Expression of catalase and retinoblastoma-related protein genes associates with cell death processes in Scots pine zygotic embryogenesis

RESEARCH ARTICLE Open Access Exp ession o ca alase and e inoblas oma- ela ed p o ein genes associa es wi h cell dea h p ocesses in Sco s pine zygo ic emb yogenesis Jaana Vuosku 1,3* , Su i Su ela 1 , Johanna Kes ilä 1 , Anne Jokela 1 , Ty i Sa jala 2 and Hely Häggman 1 Abs ac Backg ound: The cell cycle and cellula oxida i e s ess esponses a e igh ly con olled o p ope g ow h and de elopmen o Sco s pine (Pinus syl es is L.) seed. P og ammed cell dea h (PCD) is an in eg al pa o he emb yogenesis du ing which megagame ophy e cells in he emb yo su ounding egion (ESR) and cells in he nucella laye s ace dea h. In he p esen s udy, we show bo h he issue and de elopmen al s age speci ic exp ession o he genes encoding he au ophagy ela ed ATG5, ca alase (CAT), and e inoblas oma ela ed p o ein (RBR) as well as he connec ion be ween he gene exp essions and cell dea h p og ams. Resul s: We ound s ong CAT exp ession in he cells o he de eloping emb yo h oughou he emb yogenesis as well as in he cells o he megagame ophy e and he nucella laye s a he ea ly emb yogeny. The CAT exp ession was ound o o e lap wi h bo h he ATG5 exp ession and hyd ogen pe oxide localiza ion. A he la e emb yogeny, CAT exp ession diminished in he dying cells o he nucella laye s as well as in megagame ophy e cells, showing he i s signs o incipien cell dea h. Accumula ion o s a ch and mino RBR exp ession we e cha ac e is ic o megagame ophy e cells in he ESR, whe eas s ong RBR exp ession was ound in he cells o he nucella laye s a he la e emb yogeny. Conclusions: Ou esul s sugges ha ATG5, CAT, and RBR a e in ol ed in he Sco s pine emb yogenesis and cell dea h p ocesses. CAT seems o p o ec cells agains hyd ogen pe oxide accumula ion and oxida i e s ess ela ed cell dea h especially du ing ac i e me abolism. The opposi e exp ession o RBR in he ESR and nucella laye s alongside mo phological cha ac e is ics emphasizes he di e en ype o he cell dea h p ocesses in hese issues. Fu he mo e, he changes in ATG5 and RBR exp essions speci ically in he megagame ophy e cells dying by nec o ic cell dea h sugges he gene ic egula ion o de elopmen al nec osis in Sco s pine emb yogenesis. Keywo ds: Au ophagy, Ca alase, Coni e , De elopmen al cell dea h, Emb yogenesis, Megagame ophy e, Pinus, Re inoblas oma- ela ed p o ein, Sco s pine, Seed de elopmen Backg ound In mul icellula o ganisms such as plan s, he o ganized des uc ion o cells by p og ammed cell dea h (PCD) is essen ial o body plans and speci ic o gan shapes as well as o emo ing damaged o in ec ed cells [1-4]. In plan s, di e en cell dea h ypes a e o en de ined by mo phological cha ac e is ics because p ecise molecula mechanisms behind he egula ion and execu ion o cell dea h p ocesses a e s ill poo ly known [5,6]. Two classes o cell dea h, acuola cell dea h and nec osis, ha e been sugges ed o plan s bu he e ms a e no unambiguous [6,7]. Examples o acuola cell dea h a e ound du ing emb yo, o gan and issue mo phogenesis and senescence, whe eas nec osis is mos usually induced by a a ie y o abio ic s esses and by success ul ecogni ion o a pa hogen du ing he hype sensi i e esponse [6,8]. Howe e , nec osis is no longe conside ed o be an uncon olled p ocess, bu nec o ic cell dea h can also be a egula ed e en ha con ibu es o he de elopmen and o he main enance o issue and o ganismal in eg i y [9-11]. In plan s, he oles * Co espondence: [email p o ec ed] 1 Gene ics and Physiology Uni , Uni e si y o Oulu, P.O. Box 3000, FI-90014 Oulu, Finland 3 Cu en add ess: Na u al Resou ces Ins i u e Finland (Luke), Ro aniemi Uni , FI-96301 Ro aniemi, Finland Full lis o au ho in o ma ion is a ailable a he end o he a icle © 2015 Vuosku e al.; licensee BioMed Cen al. This is an Open Access a icle dis ibu ed unde he e ms o he C ea i e Commons A ibu ion License (h p://c ea i ecommons.o g/licenses/by/4.0), which pe mi s un es ic ed use, dis ibu ion, and ep oduc ion in any medium, p o ided he o iginal wo k is p ope ly c edi ed. The C ea i e Commons Public Domain Dedica ion wai e (h p://c ea i ecommons.o g/publicdomain/ze o/1.0/) applies o he da a made a ailable in his a icle, unless o he wise s a ed. Vuosku e al. BMC Plan Biology (2015) 15:88 DOI 10.1186/s12870-015-0462-0 o nucleases and p o eases in PCD a e e iden [12,13] bu he cell dea h p ocesses also in ol e many o he molecula mechanisms such as ca alase [14] and he e inoblas oma ela ed p o eins [15] which a e equi ed o main ain cellula homeos asis and hus may be di icul o iden i y as ac ual cell dea h e ec o s. The eac i e oxygen species (ROS) con ibu e o he induc ion, signalling and execu ion o plan cell dea h [16-18]. Hyd ogen pe oxide (H 2 O 2 ), he mos s able ROS [19], has ecei ed pa icula a en ion as a signal molecule in ol ed in he egula ion o essen ial biological unc ions such as cell dea h, pa hogen esponses, and gene exp ession [16,20-23]. H 2 O 2 is a oxic byp oduc o cell me abolism and H 2 O 2 gene a ion om a a ie y o cellula p ocesses inc eases in esponse o nume ous de elopmen- al signals and bio ic and abio ic s imulan s [24]. While plan s con ain se e al ypes o H 2 O 2 -me abolizing p o- eins, ca alases (CAT, hyd ogen pe oxide oxido educ ase, EC 1.11.1.6) a e highly ac i e pe oxisomal enzymes which exp ess high speci ici y owa ds H 2 O 2 and p o ec cells om he oxic e ec s by he con e sion o H 2 O 2 in o wa e and molecula oxygen [25]. I has been sugges ed ha impac o H 2 O 2 is s ongly in luenced by he ex en o accumula ion o H 2 O 2 allowed by an ioxidan enzymes such as CAT. This has been shown in Chlamydomonas einha d ii whe e a e e sible pa ial inac i a ion o CAT co ela es wi h a ansien inc ease in he le el o H 2 O 2 . The concen a ion ange seems o be necessa y o ac i a e H 2 O 2 -dependen signaling pa hways s imula ing he exp ession o H 2 O 2 esponsi e genes [26]. Fu he mo e, he di ec in e ac ion o CAT wi h ROS could allow CAT o ac as a molecula link be ween ROS and he p omo ion o au ophagy-dependen cell dea h [14]. In plan s, he e inoblas oma ela ed p o eins (RBR) egula e he p og ession o cell cycle and ansc ip ion ia ch oma in-modi ie s and, u he mo e, unc ion in p omo ion o cell di e en ia ion [27]. Recen ly, RBR1 was ound o con ol also cell dea h in maize (Zea mays L.) endospe m cells [15]. The plan RBR p o eins a e homologs o e inoblas oma suscep ibili y gene p oduc s (pRB) i s ly disco e ed in human cells [28]. The pRB p o eins a e ac i a ed by phospho yla ion and hei A/B pocke domain enables hem o in e ac wi h mo e han 100 p o eins [29]. The in e ac ion o hypophospho yla ed RBR wi h E2F and DP ansc ip ion ac o s p e en s cell di ision by supp essing he ansi ion om G1 o S phase in he cell cycle [27]. In plan s, RBR genes a e conse ed and hey ha e been ound om g een algae, b yophy es, lycophy es and om bo h monoco and dico angiospe m species [27,30]. In ou p e ious s udy, we showed ha he RBR/E2F pa hway ope a es also in coni e s by p esen ing he exp ession o RBR and E2F genes in in i o cul u ed Sco s pine (Pinus syl es is L.) emb yogenic cells [31]. PCD is an in eg al pa o he seed de elopmen in angiospe m and gymnospe m species (e.g. [32-35]). In gymnospe ms, he Sco s pine seed ep esen s a well- documen ed emb yogenesis wi h coo dina ed ac ion o se e al dis inc cell dea h p og ams. The e iliza ion o se e al eggs [36] and u he mo e he clea age o polyzygo ic emb yos [37] leads o he p esence o se e al emb yos in a young seed. Howe e , only he dominan emb yo su i es, whe eas he subo dina e emb yos die ia PCD du ing he seed de elopmen [34]. Emb yos g ow and de elop inside he co osion ca i y o he megagame ophy e issue which unc ions as a nu ien sou ce o emb yos i.e. being cong uen wi h he endospe m o angiospe ms [38]. Th oughou he emb yo de elopmen , he megagame ophy e cells in he emb yo su ounding egion (ESR) a e des oyed by mo phologically nec o ic cell dea h [35]. Addi ionally, he cells in he megagame ophy e su ounding nucella laye s die du ing he seed de elopmen [35,39] p o iding nu i ion o he su ounding issues and la e unc ioning as a ba ie agains wa e and ungi [40,41]. The impo ance o caspase-like VEIDase ac i i y, ype II me acaspases, and Tad-D nuclease ha e been pe cei ed in cell dea h du ing Sco s pine and No way sp uce (Picea abies (L.) Ka s .) emb yogenesis [35,42,43]. In coni e s, he au ophagy ela ed (ATG) p o eins a e essen ial o acuola cell dea h and o ins ance, in No way sp uce, deple ion o ATG5 and ATG6 causes abe a ions in he de elopmen o suspenso s [44]. He e, we s udy he p og ess o wo dis inc ypes o cell dea h p og ams and e eal he link be ween PCD and he exp ession o CAT and RBR genes which a e ypically conside ed as main aine s o cellula homeos asis. We ocus on he cell dea h p ocesses in he ESR and nucel- la laye s du ing he Sco s pine seed de elopmen , and show ha ATG5 p e iously connec ed o he egula ion o acuola cell dea h also exp esses in he cells des oyed ia nec o ic-like cell dea h. Me hods Imma u e and ma u e Sco s pine seeds One-yea -old imma u e seed cones we e collec ed du ing he g owing pe iod in July om an open-pollina ed eli e Sco s pine (Pinus syl es is L.) clone, K818, g owing in he Sco s pine clone collec ion in Punkaha ju, Finland (61°48′N; 29°17′E). Imma u e Sco s pine seeds we e dissec ed om he de eloping cones. Fo he ana omical obse a ions, o he de ec ion o PCD and o he localiza ion o p o eins, s a ch, and mRNA ansc ip s o ATG5,CAT,RBR and β-glucosidase (βG, EC 3.2.1.21), he seed coa s we e emo ed and imma u e seeds we e ixed immedia ely and embedded in pa a in as desc ibed below. Fo he gene exp ession s udies, imma u e seeds we e s o ed in liquid ni ogen un il use. Vuosku e al. BMC Plan Biology (2015) 15:88 Page 2 o 13 Ma u e Sco s pine cones we e collec ed om he same g a s as he imma u e cones in la e all o he same g owing season. Ma u e Sco s pine seeds we e su ace s e ilized wi h 3% Plan P ese a i e Mix u e (Plan Cell Technology) o e nigh and placed he ea e on mois il e pape and le o imbibe a oom empe a u e (RT) o wo days. The ea e , seeds we e opened wi h a scalpel, seed coa s we e emo ed, and he emb yos and megagame ophy es we e sepa a ed om each o he o he gene exp ession analysis. Fo he localiza ion o ATG5 and CAT mRNA ansc ip s ma u e seeds we e ixed as desc ibed below. Ana omical and his ochemical obse a ions De eloping and imbibed ma u e Sco s pine seeds wi h and wi hou seed coa s we e dissec ed o he his ochemical localiza ion o H 2 O 2 and pe oxidase. The 3,5,3′5′- e ame hylbenzidine (TMB) is oxidised by pe oxidases in a eac ion whe e H 2 O 2 ac sasa hyd ogen accep o , and hus, TMB can be used o localize H 2 O 2 and pe oxidases [45]. Fo he H 2 O 2 localiza ion he seeds we e incuba ed in 50 mM T is- ace a e-bu e (pH 5.0), which con ained 0.1 mg/ml 3,5,3′,5′-TMB-HCl[45],a RTa leas o 45min.In addi ion, seeds we e ea ed wi h 3% H 2 O 2 in 1x phospha e-bu e ed saline (PBS) bu e (10 mM phospha e, 150 mM NaCl, pH 7.4) o 10 min p io o he his o- chemical s aining o he pe oxidase loca ion. Nega i e con ols we e incuba ed in 50 mM T is-ace a e-bu e . The DAB (3,3′-diaminobenzidine) Pe oxidase Subs a e ki (Vec o Labo a o ies) was used in localizing pe oxidase ac i i y ollowing manu ac u e ’sins uc ions.The dissec ed seeds we e incuba ed o wo o h ee min a RT in eac ion mix u e. The DAB Pe oxidase Sub- s a e eac ion mix u e con ains H 2 O 2 which oxidizes DAB, and subsequen ly gene a es a da k b own eac ion p oduc when pe oxidases a e p esen . Nega i e con ols we e incuba ed in eac ion mix u e wi hou DAB. The blocking o pe oxidase ac i i y was a emp ed by incu- ba ing seed ma e ial in 1% H 2 O 2 a RT o 10 min. The sec ions we e examined by a s e eo mic oscope (S emi DV4, Ca l Zeiss) and imaged wi h a digi al came a (Nikon Coolpix 950, Japan). De eloping and ma u e Sco s pine seeds we e ixed o s udying he ana omical ea u es o he emb yos and o in si u mRNA hyb idiza ion analyses using he ollowing p o ocol om ixa ion o co e slip moun ing. Tissues we e ixed in 4% (w/ ) p- o maldehyde in 1x PBS. A e dehyd a ion wi h a g aded se ies o e hanol, e hanol was eplaced by e ia y bu anol and hen g adually by pa a in. Sec ions (5 and 7 μm) we e cu om he embedded samples wi h a mic o ome, moun ed on Supe F os ®Plus slides (Menzel-Glase ) and ixed by d ying o e nigh a 40°C. The pa a in sec ions we e dewaxed in His ochoice (Sigma) and ehyd a ed h ough a g aded se ies o e hanol. To s udy he de elopmen al s age o he emb yos, he p epa a es we e s ained wi h oluidine blue (0.05% oluidine blue in H 2 O). Acco ding o Singh [46] Sco s pine emb yogenesis is di ided in o h ee di e en phases, p oembyogeny, ea ly emb yogeny and la e emb yogeny. He e, we s udied he ea ly emb yogeny which ini ia es wi h he elonga ion o he suspenso sys em and e mina es wi h he appea ance o he oo me is em (Figu e 1A) and he la e emb yogeny which con ains he es ablishmen o oo and shoo me is ems and he ma u a ion o he leading emb yo (Figu e 1B). Fo he p o ein and s a ch isualiza ion he sec ions we e s ained wi h 0.2% amido black [47] and wi h 0.5% po assium iodide-iodine (IKI) [48], espec i ely. All sec ions we e s udied wi h a ligh mic oscope (Nikon Eclipse E600) and pho og aphed wi h a Qimaging Mic opublishe 5.0 RTV digi al came a. Adobe Pho oshop CS was used o adjus con as , b igh ness and colou uni o mly o en i e images. TUNEL assay Nuclea DNA agmen a ion, i.e. DNA s and b eaks lea ing ee 3′-OH e mini, was shown by he TUNEL ( e minal deoxy ibonucleo idyl ans e ase (TdT)-media ed deoxyu idine iphospha e (dUTP) nick end labelling) assay. The dewaxed and ehyd a ed sec ions we e diges ed wi h 10 μg/ml p o einase-K (Roche) o 30 min and wo washings wi h PBS. The sec ions we e labelled wi h TMR ed ( ed luo escence) using in si u cell dea h de ec ion ki (Roche) acco ding o he manu ac u e ’s p o ocol. P io o he labelling p ocedu e, he posi i e con ol sec ions we e incuba ed wi h DNase I ecombinan (Roche) o induce DNA s and b eaks. The label solu ion wi hou e minal ans e ase, ins ead o he TUNEL eac ion mix u e, was used as a nega i e con ol. The labelled sec ions we e examined wi h a con ocal lase scanning mic oscope (LSM 5 Pascal, Ca l Zeiss) wi h an HBO 100 me cu y lamp and using he HeNe lase 543 nm line, dich oic beam spli e (HFT 488/543/633; Ca l Zeiss) and LP 560 emission il e (Ca l Zeiss). RNA ex ac ion, e e se ansc ip ion and cDNA cloning To al RNA was ex ac ed using he au oma ed magne ic- based KingFishe ™mL me hod (The mo Elec on Co po a ion) wi h he MagEx ac o ® o al RNA pu i- ica ion ki (Toyobo) acco ding o he manu ac u e ’s ins uc ions. The RNA samples we e ea ed wi h RNase- ee DNase (In i ogen) a RT o 15 min o he elimina ion o con amina ing genomic DNA. The ea e he RNA samples we e pu i ied wi h he NucleoSpin® RNA Clean-Up ki (Mache ey-Nagel). The RNA yields we e measu ed h ee imes wi h OD 260 Vuosku e al. BMC Plan Biology (2015) 15:88 Page 3 o 13 analysis using NanoD op ND1000 spec opho ome e (NanoD op Technologies), and 1 μgo eachRNAsample was subsequen ly used o he cDNA syn hesis. cDNA was e e se- ansc ibed om an ancho ed oligo-dT p ime by Supe Sc ip II e e se ansc ip ase (In i ogen) using s anda d me hods in a eac ion olume o 20 μl. F agmen s o hepu a i eSco spineATG5 and cell wall associa ed βGwe e ampli ied by s anda d PCR using cDNA om imma u e seeds as a empla e, gene speci ic p ime s (Addi ional ile 1: Table S1) and DyNAzyme™EXT polyme ase (Finnzymes). The agmen s wi h app op ia e leng h we e gel-pu i ied by Mon age DNA Gel Ex ac ion Ki (Millipo e Co po a ion), cloned by TOPO TA Cloning Ki (In i ogen) and sequenced by an Applied Biosys ems 3730 DNA analyze . In si u mRNA hyb idiza ion analysis The RNA p obes o he in si u mRNA hyb idiza ion ana- lyses o ATG5,CAT,RBR and βG ansc ip s in de eloping and ma u e seeds we e p epa ed using a PCR-based ech- nique [49]. The T7 RNA polyme ase p omo e sequence (TAATACGACTCACTATAGGG) was in oduced a he 5′ends o he gene-speci ic p ime s (Addi ional ile 1: Table S2). The downs eam p ime s con ained an a i i- cially in oduced T7 p omo e a i s 5′end, which enabled he syn hesis o an isense ansc ip s. The ups eam p ime s con aining T7 p omo e s a he 5′ends was used o he syn hesis o sense ansc ip s, i.e. as nega i e con ol. The PCR agmen ep esen ing he coding egion o ei he ATG5,CAT,RBR o βGwas p oduced unde s anda d PCR condi ions by DyNAzyme™EXT polyme ase (Finnzymes) using plasmid DNA con aining he cDNA in ques ion as a empla e. The PCR agmen was gel-pu i ied (DNA Gel Ex ac ion Ki , Millipo e Co po a ion) and 250 ng was subsequen ly used as a empla e DNA o in i o ansc ip ion by T7 RNA polyme ase (In i ogen), inco po a ing dig-UTP ia DIG RNA labelling Mix (Roche Figu e 1 Ea ly and la e de elopmen al s ages o Sco s pine emb yogenesis. (A) The dominan emb yo and subo dina e emb yos in he co osion ca i y a he ea ly emb yogeny su ounded by he emb yo su ounding egion (es ) o he megagame ophy e highligh ed wi h ed colo . The a ow-shaped egion (as ) o he megagame ophy e ou side he es highligh ed wi h blue colo . (B) The dominan emb yo in he co osion ca i y a he la e emb yogeny. The es o he megagame ophy e highligh ed wi h ed colo and as highligh ed wi h blue colo . as = a ow-shaped egion, cc = co osion ca i y, e = emb yo, es = emb yo su ounding egion, m = megagame ophy e, mm = megaspo e memb anes, nc = nucella cap, nl = nucella laye s, n = cellula nucellus, s = suspenso emnan s. Ba s: 100 μm. Vuosku e al. BMC Plan Biology (2015) 15:88 Page 4 o 13 Molecula Biochemicals). Templa e DNA was diges ed wi h ou uni s o RNase- ee DNase (In i ogen) in a eac ion olume o 20 μl a 37°C o 10 min, he p obe was p ecipi a ed and he yield o he DIG-labeled RNA p obe was es ima ed by compa ing he in ensi y o he sample o he de ined con ols made wi h DIG-labelled con ol RNA (Roche Molecula Biochemicals). The sec ions we e dewaxed, ea ed wi h P o einase K (Finnzymes, 1 μg/ml in 100 mM T is/HCl, 50 mM Na 2 EDTA, pH 7.5) a 37°C o 30 min and dehyd a ed in a g aded se ies o e hanol up o absolu e. The slides we e d ied in a acuum o 1 h. Fo he hyb idiza ion, 250 μl o hyb idiza ion mix u e was added o he sec ions, moun ed unde co e slips and incuba ed in a wa e a mosphe e a 55°C o e nigh . The hyb idiza ion mix u e con ained 0.8 μg/ml o DIG-labelled RNA an isense o sense p obe, 50% ( / ) deionized o mamide, 300 mM NaCl, 10 mM T is/HCl (pH 7.0), 10 mM Na 3 PO 4 (pH 7.0), 50 mM EDTA, 10% (w/ ) dex an sul a e, 200 μg/ml RNA, 1x Denha d ’s solu ion and 10 uni s/ml RNase Ou TM inhibi o (In i ogen). A e he hyb idiza ion, he slides we e washed in 2x NaCl/Ci (300 mM NaCl, 30 mM sodium ci a e, pH 7.0) a RT o 10 min ollowed by 1x and 0.5x NaCl/Ci ea - men by slow shaking a 37°C o 10 min. The washing was ollowed by ea men o he RNase A (Roche, 1 μg/ml in 10 mM T is/HCl, 500 mM NaCl, 1 mM Na 2 EDTA, pH 7.5) a 37°C o 60 min. Then he slides we e washed ou imes in he same solu ion bu wi hou RNase A in a slow shaking a 37°C o 15 min and once in 2x NaCl/Ci a RT o 30 min. Fo he de ec ion o hyb idized p obe, he slides we e washed in T is/NaCl bu e (100 mM T is/HCl, 150 mM NaCl, pH 7.5) o 5 min and blocked wi h 3% (w/ ) blocking eagen (Dig Nucleic acid de ec ion Ki , Roche) and 0.3% ( / ) T i on X-100 in T is/NaCl bu e in a wa e a mosphe e a RT o 30 min. 1 uni /ml o An i-DIG-AP Fab agmen s (Roche) in T is/NaCl bu e was added o he sec ions, moun ed unde pa a ilm and incuba ed in a wa e a mosphe e a RT o 2 h. The slides we e washed a RT ou imes in T is/NaCl bu e o 10 min and in AP bu e (100 mM T is/HCl, 100 mM NaCl, 50 mM MgCl 2 , pH 9.5) o 5 min. Fo colou de elopmen , 2% ( / ) NBT/BCIP subs a e (Dig Nucleic acid de ec ion Ki , Roche) and 1% ( / ) T i on X-100 in AP bu e was dispe sed on he sec ions, moun ed wi h co e slips and incuba ed in a wa e a mosphe e a RT in he da k o e nigh . The slides we e washed wi h wa e , dehyd a ed in a g aded se ies o e hanol, ai -d ied and hen moun ed wi h imme sion oil and co e ed wi h co e slips. The sec ions we e examined wi h a ligh mic oscope (Nikon Op ipho 2, Japan) and imaged wi h an In ini y1–3C came a (Lumene a Co po a iom, O awa, On a io, Canada), using he IMT iSolu ion Li e image-p ocessing p og am (IMT i-Solu ion Inc., Vancou e , BC, Canada). The au o and manual iling ea u e o image-p ocessing p og am was used o combine sepa a e images o one. Non-speci ic signal was obse ed in he emnan s o he degene a ed suspenso s, ESR, and inne nucella laye s gene a ed by agmen ed nucleic acids as p e iously desc ibed in Vuosku e al.[50].Adobe Pho oshop CS5 was used o adjus con as , b igh ness and colou uni o mly o en i e images. Quan i ica ion o gene exp ession The eal- ime e e se- ansc ip ion PCR analysis (Q-RT- PCR) was used o he quan i ica ion o he CAT,RBR and βGexp ession in imma u e seeds a he de elopmen al s ages o ea ly and la e emb yogeny as well as in he emb yos and megagame ophy es o ma u e seeds. Being awa e o he challenges in inding sui able endogenous e e ence genes o pine emb yogenesis [51], bo h absolu e and ela i e Q-RT-PCR analyses we e used. Fo he de e mina ion o mRNA copy numbe s in he absolu e quan i ica ion, he s anda d cu es we e gene a ed using se ial 10- old dilu ions o syn hesized RNA molecules o con ol a iabili y du ing bo h RT and PCR s eps o Q-RT-PCR uns. The DNA empla es om which he RNA molecules could be ansc ibed we e ampli ied bybasicPCRp ocedu eusinggene-speci icp ime s (Addi ional ile 1: Table S3). The ups eam p ime s con- ained T7 p omo e sequence (TAATACGACTCACTA TAGGG) and he downs eam p ime s con ained poly(T) ail a hei 5′end. The DNA molecules we e subsequen ly used as empla es o in i o ansc ip ion by T7 RNA poly- me ase. The numbe s o s anda d RNA molecules added o he e e se- ansc ip ion eac ions we e calcula ed using he molecula weigh s o he oligonucleo ides and A ogad o’s cons an (6.022 · 10 23 mol −1 ). In he ela i e quan i ica ion, ubiquinone (UBI) and glyce aldehyde-3-phospha e dehyd o- genase (GAPDH) we e used as endogenous e e ence genes (see Addi ional ile 2 o de ails). In he absolu e Q-RT-PCR analysis (see Addi ional ile 2 o de ails o he ela i e quan i ica ion), he numbe o biological eplica es was 5, 5, 6, and 4 o ea ly s age imma u e seeds, la e s age imma u e seeds, emb yos, and megagame ophy es, espec i ely. The PCR ampli ica ion condi ions o he gene agmen we e op imized o he Ligh Cycle ® 2.0 ins umen (Roche Diagnos ics), and he subsequen PCR uns showed a single PCR p oduc du ing mel ing cu e (The Tm Calling Analysis o Ligh cycle ® 480 So wa e elease 1.5.0 SP3) and elec o- pho e ic analysis. The eal- ime PCR ampli ica ions we e pe o med using he Ligh Cycle ® 480 SYBR G een I Mas e (Roche), 50 nM gene speci ic p ime s (Addi ional ile 1: Table S4) and 2 μl cDNA in he eac ion olume o 20 μl. The nega i e con ols con ained 2 μlo molecula g ade wa e ins ead o cDNA empla e. The eal- ime PCR Vuosku e al. BMC Plan Biology (2015) 15:88 Page 5 o 13 ampli ica ion was ini ia ed by incuba ion a 95°C o 10 min ollowed by 45 cycles: 10 s a 95°C, 10 s a 58°C and 5 s a 72°C. E e y PCR eac ion was done as duplica e o con ol o he a iabili y o PCR ampli ica ion and he coe icien a ia ion, CV%, o echnical eplica es was < 2.5. The Abs Quan /2nd De i a i e analysis o Ligh cycle ® 480 so wa e elease 1.5.0 SP3 was u ilized o gene a e he c ossing poin and concen a ion alues o each sample. S a is ical analysis The mRNA copy numbe s gene a ed wi h he absolu e Q-RT-PCR analysis we e u ilized in calcula ing he gene exp ession. The exp ession o s udied genes was calcula ed by di iding he indi idual alues wi h he mean numbe o ansc ip s in he ea ly emb yogeny, ha is, alue o one was gi en o he gene exp ession in he ea ly emb yogeny. The signi icance o di e ence be ween he ea ly and la e emb yogeny and be ween he emb yo and megagame o- phy e o ma u e seeds was examined using wo sample es wi h he g aphical use in e ace R Commande [52] in R so wa e package (2.11.0) [53]. Log 10 ans o ma ion was conduc ed o a iables no no mally dis ibu ed. Resul s Nuclea DNA agmen a ion in ESR and nucella laye s In ou p e ious s udy, we showed ha megagame ophy e cells in he ESR a e des oyed by mo phologically nec o ic cell dea h and also he cells in he megagame ophy e su ounding nucella laye s die du ing he Sco s pine seed de elopmen [35]. Likewise, TUNEL posi i e nuclei we e de ec ed in he ESR cells and in he nucella laye s in his s udy (Addi ional ile 3: Figu e S2). T ansien dec ease o CAT exp ession in megagame ophy e a la e emb yogeny The Sco s pine CAT (EU513163) was ampli ied using zygo ic emb yo cDNA as a empla e. P e iously, h ee CAT genes ha e been ound p esen in he angiospe m species obacco (Nico iana abacum L.), A abidopsis, maize, pumpkin (Cucu bi a sp.) and ice (O yza sa i a L.) [54-58]. The angiospe m class I CATs a e s ongly exp essed in pho osyn he ic issues, whe eas class II CATs a e associa ed wi h ascula issues. Class III CATs a e exp essed especially in seeds and ep oduc i e issues [25]. Sco s pine CATshowed high sequence simila i y (75%) wi h maize CAT1 belonging o class III. Based on he Q-RT-PCR analysis, he numbe o CAT mRNA ansc ip s dec eased signi ican ly in de eloping Sco s pine seeds when he emb yogenesis p oceeded om he ea ly o he la e s age (P<0.001). In ma u e seeds, he numbe o CAT ansc ip s was signi ican ly g ea e in megagame ophy es han in emb yos (P=0.02) (Figu e 2A). A he ea ly emb yogeny, in ense CAT exp ession was localized in he cells o bo h he dominan emb yo and subo dina e emb yos (Figu e 2B and D) as well as in he cells o he megagame ophy e and he nucella laye s (Figu e 2B and E). A he la e emb yogeny, he CAT exp ession was s ill s ong in he cells o he dominan em- b yo (Figu e 2C and G), whe eas i was clea ly diminished in he cells o he nucella laye s (Figu e 2C and F) and in he megagame ophy e (Figu e 2C and G). In ma u e seeds he megagame ophy e cells su ounding he co osion ca i y showed in ense CAT exp ession whe eas in he emb yo, he exp ession was compa able o he la e emb yogeny (Figu e 3). The speci ici y o he an isense CAT p obe was con i med by he absence o signals in he sec ions hyb idized wi h he sense CAT p obe (Addi ional ile 4: Figu e S3). Pe oxidase and H 2 O 2 localiza ion A he ea ly emb yogeny, in ense blue colou indica ing H 2 O 2 p esence was obse ed in he seed coa , ligh wing (Figu e 4A), and cellula nucellus (Figu e 4B). In addi ion, H 2 O 2 was de ec ed in he nucella laye s (Figu e 4B), and megaspo e memb anes (Figu e 4C). A hela eemb yogeny,H 2 O 2 was s ill p esen in he seed coa and ligh wing, bu he ex en was clea ly diminished (Figu e 4D). The seeds ea ed wi h T is-ace a e bu e we e used as nega i e con ol (Figu e 4E). Pe oxidase ac i i y was de ec ed h oughou he emb yogenesis in he e y same seed s uc u es as H 2 O 2 and, addi ionally, in he ESR cells and in he a ow-shaped egion (ASR) o megagame ophy e, suspenso cells, and subo dina e emb yos (Figu e 5A and B, Addi ional ile 5: Figu e S4). Fo nega i e con ol DAB was excluded om he eac ion bu e (Figu e 5C). The pe oxidase localiza ion wi h DAB and TMB p o ocol supplemen ed wi h H 2 O 2 also ga e compa able esul s (Addi ional ile 5: Figu e S4). Minu e RBR exp ession in dying megagame ophy e cells in ESR The p edic ed Sco s pine RBR p o ein showed 57% iden i y wi h A abidopsis RBR 1 p o ein. In A abidopsis, only one RBR gene has been ound, and he p esence o wo dis inc RBR genes ha e been sugges ed o a unique ea u e o g asses [59]. In de eloping Sco s pine seeds, he e was o e all low a ia ion in he numbe o RBR mRNA ansc ip s ac oss he s udied Sco s pine seed ma e ial. The RBR ansc ip le els we e compa able be ween ea ly and la e emb yogenesis as well as be ween he emb yos and megagame ophy es o ma u e seeds when he exp ession was quan i ied wi h Q-RT-PCR (Figu e 6A). The RBR exp ession was localized in bo h emb yonic and megagame ophy e cells h oughou he emb yogenesis excluding he dying megagame ophy e cells in he ESR and he ASR cells (Figu e 6B, C and D, Addi ional ile 6: Figu e S5). The RBR exp ession signal Vuosku e al. BMC Plan Biology (2015) 15:88 Page 6 o 13 was ound weak in nucella cells a ea ly emb yogeny, bu showed mo e in ensi y a la e s ages o emb yogenesis (Figu e 6E and F). The speci ici y o he an isense RBR p obe was con i med by he absence o signals in he sec ions hyb idized wi h he sense RBR p obe (Addi ional ile 4: Figu e S6). ATG5 exp ession in dying cells o ESR and nucella laye s In o de o s udy he ype o he cell dea h p ocesses in he ESR o he megagame ophy e and in he nucella laye s, we sequenced he comple e coding sequence o he Sco s pine ATG5 gene (KM046993) and localized ATG5 mRNA ansc ip s in de eloping Sco s pine seeds a he ea ly emb yogeny and in ma u e seeds a e wo days o imbibi ion. The p edic ed Sco s pine ATG5 p o- ein showed 95% iden i y wi h he No way sp uce ATG5 p o ein which has p e iously shown o be essen ial o au ophagy and acuola cell dea h [44]. A he ea ly emb yogeny, he ATG5 exp ession was localized in bo h he ESR o he megagame ophy e and he nucella laye s (Figu e 7A). In a ma u e seed, ATG5 exp essed s ill in he ESR, bu also in he ma u a ing acheids (Figu e 7B). The speci ici y o he an isense ATG5 p obewascon i medby heabsenceo signalsin he sec ions hyb idized wi h he sense ATG5 p obe (Addi ional ile 4: Figu e S7). Figu e 2 CAT exp ession in de eloping and ma u e Sco s pine seeds. (A) The ela i e exp ession o CAT in de eloping seeds a he ea ly and la e emb yogeny and in he emb yos (e) and megagame ophy es (m) o ma u e seeds. The exp ession was based on mRNA copy numbe s gene a ed wi h he absolu e Q-RT-PCR analysis and alues p esen ed we e no malized using he exp ession a he ea ly emb yogeny. A s a deno es signi ican (P<0.05) di e ence in he exp ession. (B) The localiza ion o CAT mRNAs by in si u hyb idiza ion wi h DIG-labelled RNA-p obes (blue signal) in a de eloping Sco s pine seed a he ea ly emb yogeny. (C) The localiza ion o CAT mRNAs a he la e emb yogeny. (D) In ense CAT exp ession in he de eloping emb yos and in he megagame ophy e a he ea ly emb yogeny. (E) In ense CAT exp ession in he nucella laye s a he ea ly emb yogeny. (F) Mino CAT exp ession in he nucella laye s a he la e emb yogeny. (G) In ense CAT exp ession in he cells o he leading emb yo and mino CAT exp ession in he megagame ophy e cells a he la e emb yogeny. cc = co osion ca i y, e = emb yo, es = emb yo su ounding egion, m = megagame ophy e, nc = nucella cap, nl = nucella laye s, n = cellula nucellus, s = suspenso emnan s. Ba s: 100 μm. Vuosku e al. BMC Plan Biology (2015) 15:88 Page 7 o 13 Accumula ion and elease o s a ch and s o age p o eins du ing Sco s pine seed de elopmen The Sco s pine seed de elopmen comp ises he accumu- la ion o s o age compounds such as s a ch and s o age p o eins. A he ea ly emb yogeny, he megagame ophy e cells had only ew s o age p o eins (Figu e 8A) bu du ing he la e emb yogenesis in ensi ely s ained p o ein bodies we e ound in he megagame ophy e issue (Figu e 8B). Howe e , he megagame ophy e cells in ESR in addi ion o he cells in ASR did no pile up p o eins du ing ea ly emb yogeny, bu ins ead con ained high quan i y o s a ch (Figu e 8C). As he emb yo de elopmen p oceeded he cell wall and plasma memb ane o megagame ophy e cells in ESR we e des oyed wi h he elease o s a ch g ains in o he co osion ca i y. In dying cells, he cell wall weakening and b eakdown seemed o be connec ed wi h he inc eased in ensi y o he βGgene exp ession de ec ed wi h in si u hyb idiza ion (Addi ional ile 7: Figu e S8, S9). In addi ion o he ESR and ASR, s a ch also Figu e 3 The localiza ion o CAT mRNAs in a ma u e Sco s pine seed. (A) In ense CAT exp ession (blue signal) in he emb yo and in he megagame ophy e cells su ounding he co osion ca i y. (B) In ense CAT exp ession in he emb yonic cells. (C) Mino CAT exp ession in he cells in he inne pa o he megagame ophy e. cc = co osion ca i y, e = emb yo, m = megagame ophy e. Ba s: (B, C) 20 μm and (A) 200 μm. Figu e 4 The localiza ion o H 2 O 2 in de eloping Sco s pine seeds. (A) In ense blue colou om TMB indica es he p esence o H 2 O 2 in he seed coa and ligh wing a he ea ly emb yogeny. (B) The localiza ion o H 2 O 2 in he nucella cap, cellula nucellus, and in he nucella laye s a he ea ly emb yogeny. (C) The localiza ion o H 2 O 2 in he megaspo e memb anes a he ea ly emb yogeny. (D) The mino amoun o H 2 O 2 in he seed coa and ligh wing and he la ge amoun o H 2 O 2 indica ed by he da k blue colou in he nucella laye s a he la e emb yogeny. (E) The seed ea ed wi h T is-ace a e bu e wi hou TMB. cc = co osion ca i y, e = emb yo, es = emb yo su ounding egion, w = ligh wing, m = megagame ophy e, mm = megaspo e memb anes, nc = nucella cap, nl = nucella laye s, n = cellula nucellus, sc = seed coa , s = suspenso emnan s. Figu e 5 The localiza ion o pe oxidase ac i i y in de eloping Sco s pine seeds. (A,B) Oxidized DAB (b own colou ) indica ed pe oxidase ac i i y in he seed coa , nucella laye s, megagame ophy e cells su ounding he co osion ca i y, suspenso cells and subo dina e emb yos a he ea ly (A) and la e (B) emb yogeny. (C) The seed ea ed wi h he eac ion bu e wi hou DAB. as = a ow-shaped egion, e = emb yo, es = emb yo su ounding egion, m = megagame ophy e, mm = megaspo e memb anes, nc = nucella cap, nl = nucella laye s, n = cellula nucellus, sc = seed coa , se = subo dina e emb yo, s = suspenso emnan s. Vuosku e al. BMC Plan Biology (2015) 15:88 Page 8 o 13 accumula ed in o he cells o bo h he de eloping emb yo and megagame ophy e (Figu e 8D). Discussion As an o hodox seed, a de eloping Sco s pine seed expe iences h ee cha ac e is ic ea u es, emb yo de- elopmen , accumula ion o ese e compounds and ma u a ion/d ying, which lead om a zygo ic emb yo o a ma u e, quiescen seed [60]. Bo h me abolic ac i i y and mois u e con en luc ua e d as ically du ing seed de elopmen [61-64]. Thus, he sou ces o ROS p oduc ion, connec ed o basic cellula and speci ic seed de elopmen al p ocesses, in cells also a y [65]. Du ing he seed de elop- men , he cell cycle is igh ly con olled o p ope g ow h and de elopmen [66] bu also o cellula le el oxida i e s ess esponses [67]. He e, we show he issue and de el- opmen al s age speci ic exp ession o he ATG5,CAT,and RBR genes as well as he connec ion be ween he gene exp essions and cell dea h p og ams du ing he Sco s pine seed de elopmen . The de elopmen o a iable Sco s pine seed includes he s ic ly coo dina ed ac ion o se e al cell dea h p o- g ams ( e iewed by Vuosku e al. [68]). The au ophagic PCD o subo dina e emb yos as well as hei suspenso Figu e 6 RBR exp ession in de eloping Sco s pine seeds. (A) The ela i e exp ession o RBR in de eloping seeds a he ea ly and la e emb yogeny and in he emb yos (e) and megagame ophy es (m) o ma u e seeds. The exp ession was based on mRNA copy numbe s gene a ed wi h he absolu e Q-RT-PCR analysis and alues p esen ed we e no malized using he exp ession a he ea ly emb yogeny. (B) The localiza ion o RBR mRNAs (blue signal) in a de eloping Sco s pine seed a he ea ly emb yogeny. (C) The localiza ion o RBR mRNAs a he la e emb yogeny. (D) Mino RBR exp ession in he ESR o he megagame ophy e a he ea ly emb yogeny. (E) Weak RBR exp ession in he cells o he nucella laye s a he ea ly emb yogeny. (F) In ense RBR exp ession in he cells o he nucella laye s a he la e emb yogeny. as = a ow-shaped egion, cc = co osion ca i y, e = emb yo, es = emb yo su ounding egion, m = megagame ophy e, nc = nucella cap, nl = nucella laye s, n = cellula nucellus, s = suspenso emnan s. Ba s: (D) 20 μm, (F) 50 μm, and (B,C,E)100 μm. Vuosku e al. BMC Plan Biology (2015) 15:88 Page 9 o 13