scieee Science in your language
[en] (orig)

Immune-inducible non-coding RNA molecule lincRNA-IBIN connects immunity and metabolism in Drosophila melanogaster

Read accessible full text

Immune-inducible non-coding RNA molecule lincRNA-IBIN connects immunity and metabolism in Drosophila melanogaster

Author: Valanne, Susanna,Salminen, Tiina S,Järvelä-Stölting, Mirva,Vesala, Laura,Rämet, Mika
Year: 2019
Source: https://trepo.tuni.fi/bitstream/10024/105728/1/Immune-inducible_non-coding_2019.pdf
RESEARCH ARTICLE
Immune-inducible non-coding RNA molecule
lincRNA-IBIN connec s immuni y and
me abolism in D osophila melanogas e
Susanna Valanne
1☯
, Tiina S. Salminen
1☯
, Mi a Ja
¨ ela
¨-S o
¨l ing
1
, Lau a Vesala
1
,
Mika Ra
¨me ID
1,2,3
*
1Labo a o y o Expe imen al Immunology, BioMediTech Ins i u e and Facul y o Medicine and Li e Sciences,
Uni e si y o Tampe e, Tampe e, Finland, 2PEDEGO Resea ch Uni , and Medical Resea ch Cen e Oulu,
Uni e si y o Oulu, and Depa men o Child en and Adolescen s, Oulu Uni e si y Hospi al, Oulu, Finland,
3Depa men o Pedia ics, Tampe e Uni e si y Hospi al, Tampe e, Finland
☯These au ho s con ibu ed equally o his wo k.
*[email p o ec ed]
Abs ac
Non-coding RNAs ha e impo an oles in egula ing physiology, including immuni y. He e, we
pe o med ansc ip ome p o iling o immune- esponsi e genes in D osophila melanogas e
du ing a G am-posi i e bac e ial in ec ion, concen a ing on long non-coding RNA (lncRNA)
genes. The gene mos highly induced by a Mic ococcus lu eus in ec ion was CR44404, named
Induced by In ec ion (lincRNA-IBIN). lincRNA-IBIN is induced by bo h G am-posi i e and
G am-nega i e bac e ia in D osophila adul s and pa asi oid wasp Lep opilina boula di in D o-
sophila la ae, as well as by he ac i a ion o he Toll o he Imd pa hway in unchallenged lies.
We show ha upon in ec ion, lincRNA-IBIN is exp essed in he a body, in hemocy es and in
he gu , and i s exp ession is egula ed by NF-κB signaling and he ch oma in modeling b ahma
complex. In he a body, o e exp ession o lincRNA-IBIN a ec ed he exp ession o Toll pa h-
way -media ed genes. No ably, o e exp ession o lincRNA-IBIN in unchallenged lies ele a ed
suga le els in he hemolymph by enhancing he exp ession o genes impo an o glucose
e ie al. These da a show ha lncRNA genes play a ole in D osophila immuni y and indica e
ha lincRNA-IBIN ac s as a link be ween inna e immune esponses and me abolism.
Au ho summa y
D osophila melanogas e is a powe ul gene ic model o s udying he inna e immune
mechanisms conse ed om lies o humans. Wi h ecen me hodology, such as whole
ansc ip ome analyses, no el non-p o ein coding genes in addi ion o p o ein coding
genes a e being inc easingly iden i ied. These long and sho non-coding RNA genes a e
loca ed be ween and wi hin p o ein coding genes in he genome, and hei unc ions a e
la gely uncha ac e ized. In humans, such RNA genes ha e been shown o a ec nume ous
physiological p ocesses including immune esponses. In D osophila, e y ew non-coding
RNA genes ha e so a been cha ac e ized in de ail. In his s udy, we ha e iden i ied and
cha ac e ized an immune-inducible long non-coding RNA gene, lincRNA-IBIN.lincRNA-
PLOS Pa hogens | h ps://doi.o g/10.1371/jou nal.ppa .1007504 Janua y 11, 2019 1 / 28
a1111111111
a1111111111
a1111111111
a1111111111
a1111111111
OPEN ACCESS
Ci a ion: Valanne S, Salminen TS, Ja¨ ela¨-S o¨l ing
M, Vesala L, Ra¨me M (2019) Immune-inducible
non-coding RNA molecule lincRNA-IBIN connec s
immuni y and me abolism in D osophila
melanogas e . PLoS Pa hog 15(1): e1007504.
h ps://doi.o g/10.1371/jou nal.ppa .1007504
Edi o : Pe os Ligoxygakis, Uni e si y o Ox o d,
UNITED KINGDOM
Recei ed: May 31, 2018
Accep ed: Decembe 5, 2018
Published: Janua y 11, 2019
Copy igh : ©2019 Valanne e al. This is an open
access a icle dis ibu ed unde he e ms o he
C ea i e Commons A ibu ion License, which
pe mi s un es ic ed use, dis ibu ion, and
ep oduc ion in any medium, p o ided he o iginal
au ho and sou ce a e c edi ed.
Da a A ailabili y S a emen : The ansc ip ome
analysis (RNA sequencing) da ase s a e a ailable
h ough he ollowing links: The i s ansc ip ome
analysis (M. lu eus 24h-induced genes compa ed
o con ols): h ps://www.ncbi.nlm.nih.go /geo/
que y/acc.cgi?acc=GSE120387 The second
ansc ip ome analysis (e ec o lincRNA-IBIN
o e exp ession and in ec ion o gene exp ession
on he whole ansc ip ome scale): h ps://www.
ncbi.nlm.nih.go /geo/que y/acc.cgi?acc=
GSE120437.
IBIN is induced by exposu e o bac e ia as well as he pa asi oid wasp, Lep opilina bou-
la di, sugges ing a gene al ole in humo al and cellula inna e immuni y. Acco dingly,
o ced exp ession o lincRNA-IBIN enhances he exp ession o genes in ol ed in ca bohy-
d a e ca abolism and ele a es hemolymph glucose le els in D osophila. These esul s indi-
ca e ha lincRNA-IBIN ac s as a link be ween immuni y and me abolism in D osophila.
As esea ch in D osophila has o en esul ed in he iden i ica ion o e olu iona ily con-
se ed mechanisms also in mammals, i emains o be s udied whe he long non-coding
RNA genes egula e me abolism upon an in ec ion also in humans.
In oduc ion
The ui ly D osophila melanogas e (D. melanogas e ) is a widely used model sys em in
immunological s udies [1]. D osophila has an elegan inna e immune esponse ha includes
bo h he cellula and he humo al a ms [2,3]. Ac i a ion o he cellula immune esponse
in ol es mechanisms such as ecogni ion, phagocy osis, encapsula ion and he killing o pa a-
si es [4,5]. The humo al immune esponse is based on mic obial ecogni ion p ima ily by pep-
idoglycan ecogni ion p o eins leading o he p oduc ion o an imic obial pep ides (AMPs)
[6–9]. The humo al immune esponse is mainly media ed by wo e olu iona ily conse ed
NF-κB signaling pa hways, he Toll and he Immune de iciency (Imd) pa hway [10–12].
Recen ly, i has become e iden ha beside he p o ein coding genes ha posi i ely o nega-
i ely egula e he humo al and cellula inna e immune esponses, he e is a mul i ude o sho
and long non-coding RNA genes ha a ec inna e immune esponses [13–16]. In be ween and
wi hin p o ein coding genes in he genome, he e a e housands o uncha ac e ized non-coding
RNA genes. Small non-coding RNAs (<200 nucleo ides) a e conside ed o ha e mo e o a “house-
keeping RNA” ole. Howe e , he unc ions o long non-coding RNA (lncRNA, >200 nucleo ides)
genes a e mo e di e se [17]. Al hough he numbe o lncRNAs is s ill a ma e o deba e, ecen
me a-analyses posi he human genome o gi e ise o >60,000 lncRNAs, albei he majo i y is
p obably exp essed a low le els [18,19]. In ui lies, he e a e ewe lncRNAs in he genome and
he a io o lncRNAs o p o ein coding genes is lowe han in humans [20]. The cu en lncRNA
numbe s can be ound in he NONCODE Ve sion 5.0 da abase (www.noncode.o g).
The exp ession pa e ns o lncRNAs a e highly speci ic o issue, de elopmen al s age and
en i onmen al condi ions ( e iewed in [14,15]) and hey a e hough o ha e igh ly con olled
biological oles. Recen s udies ha e indica ed ha lncRNAs play an impo an unc ional ole
in inna e immune esponses, and speci ically in inna e immune cells. In mammals, lncRNA
genes a e exp essed in monocy es, mac ophages, dend i ic cells, neu ophils, T-cells and B-
cells [13]. A g owing lis o lncRNA genes, o example LincRNA-Cox2 [21], Le he [22],
PACER [23] and TNFα egula ing hnRNPL in e ac ing lncRNA (THRIL)[24], has been ound
o con ol gene exp ession in immune cells [13].
To s udy he ole o lncRNA genes in he D osophila immune esponse, we pe o med an-
sc ip ome analysis in D.melanogas e upon a bac e ial in ec ion wi h he G am-posi i e Mic o-
coccus lu eus (M.lu eus), gi ing pa icula emphasis o long non-coding RNA (lncRNA) genes.
The mos esponsi e o all ansc ip s was he lncRNA gene CR44404, which was up egula ed
1300- old upon a M.lu eus in ec ion. He e, we show ha CR44404 is highly induced by bo h
G am-posi i e and G am-nega i e bac e ia in D osophila adul s and by a pa asi oid wasp
in ec ion in D osophila la ae. Because o he inducible na u e o he CR44404 gene, we named
i lincRNA-IBIN (Induced By IN ec ion). Finally, we show ha lincRNA-IBIN ac s as a link
be ween inna e immune esponses and me abolism by modula ing he exp ession o genes eg-
ula ing ca bohyd a e and pep ide me abolism and a ec ing glucose le els in he hemolymph.
The ole o D osophila immune-inducible lincRNA-IBIN in immuni y and me abolism
PLOS Pa hogens | h ps://doi.o g/10.1371/jou nal.ppa .1007504 Janua y 11, 2019 2 / 28
Funding: This wo k was suppo ed by he Sig id
Juselius Founda ion (h p://sig idjuselius. i/), he
Academy o Finland (h p://www.aka. i/en/; g an
277495), he Compe i i e S a e Resea ch Financing
o he Expe Responsibili y a ea o Tampe e
Uni e si y Hospi al and Tampe e Tube culosis
Founda ion (h p://www. ube kuloosisaa io. i/) o
MR. The wo k was suppo ed by he Finnish
Cul u al Founda ion (h ps://www.sk . i/en) and
Academy o Finland (h p://www.aka. i/en/; g an
276360) o LV. The D osophila wo k was ca ied
ou in he Tampe e D osophila Facili y, which is
pa ly unded by Biocen e Finland (h ps://www.
biocen e . i/). The unde s had no ole in s udy
design, da a collec ion and analysis, decision o
publish, o p epa a ion o he manusc ip .
Compe ing in e es s: The au ho s ha e decla ed
ha no compe ing in e es s exis .
Resul s
Long non-coding RNA IBIN (CR44404) exp ession is induced by an
in ec ion in D osophila
To in es iga e he impo ance o long non-coding RNAs in D osophila immuni y, we ca ied
ou a ansc ip ome analysis (RNAseq) o lies 24h a e in ec ion wi h he G am-posi i e M.
lu eus in compa ison o age and sex-ma ched unin ec ed con ols. The RNA sequencing me hod
used in his s udy ecognizes polyadenyla ed non-coding RNAs, which a e hough o ep esen
he majo i y o long non-coding RNAs, al hough also ones wi hou poly-A ails exis [25,26].
P io o he ansc ip ome analysis, one o he Toll pa hway a ge genes IM1 (Immune induced
molecule 1), was measu ed om emales and males upon M.lu eus in ec ion. IM1 was obus ly
induced in bo h male and emale D osophila (S1A Fig), and males we e chosen o he ansc ip-
ome analysis. LYS- ype pep idoglycan con aining G am-posi i e bac e ia a e known o induce
he classical Toll pa hway a ge genes including a numbe o an imic obial pep ides (AMPs)
(e.g. [27]). As expec ed, AMPs we e s ongly up egula ed in he ansc ip ome analysis upon a
M.lu eus in ec ion, including D o,M k,D s, and mul iple IMs (Fig 1A,S1 Table). No ewo hy,
he highes up egula ion in in ec ed lies was seen in a p e iously unanno a ed long non-coding
RNA gene, CR44404 (Fig 1A). The baseline exp ession o CR44404 is e y low, and upon a M.
lu eus in ec ion, i is induced by abou 1300- old. The induc ion o CR44404 exp ession was also
shown o be compa able be ween males and emales upon M.lu eus in ec ion (S1B Fig).
Besides CR44404, he e we e only 15 o he lncRNAs ha we e mo e han 3- old up egu-
la ed upon in ec ion (Fig 1B,S2 Table). While indings om e eb a es indica e ha lncRNAs
ha e wide and impo an unc ions in immune esponses [13–16], cance and me abolism
[28,29], he ole o lncRNAs in D osophila immuni y has only begun o eme ge. CR44404 was
chosen o u he analysis based on i s in iguing exp ession pa e n.
CR44404 is 228 nucleo ides long (genomic loci 2R:17,671,068..17,671,295 [+]) and i is
loca ed be ween wo p o ein coding genes; P32 and CG30109. The e o e, CR44404 is classi ied
as a long non-coding in e genic RNA (lincRNA) molecule. Al hough CR44404 is e y close o
he p o ein-coding gene P32, he genes do no o e lap. To con i m ha CR44404 is an inde-
penden ansc ip , he exp ession le els o he adjacen genes we e examined in he ansc ip-
ome analysis. Nei he P32 no CG30109 we e a ec ed by in ec ion in he same way as
CR44404, he exp ession o which was ~1300- old upon a M.lu eus in ec ion. Ins ead, P32
(1.17- old) and CG30109 (1.27- old) we e no signi ican ly induced by M.lu eus in ec ion a
24h ime poin , indica ing ha CR44404 is exp essed independen ly om hem.
CR44404 is polyadenyla ed; i has a highly conse ed clea age signal sequence AAUAA
owa ds he end o he ull-leng h ansc ip . CR44404 does no con ain open eading ames
and based on he NCBI domain sea ch ool [30], i does no con ain any p edic ed p o ein
domains. Acco ding o RNA seconda y s uc u e p edic ions, CR44404 is mul ib anched (con-
ains 3–4 GC- ich b anches) and con ains a a iable amoun o smalle (hai pin) loops con-
nec ed o a bigge loop (S2 Fig). Based on he high exp ession o CR44404 upon in ec ion and
i s genomic loca ion, we named he gene lincRNA-Induced By IN ec ion (lincRNA-IBIN).
lincRNA-IBIN exp ession is induced by G am-posi i e and -nega i e
bac e ia and pa asi oid wasps and is dependen on he unc ional Toll and
Imd pa hways and he BAP complex
As lincRNA-IBIN was shown o be s ongly induced by G am-posi i e bac e ia 24h p.i, we nex
in ec ed male lies wi h ei he he G am-posi i e M.lu eus o he G am-nega i e En e obac e
cloacae (E. cloacae) o measu e he gene exp ession kine ics o lincRNA-IBIN du ing mul iple
The ole o D osophila immune-inducible lincRNA-IBIN in immuni y and me abolism
PLOS Pa hogens | h ps://doi.o g/10.1371/jou nal.ppa .1007504 Janua y 11, 2019 3 / 28
Fig 1. lincRNA-IBIN (CR44404) exp ession is s ongly induced by G am-posi i e and G am-nega i e bac e ia and i s exp ession is egula ed by he Toll and Imd
pa hways and a unc ional BAP complex. A) In a whole ansc ip ome analysis, 28 genes we e mo e han 18- old up egula ed a e a M.lu eus in ec ion. The highes
up egula ion in in ec ed lies was ound in a long non-coding RNA gene, CR44404 (lincRNA-IBIN). p- alue <0.005 in all selec ed genes (S1 Table). B) 16 up egula ed
lncRNA genes ha e mo e han a h ee old exp ession change in esponse o a M.lu eus in ec ion in adul lies. p- alue <0.05 in all selec ed lncRNA genes (S2 Table). C)
lincRNA-IBIN exp ession is induced in D osophila adul s wi hin wo hou s o an in ec ion by M.lu eus o E.cloacae. Fo old-induc ion alues, exp ession alues in
unin ec ed samples we e se o 1. D) M.lu eus-induced lincRNA-IBIN exp ession is dependen on he Toll pa hway ( he Toll pa hway adap o p o ein MyD88) unc ion.
E) E.cloacae-induced lincRNA-IBIN exp ession is dependen on he Imd pa hway (Relish) unc ion. In Dand E, o old-induc ion alues, exp ession alues in
The ole o D osophila immune-inducible lincRNA-IBIN in immuni y and me abolism
PLOS Pa hogens | h ps://doi.o g/10.1371/jou nal.ppa .1007504 Janua y 11, 2019 4 / 28
ime poin s anging om 0-24h a e in ec ion (Fig 1C). This e ealed ha lincRNA-IBIN is also
induced by G am-nega i e bac e ia, and in bo h in ec ions, he induc ion occu ed wi hin he
i s hou s o in ec ion and g adually inc eased owa ds he 24h ime poin (Fig 1C). To u he
s udy he ole he Toll pa hway and he Imd pa hway [10,11], in he exp ession o lincRNA-
IBIN, we knocked down MyD88 (an adap o p o ein unc ioning downs eam o he Toll ecep-
o in he Toll pa hway), cac us (a nega i e egula o o he Toll pa hway) and Relish (an Imd
pa hway NF-κB ac o ). The ea e , we in ec ed he lies wi h M.lu eus o E.cloacae and mea-
su ed he lincRNA-IBIN RNA le els. Upon a M.lu eus in ec ion, he exp ession o lincRNA-
IBIN was shown o be dependen on he exp ession o MyD88, i.e he unc ional Toll pa hway
(Fig 1D). Knocking down MyD88 upon a E.cloacae in ec ion had no e ec on he exp ession o
lincRNA-IBIN (Fig 1E), whe eas knocking down Relish o using he Relish
E20
null mu an inhib-
i ed he exp ession o lincRNA-IBIN, showing ha i equi es a unc ional Imd pa hway in his
con ex (Fig 1E). Knocking down Relish o using he Relish
E20
null mu an upon a M.lu eus
in ec ion did no inhibi he exp ession o lincRNA-IBIN (Fig 1D). The ole o he Toll pa hway
ac i a ion o he exp ession o lincRNA-IBIN was u he con i med in unin ec ed lies by
knocking down he inhibi o o he κB ac o cac us, which s ongly induced he exp ession o
lincRNA-IBIN (Fig 1F). Also, du ing he la al s age, lincRNA-IBIN was induced by he ec opic
exp ession o he cons i u i ely ac i e o m o he Toll ecep o , Toll
10b
(Fig 1G) and by o e ex-
p ession o he Imd molecule wi h he ubiqui ous da-GAL4 d i e (Fig 1H).
Nex , we es ed i he Osa-con aining B ahma (BAP) complex is needed o he exp ession
o he lincRNA-IBIN. The BAP complex is a g oup o p o ein-coding genes wo king oge he
in emodeling ch oma in [31], and he complex has p e iously been epo ed o a ec he Toll
pa hway-induced D s-luc epo e in i o in D osophila [32,33]. In e es ingly, when osa
exp ession was knocked down, lincRNA-IBIN exp ession was s ongly inhibi ed upon bo h a
M.lu eus (Fig 1I) and a E.cloacae (Fig 1J) in ec ion. The knockdown o ano he BAP complex
componen b ahma (b m) also educed lincRNA-IBIN exp ession upon bo h in ec ions (Fig 1I
and 1J). Mo eo e , because lincRNA-IBIN is s ongly induced by a bac e ial in ec ion in D o-
sophila adul s, indica ing a ole in he humo al immune esponse, we nex s udied whe he
lincRNA-IBIN is also induced du ing he cellula immune esponse by in ec ing D osophila la -
ae wi h Lep opilina boula di (L. boula di) pa asi oid wasps. Also in his con ex , he exp es-
sion o lincRNA-IBIN was s ongly induced (Fig 2).
In conclusion, lincRNA-IBIN seems o ha e a a he b oad ole in he immune esponse,
being induced by a bac e ial in ec ion in lies and by pa asi oid wasps in la ae. The M.lu eus
-media ed induc ion o lincRNA-IBIN exp ession was shown o be dependen on he Toll pa h-
way, whe eas he E.cloacae -media ed induc ion equi es he Relish/Imd pa hway. In each
s udied case, lincRNA-IBIN exp ession was dependen on a unc ional BAP complex. This ype
o unspeci ic induc ion ia bo h NF-κB pa hways is a he uncommon in D osophila and
a gues o a gene al immuni y ela ed unc ion o lincRNA-IBIN.
Tissue-speci ic exp ession and cellula localiza ion o lincRNA-IBIN
To unde s and he ole o lincRNA-IBIN in D osophila immuni y, we in es iga ed whe e
lincRNA-IBIN was exp essed and whe he i s e ec s we e issue-speci ic. Since lincRNA-IBIN
unin ec ed w,MyD88
IR
samples we e se o 1 F) lincRNA-IBIN exp ession is induced in D osophila adul s upon silencing o he D osophila inhibi o o κB ac o cac us.
G) lincRNA-IBIN exp ession is induced in D osophila la ae wi h he cons i u i ely ac i e o m o he Toll ecep o , Toll
10b
. In Fand G, o old-induc ion alues,
exp ession alues in unin ec ed/un ea ed wsamples we e se o 1. H) lincRNA-IBIN exp ession is also modes ly induced by he ubiqui ous o e exp ession o Imd wi h
daugh e less-GAL4 (da>Imd) in D osophila la ae. Fo old-induc ion alues, he exp ession alue o w,da>was se o 1. I-J) Bo h M.lu eus and E.cloacae-induced
lincRNA-IBIN exp ession is dependen on he unc ional ch oma in emodeling BAP complex. In Iand J, o old-induc ion alues, exp ession alues in unin ec ed w,
osa
IR
samples we e se o 1.
h ps://doi.o g/10.1371/jou nal.ppa .1007504.g001
The ole o D osophila immune-inducible lincRNA-IBIN in immuni y and me abolism
PLOS Pa hogens | h ps://doi.o g/10.1371/jou nal.ppa .1007504 Janua y 11, 2019 5 / 28

exp ession is s ongly in ec ion-inducible, we easoned ha i is mos likely exp essed in
immune- esponsi e issues ( he a body and hemocy es, he D osophila blood cells). Wasp
in ec ion o D osophila la ae led o he induc ion o lincRNA-IBIN exp ession in he a body
and hemocy es (Fig 2A and 2B). Like in lies, osa RNAi in la al hemocy es (HH>osa
IR
) and
a bodies (C564>osa
IR
) kep he exp ession o lincRNA-IBIN close o he basal le el (Fig 2A
and 2B). Because lincRNA-IBIN is a sho gene and e y s ongly induced upon in ec ion like
AMPs, we nex in es iga ed whe he lincRNA-IBIN is sec e ed in o he plasma in simila man-
ne as AMPs (Fig 2C). Fi s , we con i med ha hemocy es and plasma we e sepa a ed by cen-
i uga ion (S3 Fig). We also checked he exp ession o a hemocy e speci ic gene Hemolec in
(Hml) and a a body-speci ic gene La al se um p o ein 1 alpha (Lsp1α) in each issue sample
(Fig 2C, i and ii). A Hml signal was de ec ed in he hemocy e ac ion, whe eas Lsp1αle els
we e high in a body samples bu no in hemocy es o in he plasma (Fig 2C, i and ii). We did
no de ec lincRNA-IBIN in he plasma ac ion in la ge quan i ies (Fig 2C, iii).
Pin-poin ing he cellula localiza ion o a lncRNA e eals ypically mo e abou i s unc ion
han does he s uc u e o he RNA. A RNA FISH (RNA Fluo escen In Si u Hyb idiza ion) p o-
ocol was pe o med wi h 3 d ins a la al hemocy es. Unin ec ed w
1118
la al hemocy es we e
used as a con ol o imaging he basal exp ession le el and localiza ion o lincRNA-IBIN (Fig
Fig 2. lincRNA-IBIN exp ession is induced in immunogenic issues and i s cellula localiza ion is mainly nuclea .
A-B) lincRNA-IBIN is induced in he la al a body and hemocy es a e a L.boula di in ec ion and is dependen on
he exp ession o he BAP complex membe osa in hese issues. Fo old-induc ion alues, exp ession alues in
unin ec ed w,osa
IR
samples we e se o 1. C) qPCR o hemocy e-speci ic Hml (i) and a body-speci ic Lsp1α(ii) was
ca ied ou o con i m he pu i y o he issue ac ions. lincRNA-IBIN was no ound in he plasma ac ion in la ge
quan i ies (iii). D) RNA FISH pe o med in la al hemocy es shows ha lincRNA-IBIN is mainly loca ed in he
nucleus; pink labelling (lincRNA-IBIN) co-localizes wi h blue nuclea labelling (DAPI). i) Nega i e con ol (wi hou
lincRNA-IBIN p obes), ii) hemocy es om w
1118
la ae showing he basal exp ession le el and localiza ion o lincRNA-
IBIN,iii) hemocy es om la ae o e exp essing lincRNA-IBIN
1
(HH>lincRNA-IBIN
1
) and in ec ed wi h L.boula di.
h ps://doi.o g/10.1371/jou nal.ppa .1007504.g002
The ole o D osophila immune-inducible lincRNA-IBIN in immuni y and me abolism
PLOS Pa hogens | h ps://doi.o g/10.1371/jou nal.ppa .1007504 Janua y 11, 2019 6 / 28
2D, ii). Hemocy es om la ae o e exp essing lincRNA-IBIN
1
(HH>lincRNA-IBIN
1
) and
in ec ed wi h L.boula di we e used o induce he exp ession o lincRNA-IBIN (Fig 2D, iii), and
hey showed ha lincRNA-IBIN (pink labelling) was p ima ily exp essed in he nuclea com-
pa men (blue labelling) o he cell. The e o e, we conclude ha lincRNA-IBIN is exp essed in
immune esponsi e issues, is no sec e ed in o he plasma in la ge amoun s and i s cellula
localiza ion is mainly nuclea . This sugges s ha he unc ion o lincRNA-IBIN may be in he
egula ion o gene exp ession, which is ypical o lncRNAs [34–36].
O e exp essing lincRNA-IBIN enhances he exp ession o selec ed AMPs
upon an in ec ion and su i al om an in ec ion
To s udy he unc ion o lincRNA-IBIN in unin ec ed and in ec ed lies, we gene a ed UAS-
lincRNA-IBIN o e exp ession ly lines. Two o he gene a ed lines, lincRNA-IBIN
1
and lincRNA-
IBIN
7
, we e selec ed o he ollowing expe imen s. lincRNA-IBIN o e exp ession in he lincRNA-
IBIN
1
and lincRNA-IBIN
7
lines was induced using he C564-GAL4 d i e , which is exp essed
s ongly in he a body [37,38](Fig 3A). lincRNA-IBIN exp ession in unin ec ed lies was signi i-
can ly inc eased in bo h o e exp ession lines (Fig 3A, whi e ba s), wi h highe exp ession le els in
he lincRNA-IBIN
7
line. 24 h a e a M.lu eus in ec ion, he e ec o he o e exp ession on he
exp ession o lincRNA-IBIN was masked by he o e whelming endogenous exp ession o
lincRNA-IBIN (Fig 3A, black ba s). To s udy he e ec o he long- e m exposu e o lies o ele-
a ed le els o lincRNA-IBIN, we moni o ed he li espan o lies o e exp essing lincRNA-IBIN
wi h he C564-GAL4 d i e and con ols. To ensu e maximal lincRNA-IBIN exp ession, lies we e
cul u ed a +29˚C o he du a ion o he expe imen . Nei he one o he lincRNA-IBIN o e ex-
p ession lines (lincRNA-IBIN
1
and lincRNA-IBIN
7
) showed a s a is ically signi ican di e ence in
he li espan be ween lies o e exp essing lincRNA-IBIN and con ols (S4 Fig).
As lincRNA-IBIN was he mos s ongly induced gene upon a M.lu eus in ec ion, we i s
in es iga ed whe he o e exp essing lincRNA-IBIN a ec ed he su i al o he lies agains a
sep ic in ec ion wi h G am-posi i e bac e ia. Fo he su i al expe imen , we chose lincRNA-
IBIN
7
lies as hese p oduced he highes o e exp ession wi hou an in ec ion. We i s in ec ed
lincRNA-IBIN
7
lies wi h M.lu eus o p ime he Toll pa hway. 24h la e , he lies we e in ec ed
wi h he mo e pa hogenic bac e ia, En e ococcus aecalis (E. aecalis) [39]. O e exp ession o
lincRNA-IBIN
7
(C564-GAL4>lincRNA-IBIN
7
) imp o ed he su i al o he lies om he
in ec ion compa ed o he lies no o e exp essing lincRNA-IBIN (Fig 3B). MyD88 (a posi i e
egula o o he Toll pa hway) and cac us (a nega i e egula o o he Toll pa hway) knock-
down lies we e used as con ols. This indica es ha lincRNA-IBIN posi i ely a ec s immuni y
agains he pa hogenic G am-posi i e bac e ia E. aecalis.
Nex , we in es iga ed whe he lincRNA-IBIN egula es he cen al ea u e o he ly immune
de ense agains G am-posi i e bac e ia, namely he p oduc ion o AMPs ia he Toll pa hway.
The exp ession o he Toll pa hway media ed genes was moni o ed in lies o e exp essing
lincRNA-IBIN and con ols a e exposu e o M.lu eus o 24 hou s (Fig 3C and 3D). lincRNA-
IBIN o e exp ession using bo h he lincRNA-IBIN
1
and lincRNA-IBIN
7
lines wi h he
C564-GAL4 d i e esul ed in signi ican ly ele a ed le els o IM1 upon in ec ion (Fig 3C). The
exp ession o D osomycin was ele a ed in C564>lincRNA-IBIN
7
lies, whe eas in he lincRNA-
IBIN
1
line he end was simila , ye no signi ican (Fig 3D). As expec ed, MyD88 knockdown
dec eased he exp ession o IM1 and D osomycin upon in ec ion, whe eas cac us knockdown
caused a s ong induc ion o IM1 and D osomycin exp ession also in he unin ec ed lies (Fig
3C and 3D).
To add ess he impo ance o lincRNA-IBIN in a si ua ion whe e he exp ession o endoge-
nous lincRNA-IBIN is p e en ed, we u ilized he ollowing expe imen al app oach. Upon an E.
The ole o D osophila immune-inducible lincRNA-IBIN in immuni y and me abolism
PLOS Pa hogens | h ps://doi.o g/10.1371/jou nal.ppa .1007504 Janua y 11, 2019 7 / 28
Fig 3. O e exp essing lincRNA-IBIN imp o es he su i al o D osophila adul s om an in ec ion and he exp ession o selec ed a ge genes.
A) UAS-lincRNA-IBIN (CR44404) o e exp ession wi h he C564-GAL4 d i e (C564>lincRNA-IBIN
1
and C564>lincRNA-IBIN
7
) signi ican ly
The ole o D osophila immune-inducible lincRNA-IBIN in immuni y and me abolism
PLOS Pa hogens | h ps://doi.o g/10.1371/jou nal.ppa .1007504 Janua y 11, 2019 8 / 28
cloacae in ec ion, lincRNA-IBIN exp ession is ully dependen on Relish (Fig 1E). Relish RNAi
lies do no p oduce endogenous lincRNA-IBIN upon an E.cloacae in ec ion, bu in he Relish
RNAi lies combined wi h he lincRNA-IBIN
7
cons uc , lincRNA-IBIN is o e exp essed (Fig
3E). Nex , we moni o ed he su i al o Relish RNAi lies and Relish RNAi lies wi h he
lincRNA-IBIN
7
cons uc om an E.cloacae in ec ion (Fig 3F). Fig 3F demons a es ha
lincRNA-IBIN o e exp ession p o ides p o ec ion agains an E.cloacae in ec ion. lincRNA-
IBIN o e exp ession does no i sel induce an imic obial pep ides (Fig 3G and 3H), indica ing
ha he p o ec ion is independen o he AMPs. Taken oge he , lincRNA-IBIN o e exp ession
enhances he exp ession o a ge genes o he Toll pa hway. Upon in ec ion, lincRNA-IBIN
o e exp ession ga e lies a su i al ad an age. Howe e , his is no due o he induc ion o
AMPs i sel , bu esul s om a mechanism ha p omp s u he in es iga ion.
O e exp ession o lincRNA-IBIN in hemocy es inc eases hemocy e
numbe s
As shown in Fig 2,lincRNA-IBIN is exp essed in immunogenic issues in he ly, such as he a
body and hemocy es. Nex , we examined he ole o lincRNA-IBIN o e exp ession in he cellu-
la esponse, i.e. he hemocy es. Phagocy ic plasma ocy es a e he main hemocy e ype in unin-
ec ed la ae. Lamellocy es, which a e o med upon a pa asi oid wasp in ec ion, unc ion in
he encapsula ion o he wasp eggs and la ae [5,40,41]. To u he in es iga e i lincRNA-IBIN
has a ole in wo majo componen s o he cellula immune esponse, namely he inc ease in
hemocy e numbe s and di e en ia ion o lamellocy es, we u ilized he hemocy e epo e s
(msnChe y,ea e GFP) o de ec hemocy es wi h low cy ome e . The combina ion o he
epo e s wi h he hemocy e (MeHH> o sho , see ma e ials and me hods) and a body
(MeC564>) d i e s enabled us o de ec he hemocy es and o e exp ess lincRNA-IBIN in hese
issues. D i ing lincRNA-IBIN exp ession in hemocy es (MeHH>lincRNA-IBIN) esul ed in
an inc ease in o al hemocy e numbe s in unin ec ed la ae (S5A Fig), bu did no induce
ec opic lamellocy e o ma ion (S5A’ Fig). lincRNA-IBIN o e exp ession in he a body
(MeC564>lincRNA-IBIN) did no ha e an e ec on hemocy es (S5B–S5B’ Fig).
lincRNA-IBIN could enhance he p oli e a ion o hemocy es o hei elease om a ese -
oi loca ed in segmen al bands unde he la al cu icle, called he sessile compa men
[42,43]. To ha end, we imaged whole la ae and checked o he exis ence o sessile bands.
We did no obse e any no iceable loss o sessile bands ha could explain he inc eased hemo-
cy e numbe s (S5C Fig). In L.boula di-in ec ed la ae, he e was a sligh dec ease in he num-
be s o hemocy es in he lincRNA-IBIN
7
line (S5A Fig), bu lamellocy es we e no a ec ed
(S5A’ Fig). Taken oge he , he o e exp ession o lincRNA-IBIN in hemocy es inc eases he
hemocy e numbe s, bu does no a ec hemocy e di e en ia ion, in unchallenged D osophila
la ae.
inc eases he exp ession o lincRNA-IBIN in unin ec ed lies measu ed wi h qPCR, as does an in ec ion wi h M.lu eus.B) lincRNA-IBIN
o e exp ession (C564>lincRNA-IBIN
7
) imp o es he su i al o he lies a e an in ec ion wi h M.lu eus +E. aecalis.C-D) lincRNA-IBIN
o e exp ession inc eases he exp ession o wo Toll pa hway a ge genes IM1 (C) and D osomycin (D) a e a M.lu eus in ec ion. MyD88
knockdown lies we e used as a nega i e con ol and cac us knockdown lies as a posi i e con ol. In A, C and D, o old-induc ion alues,
exp ession alues in unin ec ed w,lincRNA-IBIN
7
samples we e se o 1. E) E.cloacae-induced endogenous lincRNA-IBIN exp ession is los upon
Relish RNAi. lincRNA-IBIN o e exp ession is shown in he Relish RNAi backg ound. F) Upon a E.cloacae in ec ion, lincRNA-IBIN o e exp ession
gi es a s a is ically signi ican su i al ad an age o lies wi h a Relish RNAi backg ound. G) A acin C (A C) is no p oduced in Relish RNAi lies,
bu wi h IBIN o e exp ession a e y small amoun o A C is induced. H) Dip e icin A (Dp A) is no p oduced wi h o wi hou lincRNA-IBIN
o e exp ession in lies wi h a Relish RNAi backg ound upon a E.cloacae in ec ion. In E, G and H, o old-induc ion alues, exp ession alues in
unin ec ed w,Rel
IR
samples we e se o 1.
h ps://doi.o g/10.1371/jou nal.ppa .1007504.g003
The ole o D osophila immune-inducible lincRNA-IBIN in immuni y and me abolism
PLOS Pa hogens | h ps://doi.o g/10.1371/jou nal.ppa .1007504 Janua y 11, 2019 9 / 28
plasma ocy es) [78] and MSNF9mo-mChe y ( o lamellocy es, he ea e called msnChe y)
[79] we e ob ained om Robe Schulz’s labo a o y. The lines we e ecombined o c ea e he
msnChe y,ea e GFP epo e line. The msnChe y,ea e GFP epo e was u he c ossed wi h
C564-GAL4 o ob ain msnChe y,ea e GFP;C564-GAL4 (MeC564> o sho ). msnChe y,
ea e GFP; Hml
Δ
-GAL4; he He-GAL4 (MeHH>) line was a kind gi om I. Ande l.
To c ea e lincRNA-IBIN o e exp essing ly lines, he ull-leng h gene o lincRNA-IBIN was
cloned in o he EcoRI and BcuI (SpeI) es ic ion si es in he pUAST ec o using he ollowing
p ime s (wi h es ic ion si es unde lined): CR44404_F: TAAGCAGAATTCCACAATCTAAA
GTTAACTTGCC and CR44404_R: CACACAACTAGTGTTTATTTTCTTTCTATGGTTG. The
p oduced plasmids we e injec ed in o he w
1118
backg ound in Bes Gene Inc., USA ( hebes gene.
com). Ten lines p oducing ed-eyed ans o man s we e gene a ed, and wo lines (lincRNA-IBIN
1
and lincRNA-IBIN
7
) wi h good o e exp ession o lincRNA-IBIN we e selec ed o expe imen s.
Fo he expe imen s, 10–15 i gin emales we e c ossed wi h 5–7 males pe ial con aining
mashed-po a o, sy up and yeas -based ly ood medium. C osses we e kep a +25˚C and lies
ans e ed daily in o esh ials. The ials wi h eggs we e ans e ed o +29˚C a e one day o
egg laying and kep he e un il he expe imen s a he la al o adul s age unless o he wise
s a ed. Tes g oups and con ols we e kep a he same condi ions a all imes. A e es ing ha
a ge genes o he Toll pa hway we e induced in a simila manne in he p ogeny male and
emale lies, male lies we e used o he ansc ip ome analysis wi h and wi hou a M.lu eus
in ec ion. The exp ession o CR44404 was es ed in bo h emale and male lies and ound o be
equi alen , a e which male lies we e used in all o he subsequen expe imen s.
Fo he li espan expe imen , lincRNA-IBIN o e exp essing lies (lincRNA-IBIN
1
and
lincRNA-IBIN
7
lines) we e c ossed wi h C564>d i e lies a +25˚C. A e one day, he eggs
we e ans e ed o de elop a +29˚C o a maximum lincRNA-IBIN o e exp ession o he
en i e li espan o he lies. Twice a week, he numbe o he lies was eco ded and he lies
ans e ed o esh ood.
Cul u ing bac e ia o in ec ions
Mic ococcus lu eus (M.lu eus) was cul u ed on Lu ia-Be ani (LB) aga pla es unde S ep o-
mycin selec ion ( inal concen a ion 100 μg/ml) and le o g ow a 29˚C o 2–3 days. En e o-
bac e cloacae (E.cloacae) was cul u ed on LB aga pla es unde Nalidixic acid selec ion ( inal
concen a ion 15 μg/ml) and he pla es we e incuba ed o e nigh a 37˚C. The concen a ed
bac e ial cul u e used o p icking he lies was p epa ed by collec ing he colonies om he
pla e in o 100μl o 50% glyce ol in phospha e bu e ed saline (PBS; 137 mmol/l NaCl, 2.7
mmol/l KCl, 10 mmol/l Na
2
HPO
4
, 1.8 mmol/l KH
2
PO
4
).
En e ococcus aecalis (E. aecalis) was cul u ed in B ain-Hea -In usion (BHI) medium and
incuba ed a 37˚C wi h shaking (225 pm) o e nigh . The abso bance o he E. aecalis bac e ial
cul u e g own o e nigh was measu ed wi h a spec opho ome e a 600nm a e which i was
dilu ed 1:25 in 5 ml o BHI medium and le o g ow o 2–3 hou s a 37˚C wi h shaking (225
pm) un il he abso bance a 600nm was 0.75. Then 2 ml o he bac e ial cul u e was cen i-
uged a 700 x g o 5 min and he supe na an was disca ded. The pelle was esuspended in o
100 μl o 50% glyce ol in PBS and he bac e ial concen a e was used o p icking he lies.
Fly in ec ions
Fo bac e ial in ec ions, 0–2 day old male lies we e collec ed and placed a +29˚C o 48h,
a e which a sep ic inju y o he lies was caused by p icking hem in he ho ax wi h a hin
sha p ungs en wi e dipped in o a concen a ed bac e ial cul u e. Fo he ac i a ion o he Toll
pa hway, lies we e in ec ed wi h M.lu eus (G am-posi i e bac e ia) and incuba ed o 24h a
The ole o D osophila immune-inducible lincRNA-IBIN in immuni y and me abolism
PLOS Pa hogens | h ps://doi.o g/10.1371/jou nal.ppa .1007504 Janua y 11, 2019 16 / 28

25˚C. Fo measu ing AMP exp ession le els, in ec ed lies and non-in ec ed con ols we e
incuba ed a 25˚C o he du a ion o he in ec ion, ha es ed, and hei RNAs we e ex ac ed
as desc ibed below. Fo su i al expe imen s, M.lu eus in ec ed lies (24h, 25˚C) we e subse-
quen ly in ec ed wi h E. aecalis and incuba ed a RT. The su i al o he lies was moni o ed
o 48h, as desc ibed ea lie [39]. To ac i a e he Imd pa hway, he lies we e in ec ed wi h he
G am-nega i e bac e ium E.cloacae, and he lies we e incuba ed a 25˚C o he du a ion o
he in ec ion.
In ec ing D osophila la ae wi h Lep opilina boula di wasps
2
nd
ins a la ae we e in ec ed wi h s ain G486 o L.boula di pa asi oid wasps by placing 20
emale wasps in ials wi h la ae. A e wo hou s a oom empe a u e, he wasps we e
emo ed and he la ae we e ans e ed back o +29˚C. 48 hou s la e he la ae we e dis-
sec ed o collec he hemocy es, plasma and a bodies. The in ec ion s a us o he la ae was
checked by isually con i ming he p esence o L.boula di eggs o la ae.
T ansc ip ome analysis om o al RNA (RNA sequencing)
Fo he i s ansc ip ome analysis (Fig 1A and 1B), o al RNAs om unin ec ed o M.lu eus
-in ec ed (24h p.i.) w,osa
IR
male lies we e ex ac ed wi h he TRI eagen . Fo he second
ansc ip ome analysis (Fig 4), o al RNAs we e ex ac ed om unin ec ed male lies wi h
lincRNA-IBIN o e exp ession (C564>lincRNA-IBIN
7
), unin ec ed con ols (w
1118
,lincRNA-
IBIN
7
), M.lu eus -in ec ed lincRNA-IBIN OE and con ol lies (24 h p.i.) and E.cloacae
-in ec ed lincRNA-IBIN OE and con ol lies (6 h p.i.). All he sample g oups we e c ossed a
he same ime and kep in he same condi ions un il collec ion. The esul ing RNA samples
we e DNase ea ed wi h he RapidOu DNA emo al ki (The mo Scien i ic). The quali y o
he o al RNA samples was ensu ed wi h he Ad anced Analy ical F agmen Analyze and
ound o be good. To al RNA samples we e pu e, in ac and all samples we e o simila quali y.
The p epa a ion o he RNA lib a ies and Illumina HiSeq 2500 sequencing we e ca ied ou
in he Finnish Mic oa ay and Sequencing Cen e (Tu ku, Finland). The RNA lib a ies we e
p epa ed acco ding o he Illumina T uSeq S anded mRNA Sample P epa a ion Guide (pa
# 15031047): Fi s ly, he poly-A con aining RNA molecules we e pu i ied using a poly-T oligo
a ached o magne ic beads. Following pu i ica ion, he RNA was agmen ed in o small pieces
using di alen ca ions unde an ele a ed empe a u e. The clea ed RNA agmen s we e copied
in o i s s and cDNA using e e se ansc ip ase and andom p ime s. S and speci ici y was
achie ed by eplacing dTTP wi h dUTP in he Second S and, ollowed by second s and
cDNA syn hesis using DNA Polyme ase I and RNase H. The inco po a ion o dUTP in second
s and syn hesis quenches he second s and du ing ampli ica ion, because he polyme ase
used in he assay is no inco po a ed pas his nucleo ide. The addi ion o Ac inomycin D o
Fi s S and Syn hesis Ac D mix (FSA) p e en s spu ious DNA-dependen syn hesis, while
allowing RNA-dependen syn hesis, imp o ing s and speci ici y. These cDNA agmen s hen
ha e he addi ion o a single ’A’ base and subsequen liga ion o he adap e : he Unique Illu-
mina T uSeq indexing adap e was liga ed o each sample du ing he adap e liga ion s ep o
la e pooling o se e al samples in one low cell lane. The p oduc s we e hen pu i ied and
en iched wi h PCR o c ea e he inal cDNA lib a y. Typically, he RNAseq lib a y agmen s
a e in he ange o 200–700 bp and he a e age size o he agmen s is 250–350 bp. The sam-
ples we e no malized, pooled o he au oma ed clus e p epa a ion and sequenced wi h an
Illumina HiSeq 2500 ins umen using T uSeq 3 sequencing chemis y. Pai ed-end sequenc-
ing wi h a 1 x 50 bp ead leng h was used, ollowed by a 6 bp index un. The echnical quali y
o he HiSeq 2500 un was good and he clus e amoun was as expec ed.
The ole o D osophila immune-inducible lincRNA-IBIN in immuni y and me abolism
PLOS Pa hogens | h ps://doi.o g/10.1371/jou nal.ppa .1007504 Janua y 11, 2019 17 / 28
In bo h ansc ip ome analyses, he eads ob ained we e aligned agains he D osophila mel-
anogas e e e ence genome (BDGP6 assembly, downloaded om he Illumina iGenomes
websi e and o iginally de i ed om Ensembl). The eads we e associa ed wi h known genes
based on Re Seq anno a ions de i ed om UCSC da abase and he numbe o eads associa ed
wi h each gene was coun ed using he ea u eCoun me hod. The coun s we e no malized
using he TMM no malisa ion me hod o he edgeR R/Bioconduc o package. The numbe o
eads is ep esen ed as RPKM alues (Reads Pe Kilobase o exon pe Million eads mapped).
RPKM = o al gene eads / [mapped eads (millions) x o al leng h o gene exons (kb)]. Genes
wi h exp ession alues ( ead numbe ) o less han 0.125 ac oss he ea men s we e conside ed
o be exp essed a low le els and excluded om he analysis.
Tissue p epa a ion o RNA ex ac ion
Fo ex ac ing RNA om whole lies o la ae, 3 x 5 indi iduals pe pheno ype we e collec ed
and snap- ozen on d y ice o in liquid ni ogen. Fo RNA ex ac ion om he a body, a
bodies om 3
d
ins a la ae we e dissec ed wi h o ceps unde a s e eomic oscope and washed
by dipping hem h ee imes in o a 20 μl d op o 1 x PBS. In o al, h ee biological eplica es
we e p epa ed and pools o whole a bodies om en la ae pe each biological eplica e we e
used. Samples we e snap- ozen in liquid ni ogen and s o ed a -80˚C un il RNA ex ac ion.
Fo RNA ex ac ion om hemocy es and plasma, 55–60 la ae pe eplica e we e washed,
placed in a d op o 1 x PBS on a mul iwell glass slide and dissec ed wi h o ceps o elease
hemolymph. To sepa a e hemocy es and plasma om hemolymph, suspensions we e cen i-
uged a 2500 x g o 10 min, a e which he plasma was ca e ully pipe ed in o a clean ube.
Hemocy es and plasma samples we e snap- ozen in liquid ni ogen and s o ed a -80˚C un il
RNA ex ac ion. Fo RNA ex ac ion om adul gu s, lies we e dipped in 70% e hanol and
dissec ed on a glass slide in 15 μl o 1 x PBS. The midgu egion o he gu was sepa a ed and
washed in a second d op o 1 x PBS. Gu s om 10 lies pe sample we e pooled and cen i uged
a 2000 x g o 2 min, a e which PBS was emo ed and gu s snap- ozen in liquid ni ogen
and s o ed a -80˚C un il ex ac ion.
RNA ex ac ion
To s a he RNA ex ac ion, a su icien amoun o he TRI eagen (MRC, Fishe Scien i ic)
was added o he ozen whole lies, la ae o issues. Whole lies, la ae, a body and gu is-
sues we e quickly hawed and homogenized in he TRI eagen using a mic opes le (Fishe Sci-
en i ic). Hemocy es we e homogenized in he TRI eagen by pipe ing up and down o a
minimum o en imes. Plasma samples we e quickly hawed and suspended in he TRIzol LS
eagen (The mo Fishe Scien i ic) by pipe ing up and down en imes. The ea e , o al RNAs
we e ex ac ed acco ding o he manu ac u e ’s (TRI eagen o TRIzol LS) ins uc ions. RNA
pelle s we e dissol ed in nuclease- ee wa e , and he RNA concen a ions and he pu i y we e
de e mined by a Nano-D op 2000 (The mo Scien i ic) measu emen .
Quan i a i e eal- ime PCR
Quan i a i e eal- ime PCR (qRT-PCR) was ca ied ou wi h he iTaq Uni e sal SYBR G een
One-s ep ki (Bio-Rad, He cules, CA, USA) using o al RNAs (app oxima ely 40 ng/sample) as
empla es. RpL32 o ND-39 was used as a housekeeping gene o no malize di e ences in RNA
amoun s be ween samples. In he expe imen s p esen ed in Fig 3C, he amoun s we e s an-
da dized o 40 ng o o al RNA/sample. This is because no p oduc s/mRNA om genes ha
a e conside ed o ha e a housekeeping ole a e no mally ound in he plasma. Exp ession le els
o genes in he es g oups and con ols we e measu ed wi hin he same qRT-PCR expe imen .
The ole o D osophila immune-inducible lincRNA-IBIN in immuni y and me abolism
PLOS Pa hogens | h ps://doi.o g/10.1371/jou nal.ppa .1007504 Janua y 11, 2019 18 / 28
I he samples wi hin an expe imen did no i in one 96-well pla e, a e e ence sample was
measu ed in all pla es o make in e nal no maliza ion be ween pla es possible. In he qRT-PCR
expe imen al igu es, one unin ec ed con ol sample (indica ed in he igu e legend) was se o
1, o calcula e old-induc ion alues. The p ime s used a e lis ed in Table 1.
Quan i ica ion o la al hemocy es wi h low cy ome y
Indi idual 3
d
ins a wasp-in ec ed and unin ec ed msnChe y,ea e GFP;C564>lincRNA-IBIN
(MeC564>lincRNA-IBIN), msnChe y,ea e GFP; Hml
Δ
>; He >lincRNA-IBIN (MeHH>lincRNA-
IBIN) and con ol la ae we e placed in a 20 μl d op o cold 8% BSA in 1 x PBS and dissec ed ca e-
ully wi h o ceps. Ca casses we e emo ed and he bled hemolymph was pipe ed in o a ial wi h
80 μl o 8% BSA in 1 x PBS. Ten la ae we e dissec ed pe c oss and each c oss was eplica ed h ee
imes. The samples we e un wi h a BD Accu i C6 low cy ome e (BD, F anklin Lakes, NJ, USA),
using a ga ing s a egy es ablished in [80]. In sho , GFP-posi i e cells we e de ec ed in he FL1
(510/15 BP il e ) and mChe y-posi i e cells in he FL3 (610/20 BP il e ). GFP-only, mChe y-
only and non-labelled hemocy es we e used o es ablish he ga es. Some o he GFP luo escen sig-
nal was de ec ed in he non-p ima y FL3 de ec o , and his was co ec ed o by sub ac ing 9%
om he signal.
To check how well cen i uging sepa a ed he hemocy e and plasma ac ions, i e la e 3
d
ins a HH>GFP la ae we e bled in 100 μl o 1 x PBS. The ials we e cen i uged o 10 min-
u es a 2500 g a +4˚C. The supe na an con aining he plasma was pipe ed in o ano he ial
(~90 μl) and he hemocy e pelle was e-suspended in 90 μl o 1 x PBS. Plasma and hemocy e
samples we e un wi h a low cy ome e and he numbe s o GFP-posi i e hemocy es in bo h
ac ions we e de e mined.
Imaging o D osophila la ae
La e 3
d
ins a la ae we e gen ly washed in a d op o wa e wi h a b ush, d ied on a piece o
issue pape and placed on a glass slide do sal side acing up in a d op o 70% ice-cold glyce ol.
A co e slip was placed on he la ae and hey we e s o ed a +4˚C o e nigh . The nex day, he
immobilized la ae we e imaged wi h a Zeiss AxioImage M2 wi h Apo ome 2, wi h an EC
Plan Neo lua 5x/0.16 objec i e. A Colib i LED ligh sou ce was used o exci e GFP (LED 470
nm) and mChe y (LED 555 nm) and images we e cap u ed wi h an AxioCam HRm CCD
came a. Images we e p ocessed wi h ImageJ (Ve sion: 2.0.0- c-59/1.51j) and Adobe Pho oshop
CS4. Ten la ae pe c oss we e imaged.
Table 1. qPCR p ime s.
P ime / Gene Fo wa d, 5’!3’ Re e se, 5’!3’ p oduc (bp) Ta ge
qRT-PCR p ime s
lincRNA-IBIN CAACTGCTGCCAATCCTCG GCCTGGGATCGTAGTCACTT 103 qRT-PCR
D s ATGATGCAGATCAAGTACTTG GCATCCTTCGCACCAGC 210 qRT-PCR
IM1 CTCGGTCTGCTGGCTGTGGC CCGTGGACATTGCACACCC 95 qRT-PCR
ND-39 ACCGACAAGGTTCTGACTGG CTCCGCTTAGGCAAACAGAC 201 qRT-PCR, con ol gene
RpL32 GGTTACGGATCGAACAAGCG TTCTGCATGAGCAGGACCTC 101 qRT-PCR, con ol gene
Lsp1alpha GCACTACACGCACTTCGATC CCCAGTCCTTGGCGTAGTAG 158 qRT-PCR
Hml TGCACCTGTAAGAACGGTCA GATAATGCGGATCTCCAACG 82 qRT-PCR
Mal-A1 GACCGACGTCTGGATCAG GTGAAGCCTGCTTTGGAG 138 qRT-PCR
Mal-A8 CACTGCCTCCGCTTTTTGAG CGTGGTGGTCAGATAGTCGC 110 qRT-PCR
epsilonT y AGTCGATTGAGGCCAAGGAC CCATGGTGCGGGAGTTGTAG 120 qRT-PCR
h ps://doi.o g/10.1371/jou nal.ppa .1007504. 001
The ole o D osophila immune-inducible lincRNA-IBIN in immuni y and me abolism
PLOS Pa hogens | h ps://doi.o g/10.1371/jou nal.ppa .1007504 Janua y 11, 2019 19 / 28
Cellula localiza ion o lincRNA-IBIN wi h RNA FISH in he la al
hemocy es
Fo de ec ing he cellula localiza ion o lincRNA-IBIN, he RNA luo escence in si u hyb id-
iza ion (RNA FISH) me hod wi h Cy3- agged p obes labeling he lincRNA-IBIN molecules
was used. La e 3
d
ins a male la ae we e washed in a d op o wa e wi h a b ush and he
hemolymph o wo la ae pe sample ype ( ou biological eplica es) was ca e ully bled ou
om he la ae in 20 μl o ice-cold 1 x PBS on a mul iwell glass slide well, a oiding con amina-
ion om o he issues. Hemocy es we e le o adhe e o one hou in a humidi ied chambe
a RT. Samples we e ixed wi h cold 3.7% pa a o maldehyde in 1 x PBS o 5–10 min and
washed wi h 1 x PBS o 3 x 5 min. Samples we e pe meabilized wi h 1 x PBS + 0.1% T i on X-
100 o 5 minu es and washed wi h 1 x PBS un il he e was no oam, and he mask a ound he
wells was d ied ca e ully wi h a issue pape . The samples we e blocked wi h 3% BSA in 1 x
PBS a +4˚C o/n. The RNA FISH p o ocol was pe o med by using he Quan iGene ViewRNA
Assay (A yme ix) and he p obes o lincRNA-IBIN and RpL32 o D osophila a e now a ail-
able in hei ca alog. Fo he hyb idiza ion o lincRNA-IBIN and RpL32 p obes (con ol) and a
nega i e “no p obe” con ol, p e-wa med diluen s and humidi ied chambe s we e used, and
he incuba o empe a u e (+40˚C) was moni o ed. The Wo king P obe Se Solu ion was p e-
pa ed by dilu ing each p obe se 1:100 in P obe Se Diluen QF: 20 μl d ops we e p epa ed o
each sample by combining 0.2 μl o P obe Se and 19.8 μl o P obe Se diluen QF. The p e i-
ous solu ion was aspi a ed om he wells and eplaced wi h 20 μl o he Wo king P obe Se
Solu ion and he samples we e incuba ed in humidi ied chambe s o h ee hou s a +40˚C.
Wo king P obe Se Solu ion was aspi a ed and he wells we e washed h ee imes wi h Wash
Bu e ( his was used in all he washes). 20 μl o P eAmpli ie Mix solu ion pe sample was p e-
pa ed by dilu ing P eAmpli ie Mix 1:25 in Ampli ie Diluen QF and added o samples and
incuba ed a +40˚C o 30 min. A e washing h ee imes, Ampli ie Mix solu ion was p e-
pa ed by dilu ing Ampli ie mix 1:25 in p e-wa med Ampli ie Diluen QF, added o he sam-
ples and incuba ed a +40˚C o 30 min. A e h ee washes, he Label P obe Mix Solu ion was
p epa ed by dilu ing Label P obe Mix 1:25 in Label P obe diluen QF, added o he samples
and incuba ed a +40˚C o 30 min. Samples we e washed h ee imes and we e le o 10 min
in he wash bu e o he inal wash. The samples we e moun ed wi h 20 μl o P oLong Gold
An i ade Moun an wi h DAPI (The mo Fishe Scien i ic). Co e glasses we e p essed on and
he slides we e le o ha den o e nigh in he da k, ans e ed o +4˚C o a day and imaged.
The samples we e imaged wi h a Zeiss LSM 780 con ocal mic oscope wi h a Plan Apoch o-
ma 63 x/1.4 oil imme sion objec i e. A pulsed diode lase was used o exci e DAPI (405 nm)
and a diode lase (561 nm) was used o exci e Cy3 o imaging lincRNA-IBIN and RpL32.
Images we e cap u ed using a Quasa spec al GaAsP PMT a ay de ec o and came a allowing
as spec al imaging. Images we e p ocessed wi h ImageJ (Ve sion: 2.0.0- c-59/1.51j) and
Adobe Pho oshop CS4.
Measu ing glucose, ehalose and glycogen om adul hemolymph
lincRNA-IBIN o e exp essing (C564>lincRNA-IBIN
7
) and con ol lies (w
1118
,lincRNA-IBIN
7
)
we e allowed o eclose o 2 days, collec ed in esh ials and kep a 29˚C o wo days p io o
collec ing he hemolymph. Fo expe imen s wi h in ec ed and unin ec ed lies, w
1118
lies we e
collec ed as abo e. w
1118
lies we e kep in esh ials a 25˚C o one day, a e which hal o
hem we e in ec ed by sep ic inju y wi h a E.cloacae -con amina ed needle. Flies we e kep a
25˚C o ano he 24 h p io o collec ing he hemolymph. The hemolymph was collec ed by
p icking he lies in he ho ax wi h a hin sha p ungs en wi e s e ilized in 70% e hanol. Pools
o 50 p icked lies we e collec ed on ice in 0.5 ul mic o ubes wi h small holes punc u ed in
The ole o D osophila immune-inducible lincRNA-IBIN in immuni y and me abolism
PLOS Pa hogens | h ps://doi.o g/10.1371/jou nal.ppa .1007504 Janua y 11, 2019 20 / 28
hem and placed in 1.5 μl mic o ubes. The lies we e cen i uged a 5000 x g o 5 min, a e
which 0.8 μl o hemolymph was collec ed om he bo om o he 1.5 ml ube and dilu ed 1:100
in T ehalase Bu e (TB; 5 mM T is pH 5.5, 137 mM NaCl, 2.7 mM KCl). The samples we e
snap- ozen in liquid ni ogen and s o ed a -80˚C. Glucose and ehalose we e analyzed using
a colo ime ic assay (Sigma Glucose (GO) assay ki , GACO20) based on he glucose oxidase
(GO) enzyme ollowing he p o ocol desc ibed in [81]. Fi s , a ehalase s ock was p epa ed by
dilu ing 3 μl o po cine ehalase (Sigma-Ald ich; T8778-1UN) wi h 1 ml o TB. Samples we e
hea -inac i a ed o 5 min a 70˚C, and di ided in o wo 40 μl aliquo s; one ea ed wi h an
equal amoun o ehalase s ock o b eak down ehalose in o ee glucose, and he o he le
un ea ed by adding an equal amoun o TB only. The samples we e hen incuba ed a 37˚C
o e nigh . Glucose s anda ds we e p epa ed by dilu ing 16 μl o a 1 mg/ml glucose s ock solu-
ion wi h 84 μl o TB. 2- old s anda d dilu ion cu es we e gene a ed. Nex mo ning, a 30 μl
aliquo o each sample, he dilu ion se ies and a blank we e loaded on o a 96-well pla e and
100 μl o he GO eagen (GAGO20 Glucose assay ki , Sigma-Ald ich) was added. The pla e
was sealed wi h pa a ilm and incuba ed a 37˚C o one hou . To s op he eac ion, 100 μl o 12
N sul u ic acid (H
2
SO
4
) was added on he samples, a e which he abso bance a 540 nm was
measu ed using he Wallac En ision 2104 Mul ilabel Reade (Pe kinElme ). The amoun o
glucose and ehalose (glucose + ehalose—glucose) in he samples we e de e mined acco d-
ing o he glucose s anda d cu e.
C564-GAL4 exp ession in he gu
To e i y ha he C564-GAL4 d i e is exp essed in he gu s o adul lies, C564>GFP males
and emales we e dissec ed in a d op o 1 x PBS and hei gu s we e emo ed. The gu s we e
checked o GFP exp ession using a s e eomic oscope luo escence adap e (NIGHTSEA, MA,
USA) wi h a Royal blue LED (440–460 nm) o exci a ion and a 500 nm long-pass il e .
Images we e cap u ed wi h Nikon DS-Fi2 came a.
S a is ical analyses
The i s ansc ip ome analysis (Fig 1A and 1B) da a was analyzed using he R package
Limma. The package uses a modi ied - es o gene a e an FDR ( alse disco e y a e) co ec ed
p- alue (adjus ed p- alue) o each compa ison. In he second ansc ip ome da a analysis, he
compa ison be ween lincRNA-IBIN o e exp ession and con ols (Fig 4A,S4 Table and S5
Table) was done using a wo- ailed - es (unequal a iances assumed) wi h a 5% alse disco -
e y a e (FDR) co ec ion using he Benjamini-Hochbe g me hod [82]. In Fig 4B, genes ha
had a no malized ead numbe >10 in he ea men o in e es and an exp ession old change
>2 we e included in he clus e analysis pe o med wi h he DAVID Bioin o ma ics esou ces
6.8 (h ps://da id.nci c .go ) [83,84] online ool. Fo Fig 4C and 4D, pai wise compa isons
be ween unin ec ed con ol sample and di e en ea men s we e ca ied ou using a wo-
ailed - es assuming unequal a iances.
S a is ical analyses o gene exp ession by qRT-PCR esul s we e ca ied ou using a wo-
ailed - es o wo samples assuming equal a iances. S a is ical analyses o ly su i al expe i-
men s we e ca ied ou using he log- ank (Man el-Cox) es wi h P ism 6 (G aphPad). Da a
on hemocy e quan i ica ions and ypes we e plo ed and analyzed wi h R e sion 3.3.2 (2016-
10-31), Copy igh 2015 The R Founda ion o S a is ical Compu ing. Da a we e analyzed using
analysis o a iance (ANOVA) ollowed by Tukey’s HSD pos hoc es when equi emen s o
no mali y and homoscedas ici y we e me , and in o he cases a non-pa ame ic K uskal-Wallis
ank sum es ollowed by Dunn’s pos hoc es we e applied. The le el o s a is ical signi icance
was es ablished as p <0.05.
The ole o D osophila immune-inducible lincRNA-IBIN in immuni y and me abolism
PLOS Pa hogens | h ps://doi.o g/10.1371/jou nal.ppa .1007504 Janua y 11, 2019 21 / 28

Suppo ing in o ma ion
S1 Table. Up egula ed genes in M.lu eus in ec ed lies. Up egula ed genes in esponse o a
Mic ococcus lu eus in ec ion in adul D.melanogas e . Genes we e anked based on >18 old
change di e ence be ween unin ec ed con ols and M.lu eus in ec ed lies (24h p.i.). The a e -
ages and s anda d de ia ions (SD) o he gene exp ession alues a e lis ed based on he num-
be o eads ob ained om he no malized RNA sequencing da a. (S1 Table is ela ed o Fig
1A).
(DOCX)
S2 Table. Immune esponsi e lncRNA genes. Up egula ed lncRNA-genes in esponse o a
Mic ococcus lu eus in ec ion in adul D.melanogas e . Genes we e anked based on >3 old
change di e ence be ween M.lu eus in ec ed lies (24h p.i.) and age ma ched unin ec ed con-
ols. Mos o hese lncRNA genes a e less han 1 kb long and posi ioned in ch omosomes wo
and h ee. The ype o he lncRNA is ca ego ized based on i s genomic loca ion o ei he in e -
genic (be ween genes) o o e lapping (o he gene/genes a he same locus). The a e ages and
s anda d de ia ions (SD) o he lncRNA gene exp ession alues a e lis ed based on he numbe
o eads ob ained om he no malized RNA sequencing da a. (S2 Table is ela ed o Fig 1B).
(DOCX)
S3 Table. T ansc ip ome p o iling o he e ec s o IBIN o e exp ession (OE) on he
known Toll pa hway a ge genes in unin ec ed and M.lu eus -in ec ed lies. Fold changes
(FC) we e calcula ed by compa ing he exp ession alues o each o he ea men s o unin-
ec ed con ols. O e exp essing lincRNA-IBIN sligh ly inc eases he exp ession le els o D oso-
mycin (D s) and Immune induced molecules (IM). No malized exp ession alues o he
numbe o eads ob ained om ansc ip ome sequencing a e shown as he a e ages and s an-
da d de ia ions (SD). S3 Table is ela ed o Fig 3C and 3D).
(DOCX)
S4 Table. Genes up egula ed in lincRNA-IBIN o e exp essing lies. Lis o old changes o
genes ha a e signi ican ly up egula ed in C564>lincRNA-IBIN lies compa ed o con ol lies.
S a s deno e p- alues om a wo- ailed - es ha we e signi ican a e adjus ing o a alse
disco e y a e o 5%. E.cloacae and M.lu eus columns show old changes o lincRNA-IBIN
- egula ed genes in in ec ed lies compa ed o unin ec ed con ol lies. Anno a ions a e acco d-
ing o Flybase e sion Fb_2018_05. (S4 Table is ela ed o Fig 4). p- alues: ��� <0.001, ��
<0.01, �<0.05.
(DOCX)
S5 Table. Genes down egula ed in lincRNA-IBIN o e exp essing lies. Lis o old changes
(FC) o genes ha a e signi ican ly down egula ed in C564>lincRNA-IBIN lies compa ed o
con ol lies. S a s deno e p- alues ha we e signi ican a e adjus ing o a alse disco e y a e
o 5%. E.cloacae and M.lu eus columns show old changes o lincRNA-IBIN - egula ed genes
in in ec ed lies compa ed o unin ec ed con ol lies. Anno a ions a e acco ding o Flybase
e sion Fb_2018_05. (S5 Table is ela ed o Fig 4). p- alues: ��� <0.001, �� <0.01, �<0.05
(DOCX)
S1 Fig. Exp ession o A) IM1 and B) lincRNA-IBIN upon a M.lu eus in ec ion (24) in male
and emale D osophila.w
1118
;C564>male and emale lies we e in ec ed wi h M.lu eus and
collec ed 24h la e wi h unin ec ed con ol lies. Gene exp ession le els we e measu ed om
o al RNAs ex ac ed om 3 biological eplica es con aining 5 lies each. (S1 Fig is ela ed o
Fig 1).
(TIF)
The ole o D osophila immune-inducible lincRNA-IBIN in immuni y and me abolism
PLOS Pa hogens | h ps://doi.o g/10.1371/jou nal.ppa .1007504 Janua y 11, 2019 22 / 28
S2 Fig. P edic ed seconda y s uc u es o lincRNA-IBIN. A) The seconda y s uc u e o
lincRNA-IBIN was p edic ed acco ding o he lowes ee ene gy s uc u e o he sequence
and B) composed based on he mos p obable base pai ing, which is an al e na i e me hod
ha may ha e a highe ideli y in a s uc u e p edic ion. S uc u e p edic ions we e ca ied ou
wi h he RNAs uc u e -p og am (Web se e s o RNA Seconda y S uc u e P edic ion)
h ps:// na.u mc. oches e .edu/RNAs uc u eWeb/index.h ml.
(DOCX)
S3 Fig. De ec ion o hemocy es in he plasma and hemocy e ac ions. Hemolymph samples
we e cen i uged o 10 minu es a 2500g and he supe na an was pipe ed in o a sepa a e ial.
The plasma and hemocy e ac ions we e analysed wi h a BD Accu i C6 low cy ome e o he
p esence o hemocy es. A) A majo i y o GFP-posi i e hemocy es was de ec ed in he hemo-
cy e pelle ac ion. B) Few hemocy es we e seen in he plasma ac ion. C) Numbe s o hemo-
cy es in he wo ac ions pe pools o i e HH-GAL4 >GFP la ae. (S3 Fig is ela ed o Fig 2).
(PDF)
S4 Fig. lincRNA-IBIN o e exp ession has no e ec on he li espan o lies. lincRNA-IBIN
o e exp essing lies (lincRNA-IBIN
1
and lincRNA-IBIN
7
lines) we e c ossed wi h C564>d i e
lies a +25˚C and he eggs we e ans e ed o +29˚C o he en i e li espan o he lies. Twice a
week, he numbe o lies was eco ded and he lies ans e ed o esh ood. A) Li espan o
C564>lincRNA-IBIN
7
lies and con ols, B) li espan o C564>lincRNA-IBIN
1
lies and con-
ols. (S4 Fig is ela ed o Figs 3and 4).
(TIF)
S5 Fig. lincRNA-IBIN exp ession in he hemocy es causes an inc ease in hemocy e numbe s
in unin ec ed la ae, bu does no a ec hemocy e di e en ia ion. La ae we e dissec ed
wi h o ceps in a d op o 8% BSA in 1 x PBS o elease he hemolymph. A) Quan i ica ion o
o al hemocy e (ea e GFP and msnChe y posi i e hemocy es) and A’) lamellocy e coun s
(msnChe y-posi i e only) in la ae wi h lincRNA-IBIN exp ession in he hemocy es. B)
Quan i ica ion o o al hemocy e and B’) lamellocy e coun s in la ae wi h lincRNA-IBIN
exp ession in he a body. MeHH>s ands o msnChe y,ea e GFP; Hml
Δ
-GAL4; He-GAL4
and MeC564> o msnChe y,ea e GFP; C564-GAL4. Do s ep esen indi idual la ae (10 la -
ae/ eplica e) and eplica e c osses ( h ee eplica e c osses pe geno ype) a e ma ked wi h di -
e en colo s. Black ba s ep esen he means. C) Rep esen a i e images o whole la ae
showing in ac sessile bands. Scale ba s 500 μm. Da a we e analyzed using ANOVA ollowed
by Tukey’s HSD pos hoc es o a non-pa ame ic K uskal-Wallis ank sum es ollowed by
Dunn’s pos hoc es . p- alues smalle han 0.05 we e conside ed signi ican .
(PDF)
S6 Fig. Quan i a i e RT-PCR o selec ed genes was ca ied ou wi h lies o e exp essing
lincRNA-IBIN
7
o lincRNA-IBIN
1
(C564>) and con ols (w). A) Exp ession le els o
lincRNA-IBIN;B) Mal-A1 exp ession; C) Mal-A8 exp ession; D) epsilonT y exp ession. Da a
we e analyzed using a wo- ailed - es o wo samples assuming equal a iances. p- alues
smalle han 0.05 we e conside ed signi ican . (S6 Fig is ela ed o Fig 4).
(DOCX)
S7 Fig. lincRNA-IBIN is exp essed in he adul midgu upon a sep ic in ec ion and modu-
la es hemolymph glucose le els. A) he C564-GAL4 d i e is exp essed in he D osophila
adul midgu , as demons a ed by C564>GFP exp ession. B) lincRNA-IBIN exp ession is
s ongly induced in he adul midgu o C564>lincRNA-IBIN
7
lies. C) Hemolymph ehalose
The ole o D osophila immune-inducible lincRNA-IBIN in immuni y and me abolism
PLOS Pa hogens | h ps://doi.o g/10.1371/jou nal.ppa .1007504 Janua y 11, 2019 23 / 28
le els a e no a ec ed in E.cloacae -in ec ed lies. (S7 Fig is ela ed o Fig 4).
(DOCX)
Acknowledgmen s
The au ho s hank Tuula Myllyma¨ki (Uni e si y o Tampe e) o echnical assis ance and all
he membe s o he Expe imen al Immunology esea ch g oup o insigh ul scien i ic discus-
sions. Fo he whole ansc ip ome analyses, he p epa a ion o he RNA lib a ies and Illumina
HiSeq 2500 sequencing we e ca ied ou in he Finnish Mic oa ay and Sequencing Cen e
(Tu ku, Finland), and he ansc ip ome da a analyses we e ca ied ou a The Bioin o ma ics
Uni a he Tu ku Cen e o Bio echnology and Biocen e Finland. Tampe e D osophila Co e
Facili y and Flow Cy ome y acili y a e acknowledged o p o iding he esou ces o he ly
wo k. Tampe e Imaging Facili y (TIF) is acknowledged o p o iding s a e-o - he-a acili ies.
Au ho Con ibu ions
Concep ualiza ion: Mika Ra¨me .
Fo mal analysis: Susanna Valanne, Tiina S. Salminen, Mi a Ja¨ ela¨-S o¨l ing, Lau a Vesala,
Mika Ra¨me .
Funding acquisi ion: Mika Ra¨me .
In es iga ion: Susanna Valanne, Tiina S. Salminen, Mi a Ja¨ ela¨-S o¨l ing, Lau a Vesala.
Me hodology: Susanna Valanne, Tiina S. Salminen, Mi a Ja¨ ela¨-S o¨l ing, Lau a Vesala.
P ojec adminis a ion: Mika Ra¨me .
Resou ces: Mika Ra¨me .
Supe ision: Mika Ra¨me .
Valida ion: Mika Ra¨me .
W i ing – o iginal d a : Susanna Valanne, Tiina S. Salminen.
W i ing – e iew & edi ing: Susanna Valanne, Tiina S. Salminen, Mi a Ja¨ ela¨-S o¨l ing,
Lau a Vesala, Mika Ra¨me .
Re e ences
1. Ra¨me M. The ui ly D osophila melanogas e un olds he sec e s o inna e immuni y. Ac a Paedia
2012 Sep; 101(9):900–905. h ps://doi.o g/10.1111/j.1651-2227.2012.02740.x PMID: 22606959
2. Hul ma k D. D osophila immuni y: pa hs and pa e ns. Cu Opin Immunol 2003 Feb; 15(1):12–9. PMID:
12495727
3. Lemai e B, Ho mann J. The hos de ense o D osophila melanogas e . Annu Re Immunol 2007; 25
():697–743. h ps://doi.o g/10.1146/annu e .immunol.25.022106.141615 PMID: 17201680
4. Ul ila J, Vanha-aho LM, Ra
¨me M. D osophila phagocy osis—s ill many unknowns unde he su ace.
APMIS 2011 Oc ; 119(10):651–662. h ps://doi.o g/10.1111/j.1600-0463.2011.02792.x PMID:
21917002
5. Williams MJ. D osophila hemopoiesis and cellula immuni y. J Immunol 2007 Ap 15; 178(8):4711–6.
PMID: 17404248
6. Michel T, Reichha JM, Ho mann JA, Roye J. D osophila Toll is ac i a ed by G am-posi i e bac e ia
h ough a ci cula ing pep idoglycan ecogni ion p o ein. Na u e 2001 Dec 13; 414(6865):756–9. h ps://
doi.o g/10.1038/414756a PMID: 11742401
7. Choe KM, We ne T, S o
¨ en S, Hul ma k D, Ande son KV. Requi emen o a pep idoglycan ecogni ion
p o ein (PGRP) in Relish ac i a ion and an ibac e ial immune esponses in D osophila. Science 2002
Ap 12; 296(5566):359–62. h ps://doi.o g/10.1126/science.1070216 PMID: 11872802
The ole o D osophila immune-inducible lincRNA-IBIN in immuni y and me abolism
PLOS Pa hogens | h ps://doi.o g/10.1371/jou nal.ppa .1007504 Janua y 11, 2019 24 / 28
8. Go a M, Gobe V, Michel T, Bel in M, Duyk G, Ho mann JA, e al. The D osophila immune esponse
agains G am-nega i e bac e ia is media ed by a pep idoglycan ecogni ion p o ein. Na u e 2002 Ap
11; 416(6881):640–4. h ps://doi.o g/10.1038/na u e734 PMID: 11912488
9. Ra
¨me M, Man uelli P, Pea son A, Ma hey-P e o B, Ezekowi z RA. Func ional genomic analysis o
phagocy osis and iden i ica ion o a D osophila ecep o o E. coli. Na u e 2002 Ap 11; 416
(6881):644–8. h ps://doi.o g/10.1038/na u e735 PMID: 11912489
10. Valanne S, Wang JH, Ra
¨me M. The D osophila Toll signaling pa hway. J Immunol 2011 Jan 15; 186
(2):649–656. h ps://doi.o g/10.4049/jimmunol.1002302 PMID: 21209287
11. Myllyma
¨ki H, Valanne S, Ra
¨me M. The D osophila imd signaling pa hway. J Immunol 2014 Ap 15; 192
(8):3455–3462. h ps://doi.o g/10.4049/jimmunol.1303309 PMID: 24706930
12. Ru schmann S, Jung AC, He u C, Reichha JM, Ho mann JA, Fe andon D. The Rel p o ein DIF medi-
a es he an i ungal bu no he an ibac e ial hos de ense in D osophila. Immuni y 2000 May; 12(5):569–
80. PMID: 10843389
13. A ianand MK, Fi zge ald KA. Long non-coding RNAs and con ol o gene exp ession in he immune sys-
em. T ends Mol Med 2014 No ; 20(11):623–631. h ps://doi.o g/10.1016/j.molmed.2014.09.002 PMID:
25262537
14. Aune TM, Spu lock CF,3 d. Long non-coding RNAs in inna e and adap i e immuni y. Vi us Res 2016
Jan 2; 212 ():146–160. h ps://doi.o g/10.1016/j. i us es.2015.07.003 PMID: 26166759
15. Ca pen e S. De e mining he Func ion o Long Noncoding RNA in Inna e Immuni y. Me hods Mol Biol
2016; 1390 ():183–195. h ps://doi.o g/10.1007/978-1-4939-3335-8_12 PMID: 26803630
16. Ca pen e S. Edi o ial: Func ions o Non-Coding RNA in Inna e Immuni y. F on Immunol 2015 Dec 14;
6 ():622. h ps://doi.o g/10.3389/ immu.2015.00622 PMID: 26697016
17. B osnan CA, Voinne O. The long and he sho o noncoding RNAs. Cu Opin Cell Biol 2009 Jun; 21
(3):416–425. h ps://doi.o g/10.1016/j.ceb.2009.04.001 PMID: 19447594
18. De ien T, Johnson R, Busso i G, Tanze A, Djebali S, Tilgne H, e al. The GENCODE 7 ca alog o
human long noncoding RNAs: analysis o hei gene s uc u e, e olu ion, and exp ession. Genome Res
2012 Sep; 22(9):1775–1789. h ps://doi.o g/10.1101/g .132159.111 PMID: 22955988
19. Hangaue MJ, Vaughn IW, McManus MT. Pe asi e ansc ip ion o he human genome p oduces hou-
sands o p e iously uniden i ied long in e genic noncoding RNAs. PLoS Gene 2013 Jun; 9(6):
e1003569. h ps://doi.o g/10.1371/jou nal.pgen.1003569 PMID: 23818866
20. B own JB, Boley N, Eisman R, May GE, S oibe MH, Du MO, e al. Di e si y and dynamics o he D o-
sophila ansc ip ome. Na u e 2014 Aug 28; 512(7515):393–399. h ps://doi.o g/10.1038/na u e12962
PMID: 24670639
21. Ca pen e S, Aiello D, A ianand MK, Ricci EP, Gandhi P, Hall LL, e al. A long noncoding RNA media es
bo h ac i a ion and ep ession o immune esponse genes. Science 2013 Aug 16; 341(6147):789–792.
h ps://doi.o g/10.1126/science.1240925 PMID: 23907535
22. Rapica oli NA, Qu K, Zhang J, Mikhail M, Labe ge RM, Chang HY. A mammalian pseudogene lncRNA
a he in e ace o in lamma ion and an i-in lamma o y he apeu ics. Eli e 2013 Jul 23; 2 ():e00762.
h ps://doi.o g/10.7554/eLi e.00762 PMID: 23898399
23. K awczyk M, Eme son BM. p50-associa ed COX-2 ex agenic RNA (PACER) ac i a es COX-2 gene
exp ession by occluding ep essi e NF-kappaB complexes. Eli e 2014 Ap 29; 3 ():e01776. h ps://doi.
o g/10.7554/eLi e.01776 PMID: 24843008
24. Li Z, Chao TC, Chang KY, Lin N, Pa il VS, Shimizu C, e al. The long noncoding RNA THRIL egula es
TNFalpha exp ession h ough i s in e ac ion wi h hnRNPL. P oc Na l Acad Sci U S A 2014 Jan 21; 111
(3):1002–1007. h ps://doi.o g/10.1073/pnas.1313768111 PMID: 24371310
25. Li R, Zhu H, Luo Y. Unde s anding he Func ions o Long Non-Coding RNAs h ough Thei Highe -
O de S uc u es. In J Mol Sci 2016 May 17; 17(5): h ps://doi.o g/10.3390/ijms17050702 PMID:
27196897
26. Zhang Y, Yang L, Chen LL. Li e wi hou A ail: new o ma s o long noncoding RNAs. In J Biochem Cell
Biol 2014 Sep; 54 ():338–349. h ps://doi.o g/10.1016/j.biocel.2013.10.009 PMID: 24513732
27. De G ego io E, Spellman PT, Rubin GM, Lemai e B. Genome-wide analysis o he D osophila immune
esponse by using oligonucleo ide mic oa ays. P oc Na l Acad Sci U S A 2001 Oc 23; 98(22):12590–
5. h ps://doi.o g/10.1073/pnas.221458698 PMID: 11606746
28. Zhao XY, Lin JD. Long Noncoding RNAs: A New Regula o y Code in Me abolic Con ol. T ends Bio-
chem Sci 2015 Oc ; 40(10):586–596. h ps://doi.o g/10.1016/j. ibs.2015.08.002 PMID: 26410599
29. Li Z, Li X, Wu S, Xue M, Chen W. Long non-coding RNA UCA1 p omo es glycolysis by up egula ing
hexokinase 2 h ough he mTOR-STAT3/mic oRNA143 pa hway. Cance Sci 2014 Aug; 105(8):951–
955. h ps://doi.o g/10.1111/cas.12461 PMID: 24890811
The ole o D osophila immune-inducible lincRNA-IBIN in immuni y and me abolism
PLOS Pa hogens | h ps://doi.o g/10.1371/jou nal.ppa .1007504 Janua y 11, 2019 25 / 28