ORIGINAL RESEARCH
published: 21 Sep embe 2017
doi: 10.3389/ pha .2017.00646
F on ie s in Pha macology | www. on ie sin.o g 1Sep embe 2017 | Volume 8 | A icle 646
Edi ed by:
Emanuela Riccio i,
Uni e si y o Pennsyl ania,
Uni ed S a es
Re iewed by:
Sabine G ösch,
Goe he Uni e si y F ank u , Ge many
Ma ina Ko o ko a,
Ka olinska Ins i u e (KI), Sweden
B ian G ego y Geo ge Oli e ,
Uni e si y o Technology, Sydney,
Aus alia
*Co espondence:
Ee a Moilanen
[email p o ec ed]
Special y sec ion:
This a icle was submi ed o
In lamma ion Pha macology,
a sec ion o he jou nal
F on ie s in Pha macology
Recei ed: 22 June 2017
Accep ed: 31 Augus 2017
Published: 21 Sep embe 2017
Ci a ion:
Tuu e L, Hämäläinen M, Whi le BJ
and Moilanen E (2017) Mic osomal
P os aglandin E Syn hase-1
Exp ession in In lamma o y Condi ions
Is Down egula ed by Dexame hasone:
Seminal Role o he Regula o y
Phospha ase MKP-1.
F on . Pha macol. 8:646.
doi: 10.3389/ pha .2017.00646
Mic osomal P os aglandin
E Syn hase-1 Exp ession in
In lamma o y Condi ions Is
Down egula ed by Dexame hasone:
Seminal Role o he Regula o y
Phospha ase MKP-1
Lau i Tuu e 1, Ma i Hämäläinen 1, B endan J. Whi le 1, 2 and Ee a Moilanen 1
*
1The Immunopha macology Resea ch G oup, Facul y o Medicine and Li e Sciences, Uni e si y o Tampe e, Tampe e
Uni e si y Hospi al, Tampe e, Finland, 2William Ha ey Resea ch Ins i u e, Ba s and he London School o Medicine,
London, Uni ed Kingdom
Mic osomal p os aglandin E syn hase-1 (mPGES-1) is an inducible enzyme si ua ed
downs eam o cyclo-oxygenase-2, p omo ing he excessi e PGE2p oduc ion in
in lamma ion. Dexame hasone is known o supp ess mPGES-1 bu he mechanisms
egula ing mPGES-1 exp ession emain poo ly known. MKP-1 is a phospha ase
con olling he p oin lamma o y MAP kinase pa hways p38 and JNK, hus limi ing
he in lamma o y esponses. We ha e now in es iga ed he ole o MKP-1 and MAP
kinases p38 and JNK in he egula ion o mPGES-1 exp ession by dexame hasone.
Dexame hasone inc eased MKP-1 and dec eased mPGES-1 exp ession in J774
mac ophages and in pe i oneal mac ophages om wild- ype bu no om MKP-1
de icien mice. Dexame hasone also educed p38 and JNK phospho yla ion along wi h
enhancemen o MKP-1, while inhibi ion o JNK educed mPGES-1 exp ession. These
indings we e also ansla ed o in i o condi ions as dexame hasone down egula ed
mPGES-1 exp ession in paw in lamma ion in wild- ype bu no in MKP-1 de icien
mice. In conclusion, dexame hasone was ound o down egula e mPGES-1 exp ession
h ough enhanced MKP-1 exp ession and educed JNK phospho yla ion in in lamma o y
condi ions. The esul s ex end he unde s anding on he egula ion o mPGES-1
exp ession and highligh he po en ial o MKP-1 as an an i-in lamma o y d ug a ge .
Keywo ds: mPGES-1, p os aglandins, MAP kinases, MKP-1, JNK
INTRODUCTION
Mic osomal p os aglandin E syn hase-1 (mPGES-1) is a e minal enzyme ca alyzing he syn hesis
o p os aglandin E2(PGE2), an essen ial p os anoid linked o pa hophysiological condi ions, such
as in lamma ion, pain, e e and umo igenesis (Samuelsson e al., 2007; S ables and Gil oy,
2011; Coulombe e al., 2014; Ruan and So, 2014; Koebe le and We z, 2015). Two o he PGE2
syn hesizing enzymes ha e been cha ac e ized so a , namely mic osomal p os aglandin E syn hase-
2 (mPGES-2) and cy osolic p os aglandin E syn hase (cPGES). Cons i u i ely exp essed mPGES-2
Tuu e e al. Dexame hasone Inhibi s mPGES-1 Exp ession MKP-1-dependen ly
and cPGES a e p esumed o be esponsible o physiological
PGE2 o ma ion, whe eas mPGES-1 is an inducible enzyme, he
exp ession o which is induced unde in lamma o y condi ions in
a ious cells and issues (Samuelsson e al., 2007).
The an i-in lamma o y e ec s o non-s e oidal an i-
in lamma o y d ugs (NSAIDs) a e conside ed o be based
p edominan ly on educed o ma ion o PGE2due o inhibi ion
o cyclo-oxygenase (COX) enzymes. Howe e , he known ad e se
e ec s o NSAIDs, such as gas oin es inal, ca dio ascula and
enal p oblems a e also linked o he same mechanism o ac ion,
ha is, inhibi ion o cyclo-oxygenases, es ic ing he use o
NSAIDs among many pa ien g oups. Fo example, he inc eased
isk o myoca dial in a c ion may in pa e lec he educed
o ma ion o p os acyclin (p os aglandin I2, PGI2) ollowing
inhibi ion o COX-2 in he ascula wall, while mucosal e osions
and bleedings in he gas oin es inal ack a e conside ed o
esul om dec eased o ma ion o p o ec i e physiological
p os anoids a e inhibi ion o COX enzymes (Cheng e al., 2006;
G osse e al., 2010; Coxib and adi ional, NSAID T ialis s’
(CNT) Collabo a ion, e al., 2013).
Such obse a ions could indica e ha mPGES-1 is he e o e
a po en ial d ug a ge o ea ing in lamma o y condi ions
and pain by selec i ely dec easing PGE2p oduc ion unde
in lamma o y condi ions. An inhibi o o mPGES-1 ac i i y o
exp ession could hus lead o a selec i e dec ease o excessi e
PGE2 o ma ion du ing in lamma ion since he syn hesis o o he
p os anoids a e no educed simila ly, as unde he ea men
wi h NSAIDs; u he mo e, he cons i u i e PGE2syn hesis
h ough mPGES-2 and cPGES emains unchanged. Mo eo e ,
i has been epo ed ha gene ic dele ion o pha macological
inhibi ion o mPGES-1 may also lead o an inc eased p oduc ion
o p os anoids exhibi ing an i-in lamma o y p ope ies (Idbo g
e al., 2013) and possibly modula e pla ele unc ion du ing
in lamma ion (Raou e al., 2016). O e all, inhibi ion o mPGES-
1 may he e o e esul in he apeu ic ac i i y compa able o
NSAIDs bu wi h less ad e se e ec s (Samuelsson e al., 2007;
Ko o ko a and Jakobsson, 2013; Koebe le and We z, 2015).
Inhibi o s o mPGES-1 ac i i y a e indeed unde
de elopmen . Recen ly, a phase I ial wi h he selec i e
mPGES-1 inhibi o LY3023703 indica ed a dec eased le el o
a u ina y me aboli e o PGE2 o an ex en compa able o ha
caused by he COX-2 inhibi o celecoxib. In addi ion, a mo e
a o able e ec on he p oduc ion o p os anoids o he han
PGE2was ound (Jin e al., 2015). De elopmen o mPGES-1
inhibi o s cu en ly appea s o be ocused on molecules a ec ing
he ac i i y o mPGES-1 and subsequen PGE2p oduc ion
(Chang and Meuille , 2011; Ko o ko a and Jakobsson, 2013;
Koebe le and We z, 2015; Chand asekha e al., 2016; Gup a
and Apa oy, 2016; Koebe le e al., 2016). Howe e , as p esen ed
in his s udy, an al e na i e app oach migh be o ocus on
he down egula ion o he exp ession o mPGES-1 a he han
di ec ly a ec ing he ac i i y o he enzyme.
Mi ogen ac i a ed p o ein (MAP) kinases, namely
ex acellula signal- egula ed kinase (ERK), p38 MAP-kinase and
c-Jun N- e minal kinase (JNK), egula e he cellula esponse
o a ious ex acellula in lamma o y s imuli (Johnson and
Lapada , 2002; Raman e al., 2007). These enzymes a e ac i a ed
by phospho yla ion and play an essen ial ole in he p omo ion
o in lamma o y esponses and inna e immune sys em (K ame
e al., 1996; Ashwell, 2006; Rincon and Da is, 2009; Plo niko
e al., 2011; Ko honen and Moilanen, 2014). Mi ogen-ac i a ed
p o ein kinase phospha ases (MKPs) inac i a e MAP kinases
h ough dephospho yla ion and o m a nega i e eedback sys em
o he ac i i y o MAP kinases, hus con olling and limi ing he
in lamma o y eac ion and inna e immune esponses (Chi e al.,
2006; Hamme e al., 2006; Zhao e al., 2006; Wang and Liu, 2007;
Li e al., 2009; Wancke e al., 2012). MKP-1 is he mos s udied o
MKP enzymes and i has been shown o dephospho yla e MAP
kinases p38 and / o JNK, depending on he cell ype, and he eby
dec easing he exp ession o many MAP kinase-dependen
p o-in lamma o y ac o s (F anklin and K a , 1997; F anklin
e al., 1998; Chi e al., 2006; Zhao e al., 2006; Tu peinen e al.,
2010, 2011; Comalada e al., 2012). MKP-1 has been iden i ied
as a media o o some an i-in lamma o y e ec s o d ugs such
as he glucoco icoids, he an i- heuma ic d ug au o hiomala e,
phosphodies e ase 4 inhibi o s (Kassel e al., 2001; Ab aham
e al., 2006; Nieminen e al., 2010; Shipp e al., 2010; Ko honen
e al., 2013; Ke änen e al., 2017) and ecen ly, also β2-agonis s
(Ke änen e al., 2016). In addi ion, in lamma o y esponses
ha e been ound o be mo e se e e and e en le hal in MKP-1
knock-ou mice as compa ed o wild- ype con ols (Chi e al.,
2006; Zhao e al., 2006; F azie e al., 2009; Ko honen e al., 2011,
2013), emphasizing he ole o MKP-1 as a limi ing ac o in
in lamma ion.
Mechanisms egula ing he exp ession o mPGES-1 a e no
ully known, bu one o he ew d ugs ound o inhibi he
exp ession o mPGES-1 is he glucoco icoid dexame hasone
(S ich eno h e al., 2001), known also o enhance he exp ession
o MKP-1 (Kassel e al., 2001; Ab aham e al., 2006; Shipp e al.,
2010). The e o e, we es ed he hypo hesis ha dexame hasone
inhibi s he exp ession o mPGES-1 ia an ele a ed MKP-1
exp ession and subsequen dephospho yla ion o MAP kinases,
by using he J774 mac ophage cell line and con i med he indings
by using pe i oneal mac ophages om MKP-1 de icien and
co esponding wild- ype mice. To e alua e he signi icance o
hese indings in i o, he e ec s o dexame hasone on he
exp ession o mPGES-1 in mouse paw in lamma ion in MKP-1
de icien and co esponding wild- ype mice was also s udied.
MATERIALS AND METHODS
Ma e ials
Dexame hasone was ecei ed om O ion Co p. (Espoo,
Finland). Lipopolysaccha ide (LPS) om Esche ichia coli s ain
0111:B4 and all o he eagen s we e pu chased om Sigma-
Ald ich Inc. (S . Louis, MO, USA) unless o he wise s a ed.
Animals
Wild- ype and MKP-1(-/-) C57BL/6 mice o iginally gene a ed
in he labo a o y o R. B a o a B is ol-Mye s Squibb
Pha maceu ical Resea ch Ins i u e (P ince on, NJ, USA)
we e used in he p esen s udy. Mice we e b ed a he animal
acili es in Facul y o Medicine and Li e Sciences, Uni e si y
o Tampe e unde s anda d condi ions (12:12 ligh -da k cycle,
F on ie s in Pha macology | www. on ie sin.o g 2Sep embe 2017 | Volume 8 | A icle 646
Tuu e e al. Dexame hasone Inhibi s mPGES-1 Exp ession MKP-1-dependen ly
+22 ±1◦C empe a u e, 50–60% humidi y), and ood and wa e
p o ided ad libi um. Animal expe imen s we e ca ied ou in
acco dance wi h he legisla ion o he p o ec ion o animals
used o scien i ic pu poses (Di ec i e 2010/63/EU), and he
s udy was app o ed by he Na ional Animal Expe imen Boa d.
Lipopolysaccha ide-Induced Paw Edema
Lipopolysaccha ide [50 µl o 2 mg/ml in phospha e-bu e ed
saline (PBS)] was injec ed in o he hind paw o anes he ized mice
(0.5 mg/kg, Domi o R
; O ion Oyj, Espoo, Finland, and 75 mg/kg,
Ke ala R
; P ize Oy Animal Heal h, Helsinki, Finland). The
con ala e al paw was injec ed wi h he co esponding olume o
endo oxin- ee PBS. Mice we e ea ed 1 h p io o he injec ion
o LPS wi h dexame hasone (2 mg/kg in ape i oneally) o wi h
ehicle (PBS). Paw olumes we e measu ed up o 6 h wi h a
ple hysmome e (Ugo Basile, Come io, I aly) and compa ed o
he baseline alue. A e he las measu emen mice we e sac i ied
(ce ical disloca ion) and paw issues we e collec ed in o RNA
La e solu ion (In i ogen, Ca lsbad, CA, USA).
Cell Cul u e
J774 mouse mac ophages (Ame ican Type Cul u e Collec ion,
Rock ille Pike, MD, USA ) we e cul u ed a +37◦C in 5% CO2
a mosphe e in Dulbecco’s Modi ied Eagle’s medium (DMEM,
In i ogen, Paisley, UK) con aining 10% ( / ) hea -inac i a ed
e al bo ine se um (FBS), 100 U/ml penicillin, 100 µg/ml
s ep omycin and 250 ng/ml ampho e icin B (all om Gibco,
Wien, Aus ia). Cells (2.5 ×105pe well) we e seeded on 24-well
pla es and he cell monolaye s we e g own o 72 h p io o he
expe imen s. SP600125 and SB203580 we e dissol ed in dime hyl
sul oxide (DMSO), dexame hasone and LPS in PBS. LPS and he
compounds unde in es iga ion in concen a ions indica ed o
he sol en (DMSO, inal concen a ion 0.1% / in all wells)
we e added o he cells in esh cul u e medium con aining 10%
FBS and he supplemen s, and he incuba ions we e con inued
o he ime indica ed be o e emo ing he cul u e medium and
ha es ing he cells.
Mouse pe i oneal mac ophages we e ob ained by
pe i oneal la age wi h s e ile PBS supplemen ed wi h 0.2
mM e hylenediamine e aace ic acid (EDTA). Cells we e washed
and seeded on 24-well pla es (1 ×106cells/well) in RPMI
medium supplemen ed wi h 2% FBS, 100 U/ml penicillin, 100
µg/ml s ep omycin and 250 ng/ml ampho e icin B. Cells we e
incuba ed o e nigh , washed and ea ed wi h he compounds
unde in es iga ion o he pe iod indica ed.
P epa a ion o Cell Lysa es and Wes e n
Blo Analysis
A he indica ed ime poin s, he cul u e medium was
emo ed and he cells we e washed wi h ice-cold PBS and
solubilized in cold lysis bu e con aining 10 mM T is–
HCl, 5 mM EDTA, 50 mM NaCl, 1% T i on X-100, 0.5 mM
phenylme hylsul onyl luo ide, 1 mM sodium o ho anada e,
20 mg/ml leupep in, 50 mg/ml ap o inin, 5 mM sodium
luo ide, 2 mM sodium py ophospha e and 10 mM n-oc yl-b-
D-glucopy anoside. A e incuba ion o 15 min on ice, lysa es
we e cen i uged, and he supe na an s we e collec ed and mixed
FIGURE 1 | Dexame hasone inhibi s mPGES-1 exp ession in ac i a ed
mac ophages in an MKP-1 dependen manne . (A) E ec s o dexame hasone
on pe i oneal mac ophages om wild- ype and MKP-1 knock-ou (KO) mice.
Cells we e incuba ed wi h LPS in he p esence o absence o dexame hasone
o 24 h. mPGES-1 mRNA le els we e measu ed by quan i a i e RT-PCR and
no malized agains GAPDH mRNA le els. Resul s a e exp essed in a bi a y
uni s, mPGES-1 mRNA le els in uns imula ed cells om wild ype mice we e
se as 1, and he o he alues we e ela ed o ha . Resul s a e exp essed as
mean +SEM, n=4. One-way ANOVA wi h Bon e oni’s pos - es was
pe o med and s a is ical signi icance is indica ed as ***P<0.001 and
ns =no signi ican . #P=0.0286 s uns imula ed cells om wild- ype mice.
(B) E ec o dexame hasone on mPGES-1 mRNA p oduc ion in J774 mu ine
mac ophages. Cells we e s imula ed wi h LPS in he p esence o absence o
dexame hasone o 24 h. mPGES-1 mRNA le els we e measu ed by
quan i a i e RT-PCR and no malized agains GAPDH mRNA le els. Resul s a e
exp essed in a bi a y uni s, mPGES-1 mRNA le els in LPS-s imula ed cells
we e se as 100 % and he o he alues we e ela ed o ha . Resul s a e
exp essed as mean +SEM, n=6–7. One-way ANOVA wi h Bon e oni’s
pos - es was pe o med and s a is ical signi icance is indica ed as
***P<0.001. (C) E ec o dexame hasone on mPGES-1 p o ein exp ession in
J774 mu ine mac ophages. Cells we e s imula ed wi h LPS in he p esence o
absence o dexame hasone o 24 h. mPGES-1 p o ein le els we e measu ed
by Wes e n blo analysis and ac in was used as a loading con ol. Resul s a e
exp essed in a bi a y uni s, mPGES-1 p o ein le els in LPS-s imula ed cells
we e se as 100% and he o he alues we e ela ed o ha . Resul s a e
exp essed as mean +SEM, n=6. One-way ANOVA wi h Bon e oni’s
pos - es was pe o med and s a is ical signi icance is indica ed as
***P<0.001. Shown is a ep esen a i e gel o six wi h simila esul s.
F on ie s in Pha macology | www. on ie sin.o g 3Sep embe 2017 | Volume 8 | A icle 646
Tuu e e al. Dexame hasone Inhibi s mPGES-1 Exp ession MKP-1-dependen ly
FIGURE 2 | Dexame hasone inhibi s mPGES-1 exp ession in acu e
in lamma o y esponse in i o in an MKP-1 dependen manne .
Dexame hasone (2 mg/kg) was gi en in ape i oneally an hou be o e LPS (50
µl o 2 mg/ml in PBS) was injec ed in o he hind paw o anes he ized mice o
induce acu e in lamma ion. The paw issues we e collec ed 6 h a e he LPS
injec ion and mPGES-1 mRNA le els we e measu ed by quan i a i e RT-PCR
and no malized agains GAPDH mRNA le els. Resul s a e exp essed in
a bi a y uni s, mPGES-1 mRNA le els in LPS ea ed paw issue om
wild- ype mice we e se as 100% and he o he alues a e ela ed o ha .
Resul s a e exp essed as mean +SEM, n=6–8. One-way ANOVA wi h
Bon e oni’s pos - es was pe o med and s a is ical signi icance is indica ed
as *P<0.05 and ns =no signi ican .
in a a io o 1:4 wi h SDS loading bu e (62.5 mM T is–
HCl, pH 6.8, 10% glyce ol, 2% SDS, 0.025% b omophenol
blue and 5% β-me cap oe hanol), and s o ed a −20◦C un il
analyzed.
Equal amoun s o p o ein (10 o 20 µg) we e loaded on a
12% SDS-polyac ylamide gel and sepa a ed by elec opho esis.
P o eins we e ans e ed o ni ocellulose memb anes by d y
elec oblo ing using iBlo gel ans e s acks and he In i ogen
iBlo De ice acco ding o he manu ac u e ’s ins uc ions. A e
ans e , he memb ane was blocked in TBS/T [20 mM T isbase
(pH 7.6), 150 mM NaCl, 0.1% Tween-20] con aining 5%
non- a milk o 1 h a oom empe a u e. Fo de ec ion o
phospho yla ed p o eins, memb anes we e blocked in TBS/T
con aining 5% BSA. Memb anes we e incuba ed o e nigh
a 4◦C wi h he p ima y an ibody and o 1 h wi h he
seconda y an ibody, and he chemiluminescen signal was
de ec ed by ImageQuan TM LAS 4000 mini (GE Heal hca e Bio-
Sciences AB, Uppsala, Sweden). The chemiluminescen signal
was quan i ied wi h ImageQuan TL 7.0 Image Analysis So wa e
(GE Heal hca e Bio-Sciences AB). Following an ibodies we e
used in he Wes e n blo analysis: mPGES-1 an ibody (AS-
03031; Ag ise a AB, Vännäs, Sweden); polyclonal goa an i- abbi
(sc-2004), ac in (sc-1616R) and JNK an ibody (#9251; San a
C uz Bio echnology, CA, USA), MKP-1 an ibody (SAB2500331;
Sigma-Ald ich Inc), p38 MAPK an ibody (ab27986; Abcam
plc., Camb idge, UK), phospho-p38 MAPK (#9211) and
phospho-JNK an ibody (#9251; Cell Signaling Technology Inc.,
Be e ly, MA, USA).
RNA Ex ac ion and Quan i a i e
Real-Time Re e se T ansc ip ion
Polyme ase Chain Reac ion (qRT-PCR)
A he indica ed ime poin s, he cul u e medium was emo ed,
and cell homogeniza ion and RNA ex ac ion was ca ied ou
by using GenElu eTM Mammalian To al RNA Minip ep Ki
acco ding o he manu ac u e ’s ins uc ion. In he case o
paw issue samples, RNA was ex ac ed wi h TRIzol eagen .
B ie ly, issue was i s homogenized in TRIzol (The mo Fishe
Scien i ic, Wal ham, MA, USA), and he ea e RNA was
ex ac ed wi h chlo o o m and p ecipi a ed wi h isop opanol,
washed wi h 75% e hanol and esuspended in RNAse ee
wa e . Re e se ansc ip ion o he RNA o cDNA was
pe o med wi h TaqMan R
Re e se T ansc ip ion Reagen s
(Applied Biosys ems, Fos e Ci y, CA, USA) in he case o J774
cells and wi h Maxima Fi s s and cDNA syn hesis ki o RT-
qPCR (The mo Fishe Scien i ic) in he case o PM cells and paw
issue.
P ime s and p obes we e pu chased om Me abion
(Ma ins ied, Ge many). Thei sequences and concen a ions
we e op imized acco ding o he manu ac u e ’s guidelines
in TaqMan Uni e sal PCR Mas e Mix P o ocol pa numbe
4304449 e ision C (Applied Biosys ems) and we e as ollows:
mouse mPGES-1 CCTGGATACATTTCCTCGTTGTC ( o wa d,
300 nM), GAAGGCGTGGGTTCAGCTT ( e e se, 300 nM),
and ACAGGCCGTGTGGTACACACCG (p obe, 150 nM);
mouse MKP-1 CTCCTGGTTCAACGAGGCTATT ( o wa d,
300 nM), TGCCGGCCTGGCAAT ( e e se, 300 nM), and
CCATCAAGGATGCTGGAGGGAGAGTGTT (p obe, 150
nM); mouse GAPDH GCATGGCCTTCCGTGTTC ( o wa d,
300 nM), GATGTCATCATACTTGGCAGGTTT ( e e se, 300
nM) and TCGTGGATCTGACGTGCCGCC (p obe, 150 nM).
Quan i a i e PCR was ca ied ou by using TaqMan Uni e sal
PCR Mas e Mix and ABI P ism 7500 sequence de ec ion
sys em (Applied Biosys ems). The PCR cycling pa ame e s we e
incuba ion a 50◦C o 2 min, incuba ion a 95◦C o 10 min,
40 cycles o dena u a ion a 95◦C o 15 s and annealing and
ex ension a 60◦C o 1 min. A s anda d cu e me hod was
used o es ima e he ela i e mRNA le els. When calcula ing he
esul s, mPGES-1 and MKP-1 mRNA le els we e i s no malized
agains GAPDH.
S a is ics
Resul s a e exp essed as mean +s anda d e o o he mean
(SEM). One-way ANOVA wi h Bon e oni’s pos - es was
pe o med using G aphPad InS a e sion 3.10 o Windows.
Di e ences we e conside ed signi ican a *P<0.05, **P<0.01
o ***P<0.001.
RESULTS
Exp ession o mPGES-1 in uns imula ed mac ophages om
MKP-1 de icien mice was ele a ed as compa ed o mac ophages
F on ie s in Pha macology | www. on ie sin.o g 4Sep embe 2017 | Volume 8 | A icle 646
Tuu e e al. Dexame hasone Inhibi s mPGES-1 Exp ession MKP-1-dependen ly
FIGURE 3 | Dexame hasone enhances MKP-1 exp ession in mac ophages. (A) E ec o dexame hasone on MKP-1 mRNA exp ession in J774 mu ine mac ophages.
Cells we e s imula ed wi h LPS in he p esence o absence o dexame hasone o 1 h. MKP-1 mRNA le els we e measu ed by quan i a i e RT-PCR and no malized
agains GAPDH mRNA le els. Resul s a e gi en in a bi a y uni s, MKP-1 mRNA le els in LPS-s imula ed cells we e se as 100% and he o he alues we e ela ed o
ha . Resul s a e exp essed as mean +SEM, n=11–12. One-way ANOVA wi h Bon e oni’s pos - es was pe o med and s a is ical signi icance is indica ed as
***P<0.001. (B) E ec o dexame hasone on MKP-1 p o ein exp ession in J774 mu ine mac ophages. Cells we e s imula ed wi h LPS in he p esence o absence o
dexame hasone o 1 h. MKP-1 p o ein le els we e measu ed by Wes e n blo analysis and ac in was used as a loading con ol. Resul s a e exp essed in a bi a y
uni s, MKP-1 p o ein le els in LPS-s imula ed cells we e se as 100% and he o he alues we e ela ed o ha . Resul s a e exp essed as mean +SEM. n=9.
One-way ANOVA wi h Bon e oni’s pos - es was pe o med and s a is ical signi icance is indica ed as ***P<0.001. Shown is a ep esen a i e gel o nine wi h simila
esul s. (C) E ec o dexame hasone on MKP-1 mRNA p oduc ion in pe i oneal mac ophages om wild- ype mice. Cells we e s imula ed wi h LPS in he p esence o
absence o dexame hasone o 1 h. MKP-1 mRNA le els we e measu ed by quan i a i e RT-PCR and no malized agains GAPDH mRNA le els. Resul s a e exp essed
in a bi a y uni s, MKP-1 mRNA le els in LPS-s imula ed cells we e se as 100% and he o he alues we e ela ed o ha . Resul s a e exp essed as mean +SEM,
n=5. One-way ANOVA wi h Bon e oni’s pos - es was pe o med and s a is ical signi icance is indica ed as ***P<0.001.
om wild- ype mice (Figu e 1A). A no iceable inc ease in
he exp ession le el was seen ollowing s imula ion wi h
LPS bo h in mouse pe i oneal mac ophages (Figu e 1A)
and in J774 mac ophage cell line (Figu es 1B,C). Incuba ion
wi h dexame hasone signi ican ly down egula ed mPGES-
1 exp ession in bo h LPS-s imula ed J774 mac ophages
(Figu es 1B,C) and in pe i oneal mac ophages om wild- ype
mice (Figu e 1A).
In con as , incuba ion wi h dexame hasone had no e ec on
LPS-induced mPGES-1 exp ession in pe i oneal mac ophages
om MKP-1 de icien mice (Figu e 1A). This sugges s ha
MKP-1 has an essen ial ole in media ing he supp ession by
dexame hasone o mPGES-1 exp ession in in lamma ion.
We nex in es iga ed whe he MKP-1 could media e he
a enua ion by dexame hasone o mPGES-1 exp ession also
unde in i o condi ions. To do his, he e ec o dexame hasone
F on ie s in Pha macology | www. on ie sin.o g 5Sep embe 2017 | Volume 8 | A icle 646

Tuu e e al. Dexame hasone Inhibi s mPGES-1 Exp ession MKP-1-dependen ly
FIGURE 4 | Dexame hasone inhibi s he phospho yla ion o MAP kinases p38
and JNK in ac i a ed J774 mac ophages. (A) E ec o dexame hasone on p38
phospho yla ion. J774 mac ophages we e p eincuba ed wi h dexame hasone
o 1 h and s imula ed wi h LPS o 30 min. p38 and phospho yla ed p38
(pp38) p o ein le els we e measu ed by Wes e n blo analysis and he le els o
(Con inued)
FIGURE 4 | Con inued
phospho yla ed p38 we e no malized agains he le els o o al p38. Resul s
a e exp essed in a bi a y uni s, phospho yla ed p38 le els in LPS-s imula ed
cells we e se as 100% and he o he alues we e ela ed o ha . Resul s a e
exp essed as mean +SEM, n=4. One-way ANOVA wi h Bon e oni’s
pos - es was pe o med and s a is ical signi icance is indica ed as
***P<0.001 and ns =no signi ican . Shown is a ep esen a i e gel o ou
wi h simila esul s. (B) E ec o dexame hasone on JNK phospho yla ion.
J774 mac ophages we e p eincuba ed wi h dexame hasone o 1 h and
s imula ed wi h LPS o 30 min. JNK and phospho yla ed JNK (pJNK) p o ein
le els we e measu ed by Wes e n blo analysis and he le els o
phospho yla ed JNK we e no malized agains he le els o o al JNK. Resul s
a e exp essed in a bi a y uni s, phospho yla ed JNK le els in LPS-s imula ed
cells we e se as 100% and he o he alues we e ela ed o ha . Resul s a e
exp essed as mean +SEM, n=6. One-way ANOVA wi h Bon e oni’s
pos - es was pe o med and s a is ical signi icance is indica ed as **P<0.01,
***P<0.001 and ns =no signi ican . Shown is a ep esen a i e gel o six wi h
simila esul s.
ea men on mPGES-1 exp ession in paw in lamma ion in wild-
ype and MKP-1 de icien mice was examined. Dexame hasone,
in a dose (2 mg/kg in ape i oneally) ha inhibi ed he
concu en paw edema (by 44%; P<0.05) in wild- ype bu
no in MKP-1 de icien mice, signi ican ly educed mPGES-
1 exp ession in LPS- ea ed paw issue in wild- ype mice. In
suppo o he in i o da a, dexame hasone had no e ec
on mPGES-1 exp ession le els in he paw issue in MKP-
1 de icien mice (Figu e 2). To con i m ha dexame hasone
could s imula e MKP-1 exp ession in mac ophages, MKP-1
mRNA and p o ein le els in J774 cells we e measu ed. MKP-
1 exp ession was low in uns imula ed cells bu i was inc eased
by LPS. Fu he mo e, dexame hasone enhanced MKP-1 mRNA
(Figu e 3A) and p o ein (Figu e 3B) le els in J774 mac ophages
bo h in he absence and in he p esence o LPS. Dexame hasone
likewise enhanced MKP-1 exp ession in uns imula ed and
LPS-s imula ed pe i oneal mac ophages om wild- ype mice
(Figu e 3C).
Because MKP-1 has been epo ed o inac i a e p38 and JNK
MAP kinases h ough dephospho yla ion (F anklin and K a ,
1997; F anklin e al., 1998; Kassel e al., 2001; Ab aham e al.,
2006; Chi e al., 2006; Zhao e al., 2006; Tu peinen e al., 2010,
2011; Comalada e al., 2012), he e ec s o dexame hasone on he
le els o phospho yla ed p38 and JNK in ac i a ed mac ophages
we e in es iga ed. Exposu e o LPS caused a apid inc ease in p38
and JNK phospho yla ion in J774 mac ophages (Figu es 4A,B)
and in mouse pe i oneal mac ophages (Figu es 5A,B). This e ec
was educed by dexame hasone in J774 cells (Figu es 4A,B) and
in pe i oneal mac ophages om wild- ype mice (Figu es 5A,B).
The ole o MKP-1 in he dexame hasone e ec was con i med by
he inding ha dexame hasone did no educe he LPS-enhanced
le els o phospho yla ed p38 (Figu e 5A) o JNK (Figu e 5B) in
pe i oneal mac ophages om MKP-1 de icien mice.
Fu he mo e, he JNK inhibi o SP600125 (Benne e al.,
2001; Nieminen e al., 2006) bu no he p38 inhibi o SB203580
(Cuenda e al., 1995; Shi e al., 2015) educed LPS-induced
mPGES-1 exp ession in a manne compa able o ha o
dexame hasone (Figu es 6A,B).
Toge he , hese da a sugges ha dexame hasone educes
mPGES-1 exp ession in classically ac i a ed mac ophages in
F on ie s in Pha macology | www. on ie sin.o g 6Sep embe 2017 | Volume 8 | A icle 646
Tuu e e al. Dexame hasone Inhibi s mPGES-1 Exp ession MKP-1-dependen ly
FIGURE 5 | Dexame hasone inhibi s he phospho yla ion o MAP kinases p38
and JNK in ac i a ed mac ophages in an MKP-1 dependen manne . (A) E ec
o dexame hasone on p38 phospho yla ion. Pe i oneal mac ophages om
wild- ype and MKP-1 knock-ou (KO) mice we e p eincuba ed wi h
dexame hasone o 1 h and s imula ed wi h LPS o 30 min. p38 and
phospho yla ed p38 (pp38) p o ein le els we e measu ed by Wes e n blo and
he le els o phospho yla ed p38 we e no malized agains he le els o o al
p38. Resul s a e exp essed in a bi a y uni s, phospho yla ed p38 le els in
LPS-s imula ed cells we e se as 100 % and he o he alues we e ela ed o
ha . Resul s a e exp essed as mean +SEM, n=9. One-way ANOVA wi h
Bon e oni’s pos - es was pe o med and s a is ical signi icance is indica ed
as ***P<0.001 and ns =no signi ican . Shown is a ep esen a i e gel o nine
wi h simila esul s. (B) E ec o dexame hasone on JNK phospho yla ion.
Pe i oneal mac ophages om wild- ype and MKP-1 knock-ou (KO) mice we e
p e-incuba ed wi h dexame hasone o 1 h and s imula ed wi h LPS o
30 min. JNK and phospho yla ed JNK (pJNK) p o ein le els we e measu ed by
Wes e n blo analysis and he le els o phospho yla ed JNK we e no malized
agains he le els o o al JNK. Resul s a e exp essed in a bi a y uni s,
phospho yla ed JNK le els in LPS-s imula ed cells we e se as 100% and he
o he alues we e ela ed o ha . Resul s a e exp essed as mean +SEM,
n=5. One-way ANOVA wi h Bon e oni’s pos - es was pe o med and
s a is ical signi icance is indica ed as ***P<0.001 and ns =no signi ican .
Shown is a ep esen a i e gel o i e wi h simila esul s.
FIGURE 6 | JNK inhibi o SP600125 inhibi s he exp ession o mPGES-1 in
ac i a ed mac ophages. (A) E ec s o a JNK inhibi o (SP600125), a p38
inhibi o (SB203580) and dexame hasone on mPGES-1 mRNA p oduc ion in
J774 mu ine mac ophages. Cells we e incuba ed wi h LPS and he
compounds unde in es iga ion o 24 h. mPGES-1 mRNA le els we e
measu ed by quan i a i e RT-PCR and no malized agains GAPDH mRNA
(Con inued)
F on ie s in Pha macology | www. on ie sin.o g 7Sep embe 2017 | Volume 8 | A icle 646
Tuu e e al. Dexame hasone Inhibi s mPGES-1 Exp ession MKP-1-dependen ly
FIGURE 6 | Con inued
le els. Resul s a e exp essed in a bi a y uni s, mPGES-1 mRNA le els in
LPS-s imula ed cells we e se as 100% and he o he alues we e ela ed o
ha . Resul s a e exp essed as mean +SEM, n=6–7. One-way ANOVA wi h
Bon e oni’s pos - es was pe o med and s a is ical signi icance is indica ed
as ***P<0.001 and ns =no signi ican . (B) E ec s o a JNK inhibi o
(SP600125), a p38 inhibi o (SB203580) and dexame hasone on mPGES-1
p o ein exp ession in J774 mu ine mac ophages. Cells we e s imula ed wi h
LPS and he compounds unde in es iga ion o 24 h. mPGES-1 p o ein le els
we e measu ed by Wes e n blo analysis and ac in was used as a loading
con ol. Resul s a e exp essed in a bi a y uni s, mPGES-1 p o ein le els in
LPS-s imula ed cells we e se as 100% and he o he alues we e ela ed o
ha . Resul s a e exp essed as mean +SEM, n=5–6. One-way ANOVA wi h
Bon e oni’s pos - es was pe o med and s a is ical signi icance is indica ed
as ***P<0.001, **P<0.01 and ns =no signi ican . Shown is a
ep esen a i e gel o i e wi h simila esul s.
a manne dependen on enhanced MKP-1 exp ession and
subsequen ly educed JNK phospho yla ion.
DISCUSSION
Mic osomal p os aglandin E syn hase-1 is an inducible
in lamma o y enzyme, he exp ession o which has been epo ed
o be inhibi ed by glucoco icoids (S ich eno h e al., 2001; Tuu e
e al., 2015). The p esen s udy ex ends he p e ious da a by
showing ha he glucoco icoid e ec on mPGES-1 is media ed
h ough enhanced exp ession o he egula o y phospha ase
MKP-1 and subsequen dephospho yla ion o he MAP kinase
JNK in in lamma o y condi ions.
MKP-1 de icien mice ha e a no mal pheno ype in es ing
condi ions bu hey de elop enhanced esponses in in lamma o y
s a es. Fo example, hey ha e impai ed ole ance agains
bac e ial endo oxin and when exposed o LPS, signi ican ly
highe le els o cy okines and o he in lamma o y ac o s a e
eleased and he in lamma o y esponse is much mo e se e e
as compa ed o wild- ype con ols (Chi e al., 2006; Hamme
e al., 2006; Zhao e al., 2006; Ko honen e al., 2011; Tu peinen
e al., 2011). Those indings suppo a signi ican ole o MKP-
1 as an endogenous ac o egula ing and limi ing excessi e
in lamma o y esponses and as a po en ial a ge o be inc eased
wi h an i-in lamma o y ea men s. In he p esen expe imen s
wi h cells om wild- ype and MKP-1 de icien mice, we ound
ha MKP-1 media es he supp ession by dexame hasone o
mPGES-1 exp ession in ac i a ed mac ophages. This e ec was
also ansla ed o in i o condi ions, as dexame hasone educed
mPGES-1 exp ession in in lamed paw issue in wild- ype bu
no in MKP-1 de icien mice. Dexame hasone also supp essed
in lamma o y edema in wild- ype bu no in MKP-1 de icien
mice. Al hough his is dependen on se e al in lamma o y ac o s
(Naidu e al., 2010; Za e al., 2014; Chen e al., 2016), he educed
mPGES-1 exp ession may con ibu e o he an i-in lamma o y
e ec o dexame hasone because mPGES-1 inhibi o s ha e been
epo ed o a enua e in lamma o y paw edema in expe imen al
models (Koebe le e al., 2009; Siemonei e al., 2011).
In addi ion o i s supp essi e e ec on mPGES-1,
dexame hasone augmen ed he exp ession o MKP-1 when
in oduced o wild- ype cells in he absence o in he p esence
o LPS, as shown also ea lie (Ab aham e al., 2006; Shipp e al.,
2010; Zhu e al., 2010; P abhala e al., 2016; Ke änen e al., 2017).
MKP-1 is an ea ly esponse gene, he exp ession o which is
ansien ly inc eased ollowing exposu e o in lamma o y and
cellula s ess ac o s (Owens and Keyse, 2007; Bou os e al.,
2008; Caun and Keyse, 2013). In addi ion, MKP-1 p omo e
con ains glucoco icoid esponsi e elemen s (Shipp e al., 2010)
indica ing ha glucoco icoids may di ec ly enhance MKP-1
ansc ip ion. MKP-1 exp ession is also egula ed by a ious
pos - ansc ip ional mechanisms (Wong e al., 2005; Kuwano
e al., 2008; Ko honen and Moilanen, 2014). As glucoco icoids
ha e been shown no only o enhance bu also o p olong MKP-1
exp ession (Ke änen e al., 2017), hey may egula e MKP-1 gene
exp ession a pos - ansc ip ional le el in addi ion o hei di ec
ansc ip ional e ec .
MKP-1 egula es he in lamma o y esponses by inac i a ing
MAP kinases p38 and JNK h ough dephospho yla ion (F anklin
and K a , 1997; F anklin e al., 1998; Chi e al., 2006;
Zhao e al., 2006; Tu peinen e al., 2010, 2011; Comalada
e al., 2012). The e o e, i is in e es ing ha dexame hasone
was ound o educe p38 and JNK phospho yla ion in wild-
ype bu no in MKP-1 de icien mac ophages exposed o
in lamma o y s imulus. In suppo o ou da a, Ab aham
and co-wo ke s epo ed ha dexame hasone inhibi s p38
and JNK phospho yla ion in mu ine bone-ma ow de i ed
mac ophages (Ab aham e al., 2006), whe eas in ano he s udy
dexame hasone was ound o down egula e p38 bu no JNK
o ERK phospho yla ion (Bha acha yya e al., 2007). These
indings show ha he glucoco icoid-induced enhancemen in
MKP-1 exp ession has unc ional consequences a he le el o
educed MAP kinase phospho yla ion, which is likely o esul
in deac i a ion o hese in lamma o y pa hways possibly by a
cell- ype dependen manne .
The p esen indings p o ide suppo o MAP kinase JNK
being a seminal downs eam ac o egula ing he exp ession
o mPGES-1 unde in lamma o y condi ions in mac ophages:
dexame hasone was ound o educe he phospho yla ion o bo h
p38 and JNK kinases along wi h i s s imula o y e ec on MKP-
1 exp ession. Howe e , he JNK inhibi o bu no p38 inhibi o
a enua ed he exp ession o mPGES-1. Tha is suppo ed by
he indings in human gingi al ib oblas s (Yucel-Lindbe g
e al., 2006; Båge e al., 2010), in a neona al ca diomyocy es
(Degousee e al., 2006) and in mu ine mic oglial cells (de Oli ei a
e al., 2008; He e al., 2016) in which JNK was ound o be in ol ed
in he egula ion o mPGES-1 exp ession. The e ec may be cell
ype dependen because in human os eoa h i ic chond ocy es
s imula ed wi h IL-1β, MAP kinases p38 and ERK had a c ucial
ole in he egula ion o mPGES-1 exp ession, whe eas JNK was
insigni ican (Masuko-Hongo e al., 2004).
In in lamma ion, a ious p o-in lamma o y cy okines and
bac e ial p oduc s a e known o enhance mPGES-1 exp ession.
The ansc ip ional mechanisms a e no known in de ail, bu
ea ly g ow h esponse p o ein 1 (EGR-1) and nuclea ac o
kappa B (NF-kB) ha e been iden i ied as key ansc ip ion ac o s
o mPGES-1 (Koebe le and We z, 2015). Ac i a o p o ein 1
(AP-1) is one o he addi ional ac o s epo ed o be in ol ed
F on ie s in Pha macology | www. on ie sin.o g 8Sep embe 2017 | Volume 8 | A icle 646
Tuu e e al. Dexame hasone Inhibi s mPGES-1 Exp ession MKP-1-dependen ly
in he ansc ip ional ac i a ion o mPGES-1 (Moon e al., 2005;
Jungel e al., 2007). This obse a ion is ele an in he ligh o he
p esen esul s because AP-1 is ac i a ed by JNK. Exp ession o
mPGES-1 may also be egula ed by JNK a pos - ansc ip ional
le el as a JNK inhibi o has been ound o des abilize mPGES-1
mRNA and educe mPGES-1 p o ein le els in mu ine neona al
ca diomyocy es (Degousee e al., 2006). Howe e , addi ional
s udies a e needed o cla i y he de ailed mechanisms o how JNK
egula es mPGES-1 exp ession.
In conclusion, dexame hasone was ound o down- egula e
mPGES-1 exp ession in classically ac i a ed mac ophages
h ough inc eased exp ession o he egula o y phospha ase
MKP-1 and subsequen ly dec eased phospho yla ion o he MAP
kinase JNK. These esul s ex end he p e ious unde s anding
o he molecula mechanisms egula ing mPGES-1 exp ession
in in lamma o y condi ions. The indings also highligh he
po en ial o MKP-1 as an an i-in lamma o y d ug a ge .
AUTHOR CONTRIBUTIONS
LT was in ol ed in he concep ion and design o he s udy,
labo a o y and s a is ical analyses, analysis and in e p e a ion o
he da a and d a ed he manusc ip . MH con ibu ed o he
concep ion and design o he s udy, labo a o y analyses, animal
expe imen s, analysis and in e p e a ion o he da a and in he
w i ing o he manusc ip . BW con ibu ed o he analysis and
in e p e a ion o he da a and in he w i ing o he manusc ip .
EM supe ised he s udy and con ibu ed o he concep ion and
design o he s udy, in he analysis and in e p e a ion o he da a
and in he w i ing o he manusc ip . All au ho s app o ed he
inal e sion o he manusc ip .
FUNDING
This s udy was suppo ed by g an s om he compe i i e
esea ch unding o he Pi kanmaa Hospi al Dis ic , Finland;
O ion Resea ch Founda ion, Finland; Resea ch Founda ion
o Rheuma ic Diseases, Finland and Pa ien O ganiza ion o
Rheuma oid A h i is (Tampe een Reumayhdis ys y), Finland.
ACKNOWLEDGMENTS
We wish o hank M s Salla Hie akangas o excellen echnical
assis ance and M s. Heli Mää ä o skil ul sec e a ial help.
REFERENCES
Ab aham, S. M., Law ence, T., Kleiman, A., Wa den, P., Medghalchi, M.,
Tucke mann, J., e al. (2006). An iin lamma o y e ec s o dexame hasone a e
pa ly dependen on induc ion o dual speci ici y phospha ase 1. J. Exp. Med.
203, 1883–1889. doi: 10.1084/jem.20060336
Ashwell, J. D. (2006). The many pa hs o p38 mi ogen-ac i a ed p o ein
kinase ac i a ion in he immune sys em. Na . Re . Immunol. 6, 532–540.
doi: 10.1038/n i1865
Båge, T., Lindbe g, J., Lundebe g, J., Modee , T., and Yucel-Lindbe g, T.
(2010). Signal pa hways JNK and NF-κB, iden i ied by global gene
exp ession p o iling, a e in ol ed in egula ion o TNFalpha-induced mPGES-
1 and COX-2 exp ession in gingi al ib oblas s. BMC Genomics 11:241.
doi: 10.1186/1471-2164-11-241
Benne , B. L., Sasaki, D. T., Mu ay, B. W., O’Lea y, E. C., Saka a, S.
T., Xu, W., e al. (2001). SP600125, an an h apy azolone inhibi o o
Jun N- e minal kinase. P oc. Na l. Acad. Sci. U.S.A. 98, 13681–13686.
doi: 10.1073/pnas.251194298
Bha acha yya, S., B own, D. E., B ewe , J. A., Vog , S. K., and Muglia, L. J. (2007).
Mac ophage glucoco icoid ecep o s egula e Toll-like ecep o 4-media ed
in lamma o y esponses by selec i e inhibi ion o p38 MAP kinase. Blood 109,
4313–4319. doi: 10.1182/blood-2006-10-048215
Bou os, T., Che e , E., and Me akos, P. (2008). Mi ogen-ac i a ed p o ein
(MAP) kinase/MAP kinase phospha ase egula ion: oles in cell g ow h,
dea h, and cance . Pha macol. Re . 60, 261–310. doi: 10.1124/p .107.
00106
Caun , C. J., and Keyse, S. M. (2013). Dual-speci ici y MAP kinase phospha ases
(MKPs): shaping he ou come o MAP kinase signalling. FEBS J. 280, 489–504.
doi: 10.1111/j.1742-4658.2012.08716.x
Chand asekha , S., Ha ey, A. K., Yu, X. P., Chambe s, M. G., Oskins, J. L.,
Lin, C., e al. (2016). Iden i ica ion and cha ac e iza ion o no el mic osomal
p os aglandin E syn hase-1 inhibi o s o analgesia. J. Pha macol. Exp. The .
356, 635–644. doi: 10.1124/jpe .115.228932
Chang, H. H., and Meuille , E. J. (2011). Iden i ica ion and de elopmen o
mPGES-1 inhibi o s: whe e we a e a ? Fu u e Med. Chem. 3, 1909–1934.
doi: 10.4155/ mc.11.136
Chen, C. C., Lin, M. W., Liang, C. J., and Wang, S. H. (2016).
The an i-in lamma o y e ec s and mechanisms o eupa olin in
lipopolysaccha ide-induced in lamma o y esponses in RAW264.7
mac ophages. PLoS ONE 11:e0158662. doi: 10.1371/jou nal.pone.0158662
Cheng, Y., Wang, M., Yu, Y., Lawson, J., Funk, C. D., and Fi zge ald, G. A. (2006).
Cyclooxygenases, mic osomal p os aglandin E syn hase-1, and ca dio ascula
unc ion. J. Clin. In es . 116, 1391–1399. doi: 10.1172/JCI27540
Chi, H., Ba y, S. P., Ro h, R. J., Wu, J. J., Jones, E. A., Benne , A. M., e al.
(2006). Dynamic egula ion o p o- and an i-in lamma o y cy okines by MAPK
phospha ase 1 (MKP-1) in inna e immune esponses. P oc. Na l. Acad. Sci.
U.S.A. 103, 2274–2279. doi: 10.1073/pnas.0510965103
Comalada, M., Llobe as, J., and Celada, A. (2012). MKP-1: a c i ical phospha ase
in he biology o mac ophages con olling he swi ch be ween p oli e a ion and
ac i a ion. Eu . J. Immunol. 42, 1938–1948. doi: 10.1002/eji.201242441
Coulombe, F., Jawo ska, J., Ve way, M., Tzelepis, F., Massoud, A., Gilla d,
J., e al. (2014). Ta ge ed p os aglandin E2 inhibi ion enhances an i i al
immuni y h ough induc ion o ype I in e e on and apop osis in
mac ophages. Immuni y 40, 554–568. doi: 10.1016/j.immuni.2014.
02.013
Cuenda, A., Rouse, J., Doza, Y. N., Meie , R., Cohen, P., Gallaghe , T. F., e al.
(1995). SB 203580 is a speci ic inhibi o o a MAP kinase homologue which
is s imula ed by cellula s esses and in e leukin-1. FEBS Le . 364, 229–233.
doi: 10.1016/0014-5793(95)00357-F
Coxib and adi ional, NSAID T ialis s’ (CNT) Collabo a ion, Bhala, N.,
Embe son, J., Me hi, A., Ab amson, S., A be , N., e al. (2013). Vascula and
uppe gas oin es inal e ec s o non-s e oidal an i-in lamma o y d ugs: me a-
analyses o indi idual pa icipan da a om andomised ials. Lance 382,
769–779. doi: 10.1016/S0140-6736(13)60900-9
Degousee, N., Angoul an , D., Fazel, S., S e anski, E., Saha, S., Iliescu, K., e al.
(2006). c-Jun N- e minal kinase-media ed s abiliza ion o mic osomal
p os aglandin E2 syn hase-1 mRNA egula es delayed mic osomal
p os aglandin E2 syn hase-1 exp ession and p os aglandin E2 biosyn hesis
by ca diomyocy es. J. Biol. Chem. 281, 16443–16452. doi: 10.1074/jbc.M6028
15200
de Oli ei a, A. C., Candela io-Jalil, E., Bha ia, H. S., Lieb, K., Hull, M., and Fiebich,
B. L. (2008). Regula ion o p os aglandin E2 syn hase exp ession in ac i a ed
p ima y a mic oglia: e idence o uncoupled egula ion o mPGES-1 and
COX-2. Glia 56, 844–855. doi: 10.1002/glia.20658
F anklin, C. C., and K a , A. S. (1997). Condi ional exp ession o he mi ogen-
ac i a ed p o ein kinase (MAPK) phospha ase MKP-1 p e e en ially inhibi s
F on ie s in Pha macology | www. on ie sin.o g 9Sep embe 2017 | Volume 8 | A icle 646