scieee Science in your language
[en] (orig)

Expression of catalase and retinoblastoma-related protein genes associates with cell death processes in Scots pine zygotic embryogenesis

Read accessible full text

Expression of catalase and retinoblastoma-related protein genes associates with cell death processes in Scots pine zygotic embryogenesis

Author: Vuosku, Jaana,Sutela, Suvi,Kestilä, Johanna,Jokela, Anne,Sarjala, Tytti,Häggman, Hely
Publisher: BioMed Central,London,gb
Year: 2015
Source: https://jukuri.luke.fi/bitstream/10024/486272/1/Vuosku.pdf
RESEARCH ARTICLE Open Access
Exp ession o ca alase and e inoblas oma- ela ed
p o ein genes associa es wi h cell dea h p ocesses
in Sco s pine zygo ic emb yogenesis
Jaana Vuosku
1,3*
, Su i Su ela
1
, Johanna Kes ilä
1
, Anne Jokela
1
, Ty i Sa jala
2
and Hely Häggman
1
Abs ac
Backg ound: The cell cycle and cellula oxida i e s ess esponses a e igh ly con olled o p ope g ow h and
de elopmen o Sco s pine (Pinus syl es is L.) seed. P og ammed cell dea h (PCD) is an in eg al pa o he
emb yogenesis du ing which megagame ophy e cells in he emb yo su ounding egion (ESR) and cells in he
nucella laye s ace dea h. In he p esen s udy, we show bo h he issue and de elopmen al s age speci ic
exp ession o he genes encoding he au ophagy ela ed ATG5, ca alase (CAT), and e inoblas oma ela ed p o ein
(RBR) as well as he connec ion be ween he gene exp essions and cell dea h p og ams.
Resul s: We ound s ong CAT exp ession in he cells o he de eloping emb yo h oughou he emb yogenesis as
well as in he cells o he megagame ophy e and he nucella laye s a he ea ly emb yogeny. The CAT exp ession
was ound o o e lap wi h bo h he ATG5 exp ession and hyd ogen pe oxide localiza ion. A he la e emb yogeny,
CAT exp ession diminished in he dying cells o he nucella laye s as well as in megagame ophy e cells, showing
he i s signs o incipien cell dea h. Accumula ion o s a ch and mino RBR exp ession we e cha ac e is ic o
megagame ophy e cells in he ESR, whe eas s ong RBR exp ession was ound in he cells o he nucella laye s
a he la e emb yogeny.
Conclusions: Ou esul s sugges ha ATG5, CAT, and RBR a e in ol ed in he Sco s pine emb yogenesis and cell
dea h p ocesses. CAT seems o p o ec cells agains hyd ogen pe oxide accumula ion and oxida i e s ess ela ed
cell dea h especially du ing ac i e me abolism. The opposi e exp ession o RBR in he ESR and nucella laye s
alongside mo phological cha ac e is ics emphasizes he di e en ype o he cell dea h p ocesses in hese issues.
Fu he mo e, he changes in ATG5 and RBR exp essions speci ically in he megagame ophy e cells dying by nec o ic
cell dea h sugges he gene ic egula ion o de elopmen al nec osis in Sco s pine emb yogenesis.
Keywo ds: Au ophagy, Ca alase, Coni e , De elopmen al cell dea h, Emb yogenesis, Megagame ophy e, Pinus,
Re inoblas oma- ela ed p o ein, Sco s pine, Seed de elopmen
Backg ound
In mul icellula o ganisms such as plan s, he o ganized
des uc ion o cells by p og ammed cell dea h (PCD) is
essen ial o body plans and speci ic o gan shapes as well
as o emo ing damaged o in ec ed cells [1-4]. In
plan s, di e en cell dea h ypes a e o en de ined by
mo phological cha ac e is ics because p ecise molecula
mechanisms behind he egula ion and execu ion o cell
dea h p ocesses a e s ill poo ly known [5,6]. Two classes
o cell dea h, acuola cell dea h and nec osis, ha e been
sugges ed o plan s bu he e ms a e no unambiguous
[6,7]. Examples o acuola cell dea h a e ound du ing
emb yo, o gan and issue mo phogenesis and senescence,
whe eas nec osis is mos usually induced by a a ie y o
abio ic s esses and by success ul ecogni ion o a pa hogen
du ing he hype sensi i e esponse [6,8]. Howe e , nec osis
is no longe conside ed o be an uncon olled p ocess, bu
nec o ic cell dea h can also be a egula ed e en ha
con ibu es o he de elopmen and o he main enance o
issue and o ganismal in eg i y [9-11]. In plan s, he oles
* Co espondence: [email p o ec ed]
1
Gene ics and Physiology Uni , Uni e si y o Oulu, P.O. Box 3000, FI-90014
Oulu, Finland
3
Cu en add ess: Na u al Resou ces Ins i u e Finland (Luke), Ro aniemi Uni ,
FI-96301 Ro aniemi, Finland
Full lis o au ho in o ma ion is a ailable a he end o he a icle
© 2015 Vuosku e al.; licensee BioMed Cen al. This is an Open Access a icle dis ibu ed unde he e ms o he C ea i e
Commons A ibu ion License (h p://c ea i ecommons.o g/licenses/by/4.0), which pe mi s un es ic ed use, dis ibu ion, and
ep oduc ion in any medium, p o ided he o iginal wo k is p ope ly c edi ed. The C ea i e Commons Public Domain
Dedica ion wai e (h p://c ea i ecommons.o g/publicdomain/ze o/1.0/) applies o he da a made a ailable in his a icle,
unless o he wise s a ed.
Vuosku e al. BMC Plan Biology (2015) 15:88
DOI 10.1186/s12870-015-0462-0
o nucleases and p o eases in PCD a e e iden [12,13] bu
he cell dea h p ocesses also in ol e many o he molecula
mechanisms such as ca alase [14] and he e inoblas oma
ela ed p o eins [15] which a e equi ed o main ain
cellula homeos asis and hus may be di icul o
iden i y as ac ual cell dea h e ec o s.
The eac i e oxygen species (ROS) con ibu e o he
induc ion, signalling and execu ion o plan cell dea h
[16-18]. Hyd ogen pe oxide (H
2
O
2
), he mos s able
ROS [19], has ecei ed pa icula a en ion as a signal
molecule in ol ed in he egula ion o essen ial biological
unc ions such as cell dea h, pa hogen esponses, and gene
exp ession [16,20-23]. H
2
O
2
is a oxic byp oduc o cell
me abolism and H
2
O
2
gene a ion om a a ie y o cellula
p ocesses inc eases in esponse o nume ous de elopmen-
al signals and bio ic and abio ic s imulan s [24]. While
plan s con ain se e al ypes o H
2
O
2
-me abolizing p o-
eins, ca alases (CAT, hyd ogen pe oxide oxido educ ase,
EC 1.11.1.6) a e highly ac i e pe oxisomal enzymes which
exp ess high speci ici y owa ds H
2
O
2
and p o ec cells
om he oxic e ec s by he con e sion o H
2
O
2
in o
wa e and molecula oxygen [25]. I has been sugges ed
ha impac o H
2
O
2
is s ongly in luenced by he ex en
o accumula ion o H
2
O
2
allowed by an ioxidan enzymes
such as CAT. This has been shown in Chlamydomonas
einha d ii whe e a e e sible pa ial inac i a ion o CAT
co ela es wi h a ansien inc ease in he le el o H
2
O
2
.
The concen a ion ange seems o be necessa y o ac i a e
H
2
O
2
-dependen signaling pa hways s imula ing he
exp ession o H
2
O
2
esponsi e genes [26]. Fu he mo e,
he di ec in e ac ion o CAT wi h ROS could allow
CAT o ac as a molecula link be ween ROS and he
p omo ion o au ophagy-dependen cell dea h [14].
In plan s, he e inoblas oma ela ed p o eins (RBR)
egula e he p og ession o cell cycle and ansc ip ion
ia ch oma in-modi ie s and, u he mo e, unc ion in
p omo ion o cell di e en ia ion [27]. Recen ly, RBR1
was ound o con ol also cell dea h in maize (Zea mays L.)
endospe m cells [15]. The plan RBR p o eins a e
homologs o e inoblas oma suscep ibili y gene p oduc s
(pRB) i s ly disco e ed in human cells [28]. The pRB
p o eins a e ac i a ed by phospho yla ion and hei A/B
pocke domain enables hem o in e ac wi h mo e han
100 p o eins [29]. The in e ac ion o hypophospho yla ed
RBR wi h E2F and DP ansc ip ion ac o s p e en s cell
di ision by supp essing he ansi ion om G1 o S phase
in he cell cycle [27]. In plan s, RBR genes a e conse ed
and hey ha e been ound om g een algae, b yophy es,
lycophy es and om bo h monoco and dico angiospe m
species [27,30]. In ou p e ious s udy, we showed
ha he RBR/E2F pa hway ope a es also in coni e s
by p esen ing he exp ession o RBR and E2F genes
in in i o cul u ed Sco s pine (Pinus syl es is L.)
emb yogenic cells [31].
PCD is an in eg al pa o he seed de elopmen in
angiospe m and gymnospe m species (e.g. [32-35]). In
gymnospe ms, he Sco s pine seed ep esen s a well-
documen ed emb yogenesis wi h coo dina ed ac ion o
se e al dis inc cell dea h p og ams. The e iliza ion
o se e al eggs [36] and u he mo e he clea age o
polyzygo ic emb yos [37] leads o he p esence o
se e al emb yos in a young seed. Howe e , only he
dominan emb yo su i es, whe eas he subo dina e
emb yos die ia PCD du ing he seed de elopmen
[34]. Emb yos g ow and de elop inside he co osion
ca i y o he megagame ophy e issue which unc ions
as a nu ien sou ce o emb yos i.e. being cong uen
wi h he endospe m o angiospe ms [38]. Th oughou
he emb yo de elopmen , he megagame ophy e cells
in he emb yo su ounding egion (ESR) a e des oyed
by mo phologically nec o ic cell dea h [35]. Addi ionally,
he cells in he megagame ophy e su ounding nucella
laye s die du ing he seed de elopmen [35,39] p o iding
nu i ion o he su ounding issues and la e unc ioning
as a ba ie agains wa e and ungi [40,41]. The impo ance
o caspase-like VEIDase ac i i y, ype II me acaspases, and
Tad-D nuclease ha e been pe cei ed in cell dea h du ing
Sco s pine and No way sp uce (Picea abies (L.) Ka s .)
emb yogenesis [35,42,43]. In coni e s, he au ophagy
ela ed (ATG) p o eins a e essen ial o acuola cell
dea h and o ins ance, in No way sp uce, deple ion o
ATG5 and ATG6 causes abe a ions in he de elopmen
o suspenso s [44].
He e, we s udy he p og ess o wo dis inc ypes o
cell dea h p og ams and e eal he link be ween PCD
and he exp ession o CAT and RBR genes which a e
ypically conside ed as main aine s o cellula homeos asis.
We ocus on he cell dea h p ocesses in he ESR and nucel-
la laye s du ing he Sco s pine seed de elopmen , and
show ha ATG5 p e iously connec ed o he egula ion o
acuola cell dea h also exp esses in he cells des oyed ia
nec o ic-like cell dea h.
Me hods
Imma u e and ma u e Sco s pine seeds
One-yea -old imma u e seed cones we e collec ed
du ing he g owing pe iod in July om an open-pollina ed
eli e Sco s pine (Pinus syl es is L.) clone, K818, g owing
in he Sco s pine clone collec ion in Punkaha ju, Finland
(61°48′N; 29°17′E). Imma u e Sco s pine seeds we e
dissec ed om he de eloping cones. Fo he ana omical
obse a ions, o he de ec ion o PCD and o he
localiza ion o p o eins, s a ch, and mRNA ansc ip s o
ATG5,CAT,RBR and β-glucosidase (βG, EC 3.2.1.21), he
seed coa s we e emo ed and imma u e seeds we e ixed
immedia ely and embedded in pa a in as desc ibed below.
Fo he gene exp ession s udies, imma u e seeds we e
s o ed in liquid ni ogen un il use.
Vuosku e al. BMC Plan Biology (2015) 15:88 Page 2 o 13
Ma u e Sco s pine cones we e collec ed om he same
g a s as he imma u e cones in la e all o he same
g owing season. Ma u e Sco s pine seeds we e su ace
s e ilized wi h 3% Plan P ese a i e Mix u e (Plan Cell
Technology) o e nigh and placed he ea e on mois
il e pape and le o imbibe a oom empe a u e (RT)
o wo days. The ea e , seeds we e opened wi h a
scalpel, seed coa s we e emo ed, and he emb yos
and megagame ophy es we e sepa a ed om each o he
o he gene exp ession analysis. Fo he localiza ion o
ATG5 and CAT mRNA ansc ip s ma u e seeds we e
ixed as desc ibed below.
Ana omical and his ochemical obse a ions
De eloping and imbibed ma u e Sco s pine seeds
wi h and wi hou seed coa s we e dissec ed o he
his ochemical localiza ion o H
2
O
2
and pe oxidase.
The 3,5,3′5′- e ame hylbenzidine (TMB) is oxidised
by pe oxidases in a eac ion whe e H
2
O
2
ac sasa
hyd ogen accep o , and hus, TMB can be used o
localize H
2
O
2
and pe oxidases [45]. Fo he H
2
O
2
localiza ion he seeds we e incuba ed in 50 mM T is-
ace a e-bu e (pH 5.0), which con ained 0.1 mg/ml
3,5,3′,5′-TMB-HCl[45],a RTa leas o 45min.In
addi ion, seeds we e ea ed wi h 3% H
2
O
2
in 1x
phospha e-bu e ed saline (PBS) bu e (10 mM phospha e,
150 mM NaCl, pH 7.4) o 10 min p io o he his o-
chemical s aining o he pe oxidase loca ion. Nega i e
con ols we e incuba ed in 50 mM T is-ace a e-bu e .
The DAB (3,3′-diaminobenzidine) Pe oxidase Subs a e
ki (Vec o Labo a o ies) was used in localizing pe oxidase
ac i i y ollowing manu ac u e ’sins uc ions.The
dissec ed seeds we e incuba ed o wo o h ee min
a RT in eac ion mix u e. The DAB Pe oxidase Sub-
s a e eac ion mix u e con ains H
2
O
2
which oxidizes
DAB, and subsequen ly gene a es a da k b own eac ion
p oduc when pe oxidases a e p esen . Nega i e con ols
we e incuba ed in eac ion mix u e wi hou DAB. The
blocking o pe oxidase ac i i y was a emp ed by incu-
ba ing seed ma e ial in 1% H
2
O
2
a RT o 10 min.
The sec ions we e examined by a s e eo mic oscope
(S emi DV4, Ca l Zeiss) and imaged wi h a digi al
came a (Nikon Coolpix 950, Japan).
De eloping and ma u e Sco s pine seeds we e ixed o
s udying he ana omical ea u es o he emb yos and o
in si u mRNA hyb idiza ion analyses using he ollowing
p o ocol om ixa ion o co e slip moun ing. Tissues
we e ixed in 4% (w/ ) p- o maldehyde in 1x PBS. A e
dehyd a ion wi h a g aded se ies o e hanol, e hanol
was eplaced by e ia y bu anol and hen g adually
by pa a in. Sec ions (5 and 7 μm) we e cu om he
embedded samples wi h a mic o ome, moun ed on
Supe F os ®Plus slides (Menzel-Glase ) and ixed by
d ying o e nigh a 40°C.
The pa a in sec ions we e dewaxed in His ochoice
(Sigma) and ehyd a ed h ough a g aded se ies o
e hanol. To s udy he de elopmen al s age o he
emb yos, he p epa a es we e s ained wi h oluidine blue
(0.05% oluidine blue in H
2
O). Acco ding o Singh [46]
Sco s pine emb yogenesis is di ided in o h ee di e en
phases, p oembyogeny, ea ly emb yogeny and la e
emb yogeny. He e, we s udied he ea ly emb yogeny
which ini ia es wi h he elonga ion o he suspenso
sys em and e mina es wi h he appea ance o he
oo me is em (Figu e 1A) and he la e emb yogeny
which con ains he es ablishmen o oo and shoo
me is ems and he ma u a ion o he leading emb yo
(Figu e 1B). Fo he p o ein and s a ch isualiza ion
he sec ions we e s ained wi h 0.2% amido black [47] and
wi h 0.5% po assium iodide-iodine (IKI) [48], espec i ely.
All sec ions we e s udied wi h a ligh mic oscope
(Nikon Eclipse E600) and pho og aphed wi h a Qimaging
Mic opublishe 5.0 RTV digi al came a. Adobe Pho oshop
CS was used o adjus con as , b igh ness and colou
uni o mly o en i e images.
TUNEL assay
Nuclea DNA agmen a ion, i.e. DNA s and b eaks
lea ing ee 3′-OH e mini, was shown by he TUNEL
( e minal deoxy ibonucleo idyl ans e ase (TdT)-media ed
deoxyu idine iphospha e (dUTP) nick end labelling)
assay. The dewaxed and ehyd a ed sec ions we e diges ed
wi h 10 μg/ml p o einase-K (Roche) o 30 min and wo
washings wi h PBS. The sec ions we e labelled wi h TMR
ed ( ed luo escence) using in si u cell dea h de ec ion ki
(Roche) acco ding o he manu ac u e ’s p o ocol. P io o
he labelling p ocedu e, he posi i e con ol sec ions we e
incuba ed wi h DNase I ecombinan (Roche) o induce
DNA s and b eaks. The label solu ion wi hou e minal
ans e ase, ins ead o he TUNEL eac ion mix u e, was
used as a nega i e con ol. The labelled sec ions we e
examined wi h a con ocal lase scanning mic oscope
(LSM 5 Pascal, Ca l Zeiss) wi h an HBO 100 me cu y
lamp and using he HeNe lase 543 nm line, dich oic
beam spli e (HFT 488/543/633; Ca l Zeiss) and LP
560 emission il e (Ca l Zeiss).
RNA ex ac ion, e e se ansc ip ion and cDNA cloning
To al RNA was ex ac ed using he au oma ed magne ic-
based KingFishe ™mL me hod (The mo Elec on
Co po a ion) wi h he MagEx ac o ® o al RNA pu i-
ica ion ki (Toyobo) acco ding o he manu ac u e ’s
ins uc ions. The RNA samples we e ea ed wi h
RNase- ee DNase (In i ogen) a RT o 15 min o
he elimina ion o con amina ing genomic DNA.
The ea e he RNA samples we e pu i ied wi h he
NucleoSpin® RNA Clean-Up ki (Mache ey-Nagel). The
RNA yields we e measu ed h ee imes wi h OD
260
Vuosku e al. BMC Plan Biology (2015) 15:88 Page 3 o 13
analysis using NanoD op ND1000 spec opho ome e
(NanoD op Technologies), and 1 μgo eachRNAsample
was subsequen ly used o he cDNA syn hesis. cDNA was
e e se- ansc ibed om an ancho ed oligo-dT p ime by
Supe Sc ip II e e se ansc ip ase (In i ogen) using
s anda d me hods in a eac ion olume o 20 μl. F agmen s
o hepu a i eSco spineATG5 and cell wall associa ed
βGwe e ampli ied by s anda d PCR using cDNA om
imma u e seeds as a empla e, gene speci ic p ime s
(Addi ional ile 1: Table S1) and DyNAzyme™EXT
polyme ase (Finnzymes). The agmen s wi h app op ia e
leng h we e gel-pu i ied by Mon age DNA Gel Ex ac ion
Ki (Millipo e Co po a ion), cloned by TOPO TA Cloning
Ki (In i ogen) and sequenced by an Applied Biosys ems
3730 DNA analyze .
In si u mRNA hyb idiza ion analysis
The RNA p obes o he in si u mRNA hyb idiza ion ana-
lyses o ATG5,CAT,RBR and βG ansc ip s in de eloping
and ma u e seeds we e p epa ed using a PCR-based ech-
nique [49]. The T7 RNA polyme ase p omo e sequence
(TAATACGACTCACTATAGGG) was in oduced a he
5′ends o he gene-speci ic p ime s (Addi ional ile 1:
Table S2). The downs eam p ime s con ained an a i i-
cially in oduced T7 p omo e a i s 5′end, which enabled
he syn hesis o an isense ansc ip s. The ups eam
p ime s con aining T7 p omo e s a he 5′ends was used
o he syn hesis o sense ansc ip s, i.e. as nega i e
con ol.
The PCR agmen ep esen ing he coding egion o
ei he ATG5,CAT,RBR o βGwas p oduced unde
s anda d PCR condi ions by DyNAzyme™EXT polyme ase
(Finnzymes) using plasmid DNA con aining he cDNA in
ques ion as a empla e. The PCR agmen was gel-pu i ied
(DNA Gel Ex ac ion Ki , Millipo e Co po a ion) and
250 ng was subsequen ly used as a empla e DNA o
in i o ansc ip ion by T7 RNA polyme ase (In i ogen),
inco po a ing dig-UTP ia DIG RNA labelling Mix (Roche
Figu e 1 Ea ly and la e de elopmen al s ages o Sco s pine emb yogenesis. (A) The dominan emb yo and subo dina e emb yos in he
co osion ca i y a he ea ly emb yogeny su ounded by he emb yo su ounding egion (es ) o he megagame ophy e highligh ed wi h ed
colo . The a ow-shaped egion (as ) o he megagame ophy e ou side he es highligh ed wi h blue colo . (B) The dominan emb yo in he
co osion ca i y a he la e emb yogeny. The es o he megagame ophy e highligh ed wi h ed colo and as highligh ed wi h blue colo .
as = a ow-shaped egion, cc = co osion ca i y, e = emb yo, es = emb yo su ounding egion, m = megagame ophy e, mm = megaspo e
memb anes, nc = nucella cap, nl = nucella laye s, n = cellula nucellus, s = suspenso emnan s. Ba s: 100 μm.
Vuosku e al. BMC Plan Biology (2015) 15:88 Page 4 o 13
Molecula Biochemicals). Templa e DNA was diges ed
wi h ou uni s o RNase- ee DNase (In i ogen) in a
eac ion olume o 20 μl a 37°C o 10 min, he
p obe was p ecipi a ed and he yield o he DIG-labeled
RNA p obe was es ima ed by compa ing he in ensi y o
he sample o he de ined con ols made wi h DIG-labelled
con ol RNA (Roche Molecula Biochemicals).
The sec ions we e dewaxed, ea ed wi h P o einase K
(Finnzymes, 1 μg/ml in 100 mM T is/HCl, 50 mM
Na
2
EDTA, pH 7.5) a 37°C o 30 min and dehyd a ed in
a g aded se ies o e hanol up o absolu e. The slides
we e d ied in a acuum o 1 h. Fo he hyb idiza ion,
250 μl o hyb idiza ion mix u e was added o he sec ions,
moun ed unde co e slips and incuba ed in a wa e
a mosphe e a 55°C o e nigh . The hyb idiza ion mix u e
con ained 0.8 μg/ml o DIG-labelled RNA an isense o
sense p obe, 50% ( / ) deionized o mamide, 300 mM
NaCl, 10 mM T is/HCl (pH 7.0), 10 mM Na
3
PO
4
(pH 7.0), 50 mM EDTA, 10% (w/ ) dex an sul a e,
200 μg/ml RNA, 1x Denha d ’s solu ion and 10 uni s/ml
RNase Ou TM inhibi o (In i ogen).
A e he hyb idiza ion, he slides we e washed in 2x
NaCl/Ci (300 mM NaCl, 30 mM sodium ci a e, pH 7.0)
a RT o 10 min ollowed by 1x and 0.5x NaCl/Ci ea -
men by slow shaking a 37°C o 10 min. The washing was
ollowed by ea men o he RNase A (Roche, 1 μg/ml in
10 mM T is/HCl, 500 mM NaCl, 1 mM Na
2
EDTA,
pH 7.5) a 37°C o 60 min. Then he slides we e washed
ou imes in he same solu ion bu wi hou RNase A in a
slow shaking a 37°C o 15 min and once in 2x NaCl/Ci a
RT o 30 min.
Fo he de ec ion o hyb idized p obe, he slides we e
washed in T is/NaCl bu e (100 mM T is/HCl, 150 mM
NaCl, pH 7.5) o 5 min and blocked wi h 3% (w/ )
blocking eagen (Dig Nucleic acid de ec ion Ki , Roche)
and 0.3% ( / ) T i on X-100 in T is/NaCl bu e in a
wa e a mosphe e a RT o 30 min. 1 uni /ml o
An i-DIG-AP Fab agmen s (Roche) in T is/NaCl
bu e was added o he sec ions, moun ed unde pa a ilm
and incuba ed in a wa e a mosphe e a RT o 2 h. The
slides we e washed a RT ou imes in T is/NaCl bu e
o 10 min and in AP bu e (100 mM T is/HCl, 100 mM
NaCl, 50 mM MgCl
2
, pH 9.5) o 5 min. Fo colou
de elopmen , 2% ( / ) NBT/BCIP subs a e (Dig Nucleic
acid de ec ion Ki , Roche) and 1% ( / ) T i on X-100 in
AP bu e was dispe sed on he sec ions, moun ed wi h
co e slips and incuba ed in a wa e a mosphe e a RT in
he da k o e nigh . The slides we e washed wi h wa e ,
dehyd a ed in a g aded se ies o e hanol, ai -d ied and
hen moun ed wi h imme sion oil and co e ed wi h
co e slips. The sec ions we e examined wi h a ligh
mic oscope (Nikon Op ipho 2, Japan) and imaged
wi h an In ini y1–3C came a (Lumene a Co po a iom,
O awa, On a io, Canada), using he IMT iSolu ion Li e
image-p ocessing p og am (IMT i-Solu ion Inc., Vancou e ,
BC, Canada). The au o and manual iling ea u e o
image-p ocessing p og am was used o combine sepa a e
images o one. Non-speci ic signal was obse ed in he
emnan s o he degene a ed suspenso s, ESR, and inne
nucella laye s gene a ed by agmen ed nucleic acids
as p e iously desc ibed in Vuosku e al.[50].Adobe
Pho oshop CS5 was used o adjus con as , b igh ness
and colou uni o mly o en i e images.
Quan i ica ion o gene exp ession
The eal- ime e e se- ansc ip ion PCR analysis (Q-RT-
PCR) was used o he quan i ica ion o he CAT,RBR and
βGexp ession in imma u e seeds a he de elopmen al
s ages o ea ly and la e emb yogeny as well as in he
emb yos and megagame ophy es o ma u e seeds. Being
awa e o he challenges in inding sui able endogenous
e e ence genes o pine emb yogenesis [51], bo h absolu e
and ela i e Q-RT-PCR analyses we e used. Fo he
de e mina ion o mRNA copy numbe s in he absolu e
quan i ica ion, he s anda d cu es we e gene a ed using
se ial 10- old dilu ions o syn hesized RNA molecules o
con ol a iabili y du ing bo h RT and PCR s eps o
Q-RT-PCR uns. The DNA empla es om which he
RNA molecules could be ansc ibed we e ampli ied
bybasicPCRp ocedu eusinggene-speci icp ime s
(Addi ional ile 1: Table S3). The ups eam p ime s con-
ained T7 p omo e sequence (TAATACGACTCACTA
TAGGG) and he downs eam p ime s con ained poly(T)
ail a hei 5′end. The DNA molecules we e subsequen ly
used as empla es o in i o ansc ip ion by T7 RNA poly-
me ase. The numbe s o s anda d RNA molecules added o
he e e se- ansc ip ion eac ions we e calcula ed using he
molecula weigh s o he oligonucleo ides and A ogad o’s
cons an (6.022 · 10
23
mol
−1
). In he ela i e quan i ica ion,
ubiquinone (UBI) and glyce aldehyde-3-phospha e dehyd o-
genase (GAPDH) we e used as endogenous e e ence genes
(see Addi ional ile 2 o de ails).
In he absolu e Q-RT-PCR analysis (see Addi ional ile 2
o de ails o he ela i e quan i ica ion), he numbe o
biological eplica es was 5, 5, 6, and 4 o ea ly s age
imma u e seeds, la e s age imma u e seeds, emb yos, and
megagame ophy es, espec i ely. The PCR ampli ica ion
condi ions o he gene agmen we e op imized o he
Ligh Cycle ® 2.0 ins umen (Roche Diagnos ics), and he
subsequen PCR uns showed a single PCR p oduc
du ing mel ing cu e (The Tm Calling Analysis o
Ligh cycle ® 480 So wa e elease 1.5.0 SP3) and elec o-
pho e ic analysis. The eal- ime PCR ampli ica ions we e
pe o med using he Ligh Cycle ® 480 SYBR G een I Mas e
(Roche), 50 nM gene speci ic p ime s (Addi ional ile 1:
Table S4) and 2 μl cDNA in he eac ion olume o 20 μl.
The nega i e con ols con ained 2 μlo molecula
g ade wa e ins ead o cDNA empla e. The eal- ime PCR
Vuosku e al. BMC Plan Biology (2015) 15:88 Page 5 o 13

ampli ica ion was ini ia ed by incuba ion a 95°C o
10 min ollowed by 45 cycles: 10 s a 95°C, 10 s a 58°C
and 5 s a 72°C. E e y PCR eac ion was done as duplica e
o con ol o he a iabili y o PCR ampli ica ion and
he coe icien a ia ion, CV%, o echnical eplica es
was < 2.5. The Abs Quan /2nd De i a i e analysis o
Ligh cycle ® 480 so wa e elease 1.5.0 SP3 was u ilized o
gene a e he c ossing poin and concen a ion alues o
each sample.
S a is ical analysis
The mRNA copy numbe s gene a ed wi h he absolu e
Q-RT-PCR analysis we e u ilized in calcula ing he gene
exp ession. The exp ession o s udied genes was calcula ed
by di iding he indi idual alues wi h he mean numbe o
ansc ip s in he ea ly emb yogeny, ha is, alue o one
was gi en o he gene exp ession in he ea ly emb yogeny.
The signi icance o di e ence be ween he ea ly and la e
emb yogeny and be ween he emb yo and megagame o-
phy e o ma u e seeds was examined using wo sample
es wi h he g aphical use in e ace R Commande [52] in
R so wa e package (2.11.0) [53]. Log 10 ans o ma ion
was conduc ed o a iables no no mally dis ibu ed.
Resul s
Nuclea DNA agmen a ion in ESR and nucella laye s
In ou p e ious s udy, we showed ha megagame ophy e
cells in he ESR a e des oyed by mo phologically nec o ic
cell dea h and also he cells in he megagame ophy e
su ounding nucella laye s die du ing he Sco s pine seed
de elopmen [35]. Likewise, TUNEL posi i e nuclei we e
de ec ed in he ESR cells and in he nucella laye s in his
s udy (Addi ional ile 3: Figu e S2).
T ansien dec ease o CAT exp ession in
megagame ophy e a la e emb yogeny
The Sco s pine CAT (EU513163) was ampli ied using
zygo ic emb yo cDNA as a empla e. P e iously, h ee
CAT genes ha e been ound p esen in he angiospe m
species obacco (Nico iana abacum L.), A abidopsis,
maize, pumpkin (Cucu bi a sp.) and ice (O yza sa i a L.)
[54-58]. The angiospe m class I CATs a e s ongly
exp essed in pho osyn he ic issues, whe eas class II CATs
a e associa ed wi h ascula issues. Class III CATs a e
exp essed especially in seeds and ep oduc i e issues [25].
Sco s pine CATshowed high sequence simila i y (75%) wi h
maize CAT1 belonging o class III.
Based on he Q-RT-PCR analysis, he numbe o CAT
mRNA ansc ip s dec eased signi ican ly in de eloping
Sco s pine seeds when he emb yogenesis p oceeded
om he ea ly o he la e s age (P<0.001). In ma u e
seeds, he numbe o CAT ansc ip s was signi ican ly
g ea e in megagame ophy es han in emb yos (P=0.02)
(Figu e 2A). A he ea ly emb yogeny, in ense CAT
exp ession was localized in he cells o bo h he dominan
emb yo and subo dina e emb yos (Figu e 2B and D) as
well as in he cells o he megagame ophy e and he nucella
laye s (Figu e 2B and E). A he la e emb yogeny, he CAT
exp ession was s ill s ong in he cells o he dominan em-
b yo (Figu e 2C and G), whe eas i was clea ly diminished
in he cells o he nucella laye s (Figu e 2C and F) and in
he megagame ophy e (Figu e 2C and G). In ma u e seeds
he megagame ophy e cells su ounding he co osion ca i y
showed in ense CAT exp ession whe eas in he emb yo,
he exp ession was compa able o he la e emb yogeny
(Figu e 3). The speci ici y o he an isense CAT p obe
was con i med by he absence o signals in he sec ions
hyb idized wi h he sense CAT p obe (Addi ional ile 4:
Figu e S3).
Pe oxidase and H
2
O
2
localiza ion
A he ea ly emb yogeny, in ense blue colou indica ing
H
2
O
2
p esence was obse ed in he seed coa , ligh
wing (Figu e 4A), and cellula nucellus (Figu e 4B). In
addi ion, H
2
O
2
was de ec ed in he nucella laye s
(Figu e 4B), and megaspo e memb anes (Figu e 4C).
A hela eemb yogeny,H
2
O
2
was s ill p esen in he
seed coa and ligh wing, bu he ex en was clea ly
diminished (Figu e 4D). The seeds ea ed wi h T is-ace a e
bu e we e used as nega i e con ol (Figu e 4E). Pe oxidase
ac i i y was de ec ed h oughou he emb yogenesis in he
e y same seed s uc u es as H
2
O
2
and, addi ionally,
in he ESR cells and in he a ow-shaped egion (ASR) o
megagame ophy e, suspenso cells, and subo dina e
emb yos (Figu e 5A and B, Addi ional ile 5: Figu e S4).
Fo nega i e con ol DAB was excluded om he eac ion
bu e (Figu e 5C). The pe oxidase localiza ion wi h DAB
and TMB p o ocol supplemen ed wi h H
2
O
2
also ga e
compa able esul s (Addi ional ile 5: Figu e S4).
Minu e RBR exp ession in dying megagame ophy e
cells in ESR
The p edic ed Sco s pine RBR p o ein showed 57%
iden i y wi h A abidopsis RBR 1 p o ein. In A abidopsis,
only one RBR gene has been ound, and he p esence o
wo dis inc RBR genes ha e been sugges ed o a unique
ea u e o g asses [59]. In de eloping Sco s pine seeds,
he e was o e all low a ia ion in he numbe o RBR
mRNA ansc ip s ac oss he s udied Sco s pine seed
ma e ial. The RBR ansc ip le els we e compa able
be ween ea ly and la e emb yogenesis as well as be ween
he emb yos and megagame ophy es o ma u e seeds
when he exp ession was quan i ied wi h Q-RT-PCR
(Figu e 6A). The RBR exp ession was localized in bo h
emb yonic and megagame ophy e cells h oughou he
emb yogenesis excluding he dying megagame ophy e
cells in he ESR and he ASR cells (Figu e 6B, C and D,
Addi ional ile 6: Figu e S5). The RBR exp ession signal
Vuosku e al. BMC Plan Biology (2015) 15:88 Page 6 o 13
was ound weak in nucella cells a ea ly emb yogeny,
bu showed mo e in ensi y a la e s ages o emb yogenesis
(Figu e 6E and F). The speci ici y o he an isense
RBR p obe was con i med by he absence o signals
in he sec ions hyb idized wi h he sense RBR p obe
(Addi ional ile 4: Figu e S6).
ATG5 exp ession in dying cells o ESR and nucella laye s
In o de o s udy he ype o he cell dea h p ocesses in
he ESR o he megagame ophy e and in he nucella
laye s, we sequenced he comple e coding sequence o
he Sco s pine ATG5 gene (KM046993) and localized
ATG5 mRNA ansc ip s in de eloping Sco s pine seeds
a he ea ly emb yogeny and in ma u e seeds a e wo
days o imbibi ion. The p edic ed Sco s pine ATG5 p o-
ein showed 95% iden i y wi h he No way sp uce ATG5
p o ein which has p e iously shown o be essen ial o
au ophagy and acuola cell dea h [44]. A he ea ly
emb yogeny, he ATG5 exp ession was localized in
bo h he ESR o he megagame ophy e and he nucella
laye s (Figu e 7A). In a ma u e seed, ATG5 exp essed
s ill in he ESR, bu also in he ma u a ing acheids
(Figu e 7B). The speci ici y o he an isense ATG5
p obewascon i medby heabsenceo signalsin
he sec ions hyb idized wi h he sense ATG5 p obe
(Addi ional ile 4: Figu e S7).
Figu e 2 CAT exp ession in de eloping and ma u e Sco s pine seeds. (A) The ela i e exp ession o CAT in de eloping seeds a he ea ly and
la e emb yogeny and in he emb yos (e) and megagame ophy es (m) o ma u e seeds. The exp ession was based on mRNA copy numbe s
gene a ed wi h he absolu e Q-RT-PCR analysis and alues p esen ed we e no malized using he exp ession a he ea ly emb yogeny. A s a deno es
signi ican (P<0.05) di e ence in he exp ession. (B) The localiza ion o CAT mRNAs by in si u hyb idiza ion wi h DIG-labelled RNA-p obes (blue signal)
in a de eloping Sco s pine seed a he ea ly emb yogeny. (C) The localiza ion o CAT mRNAs a he la e emb yogeny. (D) In ense CAT exp ession in he
de eloping emb yos and in he megagame ophy e a he ea ly emb yogeny. (E) In ense CAT exp ession in he nucella laye s a he ea ly emb yogeny.
(F) Mino CAT exp ession in he nucella laye s a he la e emb yogeny. (G) In ense CAT exp ession in he cells o he leading emb yo and mino CAT
exp ession in he megagame ophy e cells a he la e emb yogeny. cc = co osion ca i y, e = emb yo, es = emb yo su ounding egion,
m = megagame ophy e, nc = nucella cap, nl = nucella laye s, n = cellula nucellus, s = suspenso emnan s. Ba s: 100 μm.
Vuosku e al. BMC Plan Biology (2015) 15:88 Page 7 o 13
Accumula ion and elease o s a ch and s o age p o eins
du ing Sco s pine seed de elopmen
The Sco s pine seed de elopmen comp ises he accumu-
la ion o s o age compounds such as s a ch and s o age
p o eins. A he ea ly emb yogeny, he megagame ophy e
cells had only ew s o age p o eins (Figu e 8A) bu du ing
he la e emb yogenesis in ensi ely s ained p o ein bodies
we e ound in he megagame ophy e issue (Figu e 8B).
Howe e , he megagame ophy e cells in ESR in addi ion
o he cells in ASR did no pile up p o eins du ing ea ly
emb yogeny, bu ins ead con ained high quan i y o s a ch
(Figu e 8C). As he emb yo de elopmen p oceeded he
cell wall and plasma memb ane o megagame ophy e cells
in ESR we e des oyed wi h he elease o s a ch g ains
in o he co osion ca i y. In dying cells, he cell wall
weakening and b eakdown seemed o be connec ed
wi h he inc eased in ensi y o he βGgene exp ession
de ec ed wi h in si u hyb idiza ion (Addi ional ile 7:
Figu e S8, S9). In addi ion o he ESR and ASR, s a ch also
Figu e 3 The localiza ion o CAT mRNAs in a ma u e Sco s pine
seed. (A) In ense CAT exp ession (blue signal) in he emb yo and
in he megagame ophy e cells su ounding he co osion ca i y.
(B) In ense CAT exp ession in he emb yonic cells. (C) Mino CAT
exp ession in he cells in he inne pa o he megagame ophy e.
cc = co osion ca i y, e = emb yo, m = megagame ophy e. Ba s:
(B, C) 20 μm and (A) 200 μm.
Figu e 4 The localiza ion o H
2
O
2
in de eloping Sco s pine
seeds. (A) In ense blue colou om TMB indica es he p esence
o H
2
O
2
in he seed coa and ligh wing a he ea ly emb yogeny.
(B) The localiza ion o H
2
O
2
in he nucella cap, cellula nucellus,
and in he nucella laye s a he ea ly emb yogeny. (C) The localiza ion
o H
2
O
2
in he megaspo e memb anes a he ea ly emb yogeny.
(D) The mino amoun o H
2
O
2
in he seed coa and ligh wing and
he la ge amoun o H
2
O
2
indica ed by he da k blue colou in he
nucella laye s a he la e emb yogeny. (E) The seed ea ed
wi h T is-ace a e bu e wi hou TMB. cc = co osion ca i y,
e = emb yo, es = emb yo su ounding egion, w = ligh wing,
m = megagame ophy e, mm = megaspo e memb anes, nc = nucella
cap, nl = nucella laye s, n = cellula nucellus, sc = seed coa ,
s = suspenso emnan s.
Figu e 5 The localiza ion o pe oxidase ac i i y in de eloping
Sco s pine seeds. (A,B) Oxidized DAB (b own colou ) indica ed
pe oxidase ac i i y in he seed coa , nucella laye s, megagame ophy e
cells su ounding he co osion ca i y, suspenso cells and subo dina e
emb yos a he ea ly (A) and la e (B) emb yogeny. (C) The seed ea ed
wi h he eac ion bu e wi hou DAB. as = a ow-shaped egion,
e = emb yo, es = emb yo su ounding egion, m = megagame ophy e,
mm = megaspo e memb anes, nc = nucella cap, nl = nucella laye s,
n = cellula nucellus, sc = seed coa , se = subo dina e emb yo,
s = suspenso emnan s.
Vuosku e al. BMC Plan Biology (2015) 15:88 Page 8 o 13
accumula ed in o he cells o bo h he de eloping emb yo
and megagame ophy e (Figu e 8D).
Discussion
As an o hodox seed, a de eloping Sco s pine seed
expe iences h ee cha ac e is ic ea u es, emb yo de-
elopmen , accumula ion o ese e compounds and
ma u a ion/d ying, which lead om a zygo ic emb yo
o a ma u e, quiescen seed [60]. Bo h me abolic ac i i y
and mois u e con en luc ua e d as ically du ing seed
de elopmen [61-64]. Thus, he sou ces o ROS p oduc ion,
connec ed o basic cellula and speci ic seed de elopmen al
p ocesses, in cells also a y [65]. Du ing he seed de elop-
men , he cell cycle is igh ly con olled o p ope g ow h
and de elopmen [66] bu also o cellula le el oxida i e
s ess esponses [67]. He e, we show he issue and de el-
opmen al s age speci ic exp ession o he ATG5,CAT,and
RBR genes as well as he connec ion be ween he gene
exp essions and cell dea h p og ams du ing he Sco s pine
seed de elopmen .
The de elopmen o a iable Sco s pine seed includes
he s ic ly coo dina ed ac ion o se e al cell dea h p o-
g ams ( e iewed by Vuosku e al. [68]). The au ophagic
PCD o subo dina e emb yos as well as hei suspenso
Figu e 6 RBR exp ession in de eloping Sco s pine seeds. (A) The ela i e exp ession o RBR in de eloping seeds a he ea ly and la e
emb yogeny and in he emb yos (e) and megagame ophy es (m) o ma u e seeds. The exp ession was based on mRNA copy numbe s gene a ed
wi h he absolu e Q-RT-PCR analysis and alues p esen ed we e no malized using he exp ession a he ea ly emb yogeny. (B) The localiza ion o
RBR mRNAs (blue signal) in a de eloping Sco s pine seed a he ea ly emb yogeny. (C) The localiza ion o RBR mRNAs a he la e emb yogeny.
(D) Mino RBR exp ession in he ESR o he megagame ophy e a he ea ly emb yogeny. (E) Weak RBR exp ession in he cells o he nucella laye s
a he ea ly emb yogeny. (F) In ense RBR exp ession in he cells o he nucella laye s a he la e emb yogeny. as = a ow-shaped egion, cc = co osion
ca i y, e = emb yo, es = emb yo su ounding egion, m = megagame ophy e, nc = nucella cap, nl = nucella laye s, n = cellula nucellus, s = suspenso
emnan s. Ba s: (D) 20 μm, (F) 50 μm, and (B,C,E)100 μm.
Vuosku e al. BMC Plan Biology (2015) 15:88 Page 9 o 13