Midbiotics : conjugative plasmids for genetic engineering of natural gut flora

This is a sel -a chi ed e sion o an o iginal a icle. This e sion may di e om he o iginal in pagina ion and ypog aphic de ails. Au ho (s): Ti le: Yea : Ve sion: Copy igh : Righ s: Righ s u l: Please ci e he o iginal e sion: CC BY-NC-ND 4.0 h ps://c ea i ecommons.o g/licenses/by-nc-nd/4.0/ Midbio ics : conjuga i e plasmids o gene ic enginee ing o na u al gu lo a © 2019 The Au ho s Published e sion Ruo salainen, Pil i; Pen inen, Ree a; Ma ila, Sa i; Jalas uo i, Ma i Ruo salainen, P., Pen inen, R., Ma ila, S., & Jalas uo i, M. (2019). Midbio ics : conjuga i e plasmids o gene ic enginee ing o na u al gu lo a. Gu Mic obes, 10(6), 643-653. h ps://doi.o g/10.1080/19490976.2019.1591136 2019 Full Te ms & Condi ions o access and use can be ound a h ps://www. and online.com/ac ion/jou nalIn o ma ion?jou nalCode=kgmi20 Gu Mic obes ISSN: 1949-0976 (P in ) 1949-0984 (Online) Jou nal homepage: h ps://www. and online.com/loi/kgmi20 Midbio ics: conjuga i e plasmids o gene ic enginee ing o na u al gu lo a Pil i Ruo salainen, Ree a Pen inen, Sa i Ma ila & Ma i Jalas uo i To ci e his a icle: Pil i Ruo salainen, Ree a Pen inen, Sa i Ma ila & Ma i Jalas uo i (2019) Midbio ics: conjuga i e plasmids o gene ic enginee ing o na u al gu lo a, Gu Mic obes, 10:6, 643-653, DOI: 10.1080/19490976.2019.1591136 To link o his a icle: h ps://doi.o g/10.1080/19490976.2019.1591136 © 2019 The Au ho (s). Published wi h license by Taylo & F ancis G oup, LLC. View supplemen a y ma e ial Published online: 05 Ap 2019. Submi you a icle o his jou nal A icle iews: 2096 View ela ed a icles View C ossma k da a BRIEF REPORT Midbio ics: conjuga i e plasmids o gene ic enginee ing o na u al gu lo a Pil i Ruo salainen a , Ree a Pen inen a , Sa i Ma ila b , and Ma i Jalas uo i a,c a Uni e si y o Jy äskylä, Depa men o Biological and En i onmen al Science, Nanoscience Cen e , Jy äskylä, Finland; b Depa men o Biological Sciences, Uni e si y o Helsinki, Helsinki, Finland; c Depa men o Gene ics, Uni e si y o Camb idge, Camb idge, UK ABSTRACT The possibili y o modi y gu bac e ial lo a has become an impo an goal, and a ious app oaches a e used o achie e desi able communi ies. Howe e , he gene ic enginee ing o exis ing mic obes in he gu , which a e al eady compa ible wi h he es o he communi y and hos immune sys em, has no ecei ed much a en ion. He e, we discuss and expe imen ally e alua e he possibili y o use modi ied and mobilizable CRISPR-Cas9-endocing plasmid as a ool o induce changes in bac e ial communi ies. This plasmid sys em (b ie ly midbio ic) is deli e ed om bac e ial ec o in o a ge bac e ia ia conjuga ion. Compa ed o, o example, bac e ioph- age-based applica ions, he bene i s o conjuga i e plasmids include hei independence o any pa icula ecep o (s) on hos bac e ia and hei ela i e immuni y o bac e ial de ense mechan- isms (such as es ic ion-modi ica ion sys ems) due o he syn hesis o he complemen a y s and wi h hos -speci ic epigene ic modi ica ions. We show ha conjuga i e plasmid in associa ion wi h a mobilizable an ibio ic esis ance gene a ge ing CRISPR-plasmid e icien ly causes ESBL-posi i e ansconjugan s o lose hei esis ance, and mul iple gene ypes can be a ge ed simul aneously by in oducing se e al CRISPR RNA encoding segmen s in o he ans e ed plasmids. In he a e cases whe e he midbio ic plasmids ailed o esensi ize bac e ia o an ibio ics, he CRISPR space - (s) and hei adjacen epea s o la ge egions we e ound o be los . Resul s also e ealed po en ial ca ea s in he design o conjuga i e enginee ing sys ems as well as wo ka ounds o minimize hese isks. ARTICLE HISTORY Recei ed 19 No embe 2018 Re ised 19 Feb ua y 2019 Accep ed 28 Feb ua y 2019 KEYWORDS Gene ic enginee ing; an ibio ic esis ance; ESBL ca iage; conjuga i e plasmid; CRISPR edi ing; en e obac e ia In oduc ion The possibili y o enginee gu mic obiome has become a no able a enue o esea ch. Res o a ion o mic obial balance in he gu can p o ide a cu e o a mul i ude o complex diseases. None heless, s able ins alla ion o o eign bene icial mic obes in he gu is p oblema ic. S udies ha e shown ha die a y supplemen bac e ia (p obio ics) disappea om he communi y soon a e hei inges ion ceases. 1,2 This has led many eams o compile bac e ial cock ails ha would es ablish a mo e s able popula ion wi hin he gu . 3 Also, he nea - comple e eplacemen o gu lo a has been used o e e dysbiosis. This so-called bac e ial ansplan- a ion is an e ec i e app oach o cu e especially ecu en dia hea caused by Clos idium di icile, 4-6 bu could also be used o imp o e a - ious o he condi ions. 7 The composi ion o gu lo a is also sensi i e o die , and, o example, inc ease o ibe can esul in no able shi s in he communi y composi ion. 8 In some ci cums ances, howe e , he possibili y o modi y he genomes o exis ing bac e ia in he gu could p o ide an al e - na i e o emodel he sys em. So a , he gene ic enginee ing o bac e ial com- muni ies in si u has mainly ocused on bac e ioph- age-based applica ions. 9,10 Conjuga i e plasmids o e an al e na i e ou e wi h di e ing enginee ing quali ies. They a e ci cula an agonis ic gene ic ele- men s ha can media e hei own ans e om one bac e ium o ano he . In addi ion, hese sel - ansmissible plasmids can co- ans e non- conjuga i e plasmids wi h app op ia e o iT si e. 11 The elaxosome o he conjuga i e plasmid ecog- nizes he simila o iT si e in non-conjuga i e plas- mid and mobilizes i h ough conjuga ion. 12 The exac conjuga ion mechanisms a y be ween plas- mids, bu hey all o m a channel be ween he cells h ough which he plasmid is usually anspo ed as CONTACT Ma i Jalas uo i [email p o ec ed] Depa men o Biological and En i onmen al Science, Uni e si y o Jy äskylä, Su on ie 9C, Ambio ica Building, Jy äskylä, Finland Supplemen al da a o his a icle can be accessed on he publishe ’s websi e. GUT MICROBES 2019, VOL. 10, NO. 6, 643–653 h ps://doi.o g/10.1080/19490976.2019.1591136 © 2019 The Au ho (s). Published wi h license by Taylo & F ancis G oup, LLC. This is an Open Access a icle dis ibu ed unde he e ms o he C ea i e Commons A ibu ion-NonComme cial-NoDe i a i es License (h p://c ea i ecommons.o g/licenses/by-nc- nd/4.0/), which pe mi s non-comme cial e-use, dis ibu ion, and ep oduc ion in any medium, p o ided he o iginal wo k is p ope ly ci ed, and is no al e ed, ans o med, o buil upon in any way. a single-s anded DNA molecule o he ecipien bac e ium. Plasmids can be eadily modi ied wi h a ious molecula biology me hods, hus p o iding a ela i ely simple pla o m o ca ying ou in si u gene ic enginee ing o bac e ial cells. Gi en ha he di e si y o gu mic obio a a ies e en be ween gene ically iden ical wins, 13 he a emp s o colonize maladap ed (enginee ed) bac e ia wi hin an al eady es ablished communi y can be a challenging i no an impossible ask. In his espec , he in oduc ion o an enginee ed mobile elemen in o he exis ing com- muni y ins ead o elying on he es ablishmen o an en i e bac e ium p o ides a po en ial wo ka ound o deploying desi ed unc ionali ies wi hin he sys- em. Gi en he es ablished concep s o p obio ics (heal h-p omo ing bac e ia) and p ebio ics (nu i- en s ha p omo e he g ow h o bene icial bac e ia), ”midbio ics”(plasmid-p obio ics in a sense) p o ide ye an al e na i e o m o bio ic subs ances ha can be used o acqui e bene icial changes in he gu lo a. Na u ally, such plasmids ha e only limi ed use, albei , in ce ain ins ances, hey may be e en a p e e able choice o e p obio ics such as when only pa icula genes need o be emo ed om he communi y. Plasmids a e di ided in o incompa ibili y g oups (Inc) based on hei po en ial o s ably coexis in a bac e ial cell. In o he wo ds, wo plasmids ha sha e he same Inc-g oup canno be main ained in a single cell inde ini ely. Conjuga i e plasmids also o en encode en y- exclusion mechanisms ha p e en ela ed plas- mids om en e ing he cell. Due o hese na u al ea u es, he plasmids used o enginee ing should be uncommon in he a ge ed lo a. Na u ally, de e mining he exis ence o ce ain plasmid ypes ou inely om a he e ogenous communi y is a labo ious ask. Ye , ce ain an ibio ic esis- ance–con e ing plasmids o En e obac e iaceae, o ins ance, a e ela i ely a e in pa ien s. Indeed, in a me as udy, Ca a oli e iewed he p e alence o di e en esis ance plasmid amilies in Ex ended Spec um Be a-Lac amase (ESBL) s ains. 14 Among he a es we e IncP- ype plas- mids. Despi e his, conjuga i e IncP-plasmids a e well-s udied, hey ha e a obus conjuga ion machine y and a b oad hos ange. As such, hey p o ide an example o po en ial backbones ha could be u ilized o enginee ing pu poses. In bac e iophage-based applica ions, he gene ic ma e ial wi hin he phage is eplaced, and as i in ec s a cell a e he a achmen o a speci ic ecep o on he hos cell su ace, i deli e s he genomic ca go in o he bac e ial hos . 9,10 Phage- based ools ha e acqui ed no able a en ion and a e cu en ly unde de elopmen owa d d ugs. The ad an age o phages is ha hey ha e a na ow hos ange, and hus, hey a ge speci i- cally only he desi ed ac ion o he bac e ial communi y. Ye , bac e ia apidly become esis an o phages, and phages canno be easily used o exe ac i i y agains e en all a ian s o ce ain species. In his ega d, conjuga i e plasmids p o- ide quali ies ha could be use ul o al e na i e and mo e gene ally applicable enginee ing pu - poses. As no ed abo e, conjuga i e plasmids a e usually deli e ed as a single DNA s and o he ecipien cell. The complemen ing s and is syn hesized in he ecipien bac e ium and hus i con ains all he hos -speci ic modi ica ions in he nucleic acids. 15 This way he hos does no ecog- nize he incoming plasmid as o eign gene ic ma e ial, which, in u n, allows he plasmid o es ablish i sel in o a na u al communi y wi hou p io knowledge o he ea u es o bac e ia he ein. Addi ionally, unlike phages, conjuga i e plasmids a e no dependen on speci ic ecep o s on hos cells as plasmids equi e only cell-cell con ac . And once plasmid ge s in o na u al bac e ia, i can u he dissemina e i sel in o he nex hos . The ans e a e om one bac e ium o ano he is, o cou se, slowe and less-p ecise han phage- media ed deli e y o DNA. This se s ce ain bounda ies o he u iliza ion o plasmids. Ne e heless, conjuga i e plasmids can p o ide a b oad hos ange o in oducing gene ic ma e- ial in o he gu lo a. The ad en o CRISPR-Cas9 edi ing has p o- oked nume ous s udies whe e speci ic a ge sequences wi hin a ious hos o ganisms a e modi ied, 16 e en enabling s ain-speci ic elimina- ion o bac e ia om he e ologous communi ies. 10 In oduc ion o CRISPR-Cas9 edi ing componen s in o conjuga i e plasmids p o ides a po en ial mean o emo e unwan ed genes such as hose con e ing an ibio ic esis ance om di e se bac- e ial sys ems. ESBL ca iage e e s o non- symp oma ic coloniza ion o he gu by bac e ia 644 P. RUOTSALAINEN ET AL. which a e esis an o a wide ange o di e en be a-lac am an ibio ics. 17,18 This is o majo con- ce n, as be a-lac ams a e he mos commonly used class o an imic obials, owing o hei b oad spec- um and minimal side e ec s. They a e abun- dan ly adminis e ed o ea and p e en bac e ial in ec ions du ing a ious medical p ocedu es. O e he pas ew decades, ESBL ca iage has become inc easingly mo e common among long- e m hospi alized pa ien s as well as in he communi y. 19 ESBL ca iage se es as a ese oi o esis ance genes and signi ican ly inc eases he isk o clinical in ec ions. 20-22 As such, we he e se o e alua e he possibili y o use conjuga i ely ans e ed plasmids o induce he loss o ESBL genes (loca ed ei he in plasmids o in he ch o- mosome) om a bac e ial communi y. Resul s and discussion We cons uc ed a midbio ic sys em consis ing o ac onjuga i eIncPplasmidRP4 23 and a mobilizable pCas9 plasmid con aining S ep ococcus pyogenes– de i ed CRISPR/Cas9 24 ha a ge s conse ed si es in wo di e en be a-lac amase genes ia plasmid- encoded CRISPR RNA (c RNA). Pa o RP4 o igin- o - ans e (o iT) si e was cloned in o pCas9 plasmid in o de o make i ho izon ally ans e able by he RP4-encoded elaxosome complex. Fu he , 543 bp egion, including he a ge si e o he CRISPR/Cas9 sys em, was dele ed om he be a-lac amase gene blaTEM-2 o RP4 o p e en he sys em om sel - a ge ing. F om now on, he RP4 blaTEM−2Δ172−714 plas- midis e e ed oasdeli e yplasmidand hemod- i ied pCas9 as pCRISPR plasmid, c RNA/mul i- c RNA e e ing o space (s) a ge ing he be a- lac amase gene(s). A dono bac e ium (Esche ichia coli HMS174) ha bo ing midbio ic plasmids (deli e y and pCRISPR-c RNA plasmids) was cocul u ed oge he wi h ecipien E. coli s ain (HB101) ca ying a conjuga i e ESBL-plasmid pEC15 ha encodes blaTEM-52b a ge gene. 25 The ans e o hese plasmids o ESBL-posi i e bac- e ia and he subsequen coexp ession o endo- nuclease Cas9 and c RNA should induce he loss o esis ance by guiding he Cas9 complex o ESBL gene and c ea e a double-s anded nick wi hin he a ge si e (Figu e 1a). Nicking linea izes he plasmid and p e en s i s eplica- ion. Indeed, a e 24 h, only app oxima ely 1:10 000 ansconjugan s e ained he esis ance in compa ison o a con ol ea men lacking he c RNA (Figu e 1b). To ule ou he possibili y ha his migh esul om he unequal conjuga- ion a es be ween pCRISPR-c RNA and pCRISPR-con ol plasmid, bo h we e conjuga ed independen ly o a ecipien HB101 lacking he a ge plasmid (Figu e 2a). Al oge he , his sug- ges s ha in p inciple he dispe sal o such mid- bio ics in he bac e ial lo a would ela i ely e icien ly esensi ize he ESBL-ha bou ing eci- pien s o be a-lac ams. Ye , while his app oach appea s p omising in accele a ing ESBL loss, he e a e s ill po en ial obs acles o be aken in o accoun when speci ic genes a e a ge ed wi h Cas9. These obs acles would be ele an o mos in si u applica ions ha seek o dele e speci ic unc ions om he communi y (and some imes in applica ions ha a emp o in o- duce hem); hence, we decided o ake a close look a he ca ea s and he ealis ic p ospec s o midbio ic enginee ing. In many cases, he e can be mul iple a ian s o he genes ha encode undesi ed pheno ypes. Fo example, he eisnosingleguidingc RNA sequence ha would di ec Cas9 o all possible ESBL a ian s. Howe e , all classes o be a- lac amase genes sha e sequences ha a e usually conse ed wi hin he class (Figu e 3). Ta ge ing hese si es would p o ide a b oad ac i i y agains he class ega dless o speci ic knowledge o he a ian in any pa icula case. When a ious c RNAs a e combined in o he same plasmid simila ly o space a ays o na u al CRISPR sys ems, se e al a ge s could be abolished wi h a single pCRISPR plasmid. We es ed his by adding wo c RNA coding si es sepa a ed by a epea in o he pCRISPR plasmid. This pCRISPR-mul i-c RNA plasmid was hen ans- e ed in o wo bac e ial s ains each ha bo ing a di e en ype o an ESBL gene (blaTEM-52b and blaCTX-M-14). The plasmid exhibi ed he ac i i y agains bo h ESBL ypes, leading o a nea ly 500- old dec ease in cell densi y in ea ed bac e ia compa ed o con ol, sugges ing ha combina ion o c RNA si es could indeed be u ilized o achie e b oad ac i i y (Figu e 1c). GUT MICROBES 645 We u he s udied he indi idual bac e ia ha appea ed o ha e a oided he an i-ESBL e ec despi e ha ing been in oduced wi h he midbio ic sys em. In o he wo ds, some bac e ia which had ecei ed he pCRISPR-c RNA/mul ic RNA plasmid s ill e ained he esis ance o be a- lac ams (Figu e 1b-c). Sequencing o CRISPR space locus o hese plasmids (8 escape colonies/ eplica e/expe imen ) e ealed ha he obse ed ole ance o he midbio ic ea men a e 24 Figu e 1. Midbio ic plasmids agains ESBL-posi i e bac e ia. (a). 1) Dono cell deli e s midbio ic plasmid sys em (pCRISPR plasmid and deli e y plasmid bo h o which sha e he same o igin o ans e si e, o iT) ia conjuga ion in o ecipien a ge cell ha ha bo s ESBL plasmid (pESBL). 2) A e a success ul deli e y o he plasmids, he new hos cell s a s p oducing he componen s equi ed o CRISPR/Cas9-ac i i y (endonuclease Cas9, c RNA and ac RNA, encoded by pCRISPR). 3) Cas9 clea es he ESBL gene based on c RNA ha is p og ammed o a ge a conse ed egion wi hin he gene. 4) This esul s in deg ada ion o ESBL plasmid. (b). Among he ansconjugan s (T ansc) ecei ing he pCRISPR-c RNA, a di e ence o nea ly ou o de s o magni ude in ESBL-posi i e bac e ia was obse ed. Rec deno es he o al numbe o ecipien bac e ia. Ou o he su i o s, he dele ion o he space in he CRISPR locus o pCRISPR-c RNA plasmid (whi e a owheads) explained he loss o ac i i y. The mean cell densi y (c u/ml) is calcula ed om a o al o six eplica es om wo di e en expe imen s (n= 6). The black ba s indica e he s anda d e o o mean (SEM). (c). T ans o ma ion o pCRISPR-mul i-c RNA in o a ge bac e ia caused he cell densi y o HB101(pEC13) (blaCTX-M) o decline by wo o de s o magni ude and HB101(pEC15) (blaTEM) by h ee o de s o magni ude. The dele ion o ei he one (g een and yellow a owheads) o bo h o he space s (blue a owheads) esul ed in he su i al o ans o man s. La ge dele ion in CRISPR locus was mos likely he eason o he unsuccess ul ampli ica ion o some escape mu an s, as he p ime binding si es we e loca ed in he dele ion (o ange a ow- heads). Some su i o s con ained he in ac space s, sugges ing ha Cas9 gene o he a ge sequence migh ca y mu a ions. The mean cell densi y is calcula ed om h ee eplica es (n= 3). The black ba s indica e he s anda d e o o mean (SEM). Figu e 2. Conjuga ion o midbio ic sys em. (a). The conjuga ion a es o pCRISPR-c RNA and pCRISPR-con ol plasmid a e equal, de e mined by measu ing he mobiliza ion equencies a e 24 h conjuga ion. The e o e, he p esence o space s does no i sel hinde he mobiliza ion a e o he pCRISPR plasmid. The mean cell densi y was calcula ed om h ee eplica es (n= 3). The black ba s indica e he s anda d e o o mean (SEM). (b). A e 72 h, he deli e y plasmid was obse ed o conjuga e independen ly wi hou he mobilizable pCRISPR-con ol plasmid, as he densi y o cells con aining pCRISPR-con ol plasmid was wo o de s o magni ude lowe han cells wi h deli e y plasmid. Also, when 90 colonies om deli e y plasmid selec ion pla e we e s eaked on pla e selec ing o pCRISPR-con ol plasmid, none o hem was obse ed o con ain he pCRISPR-con ol plasmid. On he con a y, all he 90 colonies wi h pCRISPR-con ol plasmid also con ained he deli e y plasmid. The mean cell densi y was calcula ed om h ee eplica es (n= 3). The black ba s indica e he s anda d e o o mean (SEM). 646 P. RUOTSALAINEN ET AL. h was mainly due o loss o he be a-lac amase- a ge ing space (s) and hei adjacen epea (see he g aphic illus a ion o space dele ions in Figu e 1b-c). In some cases, howe e , we did no succeed o ampli y he c RNA coding egion a all, sugges ing ha a la ge dele ion migh ha e occu ed wi hin he egion. On he o he hand, some imes he c RNA si e was unal e ed, indica - ing po en ial changes elsewhe e, such as mu a ions in ac RNA, Cas9 o PAM sequence. 10 Ne e heless, he eme gence o mu an s may be di icul o p e en , bu in p inciple se e al copies o he c RNA egions, o example, could be included in he plasmid, hence allowing i o e ain i s ac i i y e en i one o he si es is los . Ano he po en ial conce n de i es om he sepa a ion o he midbio ic in o wo o mo e plas- mids. I is possible ha he deli e y plasmid mobi- lizing he pCRISPR plasmid goes ‘ ogue’and sp eads alone in he communi y, hus a enua ing he desi ed e ec . We in es iga ed his possibili y by cul i a ing midbio ic bac e ia (ha bo ing pCRISPR con ol plasmid) oge he wi h ESBL-posi i e s ain o 72 h du ing which he cul u e was e eshed once a day. All o he s udied clones (90 colonies) wi h he mobilizable pCRISPR plasmid also con- ained he deli e y plasmid. In con as o his, all bac e ia ha bo ing he deli e y plasmid had los he pCRISPR plasmid (Figu e 2b). This indica es ha he mobilizable pCRISPR plasmid is no always deli e ed oge he wi h he conjuga i e plasmid, hus equi ing coun e measu es o minimize he p obabili y o such e en s. The e a e a leas wo possibili ies o achie e his: ei he he pCRISPR plasmid and deli e y plasmid could be combined in o a single plasmid o he oxin–an i oxin sys em could be sepa a ed so ha he pCRISPR plasmid ca ies he gene o an i oxin and he deli e y plas- mid encodes he oxin. In he la e case, he dis- pe sal o he deli e y plasmid alone would lead o cy o oxic esponse and dea h o he ecipien cell. Conjuga i e plasmids a e agen s in na u al mic obial communi ies, albei no an inhe en pa o any pa icula s ain o species. In he ecen bloom in mic obio a esea ch, hey ha e so a been a seldom u ilized ool o inducing gene ic changes in exis ing bac e ial communi ies. Plasmids could be used bo h o in oduce desi ed genes o emo e exis ing ones. Whe he hey ha e applica ions beyond labo a o ies is ye o be demons a ed, and he possible sp ead o male o- len ai s ia ho izon al gene ans e may be a de e en agains using plasmids o enginee ing pu poses. Indeed, he ob ious isk in in oducing a conjuga i e plasmid in o a bac e ial communi y is ha he elemen may pick up an unwan ed gene and dispe se i u he in o o he hos s. Be o e in oduc ion in o clinical applica ions, he esis- ance genes o deli e y plasmid should be dele ed o p e en dispe sal o new esis ance genes. Howe e , i mus be no ed ha he communi ies aimed o be enginee ed will ne e heless ha bo a ious ypes o mobile gene ic elemen s, and, hus, i he e is no able selec ion wi hin he popu- la ion o acqui ing a pa icula gene, i is likely o dispe se anyway. In any e en , i he plasmid used o midbio ic-like enginee ing mus be emo ed Figu e 3. Designing o guide RNA o conse ed si es in be a- lac amase genes. A po en ial obs acle in gene dele ion by midbio ic applica ion is he di e si y o he genes ha need o be a ge ed. By combining mul iple space s in o a single plasmid and selec ing conse ed si es wi hin a ge genes, i is possible o inc ease he co e age. As he be a-lac amase genes belonging o he same class sha e conse ed si es in nucleo ide le el, hese si es can be used o design space s o CRISPR/Cas9 sys em in o de o a ge se e al esis ance gene a ian s wi h a single space . Majo i y o he genes in class blaTEM (154) con ain he conse ed a ge sequence (g een ba ). The a ge sequence selec ed o he class o blaCTX-M genes (g een ba ) is no as highly conse ed as in he blaTEM class, only 52 genes con ain he exac sequence. Only one gene in blaTEM class has a poin mu a ion ( ed ec angle) in he i s nucleo ide nex o PAM (blue), whe eas genes o blaCTX-M class ha e mo e a ia- ion in hese nucleo ides. These misma ches in he i s se en nucleo ides nex o PAM migh hinde he ecogni ion o he a ge by Cas9 24 and hus he e iciency o he space . GUT MICROBES 647 om he communi y, he plasmid-dependen bac- e iophages could p o ide a way o induce di ec selec ion agains he plasmid. Howe e , while in i o expe imen s sugges ha his would esul in plasmid loss, 26,27 i is ye o be de e mined whe he his occu s also in i o. O e all, he ac ion o he communi y ha can be enginee ed wi h conjuga i e plasmids is equal o he ac ion o he lo a ha ecei es hem. S udies sugges ha plasmid dynamics and pe sis- ence in a communi y is a complica ed ma e whe e ophic le els and a ious cha ac e is ics o plasmids, hei hos s and he en i onmen play an indispensable ole. 28,29 Wi hou ex ensi e selec ion o he midbio ic plasmid, i is unlikely o sp ead o e en all possible hos s. The e o e, as in he case o ESBL ca iage, he midbio ic sys em could be conside ed as a boos e which accele a es ESBL cu ing a he han an ou igh ea men . Some imes, howe e , e en a small ac ion o engi- nee ed bac e ia may be enough, such as in he case o making he midbio ics encode ex e nally sec e ed bac e iocins agains unwan ed bac e ial species. Ye , he o e all imp o ed unde s anding o he su i al condi ions o plasmids can help us ind ways bo h o ge id o conjuga i e plasmids and, i necessa y, o acili a e hei dispe sal. Ne e heless, while cau ion is necessa y, he abili y o in oduce o emo e genes wi hin na u al bac- e ial communi ies is a eal possibili y ha could be conside ed as a po en ial ool o gene ic engi- nee ing o exis ing bac e ial sys ems o , o exam- ple, modi ica ion o gu mic obe ansplan s p io o hei implemen a ion. Ma e ials and me hods Plasmids, bac e ial s ains and cul u e condi ions In his s udy, he so-called midbio ic sys em consis s o he conjuga i e RP4 blaTEM−2Δ172−714 plasmid (deli e y plasmid) and mobilizable pCas9 plasmid (pCRISPR plasmid, a gi om Luciano Ma a ini, Addgene plasmid # 42876) encoding he S. pyogenes CRISPR/Cas9 sys em 24 wi h c RNA(s) a ge ing conse a i e si es o di e en be a-lac amase esis- ance genes in ESBL plasmids (Table 1). pCas9 was made mobilizable by cloning RP4 o iT si e 12,30 (50980–51793 bps, ampli ied wi h p ime s RP4o iT-F and RP4o iT-R, Supplemen a y Table 1) in o pCas9 diges ed wi h SalI (The moScien i ic; Wal ham, Massachuse s, Uni ed S a es) in o egion spanning 7377–7486 bps. The phospho yla ed ESBL- gene- a ge ing c RNA oligonucleo ides (2 µM each) we e i s annealed oge he in 50 µl eac ion wi h 1x o T4 ligase bu e (New England Biolabs; Ipswich, Massachuse s, Uni ed S a es) and 0.05 M NaCl by hea ing i s a 95°C o 5 min and hen cooling i down g adually (1°C/35 sec) o 20°C. Then, c RNA inse was liga ed in o BsaI (The moScien i ic) diges ed pCas9 plasmid by T4 ligase in T4 ligase bu e (New England Biolabs; Ipswich, Massachuse s, Uni ed S a es). In o de o p epa e he pCRISPR-mul i-c RNA plasmid, he mul i- c RNA inse was mul iplied by PCR om a syn he ic plasmid (GenSc ip ; Nanjing, China) wi h p ime s space -mul i-c RNA-F and space - mul i-c RNA-R (Supplemen a y Table 1). PCR p o- duc was pu i ied acco ding o ins uc ions o Qiagen PCR pu i ica ion ki be o e being liga ed (simila ly as abo e) in o he plasmid. The pCRISPR- con ol plasmid was o he wise simila bu lacked he c RNA (Table 1). I no men ioned o he wise, all he PCRs we e done acco ding o ins uc ions o Phusion Ho S a II High-Fideli y PCR mas e mix (The moScien i ic), excep o an ex ended ini ial dena u a ion ( om 5 min o 7 min 30 s), using C1000 The mal Cycle (Bio-Rad Labo a o ies Inc.; He cules, Cali o nia, Uni ed S a es). Bo h ESBL plas- mids, pEC13 and pEC15, in ecipien s ains, o igi- na e om nosocomial isola es, 25 and he conse ed si es o hei espec i e be a-lac amase genes (Table 1) we e selec ed as a ge s o he CRISPR/Cas9 sys em o pCRISPR plasmids. All he bac e ial cul u es we e g own a +37°C in Lu ia Be ani Lennox-b o h (LB) 31 and, as necessa y, pla ed on LB-aga (1%) pla es. When app op ia e, he ollowing an ibio ic concen a ions we e used: i ampicin (50 µg/ml), s ep omycin (25 µg/ml), kanamycin (25 µg/ml), chlo amphenicol (25 µg/ml) and ampicillin (150 µg/ml). Liquid cul u es we e shaken a 220 pm. Pa ial dele ion o blaTEM-2 in RP4 The pa o blaTEM-2 gene (172–714 bp) con ain- ing he c RNA a ge si e was dele ed om RP4 o p e en he midbio ic sys em om sel - a ge ing he 648 P. RUOTSALAINEN ET AL. Table 1. Bac e ial s ains and plasmids used in he expe imen s and he space sequences o pCRISPR plasmid. Only he esis ance genes ele an o he expe imen s a e men ioned he e. S ain ea u es Plasmid Rele an cha ac e is ics Resis ance genes DONOR HMS174 E. coli K-12, ch omosomal i ampicin- esis ance RP4 blaTEM−2Δ172−714 IncP plasmid aph(3ʹ)-Ib, e , blaTEM- 2Δ172–714 pCRISPR-c RNA o iT si e o RP4 (50 980-51 793 bp) A space a ge ing conse a i e si e o blaTEM genes ca pCRISPR-mul i- c RNA c 3 space s a ge ing conse a i e si es o blaTEM, blaCTX-M, blaSHV genes, espec i ely pCRISPR-con ol Wi hou c RNA RECIPIENT HB101 E. coli K-12, ch omosomal s ep omycin esis ance pEC13 Ta ge o pCRISPR-mul i-c RNA blaCTX-M-14 pEC15 Ta ge o pCRISPR-c RNA/mul i-c RNA blaTEM-52b RECIPIENT BL21 Gold E. coli B, ch omosomal e acyclin esis ance pCRISPR-c RNA A space a ge ing conse a i e si e o blaTEM genes ca Sequence o he c RNA (5 →3ʹ) c RNA a AAACTCACCAGTCACAGAAAAGCATCTTAG mul i-c RNA b AAACTCACCAGTCACAGAAAAGCATCTTAGTTTTAGAGCTATGCTGTTTTGAATGGTCCCAAAACAAATAGGTCACCAGAACCAGGTTTTA GAGCTATGCTGTTTTGAATGGTCCCAAAACAACTGAATGAGGCGCTTCCCG a Sequence o c RNA o pCRISPR-c RNA b Sequence o c RNAs o pCRISPR-mul i-c RNA c The plasmid was isola ed om he DH5αs ain. GUT MICROBES 649