This is a sel -a chi ed e sion o an o iginal a icle. This e sion
may di e om he o iginal in pagina ion and ypog aphic de ails.
Au ho (s):
Ti le:
Yea :
Ve sion:
Copy igh :
Righ s:
Righ s u l:
Please ci e he o iginal e sion:
CC BY-NC-ND 4.0
h ps://c ea i ecommons.o g/licenses/by-nc-nd/4.0/
Midbio ics : conjuga i e plasmids o gene ic enginee ing o na u al gu lo a
© 2019 The Au ho s
Published e sion
Ruo salainen, Pil i; Pen inen, Ree a; Ma ila, Sa i; Jalas uo i, Ma i
Ruo salainen, P., Pen inen, R., Ma ila, S., & Jalas uo i, M. (2019). Midbio ics : conjuga i e
plasmids o gene ic enginee ing o na u al gu lo a. Gu Mic obes, 10(6), 643-653.
h ps://doi.o g/10.1080/19490976.2019.1591136
2019
Full Te ms & Condi ions o access and use can be ound a
h ps://www. and online.com/ac ion/jou nalIn o ma ion?jou nalCode=kgmi20
Gu Mic obes
ISSN: 1949-0976 (P in ) 1949-0984 (Online) Jou nal homepage: h ps://www. and online.com/loi/kgmi20
Midbio ics: conjuga i e plasmids o gene ic
enginee ing o na u al gu lo a
Pil i Ruo salainen, Ree a Pen inen, Sa i Ma ila & Ma i Jalas uo i
To ci e his a icle: Pil i Ruo salainen, Ree a Pen inen, Sa i Ma ila & Ma i Jalas uo i (2019)
Midbio ics: conjuga i e plasmids o gene ic enginee ing o na u al gu lo a, Gu Mic obes, 10:6,
643-653, DOI: 10.1080/19490976.2019.1591136
To link o his a icle: h ps://doi.o g/10.1080/19490976.2019.1591136
© 2019 The Au ho (s). Published wi h
license by Taylo & F ancis G oup, LLC.
View supplemen a y ma e ial
Published online: 05 Ap 2019.
Submi you a icle o his jou nal
A icle iews: 2096
View ela ed a icles
View C ossma k da a
BRIEF REPORT
Midbio ics: conjuga i e plasmids o gene ic enginee ing o na u al gu lo a
Pil i Ruo salainen
a
, Ree a Pen inen
a
, Sa i Ma ila
b
, and Ma i Jalas uo i
a,c
a
Uni e si y o Jy äskylä, Depa men o Biological and En i onmen al Science, Nanoscience Cen e , Jy äskylä, Finland;
b
Depa men o
Biological Sciences, Uni e si y o Helsinki, Helsinki, Finland;
c
Depa men o Gene ics, Uni e si y o Camb idge, Camb idge, UK
ABSTRACT
The possibili y o modi y gu bac e ial lo a has become an impo an goal, and a ious
app oaches a e used o achie e desi able communi ies. Howe e , he gene ic enginee ing o
exis ing mic obes in he gu , which a e al eady compa ible wi h he es o he communi y and
hos immune sys em, has no ecei ed much a en ion. He e, we discuss and expe imen ally
e alua e he possibili y o use modi ied and mobilizable CRISPR-Cas9-endocing plasmid as a ool
o induce changes in bac e ial communi ies. This plasmid sys em (b ie ly midbio ic) is deli e ed
om bac e ial ec o in o a ge bac e ia ia conjuga ion. Compa ed o, o example, bac e ioph-
age-based applica ions, he bene i s o conjuga i e plasmids include hei independence o any
pa icula ecep o (s) on hos bac e ia and hei ela i e immuni y o bac e ial de ense mechan-
isms (such as es ic ion-modi ica ion sys ems) due o he syn hesis o he complemen a y s and
wi h hos -speci ic epigene ic modi ica ions. We show ha conjuga i e plasmid in associa ion wi h
a mobilizable an ibio ic esis ance gene a ge ing CRISPR-plasmid e icien ly causes ESBL-posi i e
ansconjugan s o lose hei esis ance, and mul iple gene ypes can be a ge ed simul aneously
by in oducing se e al CRISPR RNA encoding segmen s in o he ans e ed plasmids. In he a e
cases whe e he midbio ic plasmids ailed o esensi ize bac e ia o an ibio ics, he CRISPR space -
(s) and hei adjacen epea s o la ge egions we e ound o be los . Resul s also e ealed
po en ial ca ea s in he design o conjuga i e enginee ing sys ems as well as wo ka ounds o
minimize hese isks.
ARTICLE HISTORY
Recei ed 19 No embe 2018
Re ised 19 Feb ua y 2019
Accep ed 28 Feb ua y 2019
KEYWORDS
Gene ic enginee ing;
an ibio ic esis ance; ESBL
ca iage; conjuga i e
plasmid; CRISPR edi ing;
en e obac e ia
In oduc ion
The possibili y o enginee gu mic obiome has
become a no able a enue o esea ch. Res o a ion
o mic obial balance in he gu can p o ide a cu e
o a mul i ude o complex diseases. None heless,
s able ins alla ion o o eign bene icial mic obes in
he gu is p oblema ic. S udies ha e shown ha
die a y supplemen bac e ia (p obio ics) disappea
om he communi y soon a e hei inges ion
ceases.
1,2
This has led many eams o compile
bac e ial cock ails ha would es ablish a mo e
s able popula ion wi hin he gu .
3
Also, he nea -
comple e eplacemen o gu lo a has been used o
e e dysbiosis. This so-called bac e ial ansplan-
a ion is an e ec i e app oach o cu e especially
ecu en dia hea caused by Clos idium
di icile,
4-6
bu could also be used o imp o e a -
ious o he condi ions.
7
The composi ion o gu
lo a is also sensi i e o die , and, o example,
inc ease o ibe can esul in no able shi s in he
communi y composi ion.
8
In some ci cums ances,
howe e , he possibili y o modi y he genomes o
exis ing bac e ia in he gu could p o ide an al e -
na i e o emodel he sys em.
So a , he gene ic enginee ing o bac e ial com-
muni ies in si u has mainly ocused on bac e ioph-
age-based applica ions.
9,10
Conjuga i e plasmids
o e an al e na i e ou e wi h di e ing enginee ing
quali ies. They a e ci cula an agonis ic gene ic ele-
men s ha can media e hei own ans e om one
bac e ium o ano he . In addi ion, hese sel -
ansmissible plasmids can co- ans e non-
conjuga i e plasmids wi h app op ia e o iT si e.
11
The elaxosome o he conjuga i e plasmid ecog-
nizes he simila o iT si e in non-conjuga i e plas-
mid and mobilizes i h ough conjuga ion.
12
The
exac conjuga ion mechanisms a y be ween plas-
mids, bu hey all o m a channel be ween he cells
h ough which he plasmid is usually anspo ed as
CONTACT Ma i Jalas uo i [email p o ec ed] Depa men o Biological and En i onmen al Science, Uni e si y o Jy äskylä, Su on ie 9C,
Ambio ica Building, Jy äskylä, Finland
Supplemen al da a o his a icle can be accessed on he publishe ’s websi e.
GUT MICROBES
2019, VOL. 10, NO. 6, 643–653
h ps://doi.o g/10.1080/19490976.2019.1591136
© 2019 The Au ho (s). Published wi h license by Taylo & F ancis G oup, LLC.
This is an Open Access a icle dis ibu ed unde he e ms o he C ea i e Commons A ibu ion-NonComme cial-NoDe i a i es License (h p://c ea i ecommons.o g/licenses/by-nc-
nd/4.0/), which pe mi s non-comme cial e-use, dis ibu ion, and ep oduc ion in any medium, p o ided he o iginal wo k is p ope ly ci ed, and is no al e ed, ans o med, o buil
upon in any way.
a single-s anded DNA molecule o he ecipien
bac e ium. Plasmids can be eadily modi ied wi h
a ious molecula biology me hods, hus p o iding
a ela i ely simple pla o m o ca ying ou in si u
gene ic enginee ing o bac e ial cells. Gi en ha he
di e si y o gu mic obio a a ies e en be ween
gene ically iden ical wins,
13
he a emp s o colonize
maladap ed (enginee ed) bac e ia wi hin an al eady
es ablished communi y can be a challenging i no an
impossible ask. In his espec , he in oduc ion o
an enginee ed mobile elemen in o he exis ing com-
muni y ins ead o elying on he es ablishmen o an
en i e bac e ium p o ides a po en ial wo ka ound
o deploying desi ed unc ionali ies wi hin he sys-
em. Gi en he es ablished concep s o p obio ics
(heal h-p omo ing bac e ia) and p ebio ics (nu i-
en s ha p omo e he g ow h o bene icial bac e ia),
”midbio ics”(plasmid-p obio ics in a sense) p o ide
ye an al e na i e o m o bio ic subs ances ha can
be used o acqui e bene icial changes in he gu lo a.
Na u ally, such plasmids ha e only limi ed use,
albei , in ce ain ins ances, hey may be e en
a p e e able choice o e p obio ics such as when
only pa icula genes need o be emo ed om he
communi y.
Plasmids a e di ided in o incompa ibili y
g oups (Inc) based on hei po en ial o s ably
coexis in a bac e ial cell. In o he wo ds, wo
plasmids ha sha e he same Inc-g oup canno
be main ained in a single cell inde ini ely.
Conjuga i e plasmids also o en encode en y-
exclusion mechanisms ha p e en ela ed plas-
mids om en e ing he cell. Due o hese na u al
ea u es, he plasmids used o enginee ing should
be uncommon in he a ge ed lo a. Na u ally,
de e mining he exis ence o ce ain plasmid
ypes ou inely om a he e ogenous communi y
is a labo ious ask. Ye , ce ain an ibio ic esis-
ance–con e ing plasmids o En e obac e iaceae,
o ins ance, a e ela i ely a e in pa ien s.
Indeed, in a me as udy, Ca a oli e iewed he
p e alence o di e en esis ance plasmid amilies
in Ex ended Spec um Be a-Lac amase (ESBL)
s ains.
14
Among he a es we e IncP- ype plas-
mids. Despi e his, conjuga i e IncP-plasmids a e
well-s udied, hey ha e a obus conjuga ion
machine y and a b oad hos ange. As such, hey
p o ide an example o po en ial backbones ha
could be u ilized o enginee ing pu poses.
In bac e iophage-based applica ions, he gene ic
ma e ial wi hin he phage is eplaced, and as i
in ec s a cell a e he a achmen o a speci ic
ecep o on he hos cell su ace, i deli e s he
genomic ca go in o he bac e ial hos .
9,10
Phage-
based ools ha e acqui ed no able a en ion and
a e cu en ly unde de elopmen owa d d ugs.
The ad an age o phages is ha hey ha e
a na ow hos ange, and hus, hey a ge speci i-
cally only he desi ed ac ion o he bac e ial
communi y. Ye , bac e ia apidly become esis an
o phages, and phages canno be easily used o
exe ac i i y agains e en all a ian s o ce ain
species. In his ega d, conjuga i e plasmids p o-
ide quali ies ha could be use ul o al e na i e
and mo e gene ally applicable enginee ing pu -
poses. As no ed abo e, conjuga i e plasmids a e
usually deli e ed as a single DNA s and o he
ecipien cell. The complemen ing s and is
syn hesized in he ecipien bac e ium and hus i
con ains all he hos -speci ic modi ica ions in he
nucleic acids.
15
This way he hos does no ecog-
nize he incoming plasmid as o eign gene ic
ma e ial, which, in u n, allows he plasmid o
es ablish i sel in o a na u al communi y wi hou
p io knowledge o he ea u es o bac e ia he ein.
Addi ionally, unlike phages, conjuga i e plasmids
a e no dependen on speci ic ecep o s on hos
cells as plasmids equi e only cell-cell con ac . And
once plasmid ge s in o na u al bac e ia, i can
u he dissemina e i sel in o he nex hos . The
ans e a e om one bac e ium o ano he is, o
cou se, slowe and less-p ecise han phage-
media ed deli e y o DNA. This se s ce ain
bounda ies o he u iliza ion o plasmids.
Ne e heless, conjuga i e plasmids can p o ide
a b oad hos ange o in oducing gene ic ma e-
ial in o he gu lo a.
The ad en o CRISPR-Cas9 edi ing has p o-
oked nume ous s udies whe e speci ic a ge
sequences wi hin a ious hos o ganisms a e
modi ied,
16
e en enabling s ain-speci ic elimina-
ion o bac e ia om he e ologous communi ies.
10
In oduc ion o CRISPR-Cas9 edi ing componen s
in o conjuga i e plasmids p o ides a po en ial
mean o emo e unwan ed genes such as hose
con e ing an ibio ic esis ance om di e se bac-
e ial sys ems. ESBL ca iage e e s o non-
symp oma ic coloniza ion o he gu by bac e ia
644 P. RUOTSALAINEN ET AL.
which a e esis an o a wide ange o di e en
be a-lac am an ibio ics.
17,18
This is o majo con-
ce n, as be a-lac ams a e he mos commonly used
class o an imic obials, owing o hei b oad spec-
um and minimal side e ec s. They a e abun-
dan ly adminis e ed o ea and p e en bac e ial
in ec ions du ing a ious medical p ocedu es.
O e he pas ew decades, ESBL ca iage has
become inc easingly mo e common among long-
e m hospi alized pa ien s as well as in he
communi y.
19
ESBL ca iage se es as a ese oi
o esis ance genes and signi ican ly inc eases he
isk o clinical in ec ions.
20-22
As such, we he e se
o e alua e he possibili y o use conjuga i ely
ans e ed plasmids o induce he loss o ESBL
genes (loca ed ei he in plasmids o in he ch o-
mosome) om a bac e ial communi y.
Resul s and discussion
We cons uc ed a midbio ic sys em consis ing o
ac
onjuga i eIncPplasmidRP4
23
and a mobilizable
pCas9 plasmid con aining S ep ococcus pyogenes–
de i ed CRISPR/Cas9
24
ha a ge s conse ed si es
in wo di e en be a-lac amase genes ia plasmid-
encoded CRISPR RNA (c RNA). Pa o RP4 o igin-
o - ans e (o iT) si e was cloned in o pCas9 plasmid
in o de o make i ho izon ally ans e able by he
RP4-encoded elaxosome complex. Fu he , 543 bp
egion, including he a ge si e o he CRISPR/Cas9
sys em, was dele ed om he be a-lac amase gene
blaTEM-2 o RP4 o p e en he sys em om sel -
a ge ing. F om now on, he RP4
blaTEM−2Δ172−714
plas-
midis e e ed oasdeli e yplasmidand hemod-
i ied pCas9 as pCRISPR plasmid, c RNA/mul i-
c RNA e e ing o space (s) a ge ing he be a-
lac amase gene(s).
A dono bac e ium (Esche ichia coli HMS174)
ha bo ing midbio ic plasmids (deli e y and
pCRISPR-c RNA plasmids) was cocul u ed
oge he wi h ecipien E. coli s ain (HB101)
ca ying a conjuga i e ESBL-plasmid pEC15
ha encodes blaTEM-52b a ge gene.
25
The
ans e o hese plasmids o ESBL-posi i e bac-
e ia and he subsequen coexp ession o endo-
nuclease Cas9 and c RNA should induce he loss
o esis ance by guiding he Cas9 complex o
ESBL gene and c ea e a double-s anded nick
wi hin he a ge si e (Figu e 1a). Nicking
linea izes he plasmid and p e en s i s eplica-
ion. Indeed, a e 24 h, only app oxima ely 1:10
000 ansconjugan s e ained he esis ance in
compa ison o a con ol ea men lacking he
c RNA (Figu e 1b). To ule ou he possibili y
ha his migh esul om he unequal conjuga-
ion a es be ween pCRISPR-c RNA and
pCRISPR-con ol plasmid, bo h we e conjuga ed
independen ly o a ecipien HB101 lacking he
a ge plasmid (Figu e 2a). Al oge he , his sug-
ges s ha in p inciple he dispe sal o such mid-
bio ics in he bac e ial lo a would ela i ely
e icien ly esensi ize he ESBL-ha bou ing eci-
pien s o be a-lac ams. Ye , while his app oach
appea s p omising in accele a ing ESBL loss,
he e a e s ill po en ial obs acles o be aken
in o accoun when speci ic genes a e a ge ed
wi h Cas9. These obs acles would be ele an o
mos in si u applica ions ha seek o dele e
speci ic unc ions om he communi y (and
some imes in applica ions ha a emp o in o-
duce hem); hence, we decided o ake a close
look a he ca ea s and he ealis ic p ospec s o
midbio ic enginee ing.
In many cases, he e can be mul iple a ian s
o he genes ha encode undesi ed pheno ypes.
Fo example, he eisnosingleguidingc RNA
sequence ha would di ec Cas9 o all possible
ESBL a ian s. Howe e , all classes o be a-
lac amase genes sha e sequences ha a e usually
conse ed wi hin he class (Figu e 3). Ta ge ing
hese si es would p o ide a b oad ac i i y agains
he class ega dless o speci ic knowledge o he
a ian in any pa icula case. When a ious
c RNAs a e combined in o he same plasmid
simila ly o space a ays o na u al CRISPR
sys ems, se e al a ge s could be abolished wi h
a single pCRISPR plasmid. We es ed his by
adding wo c RNA coding si es sepa a ed by
a epea in o he pCRISPR plasmid. This
pCRISPR-mul i-c RNA plasmid was hen ans-
e ed in o wo bac e ial s ains each ha bo ing
a di e en ype o an ESBL gene (blaTEM-52b
and blaCTX-M-14). The plasmid exhibi ed he
ac i i y agains bo h ESBL ypes, leading o
a nea ly 500- old dec ease in cell densi y in
ea ed bac e ia compa ed o con ol, sugges ing
ha combina ion o c RNA si es could indeed be
u ilized o achie e b oad ac i i y (Figu e 1c).
GUT MICROBES 645
We u he s udied he indi idual bac e ia ha
appea ed o ha e a oided he an i-ESBL e ec
despi e ha ing been in oduced wi h he midbio ic
sys em. In o he wo ds, some bac e ia which had
ecei ed he pCRISPR-c RNA/mul ic RNA
plasmid s ill e ained he esis ance o be a-
lac ams (Figu e 1b-c). Sequencing o CRISPR
space locus o hese plasmids (8 escape colonies/
eplica e/expe imen ) e ealed ha he obse ed
ole ance o he midbio ic ea men a e 24
Figu e 1. Midbio ic plasmids agains ESBL-posi i e bac e ia. (a). 1) Dono cell deli e s midbio ic plasmid sys em (pCRISPR plasmid
and deli e y plasmid bo h o which sha e he same o igin o ans e si e, o iT) ia conjuga ion in o ecipien a ge cell ha ha bo s
ESBL plasmid (pESBL). 2) A e a success ul deli e y o he plasmids, he new hos cell s a s p oducing he componen s equi ed o
CRISPR/Cas9-ac i i y (endonuclease Cas9, c RNA and ac RNA, encoded by pCRISPR). 3) Cas9 clea es he ESBL gene based on c RNA
ha is p og ammed o a ge a conse ed egion wi hin he gene. 4) This esul s in deg ada ion o ESBL plasmid. (b). Among he
ansconjugan s (T ansc) ecei ing he pCRISPR-c RNA, a di e ence o nea ly ou o de s o magni ude in ESBL-posi i e bac e ia was
obse ed. Rec deno es he o al numbe o ecipien bac e ia. Ou o he su i o s, he dele ion o he space in he CRISPR locus o
pCRISPR-c RNA plasmid (whi e a owheads) explained he loss o ac i i y. The mean cell densi y (c u/ml) is calcula ed om a o al o
six eplica es om wo di e en expe imen s (n= 6). The black ba s indica e he s anda d e o o mean (SEM). (c). T ans o ma ion o
pCRISPR-mul i-c RNA in o a ge bac e ia caused he cell densi y o HB101(pEC13) (blaCTX-M) o decline by wo o de s o magni ude
and HB101(pEC15) (blaTEM) by h ee o de s o magni ude. The dele ion o ei he one (g een and yellow a owheads) o bo h o he
space s (blue a owheads) esul ed in he su i al o ans o man s. La ge dele ion in CRISPR locus was mos likely he eason o
he unsuccess ul ampli ica ion o some escape mu an s, as he p ime binding si es we e loca ed in he dele ion (o ange a ow-
heads). Some su i o s con ained he in ac space s, sugges ing ha Cas9 gene o he a ge sequence migh ca y mu a ions. The
mean cell densi y is calcula ed om h ee eplica es (n= 3). The black ba s indica e he s anda d e o o mean (SEM).
Figu e 2. Conjuga ion o midbio ic sys em. (a). The conjuga ion a es o pCRISPR-c RNA and pCRISPR-con ol plasmid a e equal,
de e mined by measu ing he mobiliza ion equencies a e 24 h conjuga ion. The e o e, he p esence o space s does no i sel
hinde he mobiliza ion a e o he pCRISPR plasmid. The mean cell densi y was calcula ed om h ee eplica es (n= 3). The black
ba s indica e he s anda d e o o mean (SEM). (b). A e 72 h, he deli e y plasmid was obse ed o conjuga e independen ly
wi hou he mobilizable pCRISPR-con ol plasmid, as he densi y o cells con aining pCRISPR-con ol plasmid was wo o de s o
magni ude lowe han cells wi h deli e y plasmid. Also, when 90 colonies om deli e y plasmid selec ion pla e we e s eaked on
pla e selec ing o pCRISPR-con ol plasmid, none o hem was obse ed o con ain he pCRISPR-con ol plasmid. On he con a y, all
he 90 colonies wi h pCRISPR-con ol plasmid also con ained he deli e y plasmid. The mean cell densi y was calcula ed om h ee
eplica es (n= 3). The black ba s indica e he s anda d e o o mean (SEM).
646 P. RUOTSALAINEN ET AL.
h was mainly due o loss o he be a-lac amase-
a ge ing space (s) and hei adjacen epea (see
he g aphic illus a ion o space dele ions in
Figu e 1b-c). In some cases, howe e , we did no
succeed o ampli y he c RNA coding egion a all,
sugges ing ha a la ge dele ion migh ha e
occu ed wi hin he egion. On he o he hand,
some imes he c RNA si e was unal e ed, indica -
ing po en ial changes elsewhe e, such as mu a ions
in ac RNA, Cas9 o PAM sequence.
10
Ne e heless, he eme gence o mu an s may be
di icul o p e en , bu in p inciple se e al copies
o he c RNA egions, o example, could be
included in he plasmid, hence allowing i o e ain
i s ac i i y e en i one o he si es is los .
Ano he po en ial conce n de i es om he
sepa a ion o he midbio ic in o wo o mo e plas-
mids. I is possible ha he deli e y plasmid mobi-
lizing he pCRISPR plasmid goes ‘ ogue’and
sp eads alone in he communi y, hus a enua ing
he desi ed e ec . We in es iga ed his possibili y by
cul i a ing midbio ic bac e ia (ha bo ing pCRISPR
con ol plasmid) oge he wi h ESBL-posi i e s ain
o 72 h du ing which he cul u e was e eshed
once a day. All o he s udied clones (90 colonies)
wi h he mobilizable pCRISPR plasmid also con-
ained he deli e y plasmid. In con as o his, all
bac e ia ha bo ing he deli e y plasmid had los he
pCRISPR plasmid (Figu e 2b). This indica es ha
he mobilizable pCRISPR plasmid is no always
deli e ed oge he wi h he conjuga i e plasmid,
hus equi ing coun e measu es o minimize he
p obabili y o such e en s. The e a e a leas wo
possibili ies o achie e his: ei he he pCRISPR
plasmid and deli e y plasmid could be combined
in o a single plasmid o he oxin–an i oxin sys em
could be sepa a ed so ha he pCRISPR plasmid
ca ies he gene o an i oxin and he deli e y plas-
mid encodes he oxin. In he la e case, he dis-
pe sal o he deli e y plasmid alone would lead o
cy o oxic esponse and dea h o he ecipien cell.
Conjuga i e plasmids a e agen s in na u al
mic obial communi ies, albei no an inhe en
pa o any pa icula s ain o species. In he
ecen bloom in mic obio a esea ch, hey ha e
so a been a seldom u ilized ool o inducing
gene ic changes in exis ing bac e ial communi ies.
Plasmids could be used bo h o in oduce desi ed
genes o emo e exis ing ones. Whe he hey ha e
applica ions beyond labo a o ies is ye o be
demons a ed, and he possible sp ead o male o-
len ai s ia ho izon al gene ans e may be
a de e en agains using plasmids o enginee ing
pu poses. Indeed, he ob ious isk in in oducing
a conjuga i e plasmid in o a bac e ial communi y
is ha he elemen may pick up an unwan ed gene
and dispe se i u he in o o he hos s. Be o e
in oduc ion in o clinical applica ions, he esis-
ance genes o deli e y plasmid should be dele ed
o p e en dispe sal o new esis ance genes.
Howe e , i mus be no ed ha he communi ies
aimed o be enginee ed will ne e heless ha bo
a ious ypes o mobile gene ic elemen s, and,
hus, i he e is no able selec ion wi hin he popu-
la ion o acqui ing a pa icula gene, i is likely o
dispe se anyway. In any e en , i he plasmid used
o midbio ic-like enginee ing mus be emo ed
Figu e 3. Designing o guide RNA o conse ed si es in be a-
lac amase genes. A po en ial obs acle in gene dele ion by
midbio ic applica ion is he di e si y o he genes ha need
o be a ge ed. By combining mul iple space s in o a single
plasmid and selec ing conse ed si es wi hin a ge genes, i is
possible o inc ease he co e age. As he be a-lac amase genes
belonging o he same class sha e conse ed si es in nucleo ide
le el, hese si es can be used o design space s o CRISPR/Cas9
sys em in o de o a ge se e al esis ance gene a ian s wi h
a single space . Majo i y o he genes in class blaTEM (154)
con ain he conse ed a ge sequence (g een ba ). The a ge
sequence selec ed o he class o blaCTX-M genes (g een ba )
is no as highly conse ed as in he blaTEM class, only 52 genes
con ain he exac sequence. Only one gene in blaTEM class has
a poin mu a ion ( ed ec angle) in he i s nucleo ide nex o
PAM (blue), whe eas genes o blaCTX-M class ha e mo e a ia-
ion in hese nucleo ides. These misma ches in he i s se en
nucleo ides nex o PAM migh hinde he ecogni ion o he
a ge by Cas9
24
and hus he e iciency o he space .
GUT MICROBES 647
om he communi y, he plasmid-dependen bac-
e iophages could p o ide a way o induce di ec
selec ion agains he plasmid. Howe e , while
in i o expe imen s sugges ha his would esul
in plasmid loss,
26,27
i is ye o be de e mined
whe he his occu s also in i o.
O e all, he ac ion o he communi y ha can
be enginee ed wi h conjuga i e plasmids is equal
o he ac ion o he lo a ha ecei es hem.
S udies sugges ha plasmid dynamics and pe sis-
ence in a communi y is a complica ed ma e
whe e ophic le els and a ious cha ac e is ics o
plasmids, hei hos s and he en i onmen play an
indispensable ole.
28,29
Wi hou ex ensi e selec ion
o he midbio ic plasmid, i is unlikely o sp ead
o e en all possible hos s. The e o e, as in he case
o ESBL ca iage, he midbio ic sys em could be
conside ed as a boos e which accele a es ESBL
cu ing a he han an ou igh ea men .
Some imes, howe e , e en a small ac ion o engi-
nee ed bac e ia may be enough, such as in he case
o making he midbio ics encode ex e nally
sec e ed bac e iocins agains unwan ed bac e ial
species. Ye , he o e all imp o ed unde s anding
o he su i al condi ions o plasmids can help us
ind ways bo h o ge id o conjuga i e plasmids
and, i necessa y, o acili a e hei dispe sal.
Ne e heless, while cau ion is necessa y, he abili y
o in oduce o emo e genes wi hin na u al bac-
e ial communi ies is a eal possibili y ha could
be conside ed as a po en ial ool o gene ic engi-
nee ing o exis ing bac e ial sys ems o , o exam-
ple, modi ica ion o gu mic obe ansplan s p io
o hei implemen a ion.
Ma e ials and me hods
Plasmids, bac e ial s ains and cul u e condi ions
In his s udy, he so-called midbio ic sys em consis s
o he conjuga i e RP4
blaTEM−2Δ172−714
plasmid
(deli e y plasmid) and mobilizable pCas9 plasmid
(pCRISPR plasmid, a gi om Luciano Ma a ini,
Addgene plasmid # 42876) encoding he S. pyogenes
CRISPR/Cas9 sys em
24
wi h c RNA(s) a ge ing
conse a i e si es o di e en be a-lac amase esis-
ance genes in ESBL plasmids (Table 1). pCas9 was
made mobilizable by cloning RP4 o iT si e
12,30
(50980–51793 bps, ampli ied wi h p ime s
RP4o iT-F and RP4o iT-R, Supplemen a y Table 1)
in o pCas9 diges ed wi h SalI (The moScien i ic;
Wal ham, Massachuse s, Uni ed S a es) in o egion
spanning 7377–7486 bps. The phospho yla ed ESBL-
gene- a ge ing c RNA oligonucleo ides (2 µM each)
we e i s annealed oge he in 50 µl eac ion wi h 1x
o T4 ligase bu e (New England Biolabs; Ipswich,
Massachuse s, Uni ed S a es) and 0.05 M NaCl by
hea ing i s a 95°C o 5 min and hen cooling i
down g adually (1°C/35 sec) o 20°C. Then, c RNA
inse was liga ed in o BsaI (The moScien i ic)
diges ed pCas9 plasmid by T4 ligase in T4 ligase
bu e (New England Biolabs; Ipswich,
Massachuse s, Uni ed S a es). In o de o p epa e
he pCRISPR-mul i-c RNA plasmid, he mul i-
c RNA inse was mul iplied by PCR om
a syn he ic plasmid (GenSc ip ; Nanjing, China)
wi h p ime s space -mul i-c RNA-F and space -
mul i-c RNA-R (Supplemen a y Table 1). PCR p o-
duc was pu i ied acco ding o ins uc ions o
Qiagen PCR pu i ica ion ki be o e being liga ed
(simila ly as abo e) in o he plasmid. The pCRISPR-
con ol plasmid was o he wise simila bu lacked he
c RNA (Table 1). I no men ioned o he wise, all he
PCRs we e done acco ding o ins uc ions o
Phusion Ho S a II High-Fideli y PCR mas e mix
(The moScien i ic), excep o an ex ended ini ial
dena u a ion ( om 5 min o 7 min 30 s), using
C1000 The mal Cycle (Bio-Rad Labo a o ies Inc.;
He cules, Cali o nia, Uni ed S a es). Bo h ESBL plas-
mids, pEC13 and pEC15, in ecipien s ains, o igi-
na e om nosocomial isola es,
25
and he conse ed
si es o hei espec i e be a-lac amase genes (Table
1) we e selec ed as a ge s o he CRISPR/Cas9
sys em o pCRISPR plasmids.
All he bac e ial cul u es we e g own a +37°C in
Lu ia Be ani Lennox-b o h (LB)
31
and, as necessa y,
pla ed on LB-aga (1%) pla es. When app op ia e,
he ollowing an ibio ic concen a ions we e used:
i ampicin (50 µg/ml), s ep omycin (25 µg/ml),
kanamycin (25 µg/ml), chlo amphenicol (25 µg/ml)
and ampicillin (150 µg/ml). Liquid cul u es we e
shaken a 220 pm.
Pa ial dele ion o blaTEM-2 in RP4
The pa o blaTEM-2 gene (172–714 bp) con ain-
ing he c RNA a ge si e was dele ed om RP4 o
p e en he midbio ic sys em om sel - a ge ing he
648 P. RUOTSALAINEN ET AL.
Table 1. Bac e ial s ains and plasmids used in he expe imen s and he space sequences o pCRISPR plasmid. Only he esis ance genes ele an o he expe imen s a e men ioned
he e.
S ain ea u es Plasmid Rele an cha ac e is ics Resis ance genes
DONOR
HMS174
E. coli K-12, ch omosomal i ampicin- esis ance RP4
blaTEM−2Δ172−714
IncP plasmid aph(3ʹ)-Ib, e , blaTEM-
2Δ172–714
pCRISPR-c RNA o iT si e o RP4
(50 980-51 793
bp)
A space a ge ing conse a i e si e o blaTEM
genes
ca
pCRISPR-mul i-
c RNA
c
3 space s a ge ing conse a i e si es o blaTEM,
blaCTX-M, blaSHV genes, espec i ely
pCRISPR-con ol Wi hou c RNA
RECIPIENT HB101 E. coli K-12, ch omosomal s ep omycin
esis ance
pEC13 Ta ge o pCRISPR-mul i-c RNA blaCTX-M-14
pEC15 Ta ge o pCRISPR-c RNA/mul i-c RNA blaTEM-52b
RECIPIENT BL21
Gold
E. coli B, ch omosomal e acyclin esis ance pCRISPR-c RNA A space a ge ing conse a i e si e o blaTEM genes ca
Sequence o he c RNA (5 →3ʹ)
c RNA
a
AAACTCACCAGTCACAGAAAAGCATCTTAG
mul i-c RNA
b
AAACTCACCAGTCACAGAAAAGCATCTTAGTTTTAGAGCTATGCTGTTTTGAATGGTCCCAAAACAAATAGGTCACCAGAACCAGGTTTTA
GAGCTATGCTGTTTTGAATGGTCCCAAAACAACTGAATGAGGCGCTTCCCG
a
Sequence o c RNA o pCRISPR-c RNA
b
Sequence o c RNAs o pCRISPR-mul i-c RNA
c
The plasmid was isola ed om he DH5αs ain.
GUT MICROBES 649