Microsomal Prostaglandin E Synthase-1 Expression in Inflammatory Conditions Is Downregulated by Dexamethasone: Seminal Role of the Regulatory Phosphatase MKP-1

ORIGINAL RESEARCH published: 21 Sep embe 2017 doi: 10.3389/ pha .2017.00646 F on ie s in Pha macology | www. on ie sin.o g 1Sep embe 2017 | Volume 8 | A icle 646 Edi ed by: Emanuela Riccio i, Uni e si y o Pennsyl ania, Uni ed S a es Re iewed by: Sabine G ösch, Goe he Uni e si y F ank u , Ge many Ma ina Ko o ko a, Ka olinska Ins i u e (KI), Sweden B ian G ego y Geo ge Oli e , Uni e si y o Technology, Sydney, Aus alia *Co espondence: Ee a Moilanen [email p o ec ed] Special y sec ion: This a icle was submi ed o In lamma ion Pha macology, a sec ion o he jou nal F on ie s in Pha macology Recei ed: 22 June 2017 Accep ed: 31 Augus 2017 Published: 21 Sep embe 2017 Ci a ion: Tuu e L, Hämäläinen M, Whi le BJ and Moilanen E (2017) Mic osomal P os aglandin E Syn hase-1 Exp ession in In lamma o y Condi ions Is Down egula ed by Dexame hasone: Seminal Role o he Regula o y Phospha ase MKP-1. F on . Pha macol. 8:646. doi: 10.3389/ pha .2017.00646 Mic osomal P os aglandin E Syn hase-1 Exp ession in In lamma o y Condi ions Is Down egula ed by Dexame hasone: Seminal Role o he Regula o y Phospha ase MKP-1 Lau i Tuu e 1, Ma i Hämäläinen 1, B endan J. Whi le 1, 2 and Ee a Moilanen 1 * 1The Immunopha macology Resea ch G oup, Facul y o Medicine and Li e Sciences, Uni e si y o Tampe e, Tampe e Uni e si y Hospi al, Tampe e, Finland, 2William Ha ey Resea ch Ins i u e, Ba s and he London School o Medicine, London, Uni ed Kingdom Mic osomal p os aglandin E syn hase-1 (mPGES-1) is an inducible enzyme si ua ed downs eam o cyclo-oxygenase-2, p omo ing he excessi e PGE2p oduc ion in in lamma ion. Dexame hasone is known o supp ess mPGES-1 bu he mechanisms egula ing mPGES-1 exp ession emain poo ly known. MKP-1 is a phospha ase con olling he p oin lamma o y MAP kinase pa hways p38 and JNK, hus limi ing he in lamma o y esponses. We ha e now in es iga ed he ole o MKP-1 and MAP kinases p38 and JNK in he egula ion o mPGES-1 exp ession by dexame hasone. Dexame hasone inc eased MKP-1 and dec eased mPGES-1 exp ession in J774 mac ophages and in pe i oneal mac ophages om wild- ype bu no om MKP-1 de icien mice. Dexame hasone also educed p38 and JNK phospho yla ion along wi h enhancemen o MKP-1, while inhibi ion o JNK educed mPGES-1 exp ession. These indings we e also ansla ed o in i o condi ions as dexame hasone down egula ed mPGES-1 exp ession in paw in lamma ion in wild- ype bu no in MKP-1 de icien mice. In conclusion, dexame hasone was ound o down egula e mPGES-1 exp ession h ough enhanced MKP-1 exp ession and educed JNK phospho yla ion in in lamma o y condi ions. The esul s ex end he unde s anding on he egula ion o mPGES-1 exp ession and highligh he po en ial o MKP-1 as an an i-in lamma o y d ug a ge . Keywo ds: mPGES-1, p os aglandins, MAP kinases, MKP-1, JNK INTRODUCTION Mic osomal p os aglandin E syn hase-1 (mPGES-1) is a e minal enzyme ca alyzing he syn hesis o p os aglandin E2(PGE2), an essen ial p os anoid linked o pa hophysiological condi ions, such as in lamma ion, pain, e e and umo igenesis (Samuelsson e al., 2007; S ables and Gil oy, 2011; Coulombe e al., 2014; Ruan and So, 2014; Koebe le and We z, 2015). Two o he PGE2 syn hesizing enzymes ha e been cha ac e ized so a , namely mic osomal p os aglandin E syn hase- 2 (mPGES-2) and cy osolic p os aglandin E syn hase (cPGES). Cons i u i ely exp essed mPGES-2 Tuu e e al. Dexame hasone Inhibi s mPGES-1 Exp ession MKP-1-dependen ly and cPGES a e p esumed o be esponsible o physiological PGE2 o ma ion, whe eas mPGES-1 is an inducible enzyme, he exp ession o which is induced unde in lamma o y condi ions in a ious cells and issues (Samuelsson e al., 2007). The an i-in lamma o y e ec s o non-s e oidal an i- in lamma o y d ugs (NSAIDs) a e conside ed o be based p edominan ly on educed o ma ion o PGE2due o inhibi ion o cyclo-oxygenase (COX) enzymes. Howe e , he known ad e se e ec s o NSAIDs, such as gas oin es inal, ca dio ascula and enal p oblems a e also linked o he same mechanism o ac ion, ha is, inhibi ion o cyclo-oxygenases, es ic ing he use o NSAIDs among many pa ien g oups. Fo example, he inc eased isk o myoca dial in a c ion may in pa e lec he educed o ma ion o p os acyclin (p os aglandin I2, PGI2) ollowing inhibi ion o COX-2 in he ascula wall, while mucosal e osions and bleedings in he gas oin es inal ack a e conside ed o esul om dec eased o ma ion o p o ec i e physiological p os anoids a e inhibi ion o COX enzymes (Cheng e al., 2006; G osse e al., 2010; Coxib and adi ional, NSAID T ialis s’ (CNT) Collabo a ion, e al., 2013). Such obse a ions could indica e ha mPGES-1 is he e o e a po en ial d ug a ge o ea ing in lamma o y condi ions and pain by selec i ely dec easing PGE2p oduc ion unde in lamma o y condi ions. An inhibi o o mPGES-1 ac i i y o exp ession could hus lead o a selec i e dec ease o excessi e PGE2 o ma ion du ing in lamma ion since he syn hesis o o he p os anoids a e no educed simila ly, as unde he ea men wi h NSAIDs; u he mo e, he cons i u i e PGE2syn hesis h ough mPGES-2 and cPGES emains unchanged. Mo eo e , i has been epo ed ha gene ic dele ion o pha macological inhibi ion o mPGES-1 may also lead o an inc eased p oduc ion o p os anoids exhibi ing an i-in lamma o y p ope ies (Idbo g e al., 2013) and possibly modula e pla ele unc ion du ing in lamma ion (Raou e al., 2016). O e all, inhibi ion o mPGES- 1 may he e o e esul in he apeu ic ac i i y compa able o NSAIDs bu wi h less ad e se e ec s (Samuelsson e al., 2007; Ko o ko a and Jakobsson, 2013; Koebe le and We z, 2015). Inhibi o s o mPGES-1 ac i i y a e indeed unde de elopmen . Recen ly, a phase I ial wi h he selec i e mPGES-1 inhibi o LY3023703 indica ed a dec eased le el o a u ina y me aboli e o PGE2 o an ex en compa able o ha caused by he COX-2 inhibi o celecoxib. In addi ion, a mo e a o able e ec on he p oduc ion o p os anoids o he han PGE2was ound (Jin e al., 2015). De elopmen o mPGES-1 inhibi o s cu en ly appea s o be ocused on molecules a ec ing he ac i i y o mPGES-1 and subsequen PGE2p oduc ion (Chang and Meuille , 2011; Ko o ko a and Jakobsson, 2013; Koebe le and We z, 2015; Chand asekha e al., 2016; Gup a and Apa oy, 2016; Koebe le e al., 2016). Howe e , as p esen ed in his s udy, an al e na i e app oach migh be o ocus on he down egula ion o he exp ession o mPGES-1 a he han di ec ly a ec ing he ac i i y o he enzyme. Mi ogen ac i a ed p o ein (MAP) kinases, namely ex acellula signal- egula ed kinase (ERK), p38 MAP-kinase and c-Jun N- e minal kinase (JNK), egula e he cellula esponse o a ious ex acellula in lamma o y s imuli (Johnson and Lapada , 2002; Raman e al., 2007). These enzymes a e ac i a ed by phospho yla ion and play an essen ial ole in he p omo ion o in lamma o y esponses and inna e immune sys em (K ame e al., 1996; Ashwell, 2006; Rincon and Da is, 2009; Plo niko e al., 2011; Ko honen and Moilanen, 2014). Mi ogen-ac i a ed p o ein kinase phospha ases (MKPs) inac i a e MAP kinases h ough dephospho yla ion and o m a nega i e eedback sys em o he ac i i y o MAP kinases, hus con olling and limi ing he in lamma o y eac ion and inna e immune esponses (Chi e al., 2006; Hamme e al., 2006; Zhao e al., 2006; Wang and Liu, 2007; Li e al., 2009; Wancke e al., 2012). MKP-1 is he mos s udied o MKP enzymes and i has been shown o dephospho yla e MAP kinases p38 and / o JNK, depending on he cell ype, and he eby dec easing he exp ession o many MAP kinase-dependen p o-in lamma o y ac o s (F anklin and K a , 1997; F anklin e al., 1998; Chi e al., 2006; Zhao e al., 2006; Tu peinen e al., 2010, 2011; Comalada e al., 2012). MKP-1 has been iden i ied as a media o o some an i-in lamma o y e ec s o d ugs such as he glucoco icoids, he an i- heuma ic d ug au o hiomala e, phosphodies e ase 4 inhibi o s (Kassel e al., 2001; Ab aham e al., 2006; Nieminen e al., 2010; Shipp e al., 2010; Ko honen e al., 2013; Ke änen e al., 2017) and ecen ly, also β2-agonis s (Ke änen e al., 2016). In addi ion, in lamma o y esponses ha e been ound o be mo e se e e and e en le hal in MKP-1 knock-ou mice as compa ed o wild- ype con ols (Chi e al., 2006; Zhao e al., 2006; F azie e al., 2009; Ko honen e al., 2011, 2013), emphasizing he ole o MKP-1 as a limi ing ac o in in lamma ion. Mechanisms egula ing he exp ession o mPGES-1 a e no ully known, bu one o he ew d ugs ound o inhibi he exp ession o mPGES-1 is he glucoco icoid dexame hasone (S ich eno h e al., 2001), known also o enhance he exp ession o MKP-1 (Kassel e al., 2001; Ab aham e al., 2006; Shipp e al., 2010). The e o e, we es ed he hypo hesis ha dexame hasone inhibi s he exp ession o mPGES-1 ia an ele a ed MKP-1 exp ession and subsequen dephospho yla ion o MAP kinases, by using he J774 mac ophage cell line and con i med he indings by using pe i oneal mac ophages om MKP-1 de icien and co esponding wild- ype mice. To e alua e he signi icance o hese indings in i o, he e ec s o dexame hasone on he exp ession o mPGES-1 in mouse paw in lamma ion in MKP-1 de icien and co esponding wild- ype mice was also s udied. MATERIALS AND METHODS Ma e ials Dexame hasone was ecei ed om O ion Co p. (Espoo, Finland). Lipopolysaccha ide (LPS) om Esche ichia coli s ain 0111:B4 and all o he eagen s we e pu chased om Sigma- Ald ich Inc. (S . Louis, MO, USA) unless o he wise s a ed. Animals Wild- ype and MKP-1(-/-) C57BL/6 mice o iginally gene a ed in he labo a o y o R. B a o a B is ol-Mye s Squibb Pha maceu ical Resea ch Ins i u e (P ince on, NJ, USA) we e used in he p esen s udy. Mice we e b ed a he animal acili es in Facul y o Medicine and Li e Sciences, Uni e si y o Tampe e unde s anda d condi ions (12:12 ligh -da k cycle, F on ie s in Pha macology | www. on ie sin.o g 2Sep embe 2017 | Volume 8 | A icle 646 Tuu e e al. Dexame hasone Inhibi s mPGES-1 Exp ession MKP-1-dependen ly +22 ±1◦C empe a u e, 50–60% humidi y), and ood and wa e p o ided ad libi um. Animal expe imen s we e ca ied ou in acco dance wi h he legisla ion o he p o ec ion o animals used o scien i ic pu poses (Di ec i e 2010/63/EU), and he s udy was app o ed by he Na ional Animal Expe imen Boa d. Lipopolysaccha ide-Induced Paw Edema Lipopolysaccha ide [50 µl o 2 mg/ml in phospha e-bu e ed saline (PBS)] was injec ed in o he hind paw o anes he ized mice (0.5 mg/kg, Domi o R ; O ion Oyj, Espoo, Finland, and 75 mg/kg, Ke ala R ; P ize Oy Animal Heal h, Helsinki, Finland). The con ala e al paw was injec ed wi h he co esponding olume o endo oxin- ee PBS. Mice we e ea ed 1 h p io o he injec ion o LPS wi h dexame hasone (2 mg/kg in ape i oneally) o wi h ehicle (PBS). Paw olumes we e measu ed up o 6 h wi h a ple hysmome e (Ugo Basile, Come io, I aly) and compa ed o he baseline alue. A e he las measu emen mice we e sac i ied (ce ical disloca ion) and paw issues we e collec ed in o RNA La e solu ion (In i ogen, Ca lsbad, CA, USA). Cell Cul u e J774 mouse mac ophages (Ame ican Type Cul u e Collec ion, Rock ille Pike, MD, USA ) we e cul u ed a +37◦C in 5% CO2 a mosphe e in Dulbecco’s Modi ied Eagle’s medium (DMEM, In i ogen, Paisley, UK) con aining 10% ( / ) hea -inac i a ed e al bo ine se um (FBS), 100 U/ml penicillin, 100 µg/ml s ep omycin and 250 ng/ml ampho e icin B (all om Gibco, Wien, Aus ia). Cells (2.5 ×105pe well) we e seeded on 24-well pla es and he cell monolaye s we e g own o 72 h p io o he expe imen s. SP600125 and SB203580 we e dissol ed in dime hyl sul oxide (DMSO), dexame hasone and LPS in PBS. LPS and he compounds unde in es iga ion in concen a ions indica ed o he sol en (DMSO, inal concen a ion 0.1% / in all wells) we e added o he cells in esh cul u e medium con aining 10% FBS and he supplemen s, and he incuba ions we e con inued o he ime indica ed be o e emo ing he cul u e medium and ha es ing he cells. Mouse pe i oneal mac ophages we e ob ained by pe i oneal la age wi h s e ile PBS supplemen ed wi h 0.2 mM e hylenediamine e aace ic acid (EDTA). Cells we e washed and seeded on 24-well pla es (1 ×106cells/well) in RPMI medium supplemen ed wi h 2% FBS, 100 U/ml penicillin, 100 µg/ml s ep omycin and 250 ng/ml ampho e icin B. Cells we e incuba ed o e nigh , washed and ea ed wi h he compounds unde in es iga ion o he pe iod indica ed. P epa a ion o Cell Lysa es and Wes e n Blo Analysis A he indica ed ime poin s, he cul u e medium was emo ed and he cells we e washed wi h ice-cold PBS and solubilized in cold lysis bu e con aining 10 mM T is– HCl, 5 mM EDTA, 50 mM NaCl, 1% T i on X-100, 0.5 mM phenylme hylsul onyl luo ide, 1 mM sodium o ho anada e, 20 mg/ml leupep in, 50 mg/ml ap o inin, 5 mM sodium luo ide, 2 mM sodium py ophospha e and 10 mM n-oc yl-b- D-glucopy anoside. A e incuba ion o 15 min on ice, lysa es we e cen i uged, and he supe na an s we e collec ed and mixed FIGURE 1 | Dexame hasone inhibi s mPGES-1 exp ession in ac i a ed mac ophages in an MKP-1 dependen manne . (A) E ec s o dexame hasone on pe i oneal mac ophages om wild- ype and MKP-1 knock-ou (KO) mice. Cells we e incuba ed wi h LPS in he p esence o absence o dexame hasone o 24 h. mPGES-1 mRNA le els we e measu ed by quan i a i e RT-PCR and no malized agains GAPDH mRNA le els. Resul s a e exp essed in a bi a y uni s, mPGES-1 mRNA le els in uns imula ed cells om wild ype mice we e se as 1, and he o he alues we e ela ed o ha . Resul s a e exp essed as mean +SEM, n=4. One-way ANOVA wi h Bon e oni’s pos - es was pe o med and s a is ical signi icance is indica ed as ***P<0.001 and ns =no signi ican . #P=0.0286 s uns imula ed cells om wild- ype mice. (B) E ec o dexame hasone on mPGES-1 mRNA p oduc ion in J774 mu ine mac ophages. Cells we e s imula ed wi h LPS in he p esence o absence o dexame hasone o 24 h. mPGES-1 mRNA le els we e measu ed by quan i a i e RT-PCR and no malized agains GAPDH mRNA le els. Resul s a e exp essed in a bi a y uni s, mPGES-1 mRNA le els in LPS-s imula ed cells we e se as 100 % and he o he alues we e ela ed o ha . Resul s a e exp essed as mean +SEM, n=6–7. One-way ANOVA wi h Bon e oni’s pos - es was pe o med and s a is ical signi icance is indica ed as ***P<0.001. (C) E ec o dexame hasone on mPGES-1 p o ein exp ession in J774 mu ine mac ophages. Cells we e s imula ed wi h LPS in he p esence o absence o dexame hasone o 24 h. mPGES-1 p o ein le els we e measu ed by Wes e n blo analysis and ac in was used as a loading con ol. Resul s a e exp essed in a bi a y uni s, mPGES-1 p o ein le els in LPS-s imula ed cells we e se as 100% and he o he alues we e ela ed o ha . Resul s a e exp essed as mean +SEM, n=6. One-way ANOVA wi h Bon e oni’s pos - es was pe o med and s a is ical signi icance is indica ed as ***P<0.001. Shown is a ep esen a i e gel o six wi h simila esul s. F on ie s in Pha macology | www. on ie sin.o g 3Sep embe 2017 | Volume 8 | A icle 646 Tuu e e al. Dexame hasone Inhibi s mPGES-1 Exp ession MKP-1-dependen ly FIGURE 2 | Dexame hasone inhibi s mPGES-1 exp ession in acu e in lamma o y esponse in i o in an MKP-1 dependen manne . Dexame hasone (2 mg/kg) was gi en in ape i oneally an hou be o e LPS (50 µl o 2 mg/ml in PBS) was injec ed in o he hind paw o anes he ized mice o induce acu e in lamma ion. The paw issues we e collec ed 6 h a e he LPS injec ion and mPGES-1 mRNA le els we e measu ed by quan i a i e RT-PCR and no malized agains GAPDH mRNA le els. Resul s a e exp essed in a bi a y uni s, mPGES-1 mRNA le els in LPS ea ed paw issue om wild- ype mice we e se as 100% and he o he alues a e ela ed o ha . Resul s a e exp essed as mean +SEM, n=6–8. One-way ANOVA wi h Bon e oni’s pos - es was pe o med and s a is ical signi icance is indica ed as *P<0.05 and ns =no signi ican . in a a io o 1:4 wi h SDS loading bu e (62.5 mM T is– HCl, pH 6.8, 10% glyce ol, 2% SDS, 0.025% b omophenol blue and 5% β-me cap oe hanol), and s o ed a −20◦C un il analyzed. Equal amoun s o p o ein (10 o 20 µg) we e loaded on a 12% SDS-polyac ylamide gel and sepa a ed by elec opho esis. P o eins we e ans e ed o ni ocellulose memb anes by d y elec oblo ing using iBlo gel ans e s acks and he In i ogen iBlo De ice acco ding o he manu ac u e ’s ins uc ions. A e ans e , he memb ane was blocked in TBS/T [20 mM T isbase (pH 7.6), 150 mM NaCl, 0.1% Tween-20] con aining 5% non- a milk o 1 h a oom empe a u e. Fo de ec ion o phospho yla ed p o eins, memb anes we e blocked in TBS/T con aining 5% BSA. Memb anes we e incuba ed o e nigh a 4◦C wi h he p ima y an ibody and o 1 h wi h he seconda y an ibody, and he chemiluminescen signal was de ec ed by ImageQuan TM LAS 4000 mini (GE Heal hca e Bio- Sciences AB, Uppsala, Sweden). The chemiluminescen signal was quan i ied wi h ImageQuan TL 7.0 Image Analysis So wa e (GE Heal hca e Bio-Sciences AB). Following an ibodies we e used in he Wes e n blo analysis: mPGES-1 an ibody (AS- 03031; Ag ise a AB, Vännäs, Sweden); polyclonal goa an i- abbi (sc-2004), ac in (sc-1616R) and JNK an ibody (#9251; San a C uz Bio echnology, CA, USA), MKP-1 an ibody (SAB2500331; Sigma-Ald ich Inc), p38 MAPK an ibody (ab27986; Abcam plc., Camb idge, UK), phospho-p38 MAPK (#9211) and phospho-JNK an ibody (#9251; Cell Signaling Technology Inc., Be e ly, MA, USA). RNA Ex ac ion and Quan i a i e Real-Time Re e se T ansc ip ion Polyme ase Chain Reac ion (qRT-PCR) A he indica ed ime poin s, he cul u e medium was emo ed, and cell homogeniza ion and RNA ex ac ion was ca ied ou by using GenElu eTM Mammalian To al RNA Minip ep Ki acco ding o he manu ac u e ’s ins uc ion. In he case o paw issue samples, RNA was ex ac ed wi h TRIzol eagen . B ie ly, issue was i s homogenized in TRIzol (The mo Fishe Scien i ic, Wal ham, MA, USA), and he ea e RNA was ex ac ed wi h chlo o o m and p ecipi a ed wi h isop opanol, washed wi h 75% e hanol and esuspended in RNAse ee wa e . Re e se ansc ip ion o he RNA o cDNA was pe o med wi h TaqMan R Re e se T ansc ip ion Reagen s (Applied Biosys ems, Fos e Ci y, CA, USA) in he case o J774 cells and wi h Maxima Fi s s and cDNA syn hesis ki o RT- qPCR (The mo Fishe Scien i ic) in he case o PM cells and paw issue. P ime s and p obes we e pu chased om Me abion (Ma ins ied, Ge many). Thei sequences and concen a ions we e op imized acco ding o he manu ac u e ’s guidelines in TaqMan Uni e sal PCR Mas e Mix P o ocol pa numbe 4304449 e ision C (Applied Biosys ems) and we e as ollows: mouse mPGES-1 CCTGGATACATTTCCTCGTTGTC ( o wa d, 300 nM), GAAGGCGTGGGTTCAGCTT ( e e se, 300 nM), and ACAGGCCGTGTGGTACACACCG (p obe, 150 nM); mouse MKP-1 CTCCTGGTTCAACGAGGCTATT ( o wa d, 300 nM), TGCCGGCCTGGCAAT ( e e se, 300 nM), and CCATCAAGGATGCTGGAGGGAGAGTGTT (p obe, 150 nM); mouse GAPDH GCATGGCCTTCCGTGTTC ( o wa d, 300 nM), GATGTCATCATACTTGGCAGGTTT ( e e se, 300 nM) and TCGTGGATCTGACGTGCCGCC (p obe, 150 nM). Quan i a i e PCR was ca ied ou by using TaqMan Uni e sal PCR Mas e Mix and ABI P ism 7500 sequence de ec ion sys em (Applied Biosys ems). The PCR cycling pa ame e s we e incuba ion a 50◦C o 2 min, incuba ion a 95◦C o 10 min, 40 cycles o dena u a ion a 95◦C o 15 s and annealing and ex ension a 60◦C o 1 min. A s anda d cu e me hod was used o es ima e he ela i e mRNA le els. When calcula ing he esul s, mPGES-1 and MKP-1 mRNA le els we e i s no malized agains GAPDH. S a is ics Resul s a e exp essed as mean +s anda d e o o he mean (SEM). One-way ANOVA wi h Bon e oni’s pos - es was pe o med using G aphPad InS a e sion 3.10 o Windows. Di e ences we e conside ed signi ican a *P<0.05, **P<0.01 o ***P<0.001. RESULTS Exp ession o mPGES-1 in uns imula ed mac ophages om MKP-1 de icien mice was ele a ed as compa ed o mac ophages F on ie s in Pha macology | www. on ie sin.o g 4Sep embe 2017 | Volume 8 | A icle 646 Tuu e e al. Dexame hasone Inhibi s mPGES-1 Exp ession MKP-1-dependen ly FIGURE 3 | Dexame hasone enhances MKP-1 exp ession in mac ophages. (A) E ec o dexame hasone on MKP-1 mRNA exp ession in J774 mu ine mac ophages. Cells we e s imula ed wi h LPS in he p esence o absence o dexame hasone o 1 h. MKP-1 mRNA le els we e measu ed by quan i a i e RT-PCR and no malized agains GAPDH mRNA le els. Resul s a e gi en in a bi a y uni s, MKP-1 mRNA le els in LPS-s imula ed cells we e se as 100% and he o he alues we e ela ed o ha . Resul s a e exp essed as mean +SEM, n=11–12. One-way ANOVA wi h Bon e oni’s pos - es was pe o med and s a is ical signi icance is indica ed as ***P<0.001. (B) E ec o dexame hasone on MKP-1 p o ein exp ession in J774 mu ine mac ophages. Cells we e s imula ed wi h LPS in he p esence o absence o dexame hasone o 1 h. MKP-1 p o ein le els we e measu ed by Wes e n blo analysis and ac in was used as a loading con ol. Resul s a e exp essed in a bi a y uni s, MKP-1 p o ein le els in LPS-s imula ed cells we e se as 100% and he o he alues we e ela ed o ha . Resul s a e exp essed as mean +SEM. n=9. One-way ANOVA wi h Bon e oni’s pos - es was pe o med and s a is ical signi icance is indica ed as ***P<0.001. Shown is a ep esen a i e gel o nine wi h simila esul s. (C) E ec o dexame hasone on MKP-1 mRNA p oduc ion in pe i oneal mac ophages om wild- ype mice. Cells we e s imula ed wi h LPS in he p esence o absence o dexame hasone o 1 h. MKP-1 mRNA le els we e measu ed by quan i a i e RT-PCR and no malized agains GAPDH mRNA le els. Resul s a e exp essed in a bi a y uni s, MKP-1 mRNA le els in LPS-s imula ed cells we e se as 100% and he o he alues we e ela ed o ha . Resul s a e exp essed as mean +SEM, n=5. One-way ANOVA wi h Bon e oni’s pos - es was pe o med and s a is ical signi icance is indica ed as ***P<0.001. om wild- ype mice (Figu e 1A). A no iceable inc ease in he exp ession le el was seen ollowing s imula ion wi h LPS bo h in mouse pe i oneal mac ophages (Figu e 1A) and in J774 mac ophage cell line (Figu es 1B,C). Incuba ion wi h dexame hasone signi ican ly down egula ed mPGES- 1 exp ession in bo h LPS-s imula ed J774 mac ophages (Figu es 1B,C) and in pe i oneal mac ophages om wild- ype mice (Figu e 1A). In con as , incuba ion wi h dexame hasone had no e ec on LPS-induced mPGES-1 exp ession in pe i oneal mac ophages om MKP-1 de icien mice (Figu e 1A). This sugges s ha MKP-1 has an essen ial ole in media ing he supp ession by dexame hasone o mPGES-1 exp ession in in lamma ion. We nex in es iga ed whe he MKP-1 could media e he a enua ion by dexame hasone o mPGES-1 exp ession also unde in i o condi ions. To do his, he e ec o dexame hasone F on ie s in Pha macology | www. on ie sin.o g 5Sep embe 2017 | Volume 8 | A icle 646 Tuu e e al. Dexame hasone Inhibi s mPGES-1 Exp ession MKP-1-dependen ly FIGURE 4 | Dexame hasone inhibi s he phospho yla ion o MAP kinases p38 and JNK in ac i a ed J774 mac ophages. (A) E ec o dexame hasone on p38 phospho yla ion. J774 mac ophages we e p eincuba ed wi h dexame hasone o 1 h and s imula ed wi h LPS o 30 min. p38 and phospho yla ed p38 (pp38) p o ein le els we e measu ed by Wes e n blo analysis and he le els o (Con inued) FIGURE 4 | Con inued phospho yla ed p38 we e no malized agains he le els o o al p38. Resul s a e exp essed in a bi a y uni s, phospho yla ed p38 le els in LPS-s imula ed cells we e se as 100% and he o he alues we e ela ed o ha . Resul s a e exp essed as mean +SEM, n=4. One-way ANOVA wi h Bon e oni’s pos - es was pe o med and s a is ical signi icance is indica ed as ***P<0.001 and ns =no signi ican . Shown is a ep esen a i e gel o ou wi h simila esul s. (B) E ec o dexame hasone on JNK phospho yla ion. J774 mac ophages we e p eincuba ed wi h dexame hasone o 1 h and s imula ed wi h LPS o 30 min. JNK and phospho yla ed JNK (pJNK) p o ein le els we e measu ed by Wes e n blo analysis and he le els o phospho yla ed JNK we e no malized agains he le els o o al JNK. Resul s a e exp essed in a bi a y uni s, phospho yla ed JNK le els in LPS-s imula ed cells we e se as 100% and he o he alues we e ela ed o ha . Resul s a e exp essed as mean +SEM, n=6. One-way ANOVA wi h Bon e oni’s pos - es was pe o med and s a is ical signi icance is indica ed as **P<0.01, ***P<0.001 and ns =no signi ican . Shown is a ep esen a i e gel o six wi h simila esul s. ea men on mPGES-1 exp ession in paw in lamma ion in wild- ype and MKP-1 de icien mice was examined. Dexame hasone, in a dose (2 mg/kg in ape i oneally) ha inhibi ed he concu en paw edema (by 44%; P<0.05) in wild- ype bu no in MKP-1 de icien mice, signi ican ly educed mPGES- 1 exp ession in LPS- ea ed paw issue in wild- ype mice. In suppo o he in i o da a, dexame hasone had no e ec on mPGES-1 exp ession le els in he paw issue in MKP- 1 de icien mice (Figu e 2). To con i m ha dexame hasone could s imula e MKP-1 exp ession in mac ophages, MKP-1 mRNA and p o ein le els in J774 cells we e measu ed. MKP- 1 exp ession was low in uns imula ed cells bu i was inc eased by LPS. Fu he mo e, dexame hasone enhanced MKP-1 mRNA (Figu e 3A) and p o ein (Figu e 3B) le els in J774 mac ophages bo h in he absence and in he p esence o LPS. Dexame hasone likewise enhanced MKP-1 exp ession in uns imula ed and LPS-s imula ed pe i oneal mac ophages om wild- ype mice (Figu e 3C). Because MKP-1 has been epo ed o inac i a e p38 and JNK MAP kinases h ough dephospho yla ion (F anklin and K a , 1997; F anklin e al., 1998; Kassel e al., 2001; Ab aham e al., 2006; Chi e al., 2006; Zhao e al., 2006; Tu peinen e al., 2010, 2011; Comalada e al., 2012), he e ec s o dexame hasone on he le els o phospho yla ed p38 and JNK in ac i a ed mac ophages we e in es iga ed. Exposu e o LPS caused a apid inc ease in p38 and JNK phospho yla ion in J774 mac ophages (Figu es 4A,B) and in mouse pe i oneal mac ophages (Figu es 5A,B). This e ec was educed by dexame hasone in J774 cells (Figu es 4A,B) and in pe i oneal mac ophages om wild- ype mice (Figu es 5A,B). The ole o MKP-1 in he dexame hasone e ec was con i med by he inding ha dexame hasone did no educe he LPS-enhanced le els o phospho yla ed p38 (Figu e 5A) o JNK (Figu e 5B) in pe i oneal mac ophages om MKP-1 de icien mice. Fu he mo e, he JNK inhibi o SP600125 (Benne e al., 2001; Nieminen e al., 2006) bu no he p38 inhibi o SB203580 (Cuenda e al., 1995; Shi e al., 2015) educed LPS-induced mPGES-1 exp ession in a manne compa able o ha o dexame hasone (Figu es 6A,B). Toge he , hese da a sugges ha dexame hasone educes mPGES-1 exp ession in classically ac i a ed mac ophages in F on ie s in Pha macology | www. on ie sin.o g 6Sep embe 2017 | Volume 8 | A icle 646 Tuu e e al. Dexame hasone Inhibi s mPGES-1 Exp ession MKP-1-dependen ly FIGURE 5 | Dexame hasone inhibi s he phospho yla ion o MAP kinases p38 and JNK in ac i a ed mac ophages in an MKP-1 dependen manne . (A) E ec o dexame hasone on p38 phospho yla ion. Pe i oneal mac ophages om wild- ype and MKP-1 knock-ou (KO) mice we e p eincuba ed wi h dexame hasone o 1 h and s imula ed wi h LPS o 30 min. p38 and phospho yla ed p38 (pp38) p o ein le els we e measu ed by Wes e n blo and he le els o phospho yla ed p38 we e no malized agains he le els o o al p38. Resul s a e exp essed in a bi a y uni s, phospho yla ed p38 le els in LPS-s imula ed cells we e se as 100 % and he o he alues we e ela ed o ha . Resul s a e exp essed as mean +SEM, n=9. One-way ANOVA wi h Bon e oni’s pos - es was pe o med and s a is ical signi icance is indica ed as ***P<0.001 and ns =no signi ican . Shown is a ep esen a i e gel o nine wi h simila esul s. (B) E ec o dexame hasone on JNK phospho yla ion. Pe i oneal mac ophages om wild- ype and MKP-1 knock-ou (KO) mice we e p e-incuba ed wi h dexame hasone o 1 h and s imula ed wi h LPS o 30 min. JNK and phospho yla ed JNK (pJNK) p o ein le els we e measu ed by Wes e n blo analysis and he le els o phospho yla ed JNK we e no malized agains he le els o o al JNK. Resul s a e exp essed in a bi a y uni s, phospho yla ed JNK le els in LPS-s imula ed cells we e se as 100% and he o he alues we e ela ed o ha . Resul s a e exp essed as mean +SEM, n=5. One-way ANOVA wi h Bon e oni’s pos - es was pe o med and s a is ical signi icance is indica ed as ***P<0.001 and ns =no signi ican . Shown is a ep esen a i e gel o i e wi h simila esul s. FIGURE 6 | JNK inhibi o SP600125 inhibi s he exp ession o mPGES-1 in ac i a ed mac ophages. (A) E ec s o a JNK inhibi o (SP600125), a p38 inhibi o (SB203580) and dexame hasone on mPGES-1 mRNA p oduc ion in J774 mu ine mac ophages. Cells we e incuba ed wi h LPS and he compounds unde in es iga ion o 24 h. mPGES-1 mRNA le els we e measu ed by quan i a i e RT-PCR and no malized agains GAPDH mRNA (Con inued) F on ie s in Pha macology | www. on ie sin.o g 7Sep embe 2017 | Volume 8 | A icle 646 Tuu e e al. Dexame hasone Inhibi s mPGES-1 Exp ession MKP-1-dependen ly FIGURE 6 | Con inued le els. Resul s a e exp essed in a bi a y uni s, mPGES-1 mRNA le els in LPS-s imula ed cells we e se as 100% and he o he alues we e ela ed o ha . Resul s a e exp essed as mean +SEM, n=6–7. One-way ANOVA wi h Bon e oni’s pos - es was pe o med and s a is ical signi icance is indica ed as ***P<0.001 and ns =no signi ican . (B) E ec s o a JNK inhibi o (SP600125), a p38 inhibi o (SB203580) and dexame hasone on mPGES-1 p o ein exp ession in J774 mu ine mac ophages. Cells we e s imula ed wi h LPS and he compounds unde in es iga ion o 24 h. mPGES-1 p o ein le els we e measu ed by Wes e n blo analysis and ac in was used as a loading con ol. Resul s a e exp essed in a bi a y uni s, mPGES-1 p o ein le els in LPS-s imula ed cells we e se as 100% and he o he alues we e ela ed o ha . Resul s a e exp essed as mean +SEM, n=5–6. One-way ANOVA wi h Bon e oni’s pos - es was pe o med and s a is ical signi icance is indica ed as ***P<0.001, **P<0.01 and ns =no signi ican . Shown is a ep esen a i e gel o i e wi h simila esul s. a manne dependen on enhanced MKP-1 exp ession and subsequen ly educed JNK phospho yla ion. DISCUSSION Mic osomal p os aglandin E syn hase-1 is an inducible in lamma o y enzyme, he exp ession o which has been epo ed o be inhibi ed by glucoco icoids (S ich eno h e al., 2001; Tuu e e al., 2015). The p esen s udy ex ends he p e ious da a by showing ha he glucoco icoid e ec on mPGES-1 is media ed h ough enhanced exp ession o he egula o y phospha ase MKP-1 and subsequen dephospho yla ion o he MAP kinase JNK in in lamma o y condi ions. MKP-1 de icien mice ha e a no mal pheno ype in es ing condi ions bu hey de elop enhanced esponses in in lamma o y s a es. Fo example, hey ha e impai ed ole ance agains bac e ial endo oxin and when exposed o LPS, signi ican ly highe le els o cy okines and o he in lamma o y ac o s a e eleased and he in lamma o y esponse is much mo e se e e as compa ed o wild- ype con ols (Chi e al., 2006; Hamme e al., 2006; Zhao e al., 2006; Ko honen e al., 2011; Tu peinen e al., 2011). Those indings suppo a signi ican ole o MKP- 1 as an endogenous ac o egula ing and limi ing excessi e in lamma o y esponses and as a po en ial a ge o be inc eased wi h an i-in lamma o y ea men s. In he p esen expe imen s wi h cells om wild- ype and MKP-1 de icien mice, we ound ha MKP-1 media es he supp ession by dexame hasone o mPGES-1 exp ession in ac i a ed mac ophages. This e ec was also ansla ed o in i o condi ions, as dexame hasone educed mPGES-1 exp ession in in lamed paw issue in wild- ype bu no in MKP-1 de icien mice. Dexame hasone also supp essed in lamma o y edema in wild- ype bu no in MKP-1 de icien mice. Al hough his is dependen on se e al in lamma o y ac o s (Naidu e al., 2010; Za e al., 2014; Chen e al., 2016), he educed mPGES-1 exp ession may con ibu e o he an i-in lamma o y e ec o dexame hasone because mPGES-1 inhibi o s ha e been epo ed o a enua e in lamma o y paw edema in expe imen al models (Koebe le e al., 2009; Siemonei e al., 2011). In addi ion o i s supp essi e e ec on mPGES-1, dexame hasone augmen ed he exp ession o MKP-1 when in oduced o wild- ype cells in he absence o in he p esence o LPS, as shown also ea lie (Ab aham e al., 2006; Shipp e al., 2010; Zhu e al., 2010; P abhala e al., 2016; Ke änen e al., 2017). MKP-1 is an ea ly esponse gene, he exp ession o which is ansien ly inc eased ollowing exposu e o in lamma o y and cellula s ess ac o s (Owens and Keyse, 2007; Bou os e al., 2008; Caun and Keyse, 2013). In addi ion, MKP-1 p omo e con ains glucoco icoid esponsi e elemen s (Shipp e al., 2010) indica ing ha glucoco icoids may di ec ly enhance MKP-1 ansc ip ion. MKP-1 exp ession is also egula ed by a ious pos - ansc ip ional mechanisms (Wong e al., 2005; Kuwano e al., 2008; Ko honen and Moilanen, 2014). As glucoco icoids ha e been shown no only o enhance bu also o p olong MKP-1 exp ession (Ke änen e al., 2017), hey may egula e MKP-1 gene exp ession a pos - ansc ip ional le el in addi ion o hei di ec ansc ip ional e ec . MKP-1 egula es he in lamma o y esponses by inac i a ing MAP kinases p38 and JNK h ough dephospho yla ion (F anklin and K a , 1997; F anklin e al., 1998; Chi e al., 2006; Zhao e al., 2006; Tu peinen e al., 2010, 2011; Comalada e al., 2012). The e o e, i is in e es ing ha dexame hasone was ound o educe p38 and JNK phospho yla ion in wild- ype bu no in MKP-1 de icien mac ophages exposed o in lamma o y s imulus. In suppo o ou da a, Ab aham and co-wo ke s epo ed ha dexame hasone inhibi s p38 and JNK phospho yla ion in mu ine bone-ma ow de i ed mac ophages (Ab aham e al., 2006), whe eas in ano he s udy dexame hasone was ound o down egula e p38 bu no JNK o ERK phospho yla ion (Bha acha yya e al., 2007). These indings show ha he glucoco icoid-induced enhancemen in MKP-1 exp ession has unc ional consequences a he le el o educed MAP kinase phospho yla ion, which is likely o esul in deac i a ion o hese in lamma o y pa hways possibly by a cell- ype dependen manne . The p esen indings p o ide suppo o MAP kinase JNK being a seminal downs eam ac o egula ing he exp ession o mPGES-1 unde in lamma o y condi ions in mac ophages: dexame hasone was ound o educe he phospho yla ion o bo h p38 and JNK kinases along wi h i s s imula o y e ec on MKP- 1 exp ession. Howe e , he JNK inhibi o bu no p38 inhibi o a enua ed he exp ession o mPGES-1. Tha is suppo ed by he indings in human gingi al ib oblas s (Yucel-Lindbe g e al., 2006; Båge e al., 2010), in a neona al ca diomyocy es (Degousee e al., 2006) and in mu ine mic oglial cells (de Oli ei a e al., 2008; He e al., 2016) in which JNK was ound o be in ol ed in he egula ion o mPGES-1 exp ession. The e ec may be cell ype dependen because in human os eoa h i ic chond ocy es s imula ed wi h IL-1β, MAP kinases p38 and ERK had a c ucial ole in he egula ion o mPGES-1 exp ession, whe eas JNK was insigni ican (Masuko-Hongo e al., 2004). In in lamma ion, a ious p o-in lamma o y cy okines and bac e ial p oduc s a e known o enhance mPGES-1 exp ession. The ansc ip ional mechanisms a e no known in de ail, bu ea ly g ow h esponse p o ein 1 (EGR-1) and nuclea ac o kappa B (NF-kB) ha e been iden i ied as key ansc ip ion ac o s o mPGES-1 (Koebe le and We z, 2015). Ac i a o p o ein 1 (AP-1) is one o he addi ional ac o s epo ed o be in ol ed F on ie s in Pha macology | www. on ie sin.o g 8Sep embe 2017 | Volume 8 | A icle 646 Tuu e e al. Dexame hasone Inhibi s mPGES-1 Exp ession MKP-1-dependen ly in he ansc ip ional ac i a ion o mPGES-1 (Moon e al., 2005; Jungel e al., 2007). This obse a ion is ele an in he ligh o he p esen esul s because AP-1 is ac i a ed by JNK. Exp ession o mPGES-1 may also be egula ed by JNK a pos - ansc ip ional le el as a JNK inhibi o has been ound o des abilize mPGES-1 mRNA and educe mPGES-1 p o ein le els in mu ine neona al ca diomyocy es (Degousee e al., 2006). Howe e , addi ional s udies a e needed o cla i y he de ailed mechanisms o how JNK egula es mPGES-1 exp ession. In conclusion, dexame hasone was ound o down- egula e mPGES-1 exp ession in classically ac i a ed mac ophages h ough inc eased exp ession o he egula o y phospha ase MKP-1 and subsequen ly dec eased phospho yla ion o he MAP kinase JNK. These esul s ex end he p e ious unde s anding o he molecula mechanisms egula ing mPGES-1 exp ession in in lamma o y condi ions. The indings also highligh he po en ial o MKP-1 as an an i-in lamma o y d ug a ge . AUTHOR CONTRIBUTIONS LT was in ol ed in he concep ion and design o he s udy, labo a o y and s a is ical analyses, analysis and in e p e a ion o he da a and d a ed he manusc ip . MH con ibu ed o he concep ion and design o he s udy, labo a o y analyses, animal expe imen s, analysis and in e p e a ion o he da a and in he w i ing o he manusc ip . BW con ibu ed o he analysis and in e p e a ion o he da a and in he w i ing o he manusc ip . EM supe ised he s udy and con ibu ed o he concep ion and design o he s udy, in he analysis and in e p e a ion o he da a and in he w i ing o he manusc ip . All au ho s app o ed he inal e sion o he manusc ip . FUNDING This s udy was suppo ed by g an s om he compe i i e esea ch unding o he Pi kanmaa Hospi al Dis ic , Finland; O ion Resea ch Founda ion, Finland; Resea ch Founda ion o Rheuma ic Diseases, Finland and Pa ien O ganiza ion o Rheuma oid A h i is (Tampe een Reumayhdis ys y), Finland. ACKNOWLEDGMENTS We wish o hank M s Salla Hie akangas o excellen echnical assis ance and M s. Heli Mää ä o skil ul sec e a ial help. REFERENCES Ab aham, S. M., Law ence, T., Kleiman, A., Wa den, P., Medghalchi, M., Tucke mann, J., e al. (2006). An iin lamma o y e ec s o dexame hasone a e pa ly dependen on induc ion o dual speci ici y phospha ase 1. J. Exp. Med. 203, 1883–1889. doi: 10.1084/jem.20060336 Ashwell, J. D. (2006). The many pa hs o p38 mi ogen-ac i a ed p o ein kinase ac i a ion in he immune sys em. Na . Re . Immunol. 6, 532–540. doi: 10.1038/n i1865 Båge, T., Lindbe g, J., Lundebe g, J., Modee , T., and Yucel-Lindbe g, T. (2010). Signal pa hways JNK and NF-κB, iden i ied by global gene exp ession p o iling, a e in ol ed in egula ion o TNFalpha-induced mPGES- 1 and COX-2 exp ession in gingi al ib oblas s. BMC Genomics 11:241. doi: 10.1186/1471-2164-11-241 Benne , B. L., Sasaki, D. T., Mu ay, B. W., O’Lea y, E. C., Saka a, S. T., Xu, W., e al. (2001). SP600125, an an h apy azolone inhibi o o Jun N- e minal kinase. P oc. Na l. Acad. Sci. U.S.A. 98, 13681–13686. doi: 10.1073/pnas.251194298 Bha acha yya, S., B own, D. E., B ewe , J. A., Vog , S. K., and Muglia, L. J. (2007). Mac ophage glucoco icoid ecep o s egula e Toll-like ecep o 4-media ed in lamma o y esponses by selec i e inhibi ion o p38 MAP kinase. Blood 109, 4313–4319. doi: 10.1182/blood-2006-10-048215 Bou os, T., Che e , E., and Me akos, P. (2008). Mi ogen-ac i a ed p o ein (MAP) kinase/MAP kinase phospha ase egula ion: oles in cell g ow h, dea h, and cance . Pha macol. Re . 60, 261–310. doi: 10.1124/p .107. 00106 Caun , C. J., and Keyse, S. M. (2013). Dual-speci ici y MAP kinase phospha ases (MKPs): shaping he ou come o MAP kinase signalling. FEBS J. 280, 489–504. doi: 10.1111/j.1742-4658.2012.08716.x Chand asekha , S., Ha ey, A. K., Yu, X. P., Chambe s, M. G., Oskins, J. L., Lin, C., e al. (2016). Iden i ica ion and cha ac e iza ion o no el mic osomal p os aglandin E syn hase-1 inhibi o s o analgesia. J. Pha macol. Exp. The . 356, 635–644. doi: 10.1124/jpe .115.228932 Chang, H. H., and Meuille , E. J. (2011). Iden i ica ion and de elopmen o mPGES-1 inhibi o s: whe e we a e a ? Fu u e Med. Chem. 3, 1909–1934. doi: 10.4155/ mc.11.136 Chen, C. C., Lin, M. W., Liang, C. J., and Wang, S. H. (2016). The an i-in lamma o y e ec s and mechanisms o eupa olin in lipopolysaccha ide-induced in lamma o y esponses in RAW264.7 mac ophages. PLoS ONE 11:e0158662. doi: 10.1371/jou nal.pone.0158662 Cheng, Y., Wang, M., Yu, Y., Lawson, J., Funk, C. D., and Fi zge ald, G. A. (2006). Cyclooxygenases, mic osomal p os aglandin E syn hase-1, and ca dio ascula unc ion. J. Clin. In es . 116, 1391–1399. doi: 10.1172/JCI27540 Chi, H., Ba y, S. P., Ro h, R. J., Wu, J. J., Jones, E. A., Benne , A. M., e al. (2006). Dynamic egula ion o p o- and an i-in lamma o y cy okines by MAPK phospha ase 1 (MKP-1) in inna e immune esponses. P oc. Na l. Acad. Sci. U.S.A. 103, 2274–2279. doi: 10.1073/pnas.0510965103 Comalada, M., Llobe as, J., and Celada, A. (2012). MKP-1: a c i ical phospha ase in he biology o mac ophages con olling he swi ch be ween p oli e a ion and ac i a ion. Eu . J. Immunol. 42, 1938–1948. doi: 10.1002/eji.201242441 Coulombe, F., Jawo ska, J., Ve way, M., Tzelepis, F., Massoud, A., Gilla d, J., e al. (2014). Ta ge ed p os aglandin E2 inhibi ion enhances an i i al immuni y h ough induc ion o ype I in e e on and apop osis in mac ophages. Immuni y 40, 554–568. doi: 10.1016/j.immuni.2014. 02.013 Cuenda, A., Rouse, J., Doza, Y. N., Meie , R., Cohen, P., Gallaghe , T. F., e al. (1995). SB 203580 is a speci ic inhibi o o a MAP kinase homologue which is s imula ed by cellula s esses and in e leukin-1. FEBS Le . 364, 229–233. doi: 10.1016/0014-5793(95)00357-F Coxib and adi ional, NSAID T ialis s’ (CNT) Collabo a ion, Bhala, N., Embe son, J., Me hi, A., Ab amson, S., A be , N., e al. (2013). Vascula and uppe gas oin es inal e ec s o non-s e oidal an i-in lamma o y d ugs: me a- analyses o indi idual pa icipan da a om andomised ials. Lance 382, 769–779. doi: 10.1016/S0140-6736(13)60900-9 Degousee, N., Angoul an , D., Fazel, S., S e anski, E., Saha, S., Iliescu, K., e al. (2006). c-Jun N- e minal kinase-media ed s abiliza ion o mic osomal p os aglandin E2 syn hase-1 mRNA egula es delayed mic osomal p os aglandin E2 syn hase-1 exp ession and p os aglandin E2 biosyn hesis by ca diomyocy es. J. Biol. Chem. 281, 16443–16452. doi: 10.1074/jbc.M6028 15200 de Oli ei a, A. C., Candela io-Jalil, E., Bha ia, H. S., Lieb, K., Hull, M., and Fiebich, B. L. (2008). Regula ion o p os aglandin E2 syn hase exp ession in ac i a ed p ima y a mic oglia: e idence o uncoupled egula ion o mPGES-1 and COX-2. Glia 56, 844–855. doi: 10.1002/glia.20658 F anklin, C. C., and K a , A. S. (1997). Condi ional exp ession o he mi ogen- ac i a ed p o ein kinase (MAPK) phospha ase MKP-1 p e e en ially inhibi s F on ie s in Pha macology | www. on ie sin.o g 9Sep embe 2017 | Volume 8 | A icle 646