency o inc ease hei ela i e abundance in he U g oup a L18, no s a is ical
signi icance was de ec ed when compa ed o ha o hei C coun e pa s (Figu e 2a–d). On
he o he hand, he ela i e abundance o sequences belonging o he amily Pas eu ellaceae
was signi ican ly highe in he samples om he U g oup (median [IQR] = 5.57 [3.33–8.2])
han in hose om C animals (median [IQR] = < 0.01 [<0.01–<0.01]) a L4 (p= 0.0055).
Simila ly, he gene a Gemella and En e ococcus mani es ed ele a ed ela i e abundances
in he U samples a L18, wi h median [IQR] alues o 0.94 [0.52–2.19] s. 0.64
[0.41–0.85]
(p= 0.007)
and 0.08 [<0.01–2.61] s. < 0.01 [<0.01–0.03] (p= 0.030), espec i ely. In con as ,
he genus Rombou sia was mo e abundan in he C g oup a L18 (p= 0.015). Addi ion-
ally, Po phy omonas was mo e p e alen in U samples a L4, wi h a median [IQR] o
0.95
[0.67–1.66]
s. 0.1 [0.01–0.25] (p= 0.024). No signi ican di e ences in he ela i e
abundances o se e al o he axa, such as Lac obacillus,Roden ibac e , Unclassi ied_gene a,
S ep ococcus,Esche ichia-Shigella,Tu icibac e ,Ro hia and Veillonella, we e de ec ed be ween
C and U a any o he ages conside ed (Figu e 2e and Table S1).
Nu ien s 2023, 15, x FOR PEER REVIEW 9 o 26
This obse a ion was subs an ia ed s a is ically ia a subsequen PERMANOVA analysis
based on Jacca d simila i y me ics, which e ealed signi ican diffe ences in bac e ial
composi ion be ween he wo nu i ional g oups (p = 0.009 and p = 0.014). Addi ionally, a
sepa a e PCoA plo gene a ed using B ay–Cu is simila i y indices, which we e no mal-
ized ela i e o he abundance o dis inc ASVs, demons a ed signi ican clus e ing p ed-
ica ed on nu i ional s a us a L4 (p = 0.029), bu no a L14 o L18 (p > 0.05) (Figu e 1d).
A he axonomic le el, disce nible diffe ences in bac e ial ela i e abundances we e
obse ed ela ed o die ype a speci ic ime poin s. Taxa belonging o he Fi micu es and
P o eobac e ia phyla domina ed in milk samples om bo h C and U animals. O he phyla
such as Bac e oido a and Ac inobac e oido a we e also p esen bu a a lowe ela i e
abundance. Al hough Fi micu es showed a endency o dec ease and P o eobac e ia
showed a endency o inc ease hei ela i e abundance in he U g oup a L18, no s a is ical
signi icance was de ec ed when compa ed o ha o hei C coun e pa s (Figu e 2a–d).
On he o he hand, he ela i e abundance o sequences belonging o he amily Pas eu el-
laceae was signi ican ly highe in he samples om he U g oup (median [IQR] = 5.57 [3.33–
8.2]) han in hose om C animals (median [IQR] = < 0.01 [<0.01–<0.01]) a L4 (p = 0.0055).
Simila ly, he gene a Gemella and En e ococcus mani es ed ele a ed ela i e abundances in
he U samples a L18, wi h median [IQR] alues o 0.94 [0.52–2.19] s. 0.64 [0.41–0.85] (p =
0.007) and 0.08 [<0.01–2.61] s. < 0.01 [<0.01–0.03] (p = 0.030), espec i ely. In con as , he
genus Rombou sia was mo e abundan in he C g oup a L18 (p = 0.015). Addi ionally,
Po phy omonas was mo e p e alen in U samples a L4, wi h a median [IQR] o 0.95 [0.67–
1.66] s. 0.1 [0.01–0.25] (p = 0.024). No signi ican diffe ences in he ela i e abundances o
se e al o he axa, such as Lac obacillus, Roden ibac e , Unclassi ied_gene a, S ep ococcus,
Esche ichia-Shigella, Tu icibac e , Ro hia and Veillonella, we e de ec ed be ween C and U a
any o he ages conside ed (Figu e 2e and Table S1).
Figu e 2. Compa ison o he ela i e abundance o sequences belonging o main bac e ial phyla (a)
Fi micu es, (b) P o eobac e ia, (c) Bac e oido a and (d) Ac inobac e io a, and (e) he mos abundan
gene a ob ained ia me a axonomic analysis in milk samples a lac a ing days L4, L14 and L18 om
Figu e 2.
Compa ison o he ela i e abundance o sequences belonging o main bac e ial phyla
(
a
) Fi micu es, (
b
) P o eobac e ia, (
c
) Bac e oido a and (
d
) Ac inobac e io a, and (
e
) he mos abundan
gene a ob ained ia me a axonomic analysis in milk samples a lac a ing days L4, L14 and L18 om
con ol (C) and unde nou ished (U) animals. Box plo s ep esen median and in e qua ile anges
oge he wi h maximum and minimum alues. Wilcoxon analysis was used o e alua e di e ences
be ween g oups in e ms o ype o die . N = 5–6. The F p eceding Pas eu elleceae in milk samples
e e s o (e) amily axon.
Nu ien s 2023,15, 4322 16 o 26
animals; (iii) ha he co ela ions we e pa icula ly nume ous a he end o lac a ion in
bo h g oups o animals al hough in he C g oup associa ions we e mo e equen among
bac e ia exclusi ely om eces, while die a y es ic ion led o a g ea e numbe o as-
socia ions among milk bac e ia. Despi e his dynamism, a ecu ing end eme ged: he
p esence o Esche ichia-Shigella in milk samples o en mi o ed i s p esence in ecal samples.
Fu he mo e, he analysis b ough o ligh a gene al end whe e Esche ichia-Shigella and
Lac obacillus exhibi ed a nega i e co ela ion ac oss a ious ime poin s, a L4 o C samples
( =
−
0.91) and a L14 and L18 o U samples ( =
−
0.98 a bo h ages). This sugges s
a pa e n whe e a high p e alence o one genus migh be associa ed wi h a dec eased
p e alence o he o he . While his ecu ing end was obse ed, i wa an s u he
in es iga ion o explo e he po en ial implica ions and unde lying mechanisms d i ing
hese obse a ions. Rega ding he posi i e associa ions be ween ecal anae obic bac e ia,
an indica o o in es inal ma u i y, hese we e mo e equen in C animals a he di e en
imes s udied han hey we e in U pups (Pa abac e oides,Bac e oides,Tu icibac e ,Gemella,
Veillonella,Esche ichia-Shigella,Fusobac e ium,Lac obacillus,Rombus ia and Roden ibac e ),
which again e idenced he in luence o die in gu coloniza ion.
3.4. Nu i ional Res ic ion du ing Lac a ion Dis up s he Colonic Ba ie In eg i y o
he O sp ing
Gi en he shi in he bac e ial p o ile o malnou ished pups, hei in es ine s uc u al
and mo phome ic cha ac e is ics we e analyzed. As shown in Table 4, he body ( om nose
o annus) and o al in es inal leng h ( om pylo us o cecum) inc eased p og essi ely om
4 o 18 days o lac a ion in bo h expe imen al g oups C and U; howe e , he g ow h expe i-
enced by U o sp ing a s was less p onounced and he measu emen s we e signi ican ly
lowe han hose in C animals. The leng h o he small in es ine in pups om es ic ed
mo he s was always lowe han he C alues bu i only had s a is ical signi icance a L4
and L18. Rega ding he leng hs o he la ge in es ine, including colon and cecum, he
highes di e ences wi h C alues we e obse ed a L4 whe eas no a ia ions we e de ec ed
a L14 and L18 o he colon. Su p isingly, he U cecum was ound o be longe han he
cecum o C a s a L14; howe e , i s leng h dec eased again owa ds he end o lac a ion
(L18), emo ing he s a is ical signi icance.
Table 4. In es inal mo phome ic cha ac e is ics o he o sp ing du ing lac a ion.
Con ol Unde nou ished
L4 L14 L18 L4 L14 L18
Body leng h (cm) 6.23 ±0.07 8.89 ±0.09 9.36 ±0.114 6.28 ±0.17 7.4 ±0.09 *** 8.01 ±0.13 ***
To al in es ine leng h (cm) 33.47 ±0.37 48.0 ±0.90 48.43 ±1.53 29.54 ±0.67 41.0 ±2.30 39.41 ±0.72 ***
Small in es ine leng h (cm)
Colon leng h (cm)
Cecum leng h (cm)
29.15 ±0.38 40.6 ±0.81 41.47 ±1.34 25.27 ±0.64 ** 35.0 ±2.20 33.14 ±0.70 ***
3.64 ±0.13 5.83 ±0.14 5.90 ±0.24 3.16 ±0.12 * 5.17 ±0.19 5.52 ±0.14
0.68 ±0.04 1.35 ±0.06 1.38 ±0.05 0.65 ±0.03 ** 1.43 ±0.08 1.26 ±0.05
Small In es. Leng h/Body Leng h 4.68 ±0.14 4.57 ±0.12 0.48 ±0.19 4.64 ±0.10 5.23 ±0.32 4.49 ±0.20
Colon Leng h/Body Leng h 0.56 ±0.03 0.67 ±0.01 0.63 ±0.03 0.57 ±0.02 0.76 ±0.03 * 0.75 ±0.03 **
Quan i ica ion o in es inal pa ame e s o he o sp ing a 4, 14 and 18 days o lac a ion (L4, L14 and L18). S uden ’s
-analysis was used o e alua e di e ences be ween g oups in e ms o nu i ion ype. Da a ep esen
mean ±SEM
(n= 6–8). * p< 0.05; ** p< 0.01; *** p< 0.001 compa ed o C g oup.
Mo eo e , in o de o e alua e i body p opo ions we e main ained despi e nu i ional
es ic ion, we adjus ed he leng h o he small in es ine and colon based on he o al body
leng h. The measu emen s o he small in es ine in he U g oup did no di e om hose o
he C a s. Howe e , nu i ional es ic ion esul ed in signi ican changes in he ac ional
leng h o he colon, which was highe a L14 and L18 compa ed o ha in he age-ma ched
C g oup. This sugges s ha he e is some p ese a ion o colon g ow h du ing his s age o
de elopmen (Table 4).
As he in es inal ba ie is imma u e a bi h and unde goes impo an s uc u al and
unc ional changes induced by he ab up ansi ion in nu ien supply om ma e nal um-

Nu ien s 2023,15, 4322 17 o 26
bilical co d blood o en e al milk in ake, in es inal pe meabili y and mucus laye hickness
we e analyzed. These s udies ocused on he colonic issue because his is he main mic obi-
ological ese oi o he o ganism. To assess he i s pa ame e , we measu ed ZO-1 le els,
which is a igh junc ion p o ein loca ed in he apical zone o colonic epi helial cells ha
egula es pa acellula pe meabili y and con ibu es o he p ese a ion o in es inal ba ie
in eg i y [
31
]. Immuno luo escence analysis pe o med a ea ly (L4) and la e lac a ion
(L18) showed an inc ease in signal in ensi y o ZO-1 in C animals, o ming a ne wo k o
inc easingly consolida ed in eg i y in epi helial cells (Figu e 8a). Howe e , ZO-1 le els
we e signi ican ly educed in U a s a L18 compa ed o hose in he C g oup (Figu e 8b),
sugges ing a loss o in es inal ba ie in eg i y a his age.
Nu ien s 2023, 15, x FOR PEER REVIEW 17 o 26
ac ional leng h o he colon, which was highe a L14 and L18 compa ed o ha in he
age-ma ched C g oup. This sugges s ha he e is some p ese a ion o colon g ow h du -
ing his s age o de elopmen (Table 4).
As he in es inal ba ie is imma u e a bi h and unde goes impo an s uc u al and
unc ional changes induced by he ab up ansi ion in nu ien supply om ma e nal um-
bilical co d blood o en e al milk in ake, in es inal pe meabili y and mucus laye hickness
we e analyzed. These s udies ocused on he colonic issue because his is he main mic o-
biological ese oi o he o ganism. To assess he i s pa ame e , we measu ed ZO-1 le -
els, which is a igh junc ion p o ein loca ed in he apical zone o colonic epi helial cells
ha egula es pa acellula pe meabili y and con ibu es o he p ese a ion o in es inal
ba ie in eg i y [31]. Immuno luo escence analysis pe o med a ea ly (L4) and la e lac-
a ion (L18) showed an inc ease in signal in ensi y o ZO-1 in C animals, o ming a ne -
wo k o inc easingly consolida ed in eg i y in epi helial cells (Figu e 8a). Howe e , ZO-1
le els we e signi ican ly educed in U a s a L18 compa ed o hose in he C g oup (Figu e
8b), sugges ing a loss o in es inal ba ie in eg i y a his age.
Figu e 8. Cha ac e is ics o he colonic ba ie in eg i y and i m mucus laye in he offsp ing a s a
4 and 18 days o lac a ion. (a) Immuno luo escence o ZO-1 (g een) in colon sec ions. Nucleic acids
we e s ained wi h DAPI (blue) and whi e a ows indica e a eas whe e he ZO-1 s ain was dis up ed
a he epi helial cell memb ane (magni ica ion: 63×). (b) Quan i ica ion o he ZO-1 luo escence in-
ensi y exp essed in a bi a y uni s. (c) Alcian Blue (AB)-s ained colonic sec ions. The i m mucus
laye was ma ked wi h whi e b acke s (magni ica ion: 20×). (d) Quan i ica ion o he i m mucus
hickness. Da a ep esen mean ± SEM (n = 3–4; 4 sec ions pe animal). S uden ’s analysis was used
o e alua e diffe ences be ween g oups in e ms o he ype o die . * p < 0.05 compa ed o C g oup
wi hin each age. C: con ol; U: unde nou ished; L: lac a ion.
Figu e 8.
Cha ac e is ics o he colonic ba ie in eg i y and i m mucus laye in he o sp ing a s a
4 and 18 days o lac a ion. (
a
) Immuno luo escence o ZO-1 (g een) in colon sec ions. Nucleic acids
we e s ained wi h DAPI (blue) and whi e a ows indica e a eas whe e he ZO-1 s ain was dis up ed
a he epi helial cell memb ane (magni ica ion: 63
×
). (
b
) Quan i ica ion o he ZO-1 luo escence
in ensi y exp essed in a bi a y uni s. (
c
) Alcian Blue (AB)-s ained colonic sec ions. The i m mucus
laye was ma ked wi h whi e b acke s (magni ica ion: 20
×
). (
d
) Quan i ica ion o he i m mucus
hickness. Da a ep esen mean
±
SEM (n= 3–4; 4 sec ions pe animal). S uden ’s analysis was used
o e alua e di e ences be ween g oups in e ms o he ype o die . * p< 0.05 compa ed o C g oup
wi hin each age. C: con ol; U: unde nou ished; L: lac a ion.
The colonic lumen con ains a gel-like s uc u e called mucus ha ac s as a i s line o
de ense agains mic oo ganisms in ading he lamina p op ia. I is p oduced by specialized
sec e ing cells called goble cells, which o m pa o he in es inal epi helium [
32
]. Because
mic obial changes also play an impo an ole in mucus p oduc ion, we hen quan i ied he
inne mucus hickness wi h AB s aining (Figu e 8c). Mo phome ic measu emen s o he
mucus laye showed a end o enhanced hickness unde ood- es ic ed condi ions a bo h
L4 (1.9- old inc ease s. C) and L18 (1.6- old inc ease s. C); howe e , his did no each
s a is ical signi icance (p= 0.068, o bo h ages) (Figu e 8d). To u he cha ac e ize he e ec
Nu ien s 2023,15, 4322 18 o 26
o ma e nal nu i ion on gu ba ie p ope ies, we nex analyzed he gene exp ession o
key ma ke s o specialized mucus-sec e ing goble cells: Muc2,T 3,T 1 and Kl 3 (Figu e 9).
Nu i ional es ic ion did no induce any signi ican change in he exp ession o Muc2, he
main goble cell ma ke , ela i e o C g oup le els a any age conside ed (Figu e 9a). On
he con a y, he exp ession o T 3, a ac o co-sec e ed wi h MUC2 and in ol ed in cell
mig a ion, p oli e a ion and he epai o he mucosal epi helium, was signi ican ly highe
a 4 (1.56- old inc ease) and 18 days o li e (1.48- old inc ease) compa ed o he C alues
(Figu e 9b). Al hough he mucosal p o ec i e unc ion o TFF1 is simila o ha o TFF3, i s
exp ession was no al e ed in U o sp ing a s ela i e o ha o C animals du ing lac a ion
(Figu e 9c). Finally, Kl 3 exp ession, ano he ac o in ol ed in he egene a ion o epi helial
cells, was signi ican ly down egula ed a la e lac a ion (L18) unde nu ien - es ic ed
condi ions (Figu e 9d).
Nu ien s 2023, 15, x FOR PEER REVIEW 18 o 26
The colonic lumen con ains a gel-like s uc u e called mucus ha ac s as a i s line
o de ense agains mic oo ganisms in ading he lamina p op ia. I is p oduced by special-
ized sec e ing cells called goble cells, which o m pa o he in es inal epi helium [32].
Because mic obial changes also play an impo an ole in mucus p oduc ion, we hen
quan i ied he inne mucus hickness wi h AB s aining (Figu e 8c). Mo phome ic meas-
u emen s o he mucus laye showed a end o enhanced hickness unde ood- es ic ed
condi ions a bo h L4 (1.9- old inc ease s. C) and L18 (1.6- old inc ease s. C); howe e ,
his did no each s a is ical signi icance (p = 0.068, o bo h ages) (Figu e 8d). To u he
cha ac e ize he effec o ma e nal nu i ion on gu ba ie p ope ies, we nex analyzed
he gene exp ession o key ma ke s o specialized mucus-sec e ing goble cells: Muc2, Tff3,
Tff1 and Kl 3 (Figu e 9). Nu i ional es ic ion did no induce any signi ican change in
he exp ession o Muc2, he main goble cell ma ke , ela i e o C g oup le els a any age
conside ed (Figu e 9a). On he con a y, he exp ession o Tff3, a ac o co-sec e ed wi h
MUC2 and in ol ed in cell mig a ion, p oli e a ion and he epai o he mucosal epi he-
lium, was signi ican ly highe a 4 (1.56- old inc ease) and 18 days o li e (1.48- old in-
c ease) compa ed o he C alues (Figu e 9b). Al hough he mucosal p o ec i e unc ion
o TFF1 is simila o ha o TFF3, i s exp ession was no al e ed in U offsp ing a s ela i e
o ha o C animals du ing lac a ion (Figu e 9c). Finally, Kl 3 exp ession, ano he ac o
in ol ed in he egene a ion o epi helial cells, was signi ican ly down egula ed a la e
lac a ion (L18) unde nu ien - es ic ed condi ions (Figu e 9d).
Figu e 9. Changes induced by ma e nal nu i ion in he exp ession p o ile o goble cell ma ke s
om he offsp ing colon a 4 and 18 days o lac a ion. Quan i a i e RT-qPCR analysis o Muc2 (a),
Tff3 (b), Tff1 (c) and Kl 3 (d) no malized wi h he 18S ibosomal gene. Da a ep esen mean ± SEM
(n = 5–6). S uden ’s -analysis was used o e alua e diffe ences be ween he wo g oups in e m so
he ype o die . * p < 0.05; ** p < 0.001 compa ed o g oup C wi hin each age. C: con ol; U; Unde -
nou ished; L: lac a ion.
Figu e 9.
Changes induced by ma e nal nu i ion in he exp ession p o ile o goble cell ma ke s om
he o sp ing colon a 4 and 18 days o lac a ion. Quan i a i e RT-qPCR analysis o Muc2 (
a
), T 3 (
b
),
T 1 (
c
) and Kl 3 (
d
) no malized wi h he 18S ibosomal gene. Da a ep esen mean
±
SEM (n= 5–6).
S uden ’s -analysis was used o e alua e di e ences be ween he wo g oups in e m so he ype o
die . * p< 0.05; ** p< 0.001 compa ed o g oup C wi hin each age. C: con ol; U; Unde nou ished;
L: lac a ion.
4. Discussion
Lac a ion is conside ed a pe iod o majo ele ance in me abolic p og amming because
milk bac e ia a e among he i s mic obes o en e he neona al gas oin es inal ac
and, consequen ly, hey ac as d i e s in he acquisi ion and de elopmen o a heal hy
mic obio a [
18
,
33
]. Mo he - o-in an bac e ial ans e h ough ma e nal milk has been
epea edly desc ibed a he species and/o he s ain le el, ia bo h cul u e-dependen
and cul u e-independen echniques [
18
,
34
]. Wo h no ing is ha app oxima ely a qua e
o he bac e ia de ec ed in in an eces du ing ea ly li e seems o de i e om milk [
35
]
and he bac e ial gene a accoun ing o mos o he abundance (>70%) in in an eces a e
sha ed wi h human milk [
36
]. In he same di ec ion, i has been ecen ly desc ibed ha
Nu ien s 2023,15, 4322 19 o 26
ma e nal milk is closely associa ed wi h o sp ing mic obiome di e si y [
37
]. The e o e, as
die has been shown o be a majo de e minan o he ype and abundance o mic obio a
in he gas oin es inal ac , in he p esen s udy we ha e in es iga ed how ma e nal die
du ing p egnancy and lac a ion a ec his mic obial communica ion be ween mo he and
o sp ing. Ou da a show ha he diso de o milk mic obio a induced ia ma e nal ood
es ic ion seems o change he p o ile o o sp ing in es inal mic obiome and hen p omo e
an imma u e in es inal mic obio a and gu ba ie unc ion.
E en hough no die a y e ec was obse ed o alpha di e si y, nei he in milk no in
ecal samples, be a di e si y was signi ican o age and die , in bo h ypes o samples, wi h
he bac e ia ound in U samples a L4 displaying he highes dis ance o all o he samples.
I is wo h no ing ha bac e ia iden i ied in ecal samples om UL14 we e mo e simila o
CL4 han o hose collec ed om animals o he same age bu consuming a di e en die .
These esul s ein o ce he idea ha ma e nal die in luence milk mic obial composi ion
and his e ec is mi o ed in o sp ing eces, p omo ing an imma u e gu mic obiome.
Likewise, se e ely unde nou ished child en om Bangladesh [
38
] showed ma ked gu
mic obio a imma u i y ha could no be e e sed wi h die a y in e en ions, which is in
ag eemen wi h ou p e ious s udies pe o med wi h a ca ch-up g ow h a model [
16
] o
in humanized mouse models o malnu i ion [39].
The bac e ia ound in milk and o sp ing eces du ing lac a ion we e mainly ep e-
sen ed by he phyla Fi micu es, P o eobac e ia, Bac e oido a and Ac inobac e ia, he la e
axa being less abundan han he o me wo. The mos abundan ASVs ound in he milk
we e iden i ied as Lac obacillus, which accoun ed o mos o he eads wi hin he phylum
Fi micu es. The con ibu ion o Lac obacillus spp. o milk is highly conse ed ac oss species
and known o p oduce bac e iocins, which a e able o inhibi he g ow h o pa hogens [
40
].
Mo eo e , as a acul a i e anae obe, Lac obacillus is conside ed a pionee bac e ial specie
ha du ing he i s days o lac a ion deple es oxygen om gu and he eby acili a es
he subsequen coloniza ion o he gu en i onmen ia obliga e anae obes [
41
]. Wa en
e al. [
27
] epo ed ha a ia ions in he p o ein con en o ma e nal die in luenced he
ela i e abundance o he genus Lac obacillus no only om ma e nal milk bu also om
o sp ing eces. In ag eemen , we obse ed Lac obacillus spp. o show g ea e ela i e
abundance a he beginning o lac a ion in he eces om pups o mo he s subjec ed o
ood es ic ion, despi e no pa allel e ec o die being obse ed in milk. In e es ingly, i
has been sugges ed ha highe coloniza ion o he gu wi h Lac obacillus spp. in ea ly li e
p edic s an inc eased isk o being o e weigh and me abolic al e a ions in he u u e [
42
].
Gi en ha Lac obacillus spp. a e no mally ound in he aginal niche, i is possible
ha he high le els o Lac obacillus axa in he o sp ing ecal samples om U mo he s
o igina ed in pa , du ing deli e y, om changes in he aginal mic obio a composi ion
o mo he s. The composi ion o he aginal mic obio a is unde he con ol o ho monal
pa e ns [
43
] wi h highe abundance in Lac obacillus species wi h inc easing ges a ional
age. This e en seems o be pa o a s a egy o ensu e lac ic acid p oduc ion, educe
pH in he aginal ca i y and p o ec he e us om in ec ions. Howe e , he in luence
o en i onmen al ac o s, such as s ess o die , on aginal communi y s abili y is poo ly
known. Al hough ch onic s ess induced by se e e ood es ic ion, like in pa ien s wi h
ano exia ne osa, has been associa ed wi h bac e ial aginosis, mens ual cycle i egula i y
and ameno hea [
44
], he in e ac ion be ween die , mens ual dys unc ion and aginal
communi y s abili y emain unexplo ed. Thus, i is possible ha ma e nal die du ing
ges a ion may al e he aginal mic obio a ansmi ed o o sp ing and subsequen ly
in luence hei gu coloniza ion and ma u a ion.
In addi ion o Lac obacillus,Esche ichia-Shigella, included in he phylum P o eobac e ia,
is also conside ed a pionee bac e ium wi h high abundance h oughou lac a ion in he
eces o well-nou ished pups. Howe e , i s p oli e a ion appea s o be condi ioned by
nu i ional s a us gi en i s almos absolu e absence a he beginning o lac a ion in he
milk o U mo he s as well as in hei o sp ing eces, bu he subsequen sha p inc ease in
eces. This e en migh a ec he es ablishmen o a sui able in es inal mic oen i onmen
Nu ien s 2023,15, 4322 20 o 26
o ensu e he coloniza ion o s ic anae obic bac e ia and consequen ly, delay gu mic o-
bio a ma u a ion. Al hough Esche ichia-Shigella is a non-pa hogenic genus, unde speci ic
ci cums ances, ce ain se o ypes can igge symp oms such as dia hea, wi h inc eased
in es inal pe meabili y and dis up ed epi helial ba ie o e en ex a-in es inal in lamma-
o y p ocesses [
45
–
48
]. The low numbe o samples analyzed in his s udy implies ha he
mic obial shi s de ec ed o his genus did no each a s a is ically signi ican h eshold bu
migh , in ac , be ele an o homeos asis and heal h, and should be ca e ully e alua ed in
u u e s udies in ol ing a la ge numbe o animals.
Wi hin he phylum P o eobac e ia, ou me a axonomic analysis also success ully
de ec ed sequences belonging o he amily Pas eu ellaceae. Mos o hem we e assigned
o he genus Roden ibac e , while a mino ac ion was assigned o o he gene a, such as
Haemophilus and Mu ibac e . Howe e , i is impo an o no e ha ou sequencing app oach
aced some limi a ions in dis inguishing be ween sequences belonging o di e en gene a
wi hin his amily. Consequen ly, al hough he ele a ed abundance o Pas eu ellaceae in milk
samples om U animals a L4 migh p ima ily be a ibu able o Roden ibac e , he po en ial
con ibu ion o o he gene a wi hin his amily should no be disca ded.
I is no ewo hy ha in he p esen s udy, mo he s’ milk was no collec ed om he
mamma y gland as is ca ied ou in o he simila app oaches [
27
], bu om he pup’s
s omach, which is indeed he same ou e as ha o suckling o sp ing. Undoub edly,
he o sp ing mic obio a, pa icula ly ha om he o al ca i y, will modi y he bac e ia
exp essed in milk [
19
,
49
], bu will also con ibu e o he es ablishmen o he i s gu
colonize s. In line wi h his concep , he p esence o he genus Po phy omonas in he milk
o nu i ionally es ic ed mo he s d ew a en ion in ou s udies. Po phy omonas is an
anae obic bac e ium ound in he o al ca i y and is associa ed wi h he de elopmen o
pe iodon al disease. I s p esence in he o al ca i y and consequen ly, i s inges ion du -
ing ood in ake causes in es inal dysbiosis by c ea ing an en i onmen a o able o he
coloniza ion o p o-in lamma o y mic oo ganisms [
50
] and e en ually leading o ulce -
a i e coli is [
51
] o colo ec al cance [
52
]. Likewise, me abolic s udies pe o med wi h
s ep ozo ocin- ea ed mice ( o gene a e a diabe ic si ua ion) and subsequen Po phy omonas
adminis a ion showed a wo sening o he glycemic con ol oge he wi h local and sys-
emic in lamma o y e en s [
53
]. Thus, he p esence o Po phy omonas in milk migh be
conside ed a bioma ke o u u e gu dysbiosis, in lamma o y p ocesses and long- e m
me abolic al e a ions. Acco dingly, we ha e p e iously desc ibed he a o emen ioned
e iopa hological iangle in he same animal model o ood es ic ion used he ein [
16
].
Howe e , he e y ea ly igge ing e en s o his pheno ype and i s ela ionship wi h
b eas eeding and ma e nal die needed u he in es iga ions.
On he o he hand, i is known ha in es inal pe meabili y a bi h is high in newbo ns
and hen g adually dec eases o ensu e ull unc ionali y and p o ec ion om pa hogens [
54
].
Mo eo e , e idence sugges ha ce ain bac e ia and bioac i e compounds in b eas milk
play a key ole in egula ing mucosal in eg i y and in es inal epi helial pe meabili y. Hu-
man s udies ha e shown ha ull- e m b eas ed in an s ha e lowe in es inal pe meabili y
han do o mula- ed in an s [
55
,
56
]. These obse a ions a e consis en wi h animal s udies
showing ha ge m- ee mice ha e many mo phological in es inal de ec s compa ed o hei
no mally colonized coun e pa s, sugges ing ha he de elopmen o ba ie unc ion is
dependen on he p esence o mic oo ganisms [
57
]. Howe e , he speci ic mechanisms by
which a ia ions in he gu mic obio a shape he ea ly plas ici y o in es inal pe meabili y
and how hese ac o s con ibu e o heal h s a us in la e li e emain poo ly unde s ood. The
apical epi helial ne wo k o igh junc ion p o eins is he p incipal de e minan o pa acel-
lula pe meabili y and immune sys em homeos asis [
31
]. In he p esen s udy, we obse ed
ha ma e nal ood es ic ion inc eased colonic pe meabili y in he lac a ing o sp ing, as
e idenced by a educ ion in ZO-1 p o ein le els, which was no ully amelio a ed when
unde nu i ion was co ec ed pos weaning [
16
]. In ag eemen , se e e p o ein de iciency in
animal models led o s uc u al and unc ional changes o he in es ine, including malab-
so p ion and he de elopmen o a leaky gu wi h inc eased pe meabili y [
17
,
58
]. In es inal
Nu ien s 2023,15, 4322 21 o 26
biopsies om se e ely unde nou ished child en wi h en e opa hy also showed a educed
exp ession o he igh junc ions claudin-4 and E-cadhe in [
59
], al hough he molecula
mechanism ela ing unde nu i ion o changes in pa acellula p o eins emains unclea .
In line wi h his, he dis up ion o epi helial igh junc ion p o eins is consis en wi h he
ansloca ion o bac e ial componen s o he ci cula ion and de elopmen o endo oxemia,
as we [
16
] and o he s [
60
] ha e p e iously desc ibed. These changes in igh junc ion
p o ein le els pa alleled changes in he exp ession o epi helial cell componen s such as
he e oil ac o amily o pep ides (TFF), which a e no mally co-sec e ed wi h mucins. In
pa icula , TFF1 and TFF3 ac i ely pa icipa e wi h immune sys em molecules in p o ec ing
he in es inal mucosa om mic oo ganisms [
61
]. In ou animal model, we did no obse e
di e ences in T 1 exp ession associa ed wi h die ype. Howe e , a he beginning and end
o lac a ion, he exp ession o T 3 was inc eased in o sp ing subjec ed o die a y es ic ion.
In his ega d, ecen s udies in animals and pedia ic pa ien s wi h in lamma o y bowel
disease ha e shown ele a ed se um le els o TFF3, an e en associa ed wi h inc eased
in es inal pe meabili y and in lamma ion ha is no seen in heal hy subjec s o pa ien s in
emission [
62
]. The e o e, conside ing he lack o di e ences in mucin (Muc2) exp ession
be ween C and U lac a ing pups, bu he inc ease in T 3 in he la e , we hypo hesize
ha he in lamma o y esponse is ac i a ed in he colon o his popula ion. In line wi h
his, Fança-Be hon e al. [
17
] p e iously desc ibed ha he o sp ing o mo he s ed a
low-p o ein die showed dis u bed exp ession o T 3 in he colon du ing lac a ion. Like-
wise, he KLF (K üppel-like ac o ) amily o ansc ip ion ac o s is also in ol ed in he
con ol o cell p oli e a ion and di e en ia ion in bo h heal hy and pa hological si ua ions,
as well as in in lamma o y esponses [
63
]. Mo eo e , s udies in humans wi h colo ec al
cance ha e desc ibed an un a o able p ognosis a low exp ession le els o KLF3 [
64
].
The e o e, he educed exp ession o his ac o in he colon o UL18 a s compa ed o ha
in CL18 animals could be conside ed a ma ke o incipien in lamma ion. Taken oge he ,
hese esul s sugges ha inc eased pe meabili y may p o ide ansi ional bene i s o U
pups, such as imp o ed nu ien up ake and he de elopmen o sys emic ole ance, which
migh a o hei su i al. Howe e , i may also imply some disad an ages, including he
inc eased ansloca ion o mic obes and o eign pa icles leading o he de elopmen o
in ec ion, in lamma ion and me abolic disease.
Finally, we used Pea son’s co ela ions o suppo e ical mo he - o-child ansmis-
sion and he po en ial in luence o nu i ional s a us in his p ocess. I should be no ed ha
e ical ansmission can be di ec , when he p esence o a pa icula bac e ium in he milk
de e mines he p esence o he same genus in he eces, o indi ec , when he p esence o a
pa icula genus in he milk de e mines he p esence o absence o o he di e en gene a in
he eces. Thus, a ea ly lac a ion, he p esence o Esche ichia-Shigella in he milk om well-
ed animals posi i ely co ela ed wi h he abundance o hese axa in he o sp ing’s eces,
bu wi h a lowe in es inal g ow h o Lac obacillus spp. This nega i e co ela ion be ween
milk-de i ed Esche ichia-Shigella and he ecal con en o Lac obacillus was no obse ed in
U animals, p obably due o he disc iminan abundance o Esche ichia-Shigella in he milk
o ood- es ic ed mo he s a L4 which migh ha e allowed he ini ial coloniza ion o he
gu o be domina ed by Lac obacillus spp. Howe e , he la e educ ion o his axon in he
milk om ood- es ic ed animals, s ongly co ela ed wi h lowe p esence o Lac obacillus
in eces, bu he highe ela i e abundance o Esche ichia-Shigella suppo ed he nega i e
co ela ion be ween he ela i e abundance o hese wo gene a in eces as p e iously de-
sc ibed du ing he p og ession om ulce a i e coli is o colo ec al cance [
65
]. In e es ingly,
Pea son’s co ela ions also e idenced ha he numbe o posi i e associa ions de ec ed
du ing lac a ion be ween ecal anae obic bac e ia, including Fusobac e ium,Roden ibac e ,
Bac e oides,Rombus ia o Veillonella was signi ican ly mo e abundan in con ol animals han
in hose exposed o ma e nal ood es ic ion, sugges ing ha he o ma ion o an anae obic
en i onmen , cha ac e is ic o an adul gu mic obial p o ile, was delayed in he o sp ing
as a esul o ma e nal die . Thus, ou indings indica e ha gu mic obial composi ion is

Nu ien s 2023,15, 4322 22 o 26
no only de e mined by he pa icula cha ac e is ics o each mic obial communi y, bu ha
en i onmen al changes also shape he inal mic obio a.
Se e al ad an ages and limi a ions o he p esen s udy should be no ed. The main
s eng h is ha by collec ing sequen ial samples om each li e , we could examine longi u-
dinal changes in milk mic obio a composi ion o e ime and co ela e hem wi h a ia ions
in he ecal mic obiome. In addi ion, he use o a a model o e s he ad an age o be-
ing able o ca e ully con ol he ma e nal die in he absence o o he ex e nal in luences
o s udy he in es inal ou comes o he o sp ing. Howe e , his in i sel is a limi a ion
when we conside ha a s a e poly ocous and al icial mammals, meaning ha a s gi e
bi h o la ge li e s bo n a an imma u e s age a e ela i ely sho p egnancies, whe eas
women gene ally bea a single e us a an ad anced s age o me abolic de elopmen . How-
e e , compa a i e physiology be ween species p o ides an oppo uni y o unde s and he
molecula , cellula and biochemical mechanisms in ol ed in he ea ly o igin o me abolic
p og amming. On he o he hand, die and age we e no able o explain all he changes
obse ed in milk and ecal bac e ial composi ion, sugges ing ha o he ac o s may ha e
con ibu ed o he la ge in e -indi idual a ia ions obse ed in he mic obio a p o iles. In
his ega d, sex di e ences in he gu mic obio a ha e been epo ed in adul indi iduals
and a e usually a ibu ed o ho monal di e ences be ween males and emales. Howe e ,
he e is no consensus on his ela ionship in ea ly li e coloniza ion o in ela ion o b eas -
eeding [
42
,
49
]. Thus, he absence o gende -s a i ied analysis in he p esen s udy could
possibly explain why ou da a showed some inconclusi e esul s on he associa ion o he
die -induced shi in he milk mic obio a wi h a ia ions in he ecal composi ion o he
o sp ing. Finally, as 16S RNA gene sequencing has limi ed abili y o esol e axa beyond
he genus le el, u he me agenomic and cul u ing analysis will be equi ed o con i m
and alida e he esul s o his s udy as well as o quan i y bac e ial load and he iabili y
o he bac e ia iden i ied in ou samples.
5. Conclusions
In conclusion (Figu e 10), ma e nal malnu i ion is able o modi y he mic obial com-
posi ion o b eas milk, a phenomenon ha is e lec ed in he in es inal mic obio a o he
o sp ing. This ac suppo s he idea o a e ical ansmission o bac e ia om mo he o
child. One o he e ec s o his nu i ional condi ion is he delay in he ma u a ion o he in-
es inal mic obio a, as e idenced by he gap ha exis s bo h, in he e olu ion o he bac e ial
di e si y and he appea ance o he main colonizing gene a du ing lac a ion. These mic o-
bial changes we e accompanied by al e a ions in o sp ing gu pe meabili y, pa icula ly
a he end o lac a ion, as well as in he goble cell ma ke s T 3 and Kl 3, associa ed wi h
cell enewal and ch onic in lamma o y p ocesses. I is wo h men ioning ha ou p e ious
s udies [
16
] ha e al eady demons a ed ha his mic obio a imma u i y is main ained
beyond weaning and e en un il adul hood, which poin s ou he po en ial con ibu ion
o al e ed gu coloniza ion o he associa ed mo bidi ies and he sequelae o malnu i ion
in ea ly li e, including an inc eased isk o obesi y and glucose in ole ance. The e o e,
ou da a highligh he impo ance o b eas eeding as a c i ical window o he apeu ic
in e en ion ia he modula ion o he in an mic obio a as pa o p e en i e medicine.
Nu ien s 2023,15, 4322 23 o 26
Nu ien s 2023, 15, x FOR PEER REVIEW 23 o 26
he apeu ic in e en ion ia he modula ion o he in an mic obio a as pa o p e en i e
medicine.
Figu e 10. Ma e nal nu i ion de e mining milk mic obio a and in luencing offsp ing gu coloniza-
ion. Nu i ional es ic ion du ing he ea ly s ages o de elopmen al e s he mic obial composi ion
o ma e nal milk, a phenomenon e lec ed in he in es inal mic obio a o he offsp ing. As a esul ,
i al e s he abundance o majo axa in milk and eces, delaying he ma u ing o offsp ing gu mi-
c obio a. Addi ionally, hese changes in mic obial composi ion a e associa ed wi h changes in gu
pe meabili y and in he goble cells ma ke s, which a e associa ed wi h ch onic egene a ion o cells
and in lamma o y p ocesses.
Supplemen a y Ma e ials: The ollowing suppo ing in o ma ion can be downloaded a
www.mdpi.com/xxx/s1. Table S1: Rela i e abundance o he mos abundan gene a in he milk o
con ol (C) and unde nou ished (U) a s a 4, 14 and 18 days o lac a ion.; Table S2: Rela i e abun-
dance o he mos abundan gene a in he eces o con ol (C) and unde nou ished (U) offsp ing a s
a 4, 14 and 18 days o lac a ion.
Au ho Con ibu ions: Concep ualiza ion: E.F.-M. and C.Á.; me hodology: P.M.-O., C.A., T.F.-M.
and A.S.-R.; in es iga ion: E.F.-M., P.M.-O. and C.Á.; da a analysis: P.M.-O., C.A. and T.F.-M.; und-
ing Acquisi ion: E.F.-M.; C.Á., M.Á.M. and J.M.R.; isualiza ion: E.F.-M., C.A., F.E. and M.Á.M. w i -
ing—o iginal d a p epa a ion: P.M.-O., C.A. and E.F.-M.; w i ing— e iew and edi ing: E.F.-M.,
C.Á., F.E., M.Á.M. and J.M.R. All au ho s ha e ead and ag eed o he published e sion o he man-
usc ip .
Funding: This wo k was suppo ed by he g an s PID2020-116134RB-I00, PID2019-105606RB-I00
and CIBER-Conso cio Cen o de In es igación Biomédica en Red-(CB07/08/0013), Ins i u o de Salud
Ca los III, om Minis e io de Ciencia e Inno ación (MINECO).
Ins i u ional Re iew Boa d S a emen : All he expe imen s we e conduc ed in acco dance wi h
Eu opean Union (2010/63/EU) and Spanish (RD 53/2013) legisla ion and wi h he app o al o he
Animal Ca e and Use Commi ee o he Communi y o Mad id (PROEX 349/15 and PROEX 215.8/21).
In o med Consen S a emen : No applicable.
Da a A ailabili y S a emen : Da a a e a ailable upon eques o he au ho s.
Con lic s o In e es : The au ho s decla e no con lic o in e es .
Figu e 10.
Ma e nal nu i ion de e mining milk mic obio a and in luencing o sp ing gu coloniza ion.
Nu i ional es ic ion du ing he ea ly s ages o de elopmen al e s he mic obial composi ion o
ma e nal milk, a phenomenon e lec ed in he in es inal mic obio a o he o sp ing. As a esul ,
i al e s he abundance o majo axa in milk and eces, delaying he ma u ing o o sp ing gu
mic obio a. Addi ionally, hese changes in mic obial composi ion a e associa ed wi h changes in gu
pe meabili y and in he goble cells ma ke s, which a e associa ed wi h ch onic egene a ion o cells
and in lamma o y p ocesses.
Supplemen a y Ma e ials:
The ollowing suppo ing in o ma ion can be downloaded a h ps://
www.mdpi.com/a icle/10.3390/nu15204322/s1. Table S1: Rela i e abundance o he mos abundan
gene a in he milk o con ol (C) and unde nou ished (U) a s a 4, 14 and 18 days o lac a ion.; Table
S2: Rela i e abundance o he mos abundan gene a in he eces o con ol (C) and unde nou ished
(U) o sp ing a s a 4, 14 and 18 days o lac a ion.
Au ho Con ibu ions:
Concep ualiza ion: E.F.-M. and C.Á.; me hodology: P.M.-O., C.A., T.F.-M.
and A.S.-R.; in es iga ion: E.F.-M., P.M.-O. and C.Á.; da a analysis: P.M.-O., C.A. and T.F.-M.; unding
Acquisi ion: E.F.-M.; C.Á., M.Á.M. and J.M.R.; isualiza ion: E.F.-M., C.A., F.E. and M.Á.M. w i ing—
o iginal d a p epa a ion: P.M.-O., C.A. and E.F.-M.; w i ing— e iew and edi ing: E.F.-M., C.Á., F.E.,
M.Á.M. and J.M.R. All au ho s ha e ead and ag eed o he published e sion o he manusc ip .
Funding:
This wo k was suppo ed by he g an s PID2020-116134RB-I00, PID2019-105606RB-I00 and
CIBER-Conso cio Cen o de In es igación Biomédica en Red-(CB07/08/0013), Ins i u o de Salud
Ca los III, om Minis e io de Ciencia e Inno ación (MINECO).
Ins i u ional Re iew Boa d S a emen :
All he expe imen s we e conduc ed in acco dance wi h
Eu opean Union (2010/63/EU) and Spanish (RD 53/2013) legisla ion and wi h he app o al o he
Animal Ca e and Use Commi ee o he Communi y o Mad id (PROEX 349/15 and PROEX 215.8/21).
In o med Consen S a emen : No applicable.
Da a A ailabili y S a emen : Da a a e a ailable upon eques o he au ho s.
Con lic s o In e es : The au ho s decla e no con lic o in e es .
Nu ien s 2023,15, 4322 24 o 26
Re e ences
1.
Pena-León, V.; Folguei a, C.; Ba ja-Fe nández, S.; Pé ez-Lois, R.; Da Sil a Lima, N.; Ma in, M.; He as, V.; Ma ínez-Ma ínez, S.;
Vale o, P.; Iglesias, C.; e al. P olonged b eas eeding p o ec s om obesi y by hypo halamic ac ion o hepa ic FGF21. Na . Me ab.
2022,4, 901–917. [C ossRe ] [PubMed]
2.
Picó, C.; Reis, F.; Egas, C.; Ma hias, P.; Ma a ome, P. Lac a ion as a p og amming window o me abolic synd ome. Eu . J. Clin.
In es ig. 2021,51, e13482. [C ossRe ]
3.
Hsu, C.N.; Hou, C.Y.; Hsu, W.H.; Tain, Y.L. Ea ly-Li e O igins o Me abolic Synd ome: Mechanisms and P e en i e Aspec s. In . J.
Mol. Sci. 2021,22, 11872. [C ossRe ]
4.
De To o-Ma ín, J.; Fe nández-Millán, E.; Lizá aga-Mollinedo, E.; López-Oli a, E.; Se adas, P.; Esc i á, F.; Ál a ez, C. P edomi-
nan ole o GIP in he de elopmen o a me abolic synd ome-like pheno ype in emale Wis a a s submi ed o o ced ca ch-up
g ow h. Endoc inology 2014,155, 3769–3780. [C ossRe ]
5.
Tsuduki, T.; Ki ano, Y.; Honma, T.; Kijima, R.; Ikeda, I. High die a y a in ake du ing lac a ion p omo es de elopmen o
die -induced obesi y in male o sp ing o mice. J. Nu . Sci. Vi aminol. 2013,59, 384–392. [C ossRe ] [PubMed]
6. Ba ke , D.J. The o igins o he de elopmen al o igins heo y. J. In e n. Med. 2007,261, 412–417. [C ossRe ] [PubMed]
7.
G igo , M.R.; Allan, J.E.; Ca ing on, J.M.; Ca ne, A.; Geu sen, A.; Young, D.; Thompson, M.P.; Haynes, E.B.; Coleman, R.A. E ec
o Die a y P o ein and Food Res ic ion on Milk P oduc ion and Composi ion, Ma e nal Tissues and Enzymes in Lac a ing Ra s. J.
Nu . 1987,117, 1247–1258. [C ossRe ]
8.
Bau is a, C.J.; Bau is a, R.J.; Mon año, S.; Reyes-Cas o, L.A.; Rod iguez-Peña, O.N.; Ibáñez, C.A.; Na hanielsz, P.W.; Zamb ano, E.
E ec s o ma e nal p o ein es ic ion du ing p egnancy and lac a ion on milk composi ion and o sp ing de elopmen . B . J.
Nu . 2019,122, 141–151. [C ossRe ]
9.
Wa ez, J.S.; Delmon , A.; Bou e , M.; Beseme, O.; Goe s, S.; Delahaye, F.; Labo ie, C.; Lesage, J.; Foligné, B.; B e on, C.; e al.
Ma e nal pe ina al unde nu i ion modi ies lac ose and se o an e in in milk: Rele ance o he p og amming o me abolic
diseases? Am. J. Physiol. Endoc inol. Me ab. 2015,308, E393–E401. [C ossRe ]
10.
Fio o o, M.L.; Bu in, D.G.; Pe ez, M.; Reeds, P.J. In ake and use o milk nu ien s by a pups suckled in small, medium, o la ge
li e s. Am. J. Physiol. 1991,260, R1104–R1113. [C ossRe ]
11.
Palou, M.; To ens, J.M.; Cas illo, P.; Sánchez, J.; Palou, A.; Picó, C. Me abolomic app oach in milk om calo ie- es ic ed a s
du ing lac a ion: A po en ial link o he p og amming o a heal hy pheno ype in o sp ing. Eu . J. Nu .
2020
,59, 1191–1204.
[C ossRe ]
12.
Lizá aga-Mollinedo, E.; Fe nández-Millán, E.; de To o Ma ín, J.; Ma ínez-Hondu illa, C.; Esc i á, F.; Ál a ez, C. Ea ly
unde nu i ion induces glucagon esis ance and insulin hype sensi i i y in he li e o suckling a s. Am. J. Physiol. Me ab.
2012
,
302, E1070–E1077. [C ossRe ]
13.
de To o-Ma ín, J.; Fe nández-Ma celo, T.; González-Rod íguez, Á.; Esc i á, F.; Val e de, Á.M.; Ál a ez, C.; Fe nández-Millán, E.
De ec i e li e glycogen au ophagy ela ed o hype insulinemia in in au e ine g ow h- es ic ed newbo n Wis a a s. Sci. Rep.
2020,10, 17651. [C ossRe ]
14.
Lizá aga-Mollinedo, E.; Fe nández-Millán, E.; Ga cía-San F u os, M.; de To o-Ma ín, J.; Fe nández-Agulló, T.; Ros, M.; Ál a ez,
C.; Esc i á, F. Ea ly and long- e m unde nu i ion in emale a s exace ba es he me abolic isk associa ed wi h nu i ional
ehabili a ion. J. Biol. Chem. 2015,290, 19353–19366. [C ossRe ] [PubMed]
15.
López, M.; Seoane, L.M.; To a , S.; Ga cía, M.C.; Noguei as, R.; Diéguez, C.; Seña ís, R.M. A possible ole o neu opep ide Y,
agou i- ela ed p o ein and lep in ecep o iso o ms in hypo halamic p og amming by pe ina al eeding in he a . Diabe ologia
2005,48, 140–148. [C ossRe ]
16.
Ma ínez-Oca, P.; Robles-Ve a, I.; Sánchez-Ronce o, A.; Esc i á, F.; Pé ez-Vizcaíno, F.; Dua e, J.; Ál a ez, C.; Fe nández-Millán, E.
Gu DYSBIOSIS and al e ed ba ie unc ion p ecedes he appea ance o me abolic synd ome in a a model o nu ien -induced
ca ch-up g ow h. J. Nu . Biochem. 2020,81, 08383. [C ossRe ]
17.
Fança-Be hon, P.; Michel, C.; Pagniez, A.; Ri al, M.; Van Seuningen, I.; Da maun, D.; Hoeble , C. In au e ine g ow h es ic ion
al e s pos na al colonic ba ie ma u a ion in a s. Pedia . Res. 2009,66, 47–52. [C ossRe ] [PubMed]
18.
Dog a, S.K.; Kwong Chung, C.; Wang, D.; Sakwinska, O.; Colombo Mo az, S.; Sp enge , N. Nu u ing he Ea ly Li e Gu
Mic obiome and Immune Ma u a ion o Long Te m Heal h. Mic oo ganisms 2021,9, 2110. [C ossRe ]
19.
Xiao, L.; Zhao, F. Mic obial ansmission, colonisa ion and succession: F om p egnancy o in ancy. Gu
2023
,72, 772–786.
[C ossRe ] [PubMed]
20.
Lackey, K.A.; Williams, J.E.; Meehan, C.L.; Zachek, J.A.; Benda, E.D.; P ice, W.J.; Fos e , J.A.; Sellen, D.W.; Kamau-Mbu hia,
E.W.; Kamundia, E.W.; e al. Wha ’s no mal? mic obiomes in human milk and in an eces a e ela ed o each o he bu a y
geog aphically: The INSPIRE s udy. F on . Nu . 2019,6, 45. [C ossRe ]
21.
Togo, A.; Du ou , J.-C.; Lagie , J.-C.; Dubou g, G.; Raoul , D.; Million, M. Repe oi e o human b eas and milk mic obio a: A
sys ema ic e iew. Fu u e Mic obiol. 2019,14, 623–641. [C ossRe ] [PubMed]
22.
S ewa , C.J.; Ajami, N.J.; O’B ien, J.L.; Hu chinson, D.S.; Smi h, D.P.; Wong, M.C.; Ross, M.C.; Lloyd, R.E.; Doddapaneni, H.;
Me cal , G.A.; e al. Tempo al de elopmen o he gu mic obiome in ea ly childhood om he TEDDY s udy. Na u e
2018
,562,
583–588. [C ossRe ]
23.
Cab e a-Rubio, R.; Mi a-Pascual, L.; Mi a, A.; Collado, M.C. Impac o mode o deli e y on he milk mic obio a composi ion o
heal hy women. J. De . O ig. Heal h Dis. 2015,7, 54–60. [C ossRe ] [PubMed]
Nu ien s 2023,15, 4322 25 o 26
24.
Cab e a-Rubio, R.; Collado, M.C.; Lai inen, K.; Salminen, S.; Isolau i, E.; Mi a, A. The human milk mic obiome changes o e
lac a ion and is shaped by ma e nal weigh and mode o deli e y. Am. J. Clin. Nu . 2012,96, 544–551. [C ossRe ]
25.
Collado, M.C.; Lai inen, K.; Salminen, S.; Isolau i, E. Ma e nal weigh and excessi e weigh gain du ing p egnancy modi y he
immunomodula o y po en ial o b eas milk. Pedia . Res. 2012,72, 77–85. [C ossRe ] [PubMed]
26.
Kalliomäki, M.; Collado, M.C.; Salminen, S.; Isolau i, E. Ea ly di e ences in ecal mic obio a composi ion in child en may p edic
o e weigh . Am. J. Clin. Nu . 2008,87, 534–538. [C ossRe ]
27.
Wa en, M.F.; Hallowell, H.A.; Higgins, K.V.; Liles, M.R.; Hood, W.R. Ma e nal Die a y P o ein In ake In luences Milk and
O sp ing Gu Mic obial Di e si y in a Ra (Ra us no egicus) Model. Nu ien s 2019,11, 2257. [C ossRe ]
28.
Cabinian, A.; Sinsime , D.; Tang, M.; Zumba, O.; Meh a, H.; Toma, A.; San ’Angelo, D.; Laoua , Y.; Laoua , A. T ans e o Ma e nal
Immune Cells by B eas eeding: Ma e nal Cy o oxic T Lymphocy es P esen in B eas Milk Localize in he Peye ’s Pa ches o he
Nu sed In an . PLoS ONE 2016,11, e0156762. [C ossRe ]
29.
Rod íguez-C uz, M.; Alba, C.; Apa icio, M.; Checa, M.Á.; Fe nández, L.; Rod íguez, J.M. E ec o Sample Collec ion (Manual
Exp ession s. Pumping) and Skimming on he Mic obial P o ile o Human Milk Using Cul u e Techniques and Me a axonomic
Analysis. Mic oo ganisms 2020,8, 1278. [C ossRe ]
30.
Schindelin, J.; A ganda-Ca e as, I.; F ise, E.; Kaynig, V.; Longai , M.; Pie zsch, T.; P eibisch, S.; Rueden, C.; Saal eld, S.; Schmid,
B.; e al. Fiji: An open-sou ce pla o m o biological-image analysis. Na . Me hods 2012,9, 676–682. [C ossRe ]
31.
Odenwald, M.A.; Tu ne , J.R. The in es inal epi helial ba ie : A he apeu ic a ge ? Na . Re . Gas oen e ol. Hepa ol.
2012
,14, 9–21.
[C ossRe ]
32.
C osnie , C.; S ama aki, D.; Lewis, J. O ganizing cell enewal in he in es ine: S em cells, signals and combina o ial con ol. Na .
Re . Gene . 2006,7, 349–359. [C ossRe ]
33.
Milani, C.; Du an i, S.; Bo acini, F.; Casey, E.; Tu oni, F.; Mahony, J.; Belze , C.; Delgado Palacio, S.; A boleya Mon es, S.;
Mancabelli, L.; e al. The Fi s Mic obial Colonize s o he Human Gu : Composi ion, Ac i i ies, and Heal h Implica ions o he
In an Gu Mic obio a. Mic obiol. Mol. Biol. Re . 2017,81, e00036-17. [C ossRe ]
34.
Fe nández, L.; Panna aj, P.S.; Rau a a, S.; Rod íguez, J.M. The Mic obio a o he Human Mamma y Ecosys em. F on . Cell. In ec .
Mic obiol. 2020,10, 586667. [C ossRe ]
35.
Panna aj, P.S.; Li, F.; Ce ini, C.; Bende , J.M.; Yang, S.; Rollie, A.; Adise iyo, H.; Zabih, S.; Lincez, P.J.; Bi inge , K.; e al. Associa ion
be ween b eas milk bac e ial communi ies and es ablishmen and de elopmen o he in an gu mic obiome. JAMA Pedia .
2017,171, 647–654. [C ossRe ]
36.
Mu phy, K.; Cu ley, D.; O’Callaghan, T.F.; O’Shea, C.A.; Dempsey, E.M.; O’Toole, P.W.; Ross, R.P.; Ryan, C.A.; S an on, C. The
composi ion o human milk and in an ecal mic obio a o e he i s h ee mon hs o li e: A pilo s udy. Sci. Rep. 2017,7, 40597.
[C ossRe ] [PubMed]
37.
Yel e on, C.A.; Killeen, S.L.; Feehily, C.; Moo e, R.L.; Callaghan, S.L.; Ge agh y, A.A.; By ne, D.F.; Walsh, C.J.; Law on, E.M.;
Mu phy, E.F.; e al. Ma e nal b eas eeding is associa ed wi h o sp ing mic obiome di e si y; a seconda y analysis o he
Mic obeMom andomized con ol ial. F on . Mic obiol. 2023,14, 1154114. [C ossRe ] [PubMed]
38.
Sub amanian, S.; Huq, S.; Ya sunenko, T.; Haque, R.; Mah uz, M.; Alam, M.A.; Benez a, A.; Des e ano, J.; Meie , M.F.; Muegge,
B.D.; e al. Pe sis en gu mic obio a imma u i y in malnou ished Bangladeshi child en. Na u e
2014
,510, 417–421. [C ossRe ]
[PubMed]
39.
Smi h, M.I.; Ya sunenko, T.; Mana y, M.J.; T ehan, I.; Mkakosya, R.; Cheng, J.; Kau, A.L.; Rich, S.S.; Concannon, P.; Mychaleckyj,
J.C.; e al. Gu mic obiomes o Malawian win pai s disco dan o kwashio ko . Science
2013
,339, 548–554. [C ossRe ] [PubMed]
40.
Ma ín, R.; Oli a es, M.; Ma ín, M.; Xaus, J.; Fe nández, L.; Rod íguez, J. Cha ac e iza ion o a eu e in-p oducing Lac obacillus
co yni o mis s ain isola ed om a goa ’s milk cheese. In . J. Food Mic obiol. 2005,104, 267–277. [C ossRe ]
41.
Ma ino, C.; Dilmo e, A.H.; Bu cham, Z.M.; Me cal , J.L.; Jes e, D.; Knigh , R. Mic obio a succession h oughou li e om he
c adle o he g a e. Na . Re . Mic obiol. 2022,20, 707–720. [C ossRe ] [PubMed]
42.
Kozy skyj, A.L.; Kalu, R.; Kole a, P.T.; B idgman, S.L. Fe al p og amming o o e weigh h ough he mic obiome: Boys a e
disp opo iona ely a ec ed. J. De . O ig. Heal h Dis. 2016,7, 25–34. [C ossRe ] [PubMed]
43.
Jaša e i´c, E.; Bale, T.L. P ena al and pos na al con ibu ions o he ma e nal mic obiome on o sp ing p og amming. F on .
Neu oendoc inol. 2019,55, 100797. [C ossRe ] [PubMed]
44.
Milano, W.; Amb osio, P.; Ca izzone, F.; De Biasio, V.; Foia, M.G.; Sae a, B.; Milano, M.F.; Capasso, A. Mens ual Diso de s
Rela ed o Ea ing Diso de s. Endoc . Me ab. Immune Diso d. D ug Ta ge s 2022,22, 471–480. [C ossRe ]
45.
Ribe , D.; Cossa , P. How Bac e ial Pa hogens Colonize Thei Hos s and In ade Deepe Tissues. Mic obes In ec .
2015
,17, 173–183.
[C ossRe ] [PubMed]
46.
Liang, H.; Song, H.; Zhang, X.; Song, G.; Wang, Y.; Ding, X.; Duan, X.; Li, L.; Sun, T.; Kan, Q. Me o min a enua ed sepsis- ela ed
li e inju y by modula ing gu mic obio a. Eme g. Mic obes In ec . 2022,11, 815–828. [C ossRe ] [PubMed]
47.
Li, X.; He, C.; Li, N.; Ding, L.; Chen, H.; Wan, J.; Yang, X.; Xia, L.; He, W.; Xiong, H.; e al. The in e play be ween he gu mic obio a
and NLRP3 ac i a ion a ec s he se e i y o acu e panc ea i is in mice. Gu Mic obes 2020,11, 1774–1789. [C ossRe ] [PubMed]
48.
Ca aneo, A.; Ca ane, N.; Galluzzi, S.; P o asi, S.; Lopizzo, N.; Fes a i, C.; Fe a i, C.; Gue a, U.P.; Paghe a, B.; Muscio, C.; e al.
Associa ion o b ain amyloidosis wi h p o-in lamma o y gu bac e ial axa and pe iphe al in lamma ion ma ke s in cogni i ely
impai ed elde ly. Neu obiol. Aging 2017,49, 60–68. [C ossRe ]