Onco a ge 19661
www.impac jou nals.com/onco a ge
www.impac jou nals.com/onco a ge / Onco a ge , Vol. 6, No. 23
CIP2A is a candida e he apeu ic a ge in clinically challenging
p os a e cance cell popula ions
Anchi Khanna1,2, Jayan K. Rane3, Ka i K. Ki inummi1,4, Al onso U banucci1,5,6,
Me ja A. Helenius1, Teemu T. Tolonen1, Ou i R. Sa amäki1, Leena La onen1, Visa
Manni1, John E. Pimanda2, No man J. Mai land3, Jukka Wes e ma ck7,8 and Tapio
Visako pi1
1 P os a e Cance Resea ch Cen e (PCRC), Ins i u e o Biosciences and Medical Technology (BioMediTech), Uni e si y o
Tampe e and Tampe e Uni e si y Hospi al, Tampe e, Finland
2 Adul Cance P og am, The P ince o Wales Clinical School, Lowy Cance Resea ch Cen e, UNSW Medicine, Uni e si y o
New Sou h Wales, Sydney, Aus alia
3 YCR Cance Resea ch Uni , Depa men o Biology, The Uni e si y o Yo k, Hesling on, Uni ed Kingdom
4 Depa men o Signal P ocessing, Tampe e Uni e si y o Technology, Tampe e, Finland
5 Cen e o Molecula Medicine No way (NCMM), No dic EMBL Pa ne ship, Uni e si y o Oslo and Oslo Uni e si y Hospi al,
Oslo, No way
6 Depa men o Cance P e en ion, Ins i u e o Cance Resea ch, Oslo Uni e si y Hospi al, Oslo, No way
7 Tu ku Cen e o Bio echnology, Uni e si y o Tu ku and Åbo Akademi Uni e si y, Tu ku, Finland
8 Depa men o Pa hology, Uni e si y o Tu ku, Tu ku, Finland
Co espondence o: Tapio Visako pi, email: [email p o ec ed]
Co espondence o: Anchi Khanna, email: [email p o ec ed]
Keywo ds: CIP2A, and ogen ecep o , cas a ion- esis an p os a e cance , cance s em-like cells
Recei ed: Decembe 30, 2014 Accep ed: Ap il 03, 2015 Published: Ap il 19, 2015
This is an open-access a icle dis ibu ed unde he e ms o he C ea i e Commons A ibu ion License, which pe mi s un es ic ed use,
dis ibu ion, and ep oduc ion in any medium, p o ided he o iginal au ho and sou ce a e c edi ed.
ABSTRACT
Residual and ogen ecep o (AR)-signaling and p esence o cance s em-like
cells (SCs) a e he wo eme ging pa adigms o clinically challenging cas a ion-
esis an p os a e cance (CRPC). The e o e, iden i ica ion o AR- a ge p o eins ha
a e also o e exp essed in he cance SC popula ion would be an a ac i e he apeu ic
app oach.
Ou analysis o o e h ee hund ed clinical samples and pa ien -de i ed p os a e
epi helial cul u es (PPECs), e ealed Cance ous inhibi o o p o ein phospha ase 2A
(CIP2A) as one such a ge . CIP2A is signi ican ly o e exp essed in bo h ho mone-
naï e p os a e cance (HN-PC) and CRPC pa ien s . CIP2A is also o e exp essed,
by 3- and 30- old, in HN-PC and CRPC SCs espec i ely. In i o binding o he AR o
he in onic egion o CIP2A and i s unc ionali y in he AR-mode a e and AR-high
exp essing LNCaP cell-model sys ems is also demons a ed. Fu he , we show ha AR
posi i ely egula es CIP2A exp ession, bo h a he mRNA and p o ein le el. Finally,
CIP2A deple ion educed cell iabili y and colony o ming e iciency o AR-independen
PPECs as well as AR- esponsi e LNCaP cells, in which ancho age-independen g ow h
is also impai ed.
These indings iden i y CIP2A as a common denomina o o AR-signaling and
cance SC unc ionali y, highligh ing i s po en ial he apeu ic signi icance in he mos
clinically challenging p os a e pa hology: cas a ion- esis an p os a e cance .
INTRODUCTION
Since AR is ins umen al in he p og ession o
p os a e cance (PC) [1], i has been he main ocus
o he apeu ics. And ogen abla ion, ei he chemical
o su gical, has been he mains ay o ea men o
Onco a ge 19662
www.impac jou nals.com/onco a ge
ad anced PC. Howe e due o subsequen esis ance o
and ogen abla ion, his app oach ails o achie e a cu e.
The esul ing ecu en umo s a e commonly known
as cas a ion- esis an p os a e cance s (CRPCs). I has
now been demons a ed ha hese cells emain and ogen
sensi i e [2]. One hi d o he CRPCs ha bo ampli ica ion
o he AR gene [1] . In addi ion, ea angemen s o AR,
esul ing in ligand independen ac i a ion o he ecep o
has been epo ed [2]. Also, in an iand ogen ea ed
umo s, poin mu a ions ab oga ing he e ec o he d ugs
ha e been iden i ied [3] and i has been shown ha CRPC
cells can p oduce low le els o and ogens endogenously
[4]. These adap a ions make CRPCs esponsi e o
he second line AR-signaling blocking d ugs, such as
abi a e one and enzalu amide. Bu e en hese second
line d ugs a e e ec i e only in a p opo ion o pa ien s
and ail o comple ely cu e esponsi e pa ien s [5]. On
he o he hand, he exis ence o cance s em cells (SCs)
in ad anced s age PC and CRPCs has been sugges ed as
ano he po en ial mechanism o esis ance o d ugs [6].
Se e al ecen s udies ha e sugges ed ha cance SCs
a e and ogen-independen [7, 8]. Toge he hese esul s
indica e ha e icien he apy o ad anced s age PC would
equi e simul aneous a ge ing o wo ypes o cance cell
popula ions: hose ha a e dependen on AR-signaling
and he AR-independen (cells ha a e non- esponsi e o
and ogens) cance s em-like cells.
CIP2A, an endogenous inhibi o o p o ein
phospha ase 2A (PP2A), is a ecen ly iden i ied oncogene,
which is o e exp essed in se e al umou ypes a a
e y high equency [9-14]. In ac , i s o e exp ession
is eme ging as one o he mos equen al e a ions in
human cance s [13]. MYC, E2F1, AKT and mTOR ha e
so a been iden i ied as downs eam oncogenic e ec o s
o CIP2A [13, 15]. The clinical ele ance o CIP2A, in
he o m o a p ognos ic ma ke , has been es ablished
o di e en human cance s [13]. No ably, in a s udy
in ol ing small numbe o cases, CIP2A o e exp ession
was obse ed in ho mone-naï e p os a e cance (HN-
PC) specimens and i s exp ession was associa ed wi h
poo ly di e en ia ed and high- isk PCs [16]. Howe e , i s
unc ional ole in p os a e cance cell biology s ill emains
elusi e.
RESULTS
To s udy he ole o CIP2A in p os a e cance , we
i s in es iga ed he exp ession and and ogen egula ion
o his gene in clinical issue samples, p os a e cance cell
lines and di e en cell popula ions om benign p os a e
hype ophy (BPH), HN-PC and CRPC pa ien samples.
CIP2A was o e exp essed in HN-PC and e en mo e
in CRPC compa ed o BPH a he mRNA le el (Figu e
1A). Also immunos aining showed highe p o ein le els
in CRPC compa ed o HN-PC (Figu e 1B, 1C). No ably,
99% o CRPC pa ien samples we e posi i e o CIP2A
exp ession (Figu e 1C). CIP2A p o ein exp ession was
also demons a ed in AR-posi i e PC cell lines (Figu e
1D).
Nex , we assessed he exp ession o CIP2A in he
di e en popula ions o cells om biopsy samples o BPH,
HN-PC and CRPC pa ien s. We isola ed he s em-like
cell (SC), ansien ampli ying cell (TA) and commi ed
basal cell (CB) popula ions using CD133, CD44 and α
2
β
1
cell su ace ma ke s as shown in Figu e S1A. We ha e
p e iously demons a ed ha p ima y HN-PC issue
and SC cells o m se ially ansplan able subcu aneous
umo s in Rag2
-/-
γC
-/-
immune comp omised mice, which
can o m dis an me as asis and mul iple in ap os a ic
umo s in nude mice when g a ed o ho opically in a
ma igel plug con aining human p os a ic s oma [17].
As shown in Figu e 2A, he exp ession o CIP2A in he
cance s em-like cell (SC) popula ion, was inc eased by
abou h ee- old in HN-PC-SCs and by abou hi y- old
in CRPC-SCs compa ed o BPH-SCs. In con as , CIP2A
exp ession was dec eased in TA and CB cell popula ions
in cance (Figu e S1B, S1C). Func ionally, deple ion
o CIP2A in he p ima y HN-PC PPECs cells wi h wo
di e en siRNAs (Figu e 2B) esul ed in dec ease in bo h
cell iabili y (Figu e 2C) and colony o ming capaci y
(Figu e 2D). Pa icula ly, he colony o ming capaci y in
he BPH PPECs was no signi ican ly al e ed on CIP2A
deple ion (Figu e 2D). Toge he hese esul s indica e ha
CIP2A is impo an o he su i al o HN-PC s em-like
cell (SC) popula ions.
Ha ing con i med unc ional signi icance, we
nex in es iga ed he egula ion o CIP2A exp ession.
Al hough, o e exp ession and a unc ional signi icance
o CIP2A in and ogen-independen cance SCs implied
AR-independen e ec s o CIP2A, we also ha e s ong
e idence o AR-media ed CIP2A egula ion in AR-
esponsi e cells. A s a is ically signi ican associa ion o
CIP2A immunoposi i i y wi h AR nuclea s aining was
obse ed in p ima y HN-PC samples (Figu e S2A;[18]).
ChIP-Seq da a in p os a e cance cell lines om p e iously
published s udies e ealed an AR binding si e in CIP2A
in onic egion (Figu e S2B). The in i o unc ionali y o
his si e was demons a ed by an inc ease in AR binding
a his locus upon dihyd o es os e one (DHT) induc ion in
LNCaP cells using ChIP-qPCR (Figu e 3A). The LNCaP
cells modi ied o exp essed 2-4 (ARmo) and 6- (ARhi)
old highe le els o AR compa ed o con ol (pcDNA3.1)
LNCaP cells [19] showed s onge binding (Figu e 3A)
upon DHT ea men . In addi ion, an inc ease in CIP2A
mRNA exp ession was seen in LNCaP-ARhi compa ed o
LNCaP-pcDNA3.1 cells a e ea men wi h e en modes
doses o DHT (Figu e 3B and S3A). Simila ly, highe
CIP2A p o ein le els we e obse ed in LNCaP-ARhi
cells in compa ison o LNCaP-pcDNA3.1 cells wi h low
DHT s imula ion (Figu e 3C). Also, immuno luo escene
s aining demons a ed highe CIP2A p o ein le els in
LNCaP-ARhi compa ed o LNCaP-pcDNA3.1 cells a e
Onco a ge 19663
www.impac jou nals.com/onco a ge
1nM DHT (24h) ea men (Figu e S3B). These indings
a e in line wi h ou p e ious obse a ions ha and ogen-
egula ed genes a e induced in cells o e exp essing
AR, e en in lowe ligand concen a ions [19]. Nex , an
independen siRNA based app oach o e i y he ole o
and ogen ecep o in CIP2A egula ion was used. We
ans ec ed wo known AR-posi i e p os a e cance cell
lines, LNCaP and VCaP (Figu e 3D), wi h siRNAs agains
AR and es ima ed he CIP2A p o ein le els. As shown in
Figu e 3D, AR deple ion esul ed in dec eased CIP2A
p o ein exp ession in bo h he AR-posi i e p os a e cance
cell lines.
To assess whe he he AR-media ed posi i e
egula ion o CIP2A exp ession has any unc ional
consequence, we ans ec ed LNCaP-pcDNA3.1 and
LNCaP-ARhi cells wi h CIP2A siRNAs and pe o med he
unc ional assays. As demons a ed in Figu e 4A, abou 4
o 5 old dec ease in cell iabili y was obse ed in bo h
LNCaP-pcDNA3.1 and LNCaP-ARhi cells. Fu he , we
demons a ed ha CIP2A p omo es clonogenici y (Figu e
4B) and cellula ans o ma ion po en ial (Figu e 4C)
o LNCaP-pcDNA3.1 and -ARhi cells using monolaye
clonogenic and ancho age-independen so aga assays,
espec i ely. These unc ional s udies clea ly iden i y
AR as an ups eam egula o o CIP2A, which in u n
posi i ely modula es cell su i al.
Figu e 1: CIP2A is o e exp essed in p os a e cance . A. O e exp ession o CIP2A mRNA in cas a ion esis an p os a e cance
(CRPC; n = 15) ho mone-naï e p ima y p os a e cance (HN-PC; n = 27) compa ed o benign p os a ic hype plasia (BPH; n = 8). * = n
< 0.05, *** = p alue < 0.001 using he K uskal-Wallis es wi h Dunn’s mul iple compa ison pos - es . B. CIP2A p o ein exp ession in
p os a e cance specimens as de ec ed by immunohis ochemis y. A sco e o 0 (nega i e), 1 (weak), 2 (mode a e) and 3 (high) was gi en
based on he cy oplasmic CIP2A immunoposi i i y. C. S a is ical analysis o CIP2A immunoposi i i y in bo h HN-PC and CRPC cases. D.
Wes e n blo showing CIP2A p o ein le els in benign and malignan p os a e cance (PC) cells.
Onco a ge 19664
www.impac jou nals.com/onco a ge
DISCUSSION
O e exp ession o AR has been commonly obse ed
no only in p ima y PCs bu also in CRPC cases [1, 2,
4]. I s ole in sensi izing umo cells o low le els o
and ogens has been a c i ical de e en o e ec i e
he apies in p os a e cance . Addi ionally, p esence
o cance s em cells adds ano he laye o complexi y
o e ec i e ea men , especially in CRPC cases [6].
The e o e, new he apeu ic app oaches ha o e come
hese hu dles a e u gen ly equi ed o an e ec i e long-
e m he apy agains p os a e cance . This can be achie ed
by ei he using d ug combina ions ha a ge AR-signaling
and cance SC-signaling simul aneously, o by iden i ying
and a ge ing e ec o p o eins common o hese signaling
cascades.
In his s udy using pa ien -de i ed p os a e epi helial
cul u es (PPECs) and o e h ee hund ed clinical samples,
we iden i y CIP2A o be a common denomina o o AR
and cance SC-signaling unc ionali y. We demons a e
ha CIP2A is o e exp essed in PC and CRPC cases and
p omo es he iabili y and clonogenici y o AR- esponsi e
p os a e cance cells. No ably, he di e ence in g ow h in
he LNCaP-pcDNA3.1 and LNCaP-ARhi cells was no
clea ly appa en while doing he siRNA based unc ional
assays (Figu e 4A-4C) despi e di e en AR le els in hese
wo popula ions. This could be ei he be due o blun ing
o he induc ion o CIP2A p o ein le els in ARhi cells
compa ed o he pa en al LNCaP cells (1.6 old V’s 3.4
old) as shown in Figu e 3C, o due o usage o no mal
se um medium o ca y ou he knock-down assays as he
Figu e 2: CIP2A is o e exp essed and p omo es g ow h and iabili y o cance s em-like cell (SC) popula ion om
pa ien -de i ed p os a e epi helial cell (PPECs) cul u es. A. O e exp ession o CIP2A mRNA in he s em-like cell (SC) popula ion
o bo h p ima y HN-PC and CRPC pa ien samples in compa ison o BPH samples. No e he y-axis scale change be ween HN-PC and
CRPC panels. B. Wes e n blo showing he e ec o wo di e en CIP2A siRNAs on CIP2A p o ein le els in p ima y HN-PC-SC cells in
compa ison o he Sc ambled (Sc .) o con ol ans ec ed cells. C. E ec o CIP2A deple ion, using wo di e en siRNAs agains CIP2A,
on cell iabili y o HN-PC-SC cells om pa ien s in compa ison o he con ol/Sc . ans ec ed cells a 3 and 6 day ime poin . ( * = p- alue
< 0.05 using s uden - es ) D. E ec o CIP2A deple ion on colony o ming capaci y o p ima y cells om BPH and HN-PC pa ien s ( o al
cell popula ions) in compa ison o he con ol/Sc . ans ec ed cells exp essed as 100% o each. Shown a e he e ec s on bo h small (less
han 32 cells) and big colonies (mo e han 32 cells ; * = p- alue < 0.05 using s uden - es )
Onco a ge 19665
www.impac jou nals.com/onco a ge
s ess on he cells, due o he combina ion o ans ec ion
eagen and p esence o s ipped medium o low DHT
condi ions, is oxic o he cells. Fu he , we highligh ed
he ole o CIP2A p o ein in p omo ing he su i al o he
PC s em-like cell (SC) popula ions. Impo an ly, se e al
ecen s udies ha e demons a ed he umo supp essi e
ole o PP2A complex in p os a e cance [20-22]. Based
on hese indings, we sugges he apeu ic a ge ing o
CIP2A, an es ablished endogenous inhibi o o PP2A [10,
11, 14] as a no el app oach o simul aneous a ge bo h
he luminal ype mass o p os a e cance , as well as he
umo ini ia ing capaci y o he SC popula ions (Figu e
4D). Howe e , addi ional mouse p e-clinical s udies a e
equi ed o u he s eng hen CIP2A’s ole in he apy
agains p os a e cance .
Al oge he , as CIP2A deple ion in many o he
cance models ha e been demons a ed o esul in
obus an i umo e ec s [13, 23] and inhibi ion o
ac i i y o se e al oncogenic d i e pa hways [13, 15,
23], hese no el esul s highligh he po en ial emedial
ole o CIP2A in he mo e esis an and he apeu ically
challenging p os a e cance cases.
MATERIALS AND METHODS
Clinical samples o mRNA exp ession
F eshly ozen p ima y p os a e cance samples
om p os a ec omies (8 BPH and 27 un ea ed o HNPC
in addi ion o 15 CRPC specimens om ansu e h al
esec ion o he p os a e- ea ed pa ien s) we e used in he
s udy. The samples we e snap ozen in liquid ni ogen and
o al RNA was isola ed wi h T izol-Reagen (In i ogen
Inc.) acco ding o he manu ac u e ’s ins uc ions. Tumo
samples con ained, a leas , 70% cance cells. The use
o he clinical ma e ial has been app o ed by he e hical
commi ee o he Tampe e Uni e si y Hospi al.
Figu e 3: And ogen ecep o (AR) binds o CIP2A and i s ac i i y and exp ession posi i ely egula es CIP2A exp ession
in p os a e cance . A. AR binding on CIP2A in onic egion. ChIP-qPCR on LNCaP-pcDNA3.1, -ARmo, -ARhi cells, ho mone s a ed
o 4 days ollowed by ea men wi h 1nM and 100nM DHT o 2h o E hanol was pe o med o assess he AR ec ui men on he CIP2A
in onic egion. B. E ec on CIP2A mRNA exp ession in LNCaP-pcDNA3.1, -ARhi cells on DHT (1nM, 10nM, 100nM) s imula ion a
24h ime poin . C. E ec on CIP2A p o ein exp ession in LNCaP-pcDNA3.1, -ARhi cells on DHT (1nM) s imula ion a 24h ime poin
acco ding o Wes e n blo ing. D. E ec o wo independen AR siRNAs on CIP2A and AR p o ein exp ession in LNCaP cells 72h pos -
ans ec ion and e ec o AR and CIP2A siRNAs on CIP2A and AR p o ein exp ession in VCaP cells 72h pos - ans ec ion.

Onco a ge 19666
www.impac jou nals.com/onco a ge
Figu e 4: CIP2A p omo es iabili y, clonogenici y and ans o ma ion po en ial o AR-posi i e p os a e cance cell
lines. A. E ec o wo independen CIP2A siRNAs on cell iabili y o LNCaP-pcDNA3.1, -ARhi cells 3 and 6 days pos - ans ec ion.
S uden ’s - es was used o ob ain he p alues. B. E ec o CIP2A siRNA on clonogenici y o LNCaP cells 6 days pos - ans ec ion.
S uden ’s - es was used o ob ain he p alues. C. E ec o wo di e en CIP2A siRNAs on ancho age-independen g ow h. He e, LNCaP
cells we e ans ec ed wi h CIP2A.1, CIP2A.2 o Sc . siRNA and, a 48 hou s pos ans ec ion, pla ed a low densi y in so aga medium.
S uden ’s - es was used o ob ain he p alues. D. Schema ic ep esen a ion o he he apeu ic po en ial o a ge ing CIP2A. Since CIP2A
posi i i y is common o bo h AR-dependen and cance SC popula ions o p os a e cance , i su aces as an a ac i e he apeu ic a ge ,
especially in clinically challenging cas a ion- esis an p os a e cance s.
Onco a ge 19667
www.impac jou nals.com/onco a ge
Tissue mic oa ays (TMAs)
Tissue mic oa ays con ained 185 o malin-
ixed pa a in-embedded p os a ec omy and 92 CRPC
( ansu e h al esec ion o he p os a e) specimens ob ained
om Tampe e Uni e si y Hospi al. Fo he p os a ec omy-
ea ed pa ien s, de ec able PSA alues ≥0.5 ng/ml) in wo
consecu i e measu emen s o he eme gence o me as asis
we e conside ed as signs o p og ession. The use o issue
mic oa ays has been app o ed by he e hical commi ee
o Tampe e Uni e si y Hospi al and he Na ional Au ho i y
o Medicolegal A ai s. CIP2A immunoposi i i y was
g aded in one o h ee umou co es o each pa ien based
on he in ensi y o he cy oplasmic immuno eac i i y in he
cance cells, ha is, 3 was s ong, 2 mode a e, 1 weak, and
0 nega i e. All samples we e sco ed by, an expe ienced
u opa hologis (T. Tolonen), wi hou knowledge o clinical
s a us and ou come da a.
Es ablishmen o p ima y p os a e epi helial
cul u es and en ichmen o p os a e epi helial
sub-popula ions
The epi helial cul u es om p ima y p os a e
samples we e es ablished acco ding o an es ablished
p o ocol [24]. The pos ope a i e p os a e samples we e
ob ained wi h ull e hical consen and we e chopped
in o ine pieces, which we e hen subjec ed o o e nigh
collagenase (Lo ne Labo a o ies) ea men a 37
o
C. Then,
he s oma was sepa a ed by di e en ial cen i uga ion
and p os a e epi helial acini we e u he dis up ed by
mechanical and enzyma ic sepa a ion me hods. A his
poin , CD24 posi i e luminal cells we e emo ed and
en iched by employing CD24 MACS immunomagne ic
beads (Mil enyi Bio ec). The es o he p os a e epi helial
cells we e hen g own wi h i adia ed STOs on collagen
I coa ed plas ic pla es in a s em cell media a 37oC wi h
5% CO2. Cells we e sub-cul u ed ypically when hey
we e 80-90% con luen by spli ing hem in o 1:3 o 1:4
p opo ions. A passage wo; cul u ed epi helial cells we e
selec ed on he basis o exp ession o α2β1-in eg in, CD44,
and CD133 exp ession by employing apid collagen
adhesion and CD133 MACS ac iona ion (Figu e S1A).
Cell lines and cell cul u e
LNCaP cells we e pu chased om Ame ican Type
Cul u e Collec ion (ATCC) and well es ablished LNCaP-
pcDNA3.1, LNCaP-ARmo and LNCaP-ARhi sub cell
lines [19] exp essing low (endogenous AR le els),
mode a e ( wo o ou old) and high AR ( ou o six old)
AR exp ession (26) espec i ely we e also g own as pe
he ecommended condi ions. VCaP cells used we e a kind
gi by D . Jack Schalken- Radboud Uni e si y, Nijmegen
Medical Cen e , and we e g own unde he ecommended
condi ions. Wi h espec o p ima y cells p os a e cance
di ec ed co e biopsies om h ee HN-PC pa ien s had
Gleason sco e o 4+3 while CRPCs we e Gleason 9 (4+5,
one sample) and 10 (5+5, 2 samples) we e p ocessed o
es ablish cul u es in s em cell medium (SCM) as desc ibed
be o e [24].
Quan i a i e (q) RT-PCR
Cells we e collec ed om dishes and hei o al RNA
was ex ac ed using T izol (In i ogen) acco ding o he
manu ac u e ’s ins uc ions. Fi s -s and cDNA syn hesis
was ca ied ou om o al RNA using AMV e e se
ansc ip ase (Finnzymes) acco ding o he manu ac u e ’s
ins uc ions. The p ime s o Q-RT-PCR we e designed
wi h P ime 3 p og am. SYBR G een II-Fas S a ki
(Roche Diagnos ics) and Ligh Cycle appa a us (Roche
Diagnos ics) we e used o Q-RT-PCR. TBP (TATA box
binding p o ein) and Ac in mRNA was used as a e e ence.
The speci ici y o he eac ions was con i med, in addi ion
o he mel ing cu e analysis, wi h 1.5% aga ose gel
elec opho esis.
Ac in F- 5´- ACTTCACATCACAGCTCCCC -3´
Ac in R- 5´- GAATATAATCCCAAGCGGTTTG -3´
TBP – F - 5´-
CATAGGAATCCTTCTGACCCATG-3´
TBP R- 5´-
CGAGCACAGAGCCTCGCCTTTGC-3´
CIP2A F- 5′-CTGGTGAGATAATCAGCAATTT-3′
CIP2A R-
5′-CGAAACATTCATCAGACTTTTCA-3′
Small in e e ing RNA (siRNA) ans ec ions
The siRNAs o inhibi CIP2A exp ession we e
ob ained om Eu o ins MWG ope on (Ebe sbe g,
Ge many). The ollowing double-s anded
oligonucleo ides we e used:
CIP2A.1-5′-CUGUGGUUGUGUUUGCACUTT-3′
CIP2A.2-5′-ACCAUUGAUAUCCUU AGAATT-3′
AR.1(sense)-CCCAAGAUCCUUUCUGGGA+UU
AR.2 (sense)-GUGGAAGAUUCAGCCAAG
C+UU
Sc ambled-5′-UAACAAUGAGAGCACGGCTT-3 ′
Cells a 60%con luency we e ans ec ed wi h
100nM in 3 mL o an ibio ic ee medium (RPMI-1640
medium supplemen ed wi h 10% FCS) in each well
wi h he espec i e siRNAs using Lipo ec amine 2000
Reagen (Li e Technologies, Ca lsbad, CA), acco ding
o he manu ac u e ’s ins uc ions. Fo he p ima y PC
cells (pa ien -de i ed p os a e cance cells, Gl-4+3),
Cells a 70% con luency we e ans ec ed wi h 100nM
o espec i e siRNA in 500 μL o Op i-MEM se um
ee medium (Li e Technology) in each o he wells o
Onco a ge 19668
www.impac jou nals.com/onco a ge
a 6-well pla e using Oligo ec amine (Li e Technology).
2mL o SCM was added a e 4 hou s in each well. A e
4 mo e hou s, wells we e washed wi h PBS wice and 2
mL o esh SCM was added. Cells we e ha es ed a 72
hou s a e ans ec ion o de e mine he e ec on p o ein
exp ession.
Immuno lou escence
LNCaP-pcDNA3.1 and LNCaP-ARhi cells we e
seeded on s e ilized co e slips placed in each well o a
6-well pla e o e nigh and he cells we e hen ea ed wi h
1nM DHT o 24hou s. Subsequen ly he co e slips we e
placed in esh s e ilized wells and hen washed wi h PBS
be o e being ixed using 4% pa a o maldehyde o 10 min
a 37° C. Then a e washing wi h PBS wice, cells we e
ea ed wi h 0.5% NP-40 o 5min a oom empe a u e.
This was ollowed by blocking he cells wi h 0.5% bo ine
se um albumin o 30 min. Cells we e hen exposed o
he ollowing p ima y an ibody dilu ions, CIP2A; 1: 250
(San a C uz Bio echnology, San a C uz, CA). A e which
he cells we e washed wi h PBS 3 imes and incuba ed
in FITC-conjuga ed goa an i Rabbi IgG (In i ogen–
Molecula P obes, Eugene, O egon, USA) o 1h a 37°C.
Nex cells we e hen s ained wi h he Vec ashield an i ade
solu ion (Vec o Labo a o ies) con aining 0.001 mol/L
4′,6-diamidino-2- phenylindole as coun e s ain and cells
obse ed unde he mic oscope and he images aken.
Ch oma in immunop ecipi a ion (ChIP)
CIP2A ARBS was iden i ied in p e iously published
ChIP-seq da ase and ChIP was ca ied ou as desc ibed
be o e [25]. Ch oma in was immunop ecipi a ed wi h
10 µg o no mal abbi IgG, 10 µl o an i-AR polyclonal
an ibody (AR3). P ime sequences used o he CIP2A
ARBS ampli ied ia qPCR examined in his wo k a e –
CIP2A Fo wa d -5’ –
TTGTTCCTGGTCTTCCCTGT-3’,
CIP2A Re e se -5’ –
GCAAAGTTTGATTGGTTTTTCC-3’
Immunohis ochemis y
Mouse An i-CIP2A (No us Biosciences.) was used
wi h Powe Vision+ Poly-HRP IHC ki (ImmunoVision
Technologies Co., Bu lingame, CA, USA) acco ding o he
manu ac u e ’s ins uc ions. The p o ocol has p e iously
been desc ibed [18, 26].
Wes e n blo ing
P o eins we e ex ac ed in ho Laemmli sample
bu e and subjec ed o Wes e n blo analysis. 30 µg o al
p o ein ex ac s we e sepa a ed by 12% SDS-PAGE and
ans e ed o ni ocellulose memb anes. Memb anes
we e blocked wi h 5% non- a milk in TBS-0.1%-NP40
and hen incuba ed wi h mouse monoclonal AR (AR441,
NeoMa ke s-Lab Vision Co po a ion, F emon , CA, USA),
goa polyclonal an i-β-Ac in (San a C uz, Bio echnology,
San a C uz, CA, USA) o wi h mouse monoclonal an i-
CIP2A (San a C uz Bio echnology, San a C uz, CA). Fo
p ima y PC cells Cy oBus e (Me ck Millipo e) bu e was
used o lyse eshly cul u ed cells o ex ac p o eins.
Cell iabili y
One day be o e ans ec ion o CIP2A.1 o CIP2A.2
siRNAs, LNCaP and LNCaP-ARhi cells we e seeded in
RPMI-1640 medium supplemen ed wi h 10% FCS a a
densi y o 1 × 103 o 2 × 103 cells pe well in 96-well
pla es. The cells we e ans ec ed wi h he ollowing
-Lipo ec amine 2000 eagen , 33 nM sc ambled siRNA
o 33 nM CIP2A.1 o CIP2A.2. Cells we e hen cul u ed
o 3 and 6 days pos - ans ec ion be o e ela i e numbe s
o iable cells we e measu ed by luo escence a he
544 and 590 nm wa eleng hs in a FLUOs a OPTIMA
Mic opla e Reade (BMG Lab ech, Inc., Du ham, NC),
using he esazu in-based CellTi e -Blue Assay (P omega
Co po a ion) acco ding o he manu ac u e ’s ins uc ions.
In case o p ima y PC cells, 20µl o cell suspension was
added o an equal olume o 0.4% T ypan Blue S ain
(Sigma-Ald ich). The li e cells we e coun ed using
modi ied Neubaue ’s haemocy ome e .
So aga and monolaye clonogenic assays
A 48 hou s a e ans ec ion, LNCaP (1 × 104
pe dish) we e suspended in 1 mL o 0.25% aga ose
(GellyPho ; Eu oClone Spa, Pe o, I aly) supplemen ed
wi h 2 mL comple e RPMI-1640 cul u e medium
(changed e e y hi d day). This suspension was laye ed
o e 1 mL o a base laye o 0.5% aga ose in comple e
medium in six-well pla es. A e 8 o 12 days in aga ose,
cells we e s ained wi h Giemsa 1:20 in wa e (Sigma-
Ald ich), he wells we e scanned using he Su eyo
So wa e (Objec i e Imaging L d.) wi h came a (Imaging
Inc., Canada) a ached o he Olympus IX71 (Olympus,
Tokyo, Japan) mic oscope and colonies we e coun ed by
analysis wi h ImageJ So wa e (Wayne Rasband, Na ional
Ins i u es o Heal h, Be heseda, MD). Cell g oupings
ha we e g ea e han 1200 pixels in diame e wi h
3.2× enla gemen s we e coun ed as colonies. In case o
p ima y PC cells, CIP2A and sc ambled siRNAs we e
ans ec ed in o hese cells o a day, a e which hey we e
ypsynised and 250 cells we e pla ed in each well o he
6-well Collagen-I coa ed pla es (BD Biosciences). Cells
we e pla ed in iplica es wi h 2 ml o s em cell medium
(SCM) and 500 µl o i adia ed STO eede cells pe well.
Onco a ge 19669
www.impac jou nals.com/onco a ge
The media was changed e e y 2-3 days. Clonal colonies
we e coun ed a he end o 12 days unde a s anda d ligh
mic oscope. Fo isualiza ion, colonies we e s ained wi h
c ys al iole solu ion (Sigma-Ald ich).
S a is ical analysis
The associa ion be ween he CIP2A posi i i y in
p ima y HN-PC, CRPC umo s and wi h AR exp ession
was done using chi-squa e es . K uskal-Wallis and s uden
- es s we e used o o he expe imen s. All s a is ical es s
we e wo-sided.
FINANCIAL SUPPORT
This wo k was suppo ed by he Academy o
Finland, he Cance Socie y o Finland, he Sig id Juselius
Founda ion, and he Medical Resea ch Fund o Tampe e
Uni e si y Hospi al. AK is a Na ional Heal h and Medical
Resea ch Council (Pe e -Dohe y) Resea ch Fellow,
Aus alia.
CONFLICTS OF INTEREST
None.
Abb e ia ions
And ogen Recep o (AR); Cance ous Inhibi o o
P o ein phospha ase 2A (CIP2A); cas a ion- esis an
p os a e cance (CRPC); p os a e cance (PC); ho mone-
naï e p os a e cance (HN-PC); benign p os a e
hype ophy (BPH); pa ien -de i ed p os a e epi helial
cul u es (PPECs) ; dihyd o es os e one (DHT) ; s em-like
cell (SC); ansien ampli ying cell (TA); commi ed basal
cell (CB).
REFERENCES
1. Visako pi T, Hyy inen E, Koi is o P, Tanne M, Keinanen
R, Palmbe g C, Palo ie A, Tammela T, Isola J and
Kallioniemi OP. In i o ampli ica ion o he and ogen
ecep o gene and p og ession o human p os a e cance .
Na u e gene ics. 1995; 9:401-406.
2. Wal e ing KK, U banucci A and Visako pi T. And ogen
ecep o (AR) abe a ions in cas a ion- esis an p os a e
cance . Molecula and cellula endoc inology. 2012;
360:38-43.
3. Ha a T, Miyazaki J, A aki H, Yamaoka M, Kanzaki N,
Kusaka M and Miyamo o M. No el mu a ions o and ogen
ecep o : a possible mechanism o bicalu amide wi hd awal
synd ome. Cance esea ch. 2003; 63:149-153.
4. Visako pi T. No el endoc ine aspec s o p os a e cance .
Molecula and cellula endoc inology. 2012; 360:1-2.
5. Rane JK, Pellacani D and Mai land NJ. Ad anced p os a e
cance --a case o adju an di e en ia ion he apy. Na u e
e iews U ology. 2012; 9:595-602.
6. Mai land NJ and Collins AT. P os a e cance s em cells: a
new a ge o he apy. Jou nal o clinical oncology : o icial
jou nal o he Ame ican Socie y o Clinical Oncology.
2008; 26:2862-2870.
7. Old idge EE, Pellacani D, Collins AT and Mai land NJ.
P os a e cance s em cells: a e hey and ogen- esponsi e?
Molecula and cellula endoc inology. 2012; 360:14-24.
8. Qin J, Liu X, La in B, Chen X, Choy G, Je e CR, Calhoun-
Da is T, Li H, Palapa u GS, Pang S, Lin K, Huang J,
I ano I, Li W, Su aneni MV and Tang DG. The PSA(-/
lo) p os a e cance cell popula ion ha bo s sel - enewing
long- e m umo -p opaga ing cells ha esis cas a ion.
Cell s em cell. 2012; 10:556-569.
9. Khanna A. Regula ion o Cance ous inhibi o o PP2A
(CIP2A) by small molecule inhibi o o c-Jun NH
2-Te minal Kinases (JNKs), SP600125, in Human
Fib osa coma (HT1080) cells. F1000Resea ch. 2013; 2.
10. Khanna A, Bockelman C, Hemmes A, Jun ila MR, Wiks en
JP, Lundin M, Junnila S, Mu phy DJ, E an GI, Haglund
C, Wes e ma ck J and Ris imaki A. MYC-dependen
egula ion and p ognos ic ole o CIP2A in gas ic cance . J
Na l Cance Ins . 2009; 101:793-805.
11. Khanna A, Kauko O, Bockelman C, Laine A, Sch eck I,
Pa anen JI, Szwajda A, Bo mann S, Bilgen T, Helenius
M, Pokha el YR, Pimanda J, Russel MR, Haglund C, Cole
KA, Kle s om J, e al. Chk1 a ge ing eac i a es PP2A
umo supp esso ac i i y in cance cells. Cance Res. 2013;
73:6757-6769.
12. Khanna A, Okke i J, Bilgen T, Tii ikka T, Vihinen M,
Visako pi T and Wes e ma ck J. ETS1 media es MEK1/2-
dependen o e exp ession o cance ous inhibi o o p o ein
phospha ase 2A (CIP2A) in human cance cells. PLoS One.
2011; 6:e17979.
13. Khanna A, Pimanda JE and Wes e ma ck J. Cance ous
Inhibi o o P o ein Phospha ase 2A, an Eme ging Human
Oncop o ein and a Po en ial Cance The apy Ta ge . Cance
esea ch. 2013.
14. Jun ila MR, Puus inen P, Niemela M, Ahola R, A nold H,
Bo zauw T, Ala-aho R, Nielsen C, I aska J, Taya Y, Lu
SL, Lin S, Chan EK, Wang XJ, G enman R, Kas J, e al.
CIP2A inhibi s PP2A in human malignancies. Cell. 2007;
130:51-62.
15. Puus inen P, Ry e A, Mo ensen M, Kohonen P, Mo ei a
JM and Jaa ela M. CIP2A oncop o ein con ols cell g ow h
and au ophagy h ough mTORC1 ac i a ion. J Cell Biol.
2014; 204:713-727.
16. Vaa ala MH, Vaisanen MR and Ris imaki A. CIP2A
exp ession is inc eased in p os a e cance . J Exp Clin
Cance Res. 2010; 29:136.
17. K oon P, Be y PA, S owe MJ, Rod igues G, Mann VM,
Simms M, Bhasin D, Che ia S, Li C, Li PK, Mai land