Ci a ion: Ma ínez-Oca, P.; Alba, C.;
Sánchez-Ronce o, A.;
Fe nández-Ma celo, T.; Ma ín, M.Á.;
Esc i á, F.; Rod íguez, J.M.; Ál a ez,
C.; Fe nández-Millán, E. Ma e nal
Die De e mines Milk Mic obiome
Composi ion and O sp ing Gu
Coloniza ion in Wis a Ra s. Nu ien s
2023,15, 4322. h ps://doi.o g/
10.3390/nu15204322
Academic Edi o : Ma loes
Dekke Ni e
Recei ed: 14 Sep embe 2023
Re ised: 7 Oc obe 2023
Accep ed: 9 Oc obe 2023
Published: 10 Oc obe 2023
Copy igh : © 2023 by he au ho s.
Licensee MDPI, Basel, Swi ze land.
This a icle is an open access a icle
dis ibu ed unde he e ms and
condi ions o he C ea i e Commons
A ibu ion (CC BY) license (h ps://
c ea i ecommons.o g/licenses/by/
4.0/).
nu ien s
A icle
Ma e nal Die De e mines Milk Mic obiome Composi ion and
O sp ing Gu Coloniza ion in Wis a Ra s
Paula Ma ínez-Oca 1,† , Claudio Alba 2,† , Alicia Sánchez-Ronce o 3, Tama a Fe nández-Ma celo 4,
Ma íaÁngeles Ma ín4,5 , Fe nando Esc i á3,4, Juan Miguel Rod íguez 2, Ca men Ál a ez 3,4
and Elisa Fe nández-Millán3,4,*
1Ins i u o de In es igación en Ciencias de la Alimen ación (CIAL), Campus de Excelencia Cien í ica,
Consejo Supe io de In es igaciones Cien í icas-Uni e sidad Au ónoma de Mad id (CSIC-UAM),
28049 Mad id, Spain; [email p o ec ed]
2Depa men o Nu i ion and Food Science, Facul y o Ve e ina y Sciences, Uni e si y Complu ense o
Mad id, 28040 Mad id, Spain; [email p o ec ed] (C.A.); jm [email p o ec ed] (J.M.R.)
3
Depa men o Biochemis y and Molecula Biology, Facul y o Pha macy, Complu ense Uni e si y o Mad id,
28040 Mad id, Spain; [email p o ec ed] (A.S.-R.); [email p o ec ed] (F.E.); [email p o ec ed] (C.Á.)
4Cen o de In es igación Biomédica en Red (CIBERDEM), ISCIII, 28029 Mad id, Spain;
[email p o ec ed] (T.F.-M.); [email p o ec ed] (M.Á.M.)
5Depa men o Me abolism and Nu i ion, Ins i u e o Food Science and Technology and Nu i ion (ICTAN),
Consejo Supe io de In es igaciones Cien í icas (CSIC), 28040 Mad id, Spain
*Co espondence: [email p o ec ed]
†These au ho s con ibu ed equally o his wo k.
Abs ac :
Mo he ’s milk con ains a unique mic obiome ha plays a ele an ole in o sp ing heal h.
We hypo hesize ha ma e nal malnu i ion du ing lac a ion migh impac he mic obial composi ion
o milk and a ec adequa e o sp ing gu coloniza ion, inc easing he isk o la e onse diseases.
Then, Wis a a s we e ed ad libi um (Con ol, C) ood es ic ion (Unde nou ished, U) du ing
ges a ion and lac a ion. A e bi h, o sp ing eces and milk s omach con en we e collec ed a
lac a ing day (L)4, L14 and L18. The V3–V4 egion o he bac e ial 16S RNA gene was sequenced
o cha ac e ize bac e ial communi ies. An analysis o be a di e si y e ealed signi ican dispa i ies
in mic obial composi ion be ween g oups o die a L4 and L18 in bo h milk, and ecal samples. In
o al, 24 phyla we e iden i ied in milk and 18 we e iden i ied in eces, wi h Fi micu es, P o eobac e ia,
Ac inobac e oido a and Bac e oido a collec i ely ep esen ing 96.1% and 97.4% o hose iden i ied,
espec i ely. A highe abundance o Pas eu ellaceae and Po phy omonas a L4, and o Gemella and En e-
ococcus a L18 we e egis e ed in milk samples om he U g oup. Lac obacillus was also signi ican ly
mo e abundan in ecal samples o he U g oup a L4. These mic obial changes comp omised he
numbe and a ie y o milk– eces o eces– eces bac e ial co ela ions. Mo eo e , inc eased o sp ing
gu pe meabili y and an al e ed exp ession o goble cell ma ke s TFF3 and KLF3 we e obse ed in
U pups. Ou esul s sugges ha al e ed mic obial communica ion be ween mo he and o sp ing
h ough b eas eeding may explain, in pa , he de imen al consequences o ma e nal malnu i ion
on o sp ing p og amming.
Keywo ds: milk mic obiome; me abolic p og amming; gu coloniza ion; ood es ic ion; lac a ion
1. In oduc ion
Ea ly li e ad e se e en s play an impo an ole in he e iology o many diseases. In
pa icula , lac a ion is conside ed a c i ical p og amming window, being a sensi i e pe iod
in which o es ablish neu al connec ions, beha io esponses and me abolic
ci cui s [1,2].
Acco ding o his, al e ed ma e nal nu i ion has been he mos ex ensi ely s udied p o-
g amming challenge o o sp ing me abolic diseases, including obesi y and ype 2 diabe es
(T2D) [
3
–
6
]. Unde op imal condi ions, ma e nal milk is ega ded he bes eeding sou ce o
neona es, p o iding all nu ien equi emen s o ensu e adequa e g ow h and ma u a ion.
Nu ien s 2023,15, 4322. h ps://doi.o g/10.3390/nu15204322 h ps://www.mdpi.com/jou nal/nu ien s
Nu ien s 2023,15, 4322 2 o 26
Howe e , a hypocalo ic o low-p o ein die du ing lac a ion can ha e a nega i e impac on
b eas milk p oduc ion [
7
], as well as on i s con en o nu ien s [
8
,
9
], and he milk in ake by
young pups [
8
–
10
], exe ing nega i e e ec s on hei de elopmen . O he s udies in oden s,
unde mode a e o mild calo ic es ic ion du ing lac a ion (a 20% es ic ion o ad libi um
eeding), ia me abolomic analysis, iden i ied changes in 29 me aboli es ela ed o a ious
me abolic pa hways [
11
]. The mechanisms by which b eas milk p og ams in an s o a low
o high isk o becoming obese o glucose in ole an a adul hood a e no ully de ined
bu his me abolic dys unc ion has been associa ed wi h al e ed insulin sensi i i y [
12
],
hepa ic glycogen me abolism [
13
], a dis up ed lep in p oduc ion p o ile [
14
] and damaged
hypo halamic ci cui s [
14
,
15
]. Mo eo e , we and o he s ha e also desc ibed ha ma e nal
ood es ic ion leads o al e ed in es inal ba ie ma u a ion and he al e ed unc ion o he
o sp ing [
4
,
16
,
17
], p omo ing he de elopmen o local o ex a-in es inal in lamma o y
e en s [16].
I is wo h no ing ha ma e nal milk composi ion e e s no only o essen ial nu ien s
(lipids, ca bohyd a es, p o eins, i amins o mine als) bu also o o he bioac i e ac o s,
such as ho mones (insulin o lep in), cy okines, immunoglobulins, and nume ous ypes
o oligosaccha ides, among o he s [
2
]. Fo a long ime hough o be a s e ile body luid,
nowadays i is widely accep ed ha b eas milk has also i s own mic obio a, able o in lu-
ence newbo ns’ immune sys ems [
18
]. The o igin o his mic obio a is s ill unce ain. One
hypo hesis sugges s ha , h ough he p ocess o b eas eeding, skin bac e ia may be ans-
e ed o b eas milk o di ec ly o he pe son lac a ing. Ano he hypo hesis sugges s ha a
signi ican milk e lux om he in an ’s o al ca i y h ough he nipple in o he mamma y
gland may also occu . Finally, an en e o-mamma y a icking model has been p oposed
as well [
19
]. Howe e , ega dless o he ou e ia which bac e ia en e he mamma y
gland, b eas milk cons i u es he key sou ce o mic obes o neona es’ gu coloniza ion.
Human s udies ha e e ealed ha he milk o heal hy women con ains a g ea di e si y o
bac e ia, bu wi h a co e o gene a including S ep ococcus and S aphylococcus, ollowed by
Lac obacillus,Bi idobac e ium and En e ococcus [
20
,
21
]. In e es ingly, he gene a S ep ococcus
and S aphylococcus, along wi h Bi idobac e ium, ha e been desc ibed as pionee anae obic
bac e ia colonizing he gu niche in he i s days o li e [
20
,
22
], demons a ing e ical
mo he - o-child bac e ial ans e h ough b eas eeding [
20
]. The b eas milk mic obiome
can a y depending on he phase o lac a ion we a e in, he ma e nal me abolic s a us o he
body mass index as well as he weigh gain she expe ienced du ing p egnancy o he ype
o deli e y [
23
,
24
]. In his ega d, i has been seen ha obese mo he s ha e a di e en and
less di e se milk mic obial composi ion han ha o no mal-weigh mo he s [
24
], which
is cha ac e ized by low le els o Bi idobac e ium bu high le els o S aphylococcus [
25
]. In
ag eemen , lowe le els o Bi idobac e ium ha e been epo ed in eces om obese child en
compa ed o hose o no mal weigh o he same age [
26
]. Mo eo e , animal s udies, includ-
ing ou s, ha e also demons a ed ha he die es ic ion o mo he s impac s milk mic obial
di e si y [
27
] and causes a shi in he composi ion o o sp ing gu mic obio a [
16
,
27
],
which p ecedes he onse o me abolic synd ome [
4
,
16
], sugges ing a causal ela ionship.
Thus, gi en he signi ican associa ion be ween mic obiome composi ion and me abolic
disease ou comes, he ma e nal die a y in luence on o sp ing disease de elopmen may
be pa ially explained by he die a y modula ion o milk mic obial componen s impac ing
he o sp ing gu ’s p ima y coloniza ion. Howe e , o ou knowledge, no s udies ha e
pe o med a de ailed cha ac e iza ion o he milk mic obiome du ing lac a ion in pa allel
o he s udy o he empo al p og ess o gu mic obial coloniza ion. The e o e, he p ima y
pu pose o his s udy is o de e mine he in luence o ma e nal die (a 65% ood es ic ion o
Wis a a s) on he milk mic obiome and whe he o no a ia ions in he milk mic obiome
a e ela ed o a ia ions in he neona e ecal mic obiome. To his end, he e we analyzed
longi udinal ma e nal milk and o sp ing ecal samples ia me a axonomic sequencing,
om a ew days a e bi h o he ime close weaning.
Nu ien s 2023,15, 4322 3 o 26
2. Ma e ials and Me hods
2.1. Animals and Die s
The Ins i u ional Animal Ca e and Use Commi ee o he Communi y o Mad id ap-
p o ed all me hods o his s udy (PROEX 349/15 and PROEX 215.8/21). The in es iga o s
we e acc edi ed, and he animal acili ies we e app o ed by he Gene al Adminis a ion
o Ag icul u e and Li es ock o he Au onomous Go e nmen o Mad id (Spain). Ten-
week-old Wis a a s, ob ained om Jan ie Labs (F ance), we e housed unde speci ic
pa hogen- ee and s anda d labo a o y condi ions (12:12 h ligh cycle; 21
◦
C) wi h ad
lib access o wa e and a no mal chow die (2.9 kcal/g; 12% a , 60% ca bohyd a es and
28% p o ein; A04, SAFE). A e 10 days o habi ua ion, emales we e housed wi h males
o e nigh , and wo weeks a e ma ing, p egnan a s we e andomly assigned o one o
he wo ea men g oups. The i s g oup was ed ad lib wi h he men ioned s anda d
chow die (con ol (C), n= 6), and he second g oup was 65% ood es ic ed du ing he las
hi d o ges a ion and pos na ally (unde nou ished (U), n= 6), as p e iously desc ibed [
16
].
To educe he e ec o li e size on pos na al g ow h and milk in ake, li e s we e made
uni o m a bi h, o eigh pups pe nu sing dam. Food es ic ion was main ained in he
mo he s du ing lac a ion, and pups we e sac i iced ia decapi a ion a 4, 14 and 18 days o
li e (L4, L14 and L18) o collec he di e en ypes o samples. The weigh gain o pups was
moni o ed h oughou lac a ion and he body and gas oin es inal sys em leng h ( om he
pylo us o he anus) we e measu ed o de e mine he nu i ional es ic ion e ec s on he
o gan sizes. This animal model is designed o moni o lac a ion un il L18, which is 5 days
be o e weaning, o p e en he pups om beginning o inges he mo he ’s chow die by
hemsel es and hus ensu e he e was no mixed die .
2.2. Sample Collec ion
Milk collec ion o i s mic obiological analysis was always conduc ed a he same ime
(9:00 a.m.) and unde s e ile condi ions. Al hough a dams p oduce copious amoun s o
milk ela i e ha p oduced by smalle oden s, he impac o long- e m ood es ic ion,
om mid-ges a ion h ough o lac a ion, signi ican ly limi ed he a ailabili y o milk om
mo he s’ b eas s. P io esea ch on oden s has sugges ed ha he composi ion o s omachal
milk is simila o ha o b eas milk [
28
], ep esen ing e ical ansmission be ween mo he
and child. Thus, a e sac i ice, he pups’ s omachs we e dissec ed, and he con en s we e
kep a 4
◦
C and immedia ely p ocessed. Likewise, ecal colonic con en was collec ed
asep ically om pups in o a s e ile ube, 0.5 mL o TE50 bu e (10 mM T is-HCl and 50 mM
EDTA, pH 8) was added, he mix u e was o exed un il i was homogeneous, and hen i
was ozen a
−
80
◦
C un il DNA ex ac ion and mic obial s udies we e pe o med. Fo gene
exp ession analysis, he dis al colon was opened longi udinally and cleansed wi h saline
solu ion. Fo his ological s udies, he colon was dissec ed and, main aining i s cylind ical
s uc u e and ecal con en , imme sed in Ca noy ixa i e solu ion.
2.3. Analy ical De e mina ions
Be o e sac i ice ia decapi a ion, he neona es we e weighed and hen blood samples
we e collec ed; hei se um was sepa a ed and s o ed ozen a
−
20
◦
C un il analysis. Se um
insulin and glucagon le els we e de e mined wi h a speci ic a insulin and glucagon
adioimmunoassay ki (LINCO Resea ch, Inc., Me ck Millipo e, S . Louis, MI, USA), in
acco dance wi h he manu ac u e ’s p o ocol. A sensi i i y o 0.1 ng/mL and o 20 pg/mL
was achie ed wi h o e nigh equilib ium using 100
µ
L o he se um samples, espec i ely.
The coe icien s o a ia ion wi hin and be ween assays we e 10% o insulin and 4.0 and
7.3% o glucagon, espec i ely. Se um glucose and lipid pa ame e s ( o al choles e ol and
iglyce ides) we e de e mined ia he enzyma ic colo ime ic glucose oxidase/pe oxidase
me hod (Biosys ems, Ba celona, Spain).
Nu ien s 2023,15, 4322 4 o 26
2.4. DNA Ex ac ion
2.4.1. Milk
The samples unde wen cen i uga ion a 4
◦
C o 15 min a a ela i e cen i ugal o ce
o 11,000
×
g. DNA was hen ex ac ed om he esul an pelle s using QIAamp DNA S ool
Mini Ki (Qiagen, Hilden, Ge many), in acco dance wi h he manu ac u e ’s guidelines,
albei wi h p e iously documen ed modi ica ions [
29
]. The ex ac ed DNA was elu ed
in 20
µ
L o nuclease- ee wa e and subsequen ly s o ed a
−
20
◦
C pending addi ional
analyses. The DNA concen a ion was es ima ed u ilizing NanoD op ND-1000 UV-Vis
Spec opho ome e (NanoD op Technologies, Wilming on, DE, USA). The DNA ex ac ion
and pu i ica ion p o ocol delinea ed abo e was also applied o wo nega i e con ol blanks,
which did no con ain any sample ma e ial.
2.4.2. Feces
The ozen ecal samples we e apidly hawed using a d y hea block se a 37
◦
C,
ollowed by o exing o achie e e-homogeniza ion. DNA was ex ac ed u ilizing QI-
Aamp Fas DNA S ool Mini Ki (Qiagen, Ge man own, MD, USA) in conjunc ion wi h
0.1 mm diame e zi conia/silica beads (BioSpec P oduc s, Inc., Ba les ille, OK, USA) and
a Fas P ep FP120A-115 homogenize (Qbiogene, Ca lsbad, CA, USA). Du ing each ound
o DNA ex ac ion, 500
µ
L o TE50 bu e om he same aliquo was used in he sample
and 500
µ
L o nuclease- ee wa e (Ambion, Wal ham, MA, USA) was used o nega i e
con ols. The ex ac ed DNA samples we e elu ed in 20
µ
L o ATE bu e , as p o ided in
he ex ac ion ki , and s o ed a −80 ◦C un il u he analysis.
2.5. DNA Quali y, Quan i ica ion, and Sequencing
DNA quali y and quan i ica ion we e assessed as p e iously desc ibed [
20
]. B ie ly,
he concen a ion o he DNA samples was de e mined using he Quan -iT PicoG een
eagen (The mo Fishe Scien i ic, Inc., Wal ham, MA, USA). Ampli ica ion a ge ed he
V3–V4 egion o he 16S RNA gene. Bo h nega i e and posi i e con ol PCR p oduc s we e
subjec ed o aga ose gel elec opho esis a 80 V o 30 min using 1% aga ose gel and TAE
(T is-Ace a e-EDTA) bu e . The gel was s ained wi h GelRed
™
(10X, Bio ium, F emon , CA,
USA) and isualized using Ul aCam Digi al Imaging Sys em (Bio-Rad, He cules, CA, USA).
Amplicon quali y was assessed wi h a QIAxcel DNA Sc eening ca idge (Qiagen, Hilden,
Ge many) in acco dance wi h he manu ac u e ’s guidelines. High- esolu ion capilla y
elec opho esis on a QIAxcel Ad anced Sys em (Qiagen) was employed o isualiza ion.
Samples demons a ing a peak a he desi ed amplicon size and minimal p ime dime
o ma ion we e deemed o be o su icien quali y.
Subsequen o p ima y PCR ampli ica ion ( he esul ing amplicons being app ox-
ima ely 450 bp in leng h), he indi idual amplicon lib a ies we e cha ac e ized using
Bioanalyze 2100 (Agilen Technologies, Palo Al o, CA, USA). The lib a ies we e hen
pooled in equimola concen a ions, ollowed by pu i ica ion and quan i ica ion. The p e-
cise concen a ion o he pooled sample was con i med ia eal- ime PCR (Kapa Biosys ems,
Wilming on, MA, USA). Finally, he pooled DNA samples unde wen sequencing on an
Illumina MiSeq ins umen , employing 2
×
300 bp pai ed-end ead sequencing a he
Genomics Uni o Pa que Cien í ico de Mad id, Spain.
In acco dance wi h manu ac u e speci ica ions, sequences unde wen demul iplexing
acili a ed by Illumina’s so wa e pla o m ( . 2.6.2.3). Subsequen bioin o ma ic anal-
ysis was conduc ed u ilizing Quan i a i e Insigh s in o Mic obial Ecology 2 (QIIME 2,
e sion 2022.2) in conjunc ion wi h R S a is ical Compu ing En i onmen ( e sion 3.5.1;
URL: h ps://www. -p ojec .o g/ accessed on 13 Janua y 2023). Fo he op imiza ion
o sequence in eg i y, he DADA2 algo i hm was employed unde speci ic pa ame e s:
o wa d eads we e unca ed pos -posi ion 295 while excising he ini ial 15 nucleo ides;
con e sely, e e se eads we e unca ed a posi ion 258 wi h he p elimina y 7 nucleo ides
elimina ed. This p ocedu e was implemen ed o ob ia e posi ions demons a ing a median
nucleo ide quali y sco e in e io o Q20. Taxonomic a ilia ion o indi idual amplicon
Nu ien s 2023,15, 4322 5 o 26
sequence a ian s (ASVs) was asce ained h ough he q2 ea u e classi ie , u ilizing a nai e
Bayes axonomic classi ica ion schema agains he SILVA 138.1 e e ence da abase. Las ly,
po en ial con aminan s we e iden i ied, isualized and pu ged om he da ase ia he
decon am package ( e sion 1.2.1), inco po a ing da a om wo nega i e con ol samples
o igo ous e i ica ion.
2.6. Me a axonomic Analysis o Bac e ial Mic obio a
A ma ix de ailing ASVs speci ic o each espec i e sample was sys ema ically gene -
a ed. The subsequen no maliza ion o bac e ial axa abundances was pe o med u ilizing
he o al sum scaling (TSS) me hod, whe e in each disc e e ASV coun was di ided by
he cumula i e lib a y size, he eby ende ing he ela i e p opo ion o indi idual ASV
coun s pe sample. Fo he examina ion o alpha di e si y, bo h Shannon and Richness
di e si y indices we e employed, acili a ed h ough he egan package wi hin R S a is ical
Compu ing En i onmen (Ve sion 2.5.6).
To p o ide a comp ehensi e assessmen o communi y s uc u e, be a di e si y was
analyzed using bo h B ay–Cu is and bina y Jacca d dissimila i y me ics. These me ics
se e o quan i y he composi ional dissimila i y be ween mic obial communi ies ac oss
samples. All compu a ions and s a is ical manipula ions we e execu ed wi hin he R
amewo k, ensu ing me hodological consis ency and analy ical igo .
2.7. Immuno luo escence S aining
The immuno luo escence s aining o igh junc ion p o ein zonula occludens-1 (ZO-1)
was pe o med on colonic sec ions as p e iously desc ibed [
16
]. B ie ly, a e being depa a -
inized and ehyd a ed, he an igens we e e ie ed wi h sodium ci a e bu e (10 mM
Na
3
C
6
H
5
O
7
and Tween-20 0.05%, pH 6) a 97
◦
C o 30 min. Non-speci ic backg ound
was blocked ia incuba ion wi h 2% BSA, 1% NGS and 0.2% T i on X-100 in PBS o 1 h a
oom empe a u e. Sec ions we e incuba ed o e nigh a 4
◦
C wi h abbi an i-ZO-1 (1:50,
The moFishe Scien i ic, Inc., Wal ham, MA, USA) and hen p obed in he da k wi h a
1:100 dilu ion o Alexa Fluo 488-conjuga ed goa an i- abbi IgG an ibody and a 1:1000
dilu ion o 10 mg/mL o DAPI solu ion (The mo Fishe Scien i ic, Wal ham, MA, USA)
o 1 h a oom empe a u e. Finally, he sec ions we e co e ed wi h P oLong Gold An-
i ade Moun an (In i ogen, The mo Fishe Scien i ic, Inc., Wal ham, MA, USA). Nega i e
con ol slides we e ob ained by incuba ing hem wi hou he p ima y an ibody bu wi h a
seconda y Alexa Fluo an ibody. Fo quan i ica ion, images we e cap u ed using a Leica
SP-2 AOBS con ocal mic oscope a 630
×
magni ica ion. A leas wo non-adjacen sec ions
o colon pe a we e s ained and ou images pe sec ion we e used. Two independen
expe imen s we e conduc ed, wi h 2–3 a s pe g oup in each expe imen . To measu e he
in ensi y o he s ained a ea, Fiji (ImageJ so wa e . 2.14.0) was employed [30].
2.8. Inne Mucus Laye Thickness Analysis
Samples om he dis al colon we e ha es ed and immedia ely p ese ed in Ca noy’s
ixa i e (d y me hanol: chlo o o m: glacial ace ic acid in he a io 60:30:10) as desc ibed
ea lie [
16
]. A e 4 h in Ca noy’s solu ion, he colons we e washed in d y me hanol and
e hanol 100% o 1 h, cleaned wi h xylene and embedded in pa a in wax. Then, he
Alcian blue pH 2.5 (AB) (AB-8GX, PanReac Applichem; Schi ’s eagen , VWR Chemicals)
s aining o 5
µ
m sec ions was pe o med. Only egions in which he mucus laye was
sandwiched be ween he epi helium on one side and luminal con en on he o he we e
used o measu emen s o hickness. Ca e was aken o conside only hose egions ha
ep esen ed egula hickness; 6 o 8 measu emen s we e aken pe image, a e aged o e
he o al usable a ea o he colon. His ological de e mina ions we e pe o med using a
ligh mic oscope (Eclipse 80i, Nikon, Tokyo, Japan) connec ed o a digi al came a (XCD-
U100CR, Sony, Tokyo, Japan). Mo phome ic cha ac e is ics we e analyzed using His olab
so wa e . 7.0 (Mic o ision Ins umen s, EVRY Cedex, F ance. Measu emen s we e always
single-blinded.

Nu ien s 2023,15, 4322 6 o 26
2.9. RNA Ex ac ion and Quan i a i e RT-PCR
To al RNA was ex ac ed om ozen colonic issues using TRIzol Reagen (In i ogen,
The mo Fishe Scien i ic, Inc., Wal ham, MA, USA) and e e se ansc ibed using a high-
capaci y cDNA e e se ansc ip ion ki (Applied Biosys ems, The moFishe Scien i ic,
Inc., Wal ham, MA, USA). Real- ime quan i a i e PCR analyses we e pe o med using
o wa d and e e se p ime s (Table 1) o de e mine he ela i e abundance o Muc2,T 1,
T 3 and Kl 3 genes. The compa a i e h eshold cycle me hod was used o calcula e ela i e
exp ession. The a ge gene alues we e no malized o he exp ession o he endogenous
e e ence (18S) (Table 1).
Table 1. Lis o p ime s (Sigma-Ald ich).
Gene Symbol Sequence (50–30)
MUC2 Muc2 AAGCCAGATCCCGAAACCAT
ATGGCCCCATTCACAACTGCC
TFF1 T 1 CAAGGTGACCTGTGTCCTC
CTTGCTGGTTCTCAATGACC
TFF3 T 3 GACTCCAGCATCCCAAATGT
GCAGATCAGGGGTGAGTGTT
KLF3 Kl 3 TCATGTACACCAGCCACCTG
TAGTCAGTCCTCTGTGGTTC
18S ARN Rps18 GTAACCCGTTGAACCCCATT
CCATCCAATCGGTAGTAGCG
2.10. S a ical and Bioin o ma ic Analyses
The dis ibu ion o he da a was ini ially assessed using he Shapi o–Wilk no mali y
es . Da a con o ming o a no mal dis ibu ion we e exp essed as he mean
±
s anda d
e o o he mean (SEM) o he mean alongside he 95% con idence in e al (95% CI). When
da a we e no no mally dis ibu ed, hey we e p esen ed as he median coupled wi h he
in e qua ile ange (IQR). Fo he compa ison o wo g oups, signi icance was assessed
using a 2- ailed S uden ’s - es o no mally dis ibu ed da a and Wilcoxon ank sum es s
o non-pa ame ic da a, wi h a signi icance le el se a p< 0.05 o all es s. Fo compa isons
in ol ing mo e han wo g oups, analysis o a iance (ANOVA) was used o no mally
dis ibu ed da a, whe eas he K uskal–Wallis es was employed o non-pa ame ic da a.
Pos hoc analyses included pai wise - es s o ANOVA and Wilcoxon ank sum es s wi h
con inui y co ec ion o he K uskal–Wallis es .
Fu he specialized analyses included he e alua ion o median ela i e abundances
o dominan axa using K uskal–Wallis es s o Wilcoxon ank es s, ollowed by app o-
p ia e mul iple compa ison co ec ions such as he Bon e oni me hod. Alpha di e si y
was measu ed using he Shannon di e si y index, which conside s bo h he numbe and
e enness o mic obial species. Be a di e si y was isualized h ough p incipal coo di-
na es analysis (PCoA) based on dis ance ma ices, wi h B ay–Cu is and bina y Jacca d
indices used o quan i a i e and quali a i e analyses, espec i ely. PERMANOVA wi h
999 pe mu a ions was pe o med o e eal s a is ically signi ican di e ences in be a di-
e si y
(p< 0.05).
Pea son ank co ela ion analyses we e conduc ed o e alua e po en ial
co ela ions be ween bac e ial gene a in milk and ecal samples, as well as wi hin ecal
samples alone. All s a is ical and bioin o ma ic analyses we e conduc ed using R so wa e,
combining e sion 3.3.2 and e sion 4.0.3 (R-p ojec , h p://www. -p ojec .o g, accessed
on 13 Janua y 2023), along wi h QIIME pipelines ( . 1.8.0).
3. Resul s
3.1. E ec o Nu i ional Res ic ion on he Biochemical P o ile o O sp ing Ra s du ing Lac a ion
Bo h nu i ional es ic ion and he pa icula me abolic adap a ions ha expe ience
he mo he du ing ges a ion and lac a ion may con ibu e o he ea ly p og amming o
an o sp ing. In his con ex , ma e nal ood es ic ion du ing he las hi d o p egnancy
Nu ien s 2023,15, 4322 7 o 26
esul ed in pups wi h a signi ican lowe body weigh a bi h compa ed o ha o C
newbo ns, bu wi hou s a is ical di e ences in he li e size and only a sligh endency o
inc ease in he male- o- emale a io (p= 0.09) (Table 2). Consis en wi h p e ious da a [
12
],
nu i ional es ic ed lac a ing a s (U) showed a signi ican educ ion in body weigh gain
compa ed o ha o C animals, eaching a di e ence o almos a 50% a he end o he
pe iod (L18) (Table 3). Simila ly, se um glucose, insulin and glucagon le els emained
signi ican ly lowe h oughou lac a ion in U animals. In he case o he se um lipid p o ile,
he e we e no di e ences be ween he wo g oups (C and U) a any age. Howe e , while
choles e ol and iglyce ides le els we e high in bo h C and U pups a he beginning o
lac a ion (L4), hese le els dec eased and became s able wi h inc easing age (Table 3).
Table 2. Cha ac e is ics o he li e s a bi h.
Con ol Unde nou ished
Newbo ns weigh (g) 6.16 ±0.14 5.69 ±0.09 **
Li e size 11.5 ±1.30 9.86 ±0.72
Numbe o male newbo ns 6.25 ±11.11 5.71 ±0.65
Numbe o emale newbo ns 5.25 ±0.63 4.00 ±0.67
Ra io males/ emales 1.23 ±0.24 1.88 ±0.25
Da a a e means
±
SEM (6–8 animals). S uden ’s analysis was used o e alua e di e ences be ween he wo
g oups. ** p< 0.01 compa ed o C g oup.
Table 3. Se um biochemical p o ile o he o sp ing du ing lac a ion.
Con ol Unde nou ished
L4 L14 L18 L4 L14 L18
Body weigh (g) 11.36 ±0.23 27.94 ±0.4 34.65 ±1.02
8.35
±
0.15 *** 16.5
±
0.41 ***
16.62 ±0.36 ***
Glycemia (mg/dL) 119.1 ±1.43 107.8 ±1.03 146.19 ±1.19
85.9
±
4.02 ***
85.3 ±5.29 ** 93.15 ±4.94 ***
Insulinemia (ng/mL) 0.67 ±0.06 0.70 ±0.08 0.78 ±0.17
0.29
±
0.04 ***
0.25 ±0.06 ** 0.36 ±0.09 *
Glucagonemia (pg/mL) 252.3 ±10.6 298 ±11.2 129.1 ±6.9
103.9
±
4.4 ***
97 ±1.3 *** 83.2 ±4.3 ***
Choles e ol (mg/dL) 154.66 ±4.11 127.48 ±5.81 119.95 ±4.5 144.38 ±3.28 119.62 ±4.51 116.86 ±5.2
T iglyce ides (mg/dL) 157.08 ±5.26 79.94 ±4.75 63.41 ±5.42 160.17 ±8.57 74.02 ±3.07 68.42 ±3.51
Da a a e mean
±
SEM (n= 6–8 animals). Biochemical and ho monal pa ame e s o con ol (C) and unde nou ished
(U) a s a 4, 14 and 18 days o lac a ion (L). S uden ’s analysis was used o e alua e di e ences be ween g oups
in e ms o nu i ional ype. * p< 0.05; ** p< 0.01; *** p< 0.001 compa ed o C g oup a he same age.
3.2. E ec o Ma e nal Die on he Milk and Gu Mic obiome o O sp ing h oughou Lac a ion
3.2.1. Me a axonomic Analysis o he Milk Samples
The compa a i e me a axonomic analysis o mic obial p o iles in milk samples, s a i-
ied acco ding o nu i ional s a us (C s. U) and days o lac a ion (L4, L14 and L18), was
conduc ed u ilizing 35 o he samples as delinea ed in Sec ion 2.5. F om hese 35 milk
samples, a cumula i e o al o 811,904 high-quali y il e ed sequences was ob ained. The
sequence coun pe sample oscilla ed be ween 12,569 and 33,787 (median [IQR]: 22,540
[18,872.5–28,013]), which could be clus e ed in o 2586 dis inc ASVs. The alpha di e si y
wi hin hese milk samples, i espec i e o whe he hey we e om C o U g oups, exhibi ed
compa able Richness and Shannon di e si y indices ac oss all ime poin s o lac a ion (L4,
L14 and L18), as depic ed in Figu e 1a,b.
Nu ien s 2023,15, 4322 8 o 26
Nu ien s 2023, 15, x FOR PEER REVIEW 8 o 26
wi hin hese milk samples, i espec i e o whe he hey we e om C o U g oups, exhib-
i ed compa able Richness and Shannon di e si y indices ac oss all ime poin s o lac a ion
(L4, L14 and L18), as depic ed in Figu e 1a,b.
Figu e 1. Mic obial alpha di e si y in milk samples exp essed by (a) he numbe o obse ed gene a
(gene a ichness) and (b) he Shannon index. Box plo s ep esen median and in e qua ile anges
oge he wi h maximum and minimum alues. K uskal–Wallis analysis was used o e alua e diffe -
ences be ween g oups (in e ms o lac a ional age and ype o die ). The Be a di e si y analysis o
milk samples was measu ed as (c) he p esence/absence (Binna y Jacca d me hod) o (d) he ela i e
abundance (B ay–Cu is simila i y analysis) o he diffe en species quan i ied in con ol g oups
(yellow: C4; o ange: C14; ed: C18) and unde nou ished g oups (ligh blue: U4; cyan blue: U14; da k
blue: U18). The alue gi en on each axis label ep esen s he pe cen age o he o al a iance ex-
plained by ha axis. Pe mano a analysis was used o e alua e diffe ences be ween g oups (in e ms
o lac a ional age and ype o die ). N = 5–6 pe condi ion. C: con ol; U: unde nou ished. L: lac a ion.
An analysis o be a di e si y was conduc ed o compa e he C and U g oups a each
designa ed lac a ional ime poin . Two-dimensional p incipal coo dina es analysis (2D-
PCoA) u ilizing Jacca d dis ance me ics p o ided a isual pla o m o assessing he ex-
en o sample clus e ing based on bo h nu i ional s a us and lac a ional s age. No ably,
dis inc clus e ing pa e ns eme ged a day 4 and day 18 (Figu e 1c), sugges ing a signi i-
can di e gence in mic obial p o iles be ween C and U coho s a hese sampling poin s.
Figu e 1.
Mic obial alpha di e si y in milk samples exp essed by (
a
) he numbe o obse ed
gene a (gene a ichness) and (
b
) he Shannon index. Box plo s ep esen median and in e qua ile
anges oge he wi h maximum and minimum alues. K uskal–Wallis analysis was used o e alua e
di e ences be ween g oups (in e ms o lac a ional age and ype o die ). The Be a di e si y analysis o
milk samples was measu ed as (
c
) he p esence/absence (Binna y Jacca d me hod) o (
d
) he ela i e
abundance (B ay–Cu is simila i y analysis) o he di e en species quan i ied in con ol g oups
(yellow: C4; o ange: C14; ed: C18) and unde nou ished g oups (ligh blue: U4; cyan blue: U14;
da k blue: U18). The alue gi en on each axis label ep esen s he pe cen age o he o al a iance
explained by ha axis. Pe mano a analysis was used o e alua e di e ences be ween g oups (in
e ms o lac a ional age and ype o die ). N = 5–6 pe condi ion. C: con ol; U: unde nou ished.
L: lac a ion.
An analysis o be a di e si y was conduc ed o compa e he C and U g oups a each
designa ed lac a ional ime poin . Two-dimensional p incipal coo dina es analysis (2D-
PCoA) u ilizing Jacca d dis ance me ics p o ided a isual pla o m o assessing he
ex en o sample clus e ing based on bo h nu i ional s a us and lac a ional s age. No ably,
dis inc clus e ing pa e ns eme ged a day 4 and day 18 (Figu e 1c), sugges ing a signi ican
di e gence in mic obial p o iles be ween C and U coho s a hese sampling poin s. This
obse a ion was subs an ia ed s a is ically ia a subsequen PERMANOVA analysis based
on Jacca d simila i y me ics, which e ealed signi ican di e ences in bac e ial composi ion
be ween he wo nu i ional g oups (p= 0.009 and p= 0.014). Addi ionally, a sepa a e PCoA
plo gene a ed using B ay–Cu is simila i y indices, which we e no malized ela i e o he
Nu ien s 2023,15, 4322 9 o 26
abundance o dis inc ASVs, demons a ed signi ican clus e ing p edica ed on nu i ional
s a us a L4 (p= 0.029), bu no a L14 o L18 (p> 0.05) (Figu e 1d).
A he axonomic le el, disce nible di e ences in bac e ial ela i e abundances we e
obse ed ela ed o die ype a speci ic ime poin s. Taxa belonging o he Fi micu es
and P o eobac e ia phyla domina ed in milk samples om bo h C and U animals. O he
phyla such as Bac e oido a and Ac inobac e oido a we e also p esen bu a a lowe ela-
i e abundance. Al hough Fi micu es showed a endency o dec ease and P o eobac e ia
showed a endency o inc ease hei ela i e abundance in he U g oup a L18, no s a is ical
signi icance was de ec ed when compa ed o ha o hei C coun e pa s (Figu e 2a–d). On
he o he hand, he ela i e abundance o sequences belonging o he amily Pas eu ellaceae
was signi ican ly highe in he samples om he U g oup (median [IQR] = 5.57 [3.33–8.2])
han in hose om C animals (median [IQR] = < 0.01 [<0.01–<0.01]) a L4 (p= 0.0055).
Simila ly, he gene a Gemella and En e ococcus mani es ed ele a ed ela i e abundances
in he U samples a L18, wi h median [IQR] alues o 0.94 [0.52–2.19] s. 0.64
[0.41–0.85]
(p= 0.007)
and 0.08 [<0.01–2.61] s. < 0.01 [<0.01–0.03] (p= 0.030), espec i ely. In con as ,
he genus Rombou sia was mo e abundan in he C g oup a L18 (p= 0.015). Addi ion-
ally, Po phy omonas was mo e p e alen in U samples a L4, wi h a median [IQR] o
0.95
[0.67–1.66]
s. 0.1 [0.01–0.25] (p= 0.024). No signi ican di e ences in he ela i e
abundances o se e al o he axa, such as Lac obacillus,Roden ibac e , Unclassi ied_gene a,
S ep ococcus,Esche ichia-Shigella,Tu icibac e ,Ro hia and Veillonella, we e de ec ed be ween
C and U a any o he ages conside ed (Figu e 2e and Table S1).
Nu ien s 2023, 15, x FOR PEER REVIEW 9 o 26
This obse a ion was subs an ia ed s a is ically ia a subsequen PERMANOVA analysis
based on Jacca d simila i y me ics, which e ealed signi ican diffe ences in bac e ial
composi ion be ween he wo nu i ional g oups (p = 0.009 and p = 0.014). Addi ionally, a
sepa a e PCoA plo gene a ed using B ay–Cu is simila i y indices, which we e no mal-
ized ela i e o he abundance o dis inc ASVs, demons a ed signi ican clus e ing p ed-
ica ed on nu i ional s a us a L4 (p = 0.029), bu no a L14 o L18 (p > 0.05) (Figu e 1d).
A he axonomic le el, disce nible diffe ences in bac e ial ela i e abundances we e
obse ed ela ed o die ype a speci ic ime poin s. Taxa belonging o he Fi micu es and
P o eobac e ia phyla domina ed in milk samples om bo h C and U animals. O he phyla
such as Bac e oido a and Ac inobac e oido a we e also p esen bu a a lowe ela i e
abundance. Al hough Fi micu es showed a endency o dec ease and P o eobac e ia
showed a endency o inc ease hei ela i e abundance in he U g oup a L18, no s a is ical
signi icance was de ec ed when compa ed o ha o hei C coun e pa s (Figu e 2a–d).
On he o he hand, he ela i e abundance o sequences belonging o he amily Pas eu el-
laceae was signi ican ly highe in he samples om he U g oup (median [IQR] = 5.57 [3.33–
8.2]) han in hose om C animals (median [IQR] = < 0.01 [<0.01–<0.01]) a L4 (p = 0.0055).
Simila ly, he gene a Gemella and En e ococcus mani es ed ele a ed ela i e abundances in
he U samples a L18, wi h median [IQR] alues o 0.94 [0.52–2.19] s. 0.64 [0.41–0.85] (p =
0.007) and 0.08 [<0.01–2.61] s. < 0.01 [<0.01–0.03] (p = 0.030), espec i ely. In con as , he
genus Rombou sia was mo e abundan in he C g oup a L18 (p = 0.015). Addi ionally,
Po phy omonas was mo e p e alen in U samples a L4, wi h a median [IQR] o 0.95 [0.67–
1.66] s. 0.1 [0.01–0.25] (p = 0.024). No signi ican diffe ences in he ela i e abundances o
se e al o he axa, such as Lac obacillus, Roden ibac e , Unclassi ied_gene a, S ep ococcus,
Esche ichia-Shigella, Tu icibac e , Ro hia and Veillonella, we e de ec ed be ween C and U a
any o he ages conside ed (Figu e 2e and Table S1).
Figu e 2. Compa ison o he ela i e abundance o sequences belonging o main bac e ial phyla (a)
Fi micu es, (b) P o eobac e ia, (c) Bac e oido a and (d) Ac inobac e io a, and (e) he mos abundan
gene a ob ained ia me a axonomic analysis in milk samples a lac a ing days L4, L14 and L18 om
Figu e 2.
Compa ison o he ela i e abundance o sequences belonging o main bac e ial phyla
(
a
) Fi micu es, (
b
) P o eobac e ia, (
c
) Bac e oido a and (
d
) Ac inobac e io a, and (
e
) he mos abundan
gene a ob ained ia me a axonomic analysis in milk samples a lac a ing days L4, L14 and L18 om
con ol (C) and unde nou ished (U) animals. Box plo s ep esen median and in e qua ile anges
oge he wi h maximum and minimum alues. Wilcoxon analysis was used o e alua e di e ences
be ween g oups in e ms o ype o die . N = 5–6. The F p eceding Pas eu elleceae in milk samples
e e s o (e) amily axon.
Nu ien s 2023,15, 4322 16 o 26
animals; (iii) ha he co ela ions we e pa icula ly nume ous a he end o lac a ion in
bo h g oups o animals al hough in he C g oup associa ions we e mo e equen among
bac e ia exclusi ely om eces, while die a y es ic ion led o a g ea e numbe o as-
socia ions among milk bac e ia. Despi e his dynamism, a ecu ing end eme ged: he
p esence o Esche ichia-Shigella in milk samples o en mi o ed i s p esence in ecal samples.
Fu he mo e, he analysis b ough o ligh a gene al end whe e Esche ichia-Shigella and
Lac obacillus exhibi ed a nega i e co ela ion ac oss a ious ime poin s, a L4 o C samples
( =
−
0.91) and a L14 and L18 o U samples ( =
−
0.98 a bo h ages). This sugges s
a pa e n whe e a high p e alence o one genus migh be associa ed wi h a dec eased
p e alence o he o he . While his ecu ing end was obse ed, i wa an s u he
in es iga ion o explo e he po en ial implica ions and unde lying mechanisms d i ing
hese obse a ions. Rega ding he posi i e associa ions be ween ecal anae obic bac e ia,
an indica o o in es inal ma u i y, hese we e mo e equen in C animals a he di e en
imes s udied han hey we e in U pups (Pa abac e oides,Bac e oides,Tu icibac e ,Gemella,
Veillonella,Esche ichia-Shigella,Fusobac e ium,Lac obacillus,Rombus ia and Roden ibac e ),
which again e idenced he in luence o die in gu coloniza ion.
3.4. Nu i ional Res ic ion du ing Lac a ion Dis up s he Colonic Ba ie In eg i y o
he O sp ing
Gi en he shi in he bac e ial p o ile o malnou ished pups, hei in es ine s uc u al
and mo phome ic cha ac e is ics we e analyzed. As shown in Table 4, he body ( om nose
o annus) and o al in es inal leng h ( om pylo us o cecum) inc eased p og essi ely om
4 o 18 days o lac a ion in bo h expe imen al g oups C and U; howe e , he g ow h expe i-
enced by U o sp ing a s was less p onounced and he measu emen s we e signi ican ly
lowe han hose in C animals. The leng h o he small in es ine in pups om es ic ed
mo he s was always lowe han he C alues bu i only had s a is ical signi icance a L4
and L18. Rega ding he leng hs o he la ge in es ine, including colon and cecum, he
highes di e ences wi h C alues we e obse ed a L4 whe eas no a ia ions we e de ec ed
a L14 and L18 o he colon. Su p isingly, he U cecum was ound o be longe han he
cecum o C a s a L14; howe e , i s leng h dec eased again owa ds he end o lac a ion
(L18), emo ing he s a is ical signi icance.
Table 4. In es inal mo phome ic cha ac e is ics o he o sp ing du ing lac a ion.
Con ol Unde nou ished
L4 L14 L18 L4 L14 L18
Body leng h (cm) 6.23 ±0.07 8.89 ±0.09 9.36 ±0.114 6.28 ±0.17 7.4 ±0.09 *** 8.01 ±0.13 ***
To al in es ine leng h (cm) 33.47 ±0.37 48.0 ±0.90 48.43 ±1.53 29.54 ±0.67 41.0 ±2.30 39.41 ±0.72 ***
Small in es ine leng h (cm)
Colon leng h (cm)
Cecum leng h (cm)
29.15 ±0.38 40.6 ±0.81 41.47 ±1.34 25.27 ±0.64 ** 35.0 ±2.20 33.14 ±0.70 ***
3.64 ±0.13 5.83 ±0.14 5.90 ±0.24 3.16 ±0.12 * 5.17 ±0.19 5.52 ±0.14
0.68 ±0.04 1.35 ±0.06 1.38 ±0.05 0.65 ±0.03 ** 1.43 ±0.08 1.26 ±0.05
Small In es. Leng h/Body Leng h 4.68 ±0.14 4.57 ±0.12 0.48 ±0.19 4.64 ±0.10 5.23 ±0.32 4.49 ±0.20
Colon Leng h/Body Leng h 0.56 ±0.03 0.67 ±0.01 0.63 ±0.03 0.57 ±0.02 0.76 ±0.03 * 0.75 ±0.03 **
Quan i ica ion o in es inal pa ame e s o he o sp ing a 4, 14 and 18 days o lac a ion (L4, L14 and L18). S uden ’s
-analysis was used o e alua e di e ences be ween g oups in e ms o nu i ion ype. Da a ep esen
mean ±SEM
(n= 6–8). * p< 0.05; ** p< 0.01; *** p< 0.001 compa ed o C g oup.
Mo eo e , in o de o e alua e i body p opo ions we e main ained despi e nu i ional
es ic ion, we adjus ed he leng h o he small in es ine and colon based on he o al body
leng h. The measu emen s o he small in es ine in he U g oup did no di e om hose o
he C a s. Howe e , nu i ional es ic ion esul ed in signi ican changes in he ac ional
leng h o he colon, which was highe a L14 and L18 compa ed o ha in he age-ma ched
C g oup. This sugges s ha he e is some p ese a ion o colon g ow h du ing his s age o
de elopmen (Table 4).
As he in es inal ba ie is imma u e a bi h and unde goes impo an s uc u al and
unc ional changes induced by he ab up ansi ion in nu ien supply om ma e nal um-

Nu ien s 2023,15, 4322 17 o 26
bilical co d blood o en e al milk in ake, in es inal pe meabili y and mucus laye hickness
we e analyzed. These s udies ocused on he colonic issue because his is he main mic obi-
ological ese oi o he o ganism. To assess he i s pa ame e , we measu ed ZO-1 le els,
which is a igh junc ion p o ein loca ed in he apical zone o colonic epi helial cells ha
egula es pa acellula pe meabili y and con ibu es o he p ese a ion o in es inal ba ie
in eg i y [
31
]. Immuno luo escence analysis pe o med a ea ly (L4) and la e lac a ion
(L18) showed an inc ease in signal in ensi y o ZO-1 in C animals, o ming a ne wo k o
inc easingly consolida ed in eg i y in epi helial cells (Figu e 8a). Howe e , ZO-1 le els
we e signi ican ly educed in U a s a L18 compa ed o hose in he C g oup (Figu e 8b),
sugges ing a loss o in es inal ba ie in eg i y a his age.
Nu ien s 2023, 15, x FOR PEER REVIEW 17 o 26
ac ional leng h o he colon, which was highe a L14 and L18 compa ed o ha in he
age-ma ched C g oup. This sugges s ha he e is some p ese a ion o colon g ow h du -
ing his s age o de elopmen (Table 4).
As he in es inal ba ie is imma u e a bi h and unde goes impo an s uc u al and
unc ional changes induced by he ab up ansi ion in nu ien supply om ma e nal um-
bilical co d blood o en e al milk in ake, in es inal pe meabili y and mucus laye hickness
we e analyzed. These s udies ocused on he colonic issue because his is he main mic o-
biological ese oi o he o ganism. To assess he i s pa ame e , we measu ed ZO-1 le -
els, which is a igh junc ion p o ein loca ed in he apical zone o colonic epi helial cells
ha egula es pa acellula pe meabili y and con ibu es o he p ese a ion o in es inal
ba ie in eg i y [31]. Immuno luo escence analysis pe o med a ea ly (L4) and la e lac-
a ion (L18) showed an inc ease in signal in ensi y o ZO-1 in C animals, o ming a ne -
wo k o inc easingly consolida ed in eg i y in epi helial cells (Figu e 8a). Howe e , ZO-1
le els we e signi ican ly educed in U a s a L18 compa ed o hose in he C g oup (Figu e
8b), sugges ing a loss o in es inal ba ie in eg i y a his age.
Figu e 8. Cha ac e is ics o he colonic ba ie in eg i y and i m mucus laye in he offsp ing a s a
4 and 18 days o lac a ion. (a) Immuno luo escence o ZO-1 (g een) in colon sec ions. Nucleic acids
we e s ained wi h DAPI (blue) and whi e a ows indica e a eas whe e he ZO-1 s ain was dis up ed
a he epi helial cell memb ane (magni ica ion: 63×). (b) Quan i ica ion o he ZO-1 luo escence in-
ensi y exp essed in a bi a y uni s. (c) Alcian Blue (AB)-s ained colonic sec ions. The i m mucus
laye was ma ked wi h whi e b acke s (magni ica ion: 20×). (d) Quan i ica ion o he i m mucus
hickness. Da a ep esen mean ± SEM (n = 3–4; 4 sec ions pe animal). S uden ’s analysis was used
o e alua e diffe ences be ween g oups in e ms o he ype o die . * p < 0.05 compa ed o C g oup
wi hin each age. C: con ol; U: unde nou ished; L: lac a ion.
Figu e 8.
Cha ac e is ics o he colonic ba ie in eg i y and i m mucus laye in he o sp ing a s a
4 and 18 days o lac a ion. (
a
) Immuno luo escence o ZO-1 (g een) in colon sec ions. Nucleic acids
we e s ained wi h DAPI (blue) and whi e a ows indica e a eas whe e he ZO-1 s ain was dis up ed
a he epi helial cell memb ane (magni ica ion: 63
×
). (
b
) Quan i ica ion o he ZO-1 luo escence
in ensi y exp essed in a bi a y uni s. (
c
) Alcian Blue (AB)-s ained colonic sec ions. The i m mucus
laye was ma ked wi h whi e b acke s (magni ica ion: 20
×
). (
d
) Quan i ica ion o he i m mucus
hickness. Da a ep esen mean
±
SEM (n= 3–4; 4 sec ions pe animal). S uden ’s analysis was used
o e alua e di e ences be ween g oups in e ms o he ype o die . * p< 0.05 compa ed o C g oup
wi hin each age. C: con ol; U: unde nou ished; L: lac a ion.
The colonic lumen con ains a gel-like s uc u e called mucus ha ac s as a i s line o
de ense agains mic oo ganisms in ading he lamina p op ia. I is p oduced by specialized
sec e ing cells called goble cells, which o m pa o he in es inal epi helium [
32
]. Because
mic obial changes also play an impo an ole in mucus p oduc ion, we hen quan i ied he
inne mucus hickness wi h AB s aining (Figu e 8c). Mo phome ic measu emen s o he
mucus laye showed a end o enhanced hickness unde ood- es ic ed condi ions a bo h
L4 (1.9- old inc ease s. C) and L18 (1.6- old inc ease s. C); howe e , his did no each
s a is ical signi icance (p= 0.068, o bo h ages) (Figu e 8d). To u he cha ac e ize he e ec
Nu ien s 2023,15, 4322 18 o 26
o ma e nal nu i ion on gu ba ie p ope ies, we nex analyzed he gene exp ession o
key ma ke s o specialized mucus-sec e ing goble cells: Muc2,T 3,T 1 and Kl 3 (Figu e 9).
Nu i ional es ic ion did no induce any signi ican change in he exp ession o Muc2, he
main goble cell ma ke , ela i e o C g oup le els a any age conside ed (Figu e 9a). On
he con a y, he exp ession o T 3, a ac o co-sec e ed wi h MUC2 and in ol ed in cell
mig a ion, p oli e a ion and he epai o he mucosal epi helium, was signi ican ly highe
a 4 (1.56- old inc ease) and 18 days o li e (1.48- old inc ease) compa ed o he C alues
(Figu e 9b). Al hough he mucosal p o ec i e unc ion o TFF1 is simila o ha o TFF3, i s
exp ession was no al e ed in U o sp ing a s ela i e o ha o C animals du ing lac a ion
(Figu e 9c). Finally, Kl 3 exp ession, ano he ac o in ol ed in he egene a ion o epi helial
cells, was signi ican ly down egula ed a la e lac a ion (L18) unde nu ien - es ic ed
condi ions (Figu e 9d).
Nu ien s 2023, 15, x FOR PEER REVIEW 18 o 26
The colonic lumen con ains a gel-like s uc u e called mucus ha ac s as a i s line
o de ense agains mic oo ganisms in ading he lamina p op ia. I is p oduced by special-
ized sec e ing cells called goble cells, which o m pa o he in es inal epi helium [32].
Because mic obial changes also play an impo an ole in mucus p oduc ion, we hen
quan i ied he inne mucus hickness wi h AB s aining (Figu e 8c). Mo phome ic meas-
u emen s o he mucus laye showed a end o enhanced hickness unde ood- es ic ed
condi ions a bo h L4 (1.9- old inc ease s. C) and L18 (1.6- old inc ease s. C); howe e ,
his did no each s a is ical signi icance (p = 0.068, o bo h ages) (Figu e 8d). To u he
cha ac e ize he effec o ma e nal nu i ion on gu ba ie p ope ies, we nex analyzed
he gene exp ession o key ma ke s o specialized mucus-sec e ing goble cells: Muc2, Tff3,
Tff1 and Kl 3 (Figu e 9). Nu i ional es ic ion did no induce any signi ican change in
he exp ession o Muc2, he main goble cell ma ke , ela i e o C g oup le els a any age
conside ed (Figu e 9a). On he con a y, he exp ession o Tff3, a ac o co-sec e ed wi h
MUC2 and in ol ed in cell mig a ion, p oli e a ion and he epai o he mucosal epi he-
lium, was signi ican ly highe a 4 (1.56- old inc ease) and 18 days o li e (1.48- old in-
c ease) compa ed o he C alues (Figu e 9b). Al hough he mucosal p o ec i e unc ion
o TFF1 is simila o ha o TFF3, i s exp ession was no al e ed in U offsp ing a s ela i e
o ha o C animals du ing lac a ion (Figu e 9c). Finally, Kl 3 exp ession, ano he ac o
in ol ed in he egene a ion o epi helial cells, was signi ican ly down egula ed a la e
lac a ion (L18) unde nu ien - es ic ed condi ions (Figu e 9d).
Figu e 9. Changes induced by ma e nal nu i ion in he exp ession p o ile o goble cell ma ke s
om he offsp ing colon a 4 and 18 days o lac a ion. Quan i a i e RT-qPCR analysis o Muc2 (a),
Tff3 (b), Tff1 (c) and Kl 3 (d) no malized wi h he 18S ibosomal gene. Da a ep esen mean ± SEM
(n = 5–6). S uden ’s -analysis was used o e alua e diffe ences be ween he wo g oups in e m so
he ype o die . * p < 0.05; ** p < 0.001 compa ed o g oup C wi hin each age. C: con ol; U; Unde -
nou ished; L: lac a ion.
Figu e 9.
Changes induced by ma e nal nu i ion in he exp ession p o ile o goble cell ma ke s om
he o sp ing colon a 4 and 18 days o lac a ion. Quan i a i e RT-qPCR analysis o Muc2 (
a
), T 3 (
b
),
T 1 (
c
) and Kl 3 (
d
) no malized wi h he 18S ibosomal gene. Da a ep esen mean
±
SEM (n= 5–6).
S uden ’s -analysis was used o e alua e di e ences be ween he wo g oups in e m so he ype o
die . * p< 0.05; ** p< 0.001 compa ed o g oup C wi hin each age. C: con ol; U; Unde nou ished;
L: lac a ion.
4. Discussion
Lac a ion is conside ed a pe iod o majo ele ance in me abolic p og amming because
milk bac e ia a e among he i s mic obes o en e he neona al gas oin es inal ac
and, consequen ly, hey ac as d i e s in he acquisi ion and de elopmen o a heal hy
mic obio a [
18
,
33
]. Mo he - o-in an bac e ial ans e h ough ma e nal milk has been
epea edly desc ibed a he species and/o he s ain le el, ia bo h cul u e-dependen
and cul u e-independen echniques [
18
,
34
]. Wo h no ing is ha app oxima ely a qua e
o he bac e ia de ec ed in in an eces du ing ea ly li e seems o de i e om milk [
35
]
and he bac e ial gene a accoun ing o mos o he abundance (>70%) in in an eces a e
sha ed wi h human milk [
36
]. In he same di ec ion, i has been ecen ly desc ibed ha
Nu ien s 2023,15, 4322 19 o 26
ma e nal milk is closely associa ed wi h o sp ing mic obiome di e si y [
37
]. The e o e, as
die has been shown o be a majo de e minan o he ype and abundance o mic obio a
in he gas oin es inal ac , in he p esen s udy we ha e in es iga ed how ma e nal die
du ing p egnancy and lac a ion a ec his mic obial communica ion be ween mo he and
o sp ing. Ou da a show ha he diso de o milk mic obio a induced ia ma e nal ood
es ic ion seems o change he p o ile o o sp ing in es inal mic obiome and hen p omo e
an imma u e in es inal mic obio a and gu ba ie unc ion.
E en hough no die a y e ec was obse ed o alpha di e si y, nei he in milk no in
ecal samples, be a di e si y was signi ican o age and die , in bo h ypes o samples, wi h
he bac e ia ound in U samples a L4 displaying he highes dis ance o all o he samples.
I is wo h no ing ha bac e ia iden i ied in ecal samples om UL14 we e mo e simila o
CL4 han o hose collec ed om animals o he same age bu consuming a di e en die .
These esul s ein o ce he idea ha ma e nal die in luence milk mic obial composi ion
and his e ec is mi o ed in o sp ing eces, p omo ing an imma u e gu mic obiome.
Likewise, se e ely unde nou ished child en om Bangladesh [
38
] showed ma ked gu
mic obio a imma u i y ha could no be e e sed wi h die a y in e en ions, which is in
ag eemen wi h ou p e ious s udies pe o med wi h a ca ch-up g ow h a model [
16
] o
in humanized mouse models o malnu i ion [39].
The bac e ia ound in milk and o sp ing eces du ing lac a ion we e mainly ep e-
sen ed by he phyla Fi micu es, P o eobac e ia, Bac e oido a and Ac inobac e ia, he la e
axa being less abundan han he o me wo. The mos abundan ASVs ound in he milk
we e iden i ied as Lac obacillus, which accoun ed o mos o he eads wi hin he phylum
Fi micu es. The con ibu ion o Lac obacillus spp. o milk is highly conse ed ac oss species
and known o p oduce bac e iocins, which a e able o inhibi he g ow h o pa hogens [
40
].
Mo eo e , as a acul a i e anae obe, Lac obacillus is conside ed a pionee bac e ial specie
ha du ing he i s days o lac a ion deple es oxygen om gu and he eby acili a es
he subsequen coloniza ion o he gu en i onmen ia obliga e anae obes [
41
]. Wa en
e al. [
27
] epo ed ha a ia ions in he p o ein con en o ma e nal die in luenced he
ela i e abundance o he genus Lac obacillus no only om ma e nal milk bu also om
o sp ing eces. In ag eemen , we obse ed Lac obacillus spp. o show g ea e ela i e
abundance a he beginning o lac a ion in he eces om pups o mo he s subjec ed o
ood es ic ion, despi e no pa allel e ec o die being obse ed in milk. In e es ingly, i
has been sugges ed ha highe coloniza ion o he gu wi h Lac obacillus spp. in ea ly li e
p edic s an inc eased isk o being o e weigh and me abolic al e a ions in he u u e [
42
].
Gi en ha Lac obacillus spp. a e no mally ound in he aginal niche, i is possible
ha he high le els o Lac obacillus axa in he o sp ing ecal samples om U mo he s
o igina ed in pa , du ing deli e y, om changes in he aginal mic obio a composi ion
o mo he s. The composi ion o he aginal mic obio a is unde he con ol o ho monal
pa e ns [
43
] wi h highe abundance in Lac obacillus species wi h inc easing ges a ional
age. This e en seems o be pa o a s a egy o ensu e lac ic acid p oduc ion, educe
pH in he aginal ca i y and p o ec he e us om in ec ions. Howe e , he in luence
o en i onmen al ac o s, such as s ess o die , on aginal communi y s abili y is poo ly
known. Al hough ch onic s ess induced by se e e ood es ic ion, like in pa ien s wi h
ano exia ne osa, has been associa ed wi h bac e ial aginosis, mens ual cycle i egula i y
and ameno hea [
44
], he in e ac ion be ween die , mens ual dys unc ion and aginal
communi y s abili y emain unexplo ed. Thus, i is possible ha ma e nal die du ing
ges a ion may al e he aginal mic obio a ansmi ed o o sp ing and subsequen ly
in luence hei gu coloniza ion and ma u a ion.
In addi ion o Lac obacillus,Esche ichia-Shigella, included in he phylum P o eobac e ia,
is also conside ed a pionee bac e ium wi h high abundance h oughou lac a ion in he
eces o well-nou ished pups. Howe e , i s p oli e a ion appea s o be condi ioned by
nu i ional s a us gi en i s almos absolu e absence a he beginning o lac a ion in he
milk o U mo he s as well as in hei o sp ing eces, bu he subsequen sha p inc ease in
eces. This e en migh a ec he es ablishmen o a sui able in es inal mic oen i onmen
Nu ien s 2023,15, 4322 20 o 26
o ensu e he coloniza ion o s ic anae obic bac e ia and consequen ly, delay gu mic o-
bio a ma u a ion. Al hough Esche ichia-Shigella is a non-pa hogenic genus, unde speci ic
ci cums ances, ce ain se o ypes can igge symp oms such as dia hea, wi h inc eased
in es inal pe meabili y and dis up ed epi helial ba ie o e en ex a-in es inal in lamma-
o y p ocesses [
45
–
48
]. The low numbe o samples analyzed in his s udy implies ha he
mic obial shi s de ec ed o his genus did no each a s a is ically signi ican h eshold bu
migh , in ac , be ele an o homeos asis and heal h, and should be ca e ully e alua ed in
u u e s udies in ol ing a la ge numbe o animals.
Wi hin he phylum P o eobac e ia, ou me a axonomic analysis also success ully
de ec ed sequences belonging o he amily Pas eu ellaceae. Mos o hem we e assigned
o he genus Roden ibac e , while a mino ac ion was assigned o o he gene a, such as
Haemophilus and Mu ibac e . Howe e , i is impo an o no e ha ou sequencing app oach
aced some limi a ions in dis inguishing be ween sequences belonging o di e en gene a
wi hin his amily. Consequen ly, al hough he ele a ed abundance o Pas eu ellaceae in milk
samples om U animals a L4 migh p ima ily be a ibu able o Roden ibac e , he po en ial
con ibu ion o o he gene a wi hin his amily should no be disca ded.
I is no ewo hy ha in he p esen s udy, mo he s’ milk was no collec ed om he
mamma y gland as is ca ied ou in o he simila app oaches [
27
], bu om he pup’s
s omach, which is indeed he same ou e as ha o suckling o sp ing. Undoub edly,
he o sp ing mic obio a, pa icula ly ha om he o al ca i y, will modi y he bac e ia
exp essed in milk [
19
,
49
], bu will also con ibu e o he es ablishmen o he i s gu
colonize s. In line wi h his concep , he p esence o he genus Po phy omonas in he milk
o nu i ionally es ic ed mo he s d ew a en ion in ou s udies. Po phy omonas is an
anae obic bac e ium ound in he o al ca i y and is associa ed wi h he de elopmen o
pe iodon al disease. I s p esence in he o al ca i y and consequen ly, i s inges ion du -
ing ood in ake causes in es inal dysbiosis by c ea ing an en i onmen a o able o he
coloniza ion o p o-in lamma o y mic oo ganisms [
50
] and e en ually leading o ulce -
a i e coli is [
51
] o colo ec al cance [
52
]. Likewise, me abolic s udies pe o med wi h
s ep ozo ocin- ea ed mice ( o gene a e a diabe ic si ua ion) and subsequen Po phy omonas
adminis a ion showed a wo sening o he glycemic con ol oge he wi h local and sys-
emic in lamma o y e en s [
53
]. Thus, he p esence o Po phy omonas in milk migh be
conside ed a bioma ke o u u e gu dysbiosis, in lamma o y p ocesses and long- e m
me abolic al e a ions. Acco dingly, we ha e p e iously desc ibed he a o emen ioned
e iopa hological iangle in he same animal model o ood es ic ion used he ein [
16
].
Howe e , he e y ea ly igge ing e en s o his pheno ype and i s ela ionship wi h
b eas eeding and ma e nal die needed u he in es iga ions.
On he o he hand, i is known ha in es inal pe meabili y a bi h is high in newbo ns
and hen g adually dec eases o ensu e ull unc ionali y and p o ec ion om pa hogens [
54
].
Mo eo e , e idence sugges ha ce ain bac e ia and bioac i e compounds in b eas milk
play a key ole in egula ing mucosal in eg i y and in es inal epi helial pe meabili y. Hu-
man s udies ha e shown ha ull- e m b eas ed in an s ha e lowe in es inal pe meabili y
han do o mula- ed in an s [
55
,
56
]. These obse a ions a e consis en wi h animal s udies
showing ha ge m- ee mice ha e many mo phological in es inal de ec s compa ed o hei
no mally colonized coun e pa s, sugges ing ha he de elopmen o ba ie unc ion is
dependen on he p esence o mic oo ganisms [
57
]. Howe e , he speci ic mechanisms by
which a ia ions in he gu mic obio a shape he ea ly plas ici y o in es inal pe meabili y
and how hese ac o s con ibu e o heal h s a us in la e li e emain poo ly unde s ood. The
apical epi helial ne wo k o igh junc ion p o eins is he p incipal de e minan o pa acel-
lula pe meabili y and immune sys em homeos asis [
31
]. In he p esen s udy, we obse ed
ha ma e nal ood es ic ion inc eased colonic pe meabili y in he lac a ing o sp ing, as
e idenced by a educ ion in ZO-1 p o ein le els, which was no ully amelio a ed when
unde nu i ion was co ec ed pos weaning [
16
]. In ag eemen , se e e p o ein de iciency in
animal models led o s uc u al and unc ional changes o he in es ine, including malab-
so p ion and he de elopmen o a leaky gu wi h inc eased pe meabili y [
17
,
58
]. In es inal
Nu ien s 2023,15, 4322 21 o 26
biopsies om se e ely unde nou ished child en wi h en e opa hy also showed a educed
exp ession o he igh junc ions claudin-4 and E-cadhe in [
59
], al hough he molecula
mechanism ela ing unde nu i ion o changes in pa acellula p o eins emains unclea .
In line wi h his, he dis up ion o epi helial igh junc ion p o eins is consis en wi h he
ansloca ion o bac e ial componen s o he ci cula ion and de elopmen o endo oxemia,
as we [
16
] and o he s [
60
] ha e p e iously desc ibed. These changes in igh junc ion
p o ein le els pa alleled changes in he exp ession o epi helial cell componen s such as
he e oil ac o amily o pep ides (TFF), which a e no mally co-sec e ed wi h mucins. In
pa icula , TFF1 and TFF3 ac i ely pa icipa e wi h immune sys em molecules in p o ec ing
he in es inal mucosa om mic oo ganisms [
61
]. In ou animal model, we did no obse e
di e ences in T 1 exp ession associa ed wi h die ype. Howe e , a he beginning and end
o lac a ion, he exp ession o T 3 was inc eased in o sp ing subjec ed o die a y es ic ion.
In his ega d, ecen s udies in animals and pedia ic pa ien s wi h in lamma o y bowel
disease ha e shown ele a ed se um le els o TFF3, an e en associa ed wi h inc eased
in es inal pe meabili y and in lamma ion ha is no seen in heal hy subjec s o pa ien s in
emission [
62
]. The e o e, conside ing he lack o di e ences in mucin (Muc2) exp ession
be ween C and U lac a ing pups, bu he inc ease in T 3 in he la e , we hypo hesize
ha he in lamma o y esponse is ac i a ed in he colon o his popula ion. In line wi h
his, Fança-Be hon e al. [
17
] p e iously desc ibed ha he o sp ing o mo he s ed a
low-p o ein die showed dis u bed exp ession o T 3 in he colon du ing lac a ion. Like-
wise, he KLF (K üppel-like ac o ) amily o ansc ip ion ac o s is also in ol ed in he
con ol o cell p oli e a ion and di e en ia ion in bo h heal hy and pa hological si ua ions,
as well as in in lamma o y esponses [
63
]. Mo eo e , s udies in humans wi h colo ec al
cance ha e desc ibed an un a o able p ognosis a low exp ession le els o KLF3 [
64
].
The e o e, he educed exp ession o his ac o in he colon o UL18 a s compa ed o ha
in CL18 animals could be conside ed a ma ke o incipien in lamma ion. Taken oge he ,
hese esul s sugges ha inc eased pe meabili y may p o ide ansi ional bene i s o U
pups, such as imp o ed nu ien up ake and he de elopmen o sys emic ole ance, which
migh a o hei su i al. Howe e , i may also imply some disad an ages, including he
inc eased ansloca ion o mic obes and o eign pa icles leading o he de elopmen o
in ec ion, in lamma ion and me abolic disease.
Finally, we used Pea son’s co ela ions o suppo e ical mo he - o-child ansmis-
sion and he po en ial in luence o nu i ional s a us in his p ocess. I should be no ed ha
e ical ansmission can be di ec , when he p esence o a pa icula bac e ium in he milk
de e mines he p esence o he same genus in he eces, o indi ec , when he p esence o a
pa icula genus in he milk de e mines he p esence o absence o o he di e en gene a in
he eces. Thus, a ea ly lac a ion, he p esence o Esche ichia-Shigella in he milk om well-
ed animals posi i ely co ela ed wi h he abundance o hese axa in he o sp ing’s eces,
bu wi h a lowe in es inal g ow h o Lac obacillus spp. This nega i e co ela ion be ween
milk-de i ed Esche ichia-Shigella and he ecal con en o Lac obacillus was no obse ed in
U animals, p obably due o he disc iminan abundance o Esche ichia-Shigella in he milk
o ood- es ic ed mo he s a L4 which migh ha e allowed he ini ial coloniza ion o he
gu o be domina ed by Lac obacillus spp. Howe e , he la e educ ion o his axon in he
milk om ood- es ic ed animals, s ongly co ela ed wi h lowe p esence o Lac obacillus
in eces, bu he highe ela i e abundance o Esche ichia-Shigella suppo ed he nega i e
co ela ion be ween he ela i e abundance o hese wo gene a in eces as p e iously de-
sc ibed du ing he p og ession om ulce a i e coli is o colo ec al cance [
65
]. In e es ingly,
Pea son’s co ela ions also e idenced ha he numbe o posi i e associa ions de ec ed
du ing lac a ion be ween ecal anae obic bac e ia, including Fusobac e ium,Roden ibac e ,
Bac e oides,Rombus ia o Veillonella was signi ican ly mo e abundan in con ol animals han
in hose exposed o ma e nal ood es ic ion, sugges ing ha he o ma ion o an anae obic
en i onmen , cha ac e is ic o an adul gu mic obial p o ile, was delayed in he o sp ing
as a esul o ma e nal die . Thus, ou indings indica e ha gu mic obial composi ion is

Nu ien s 2023,15, 4322 22 o 26
no only de e mined by he pa icula cha ac e is ics o each mic obial communi y, bu ha
en i onmen al changes also shape he inal mic obio a.
Se e al ad an ages and limi a ions o he p esen s udy should be no ed. The main
s eng h is ha by collec ing sequen ial samples om each li e , we could examine longi u-
dinal changes in milk mic obio a composi ion o e ime and co ela e hem wi h a ia ions
in he ecal mic obiome. In addi ion, he use o a a model o e s he ad an age o be-
ing able o ca e ully con ol he ma e nal die in he absence o o he ex e nal in luences
o s udy he in es inal ou comes o he o sp ing. Howe e , his in i sel is a limi a ion
when we conside ha a s a e poly ocous and al icial mammals, meaning ha a s gi e
bi h o la ge li e s bo n a an imma u e s age a e ela i ely sho p egnancies, whe eas
women gene ally bea a single e us a an ad anced s age o me abolic de elopmen . How-
e e , compa a i e physiology be ween species p o ides an oppo uni y o unde s and he
molecula , cellula and biochemical mechanisms in ol ed in he ea ly o igin o me abolic
p og amming. On he o he hand, die and age we e no able o explain all he changes
obse ed in milk and ecal bac e ial composi ion, sugges ing ha o he ac o s may ha e
con ibu ed o he la ge in e -indi idual a ia ions obse ed in he mic obio a p o iles. In
his ega d, sex di e ences in he gu mic obio a ha e been epo ed in adul indi iduals
and a e usually a ibu ed o ho monal di e ences be ween males and emales. Howe e ,
he e is no consensus on his ela ionship in ea ly li e coloniza ion o in ela ion o b eas -
eeding [
42
,
49
]. Thus, he absence o gende -s a i ied analysis in he p esen s udy could
possibly explain why ou da a showed some inconclusi e esul s on he associa ion o he
die -induced shi in he milk mic obio a wi h a ia ions in he ecal composi ion o he
o sp ing. Finally, as 16S RNA gene sequencing has limi ed abili y o esol e axa beyond
he genus le el, u he me agenomic and cul u ing analysis will be equi ed o con i m
and alida e he esul s o his s udy as well as o quan i y bac e ial load and he iabili y
o he bac e ia iden i ied in ou samples.
5. Conclusions
In conclusion (Figu e 10), ma e nal malnu i ion is able o modi y he mic obial com-
posi ion o b eas milk, a phenomenon ha is e lec ed in he in es inal mic obio a o he
o sp ing. This ac suppo s he idea o a e ical ansmission o bac e ia om mo he o
child. One o he e ec s o his nu i ional condi ion is he delay in he ma u a ion o he in-
es inal mic obio a, as e idenced by he gap ha exis s bo h, in he e olu ion o he bac e ial
di e si y and he appea ance o he main colonizing gene a du ing lac a ion. These mic o-
bial changes we e accompanied by al e a ions in o sp ing gu pe meabili y, pa icula ly
a he end o lac a ion, as well as in he goble cell ma ke s T 3 and Kl 3, associa ed wi h
cell enewal and ch onic in lamma o y p ocesses. I is wo h men ioning ha ou p e ious
s udies [
16
] ha e al eady demons a ed ha his mic obio a imma u i y is main ained
beyond weaning and e en un il adul hood, which poin s ou he po en ial con ibu ion
o al e ed gu coloniza ion o he associa ed mo bidi ies and he sequelae o malnu i ion
in ea ly li e, including an inc eased isk o obesi y and glucose in ole ance. The e o e,
ou da a highligh he impo ance o b eas eeding as a c i ical window o he apeu ic
in e en ion ia he modula ion o he in an mic obio a as pa o p e en i e medicine.
Nu ien s 2023,15, 4322 23 o 26
Nu ien s 2023, 15, x FOR PEER REVIEW 23 o 26
he apeu ic in e en ion ia he modula ion o he in an mic obio a as pa o p e en i e
medicine.
Figu e 10. Ma e nal nu i ion de e mining milk mic obio a and in luencing offsp ing gu coloniza-
ion. Nu i ional es ic ion du ing he ea ly s ages o de elopmen al e s he mic obial composi ion
o ma e nal milk, a phenomenon e lec ed in he in es inal mic obio a o he offsp ing. As a esul ,
i al e s he abundance o majo axa in milk and eces, delaying he ma u ing o offsp ing gu mi-
c obio a. Addi ionally, hese changes in mic obial composi ion a e associa ed wi h changes in gu
pe meabili y and in he goble cells ma ke s, which a e associa ed wi h ch onic egene a ion o cells
and in lamma o y p ocesses.
Supplemen a y Ma e ials: The ollowing suppo ing in o ma ion can be downloaded a
www.mdpi.com/xxx/s1. Table S1: Rela i e abundance o he mos abundan gene a in he milk o
con ol (C) and unde nou ished (U) a s a 4, 14 and 18 days o lac a ion.; Table S2: Rela i e abun-
dance o he mos abundan gene a in he eces o con ol (C) and unde nou ished (U) offsp ing a s
a 4, 14 and 18 days o lac a ion.
Au ho Con ibu ions: Concep ualiza ion: E.F.-M. and C.Á.; me hodology: P.M.-O., C.A., T.F.-M.
and A.S.-R.; in es iga ion: E.F.-M., P.M.-O. and C.Á.; da a analysis: P.M.-O., C.A. and T.F.-M.; und-
ing Acquisi ion: E.F.-M.; C.Á., M.Á.M. and J.M.R.; isualiza ion: E.F.-M., C.A., F.E. and M.Á.M. w i -
ing—o iginal d a p epa a ion: P.M.-O., C.A. and E.F.-M.; w i ing— e iew and edi ing: E.F.-M.,
C.Á., F.E., M.Á.M. and J.M.R. All au ho s ha e ead and ag eed o he published e sion o he man-
usc ip .
Funding: This wo k was suppo ed by he g an s PID2020-116134RB-I00, PID2019-105606RB-I00
and CIBER-Conso cio Cen o de In es igación Biomédica en Red-(CB07/08/0013), Ins i u o de Salud
Ca los III, om Minis e io de Ciencia e Inno ación (MINECO).
Ins i u ional Re iew Boa d S a emen : All he expe imen s we e conduc ed in acco dance wi h
Eu opean Union (2010/63/EU) and Spanish (RD 53/2013) legisla ion and wi h he app o al o he
Animal Ca e and Use Commi ee o he Communi y o Mad id (PROEX 349/15 and PROEX 215.8/21).
In o med Consen S a emen : No applicable.
Da a A ailabili y S a emen : Da a a e a ailable upon eques o he au ho s.
Con lic s o In e es : The au ho s decla e no con lic o in e es .
Figu e 10.
Ma e nal nu i ion de e mining milk mic obio a and in luencing o sp ing gu coloniza ion.
Nu i ional es ic ion du ing he ea ly s ages o de elopmen al e s he mic obial composi ion o
ma e nal milk, a phenomenon e lec ed in he in es inal mic obio a o he o sp ing. As a esul ,
i al e s he abundance o majo axa in milk and eces, delaying he ma u ing o o sp ing gu
mic obio a. Addi ionally, hese changes in mic obial composi ion a e associa ed wi h changes in gu
pe meabili y and in he goble cells ma ke s, which a e associa ed wi h ch onic egene a ion o cells
and in lamma o y p ocesses.
Supplemen a y Ma e ials:
The ollowing suppo ing in o ma ion can be downloaded a h ps://
www.mdpi.com/a icle/10.3390/nu15204322/s1. Table S1: Rela i e abundance o he mos abundan
gene a in he milk o con ol (C) and unde nou ished (U) a s a 4, 14 and 18 days o lac a ion.; Table
S2: Rela i e abundance o he mos abundan gene a in he eces o con ol (C) and unde nou ished
(U) o sp ing a s a 4, 14 and 18 days o lac a ion.
Au ho Con ibu ions:
Concep ualiza ion: E.F.-M. and C.Á.; me hodology: P.M.-O., C.A., T.F.-M.
and A.S.-R.; in es iga ion: E.F.-M., P.M.-O. and C.Á.; da a analysis: P.M.-O., C.A. and T.F.-M.; unding
Acquisi ion: E.F.-M.; C.Á., M.Á.M. and J.M.R.; isualiza ion: E.F.-M., C.A., F.E. and M.Á.M. w i ing—
o iginal d a p epa a ion: P.M.-O., C.A. and E.F.-M.; w i ing— e iew and edi ing: E.F.-M., C.Á., F.E.,
M.Á.M. and J.M.R. All au ho s ha e ead and ag eed o he published e sion o he manusc ip .
Funding:
This wo k was suppo ed by he g an s PID2020-116134RB-I00, PID2019-105606RB-I00 and
CIBER-Conso cio Cen o de In es igación Biomédica en Red-(CB07/08/0013), Ins i u o de Salud
Ca los III, om Minis e io de Ciencia e Inno ación (MINECO).
Ins i u ional Re iew Boa d S a emen :
All he expe imen s we e conduc ed in acco dance wi h
Eu opean Union (2010/63/EU) and Spanish (RD 53/2013) legisla ion and wi h he app o al o he
Animal Ca e and Use Commi ee o he Communi y o Mad id (PROEX 349/15 and PROEX 215.8/21).
In o med Consen S a emen : No applicable.
Da a A ailabili y S a emen : Da a a e a ailable upon eques o he au ho s.
Con lic s o In e es : The au ho s decla e no con lic o in e es .
Nu ien s 2023,15, 4322 24 o 26
Re e ences
1.
Pena-León, V.; Folguei a, C.; Ba ja-Fe nández, S.; Pé ez-Lois, R.; Da Sil a Lima, N.; Ma in, M.; He as, V.; Ma ínez-Ma ínez, S.;
Vale o, P.; Iglesias, C.; e al. P olonged b eas eeding p o ec s om obesi y by hypo halamic ac ion o hepa ic FGF21. Na . Me ab.
2022,4, 901–917. [C ossRe ] [PubMed]
2.
Picó, C.; Reis, F.; Egas, C.; Ma hias, P.; Ma a ome, P. Lac a ion as a p og amming window o me abolic synd ome. Eu . J. Clin.
In es ig. 2021,51, e13482. [C ossRe ]
3.
Hsu, C.N.; Hou, C.Y.; Hsu, W.H.; Tain, Y.L. Ea ly-Li e O igins o Me abolic Synd ome: Mechanisms and P e en i e Aspec s. In . J.
Mol. Sci. 2021,22, 11872. [C ossRe ]
4.
De To o-Ma ín, J.; Fe nández-Millán, E.; Lizá aga-Mollinedo, E.; López-Oli a, E.; Se adas, P.; Esc i á, F.; Ál a ez, C. P edomi-
nan ole o GIP in he de elopmen o a me abolic synd ome-like pheno ype in emale Wis a a s submi ed o o ced ca ch-up
g ow h. Endoc inology 2014,155, 3769–3780. [C ossRe ]
5.
Tsuduki, T.; Ki ano, Y.; Honma, T.; Kijima, R.; Ikeda, I. High die a y a in ake du ing lac a ion p omo es de elopmen o
die -induced obesi y in male o sp ing o mice. J. Nu . Sci. Vi aminol. 2013,59, 384–392. [C ossRe ] [PubMed]
6. Ba ke , D.J. The o igins o he de elopmen al o igins heo y. J. In e n. Med. 2007,261, 412–417. [C ossRe ] [PubMed]
7.
G igo , M.R.; Allan, J.E.; Ca ing on, J.M.; Ca ne, A.; Geu sen, A.; Young, D.; Thompson, M.P.; Haynes, E.B.; Coleman, R.A. E ec
o Die a y P o ein and Food Res ic ion on Milk P oduc ion and Composi ion, Ma e nal Tissues and Enzymes in Lac a ing Ra s. J.
Nu . 1987,117, 1247–1258. [C ossRe ]
8.
Bau is a, C.J.; Bau is a, R.J.; Mon año, S.; Reyes-Cas o, L.A.; Rod iguez-Peña, O.N.; Ibáñez, C.A.; Na hanielsz, P.W.; Zamb ano, E.
E ec s o ma e nal p o ein es ic ion du ing p egnancy and lac a ion on milk composi ion and o sp ing de elopmen . B . J.
Nu . 2019,122, 141–151. [C ossRe ]
9.
Wa ez, J.S.; Delmon , A.; Bou e , M.; Beseme, O.; Goe s, S.; Delahaye, F.; Labo ie, C.; Lesage, J.; Foligné, B.; B e on, C.; e al.
Ma e nal pe ina al unde nu i ion modi ies lac ose and se o an e in in milk: Rele ance o he p og amming o me abolic
diseases? Am. J. Physiol. Endoc inol. Me ab. 2015,308, E393–E401. [C ossRe ]
10.
Fio o o, M.L.; Bu in, D.G.; Pe ez, M.; Reeds, P.J. In ake and use o milk nu ien s by a pups suckled in small, medium, o la ge
li e s. Am. J. Physiol. 1991,260, R1104–R1113. [C ossRe ]
11.
Palou, M.; To ens, J.M.; Cas illo, P.; Sánchez, J.; Palou, A.; Picó, C. Me abolomic app oach in milk om calo ie- es ic ed a s
du ing lac a ion: A po en ial link o he p og amming o a heal hy pheno ype in o sp ing. Eu . J. Nu .
2020
,59, 1191–1204.
[C ossRe ]
12.
Lizá aga-Mollinedo, E.; Fe nández-Millán, E.; de To o Ma ín, J.; Ma ínez-Hondu illa, C.; Esc i á, F.; Ál a ez, C. Ea ly
unde nu i ion induces glucagon esis ance and insulin hype sensi i i y in he li e o suckling a s. Am. J. Physiol. Me ab.
2012
,
302, E1070–E1077. [C ossRe ]
13.
de To o-Ma ín, J.; Fe nández-Ma celo, T.; González-Rod íguez, Á.; Esc i á, F.; Val e de, Á.M.; Ál a ez, C.; Fe nández-Millán, E.
De ec i e li e glycogen au ophagy ela ed o hype insulinemia in in au e ine g ow h- es ic ed newbo n Wis a a s. Sci. Rep.
2020,10, 17651. [C ossRe ]
14.
Lizá aga-Mollinedo, E.; Fe nández-Millán, E.; Ga cía-San F u os, M.; de To o-Ma ín, J.; Fe nández-Agulló, T.; Ros, M.; Ál a ez,
C.; Esc i á, F. Ea ly and long- e m unde nu i ion in emale a s exace ba es he me abolic isk associa ed wi h nu i ional
ehabili a ion. J. Biol. Chem. 2015,290, 19353–19366. [C ossRe ] [PubMed]
15.
López, M.; Seoane, L.M.; To a , S.; Ga cía, M.C.; Noguei as, R.; Diéguez, C.; Seña ís, R.M. A possible ole o neu opep ide Y,
agou i- ela ed p o ein and lep in ecep o iso o ms in hypo halamic p og amming by pe ina al eeding in he a . Diabe ologia
2005,48, 140–148. [C ossRe ]
16.
Ma ínez-Oca, P.; Robles-Ve a, I.; Sánchez-Ronce o, A.; Esc i á, F.; Pé ez-Vizcaíno, F.; Dua e, J.; Ál a ez, C.; Fe nández-Millán, E.
Gu DYSBIOSIS and al e ed ba ie unc ion p ecedes he appea ance o me abolic synd ome in a a model o nu ien -induced
ca ch-up g ow h. J. Nu . Biochem. 2020,81, 08383. [C ossRe ]
17.
Fança-Be hon, P.; Michel, C.; Pagniez, A.; Ri al, M.; Van Seuningen, I.; Da maun, D.; Hoeble , C. In au e ine g ow h es ic ion
al e s pos na al colonic ba ie ma u a ion in a s. Pedia . Res. 2009,66, 47–52. [C ossRe ] [PubMed]
18.
Dog a, S.K.; Kwong Chung, C.; Wang, D.; Sakwinska, O.; Colombo Mo az, S.; Sp enge , N. Nu u ing he Ea ly Li e Gu
Mic obiome and Immune Ma u a ion o Long Te m Heal h. Mic oo ganisms 2021,9, 2110. [C ossRe ]
19.
Xiao, L.; Zhao, F. Mic obial ansmission, colonisa ion and succession: F om p egnancy o in ancy. Gu
2023
,72, 772–786.
[C ossRe ] [PubMed]
20.
Lackey, K.A.; Williams, J.E.; Meehan, C.L.; Zachek, J.A.; Benda, E.D.; P ice, W.J.; Fos e , J.A.; Sellen, D.W.; Kamau-Mbu hia,
E.W.; Kamundia, E.W.; e al. Wha ’s no mal? mic obiomes in human milk and in an eces a e ela ed o each o he bu a y
geog aphically: The INSPIRE s udy. F on . Nu . 2019,6, 45. [C ossRe ]
21.
Togo, A.; Du ou , J.-C.; Lagie , J.-C.; Dubou g, G.; Raoul , D.; Million, M. Repe oi e o human b eas and milk mic obio a: A
sys ema ic e iew. Fu u e Mic obiol. 2019,14, 623–641. [C ossRe ] [PubMed]
22.
S ewa , C.J.; Ajami, N.J.; O’B ien, J.L.; Hu chinson, D.S.; Smi h, D.P.; Wong, M.C.; Ross, M.C.; Lloyd, R.E.; Doddapaneni, H.;
Me cal , G.A.; e al. Tempo al de elopmen o he gu mic obiome in ea ly childhood om he TEDDY s udy. Na u e
2018
,562,
583–588. [C ossRe ]
23.
Cab e a-Rubio, R.; Mi a-Pascual, L.; Mi a, A.; Collado, M.C. Impac o mode o deli e y on he milk mic obio a composi ion o
heal hy women. J. De . O ig. Heal h Dis. 2015,7, 54–60. [C ossRe ] [PubMed]
Nu ien s 2023,15, 4322 25 o 26
24.
Cab e a-Rubio, R.; Collado, M.C.; Lai inen, K.; Salminen, S.; Isolau i, E.; Mi a, A. The human milk mic obiome changes o e
lac a ion and is shaped by ma e nal weigh and mode o deli e y. Am. J. Clin. Nu . 2012,96, 544–551. [C ossRe ]
25.
Collado, M.C.; Lai inen, K.; Salminen, S.; Isolau i, E. Ma e nal weigh and excessi e weigh gain du ing p egnancy modi y he
immunomodula o y po en ial o b eas milk. Pedia . Res. 2012,72, 77–85. [C ossRe ] [PubMed]
26.
Kalliomäki, M.; Collado, M.C.; Salminen, S.; Isolau i, E. Ea ly di e ences in ecal mic obio a composi ion in child en may p edic
o e weigh . Am. J. Clin. Nu . 2008,87, 534–538. [C ossRe ]
27.
Wa en, M.F.; Hallowell, H.A.; Higgins, K.V.; Liles, M.R.; Hood, W.R. Ma e nal Die a y P o ein In ake In luences Milk and
O sp ing Gu Mic obial Di e si y in a Ra (Ra us no egicus) Model. Nu ien s 2019,11, 2257. [C ossRe ]
28.
Cabinian, A.; Sinsime , D.; Tang, M.; Zumba, O.; Meh a, H.; Toma, A.; San ’Angelo, D.; Laoua , Y.; Laoua , A. T ans e o Ma e nal
Immune Cells by B eas eeding: Ma e nal Cy o oxic T Lymphocy es P esen in B eas Milk Localize in he Peye ’s Pa ches o he
Nu sed In an . PLoS ONE 2016,11, e0156762. [C ossRe ]
29.
Rod íguez-C uz, M.; Alba, C.; Apa icio, M.; Checa, M.Á.; Fe nández, L.; Rod íguez, J.M. E ec o Sample Collec ion (Manual
Exp ession s. Pumping) and Skimming on he Mic obial P o ile o Human Milk Using Cul u e Techniques and Me a axonomic
Analysis. Mic oo ganisms 2020,8, 1278. [C ossRe ]
30.
Schindelin, J.; A ganda-Ca e as, I.; F ise, E.; Kaynig, V.; Longai , M.; Pie zsch, T.; P eibisch, S.; Rueden, C.; Saal eld, S.; Schmid,
B.; e al. Fiji: An open-sou ce pla o m o biological-image analysis. Na . Me hods 2012,9, 676–682. [C ossRe ]
31.
Odenwald, M.A.; Tu ne , J.R. The in es inal epi helial ba ie : A he apeu ic a ge ? Na . Re . Gas oen e ol. Hepa ol.
2012
,14, 9–21.
[C ossRe ]
32.
C osnie , C.; S ama aki, D.; Lewis, J. O ganizing cell enewal in he in es ine: S em cells, signals and combina o ial con ol. Na .
Re . Gene . 2006,7, 349–359. [C ossRe ]
33.
Milani, C.; Du an i, S.; Bo acini, F.; Casey, E.; Tu oni, F.; Mahony, J.; Belze , C.; Delgado Palacio, S.; A boleya Mon es, S.;
Mancabelli, L.; e al. The Fi s Mic obial Colonize s o he Human Gu : Composi ion, Ac i i ies, and Heal h Implica ions o he
In an Gu Mic obio a. Mic obiol. Mol. Biol. Re . 2017,81, e00036-17. [C ossRe ]
34.
Fe nández, L.; Panna aj, P.S.; Rau a a, S.; Rod íguez, J.M. The Mic obio a o he Human Mamma y Ecosys em. F on . Cell. In ec .
Mic obiol. 2020,10, 586667. [C ossRe ]
35.
Panna aj, P.S.; Li, F.; Ce ini, C.; Bende , J.M.; Yang, S.; Rollie, A.; Adise iyo, H.; Zabih, S.; Lincez, P.J.; Bi inge , K.; e al. Associa ion
be ween b eas milk bac e ial communi ies and es ablishmen and de elopmen o he in an gu mic obiome. JAMA Pedia .
2017,171, 647–654. [C ossRe ]
36.
Mu phy, K.; Cu ley, D.; O’Callaghan, T.F.; O’Shea, C.A.; Dempsey, E.M.; O’Toole, P.W.; Ross, R.P.; Ryan, C.A.; S an on, C. The
composi ion o human milk and in an ecal mic obio a o e he i s h ee mon hs o li e: A pilo s udy. Sci. Rep. 2017,7, 40597.
[C ossRe ] [PubMed]
37.
Yel e on, C.A.; Killeen, S.L.; Feehily, C.; Moo e, R.L.; Callaghan, S.L.; Ge agh y, A.A.; By ne, D.F.; Walsh, C.J.; Law on, E.M.;
Mu phy, E.F.; e al. Ma e nal b eas eeding is associa ed wi h o sp ing mic obiome di e si y; a seconda y analysis o he
Mic obeMom andomized con ol ial. F on . Mic obiol. 2023,14, 1154114. [C ossRe ] [PubMed]
38.
Sub amanian, S.; Huq, S.; Ya sunenko, T.; Haque, R.; Mah uz, M.; Alam, M.A.; Benez a, A.; Des e ano, J.; Meie , M.F.; Muegge,
B.D.; e al. Pe sis en gu mic obio a imma u i y in malnou ished Bangladeshi child en. Na u e
2014
,510, 417–421. [C ossRe ]
[PubMed]
39.
Smi h, M.I.; Ya sunenko, T.; Mana y, M.J.; T ehan, I.; Mkakosya, R.; Cheng, J.; Kau, A.L.; Rich, S.S.; Concannon, P.; Mychaleckyj,
J.C.; e al. Gu mic obiomes o Malawian win pai s disco dan o kwashio ko . Science
2013
,339, 548–554. [C ossRe ] [PubMed]
40.
Ma ín, R.; Oli a es, M.; Ma ín, M.; Xaus, J.; Fe nández, L.; Rod íguez, J. Cha ac e iza ion o a eu e in-p oducing Lac obacillus
co yni o mis s ain isola ed om a goa ’s milk cheese. In . J. Food Mic obiol. 2005,104, 267–277. [C ossRe ]
41.
Ma ino, C.; Dilmo e, A.H.; Bu cham, Z.M.; Me cal , J.L.; Jes e, D.; Knigh , R. Mic obio a succession h oughou li e om he
c adle o he g a e. Na . Re . Mic obiol. 2022,20, 707–720. [C ossRe ] [PubMed]
42.
Kozy skyj, A.L.; Kalu, R.; Kole a, P.T.; B idgman, S.L. Fe al p og amming o o e weigh h ough he mic obiome: Boys a e
disp opo iona ely a ec ed. J. De . O ig. Heal h Dis. 2016,7, 25–34. [C ossRe ] [PubMed]
43.
Jaša e i´c, E.; Bale, T.L. P ena al and pos na al con ibu ions o he ma e nal mic obiome on o sp ing p og amming. F on .
Neu oendoc inol. 2019,55, 100797. [C ossRe ] [PubMed]
44.
Milano, W.; Amb osio, P.; Ca izzone, F.; De Biasio, V.; Foia, M.G.; Sae a, B.; Milano, M.F.; Capasso, A. Mens ual Diso de s
Rela ed o Ea ing Diso de s. Endoc . Me ab. Immune Diso d. D ug Ta ge s 2022,22, 471–480. [C ossRe ]
45.
Ribe , D.; Cossa , P. How Bac e ial Pa hogens Colonize Thei Hos s and In ade Deepe Tissues. Mic obes In ec .
2015
,17, 173–183.
[C ossRe ] [PubMed]
46.
Liang, H.; Song, H.; Zhang, X.; Song, G.; Wang, Y.; Ding, X.; Duan, X.; Li, L.; Sun, T.; Kan, Q. Me o min a enua ed sepsis- ela ed
li e inju y by modula ing gu mic obio a. Eme g. Mic obes In ec . 2022,11, 815–828. [C ossRe ] [PubMed]
47.
Li, X.; He, C.; Li, N.; Ding, L.; Chen, H.; Wan, J.; Yang, X.; Xia, L.; He, W.; Xiong, H.; e al. The in e play be ween he gu mic obio a
and NLRP3 ac i a ion a ec s he se e i y o acu e panc ea i is in mice. Gu Mic obes 2020,11, 1774–1789. [C ossRe ] [PubMed]
48.
Ca aneo, A.; Ca ane, N.; Galluzzi, S.; P o asi, S.; Lopizzo, N.; Fes a i, C.; Fe a i, C.; Gue a, U.P.; Paghe a, B.; Muscio, C.; e al.
Associa ion o b ain amyloidosis wi h p o-in lamma o y gu bac e ial axa and pe iphe al in lamma ion ma ke s in cogni i ely
impai ed elde ly. Neu obiol. Aging 2017,49, 60–68. [C ossRe ]