ORIGINAL RESEARCH
published: 07 No embe 2016
doi: 10.3389/ phys.2016.00511
F on ie s in Physiology | www. on ie sin.o g 1No embe 2016 | Volume 7 | A icle 511
Edi ed by:
Hans O. Poe ne ,
Al ed Wegene Ins i u e o Pola and
Ma ine Resea ch, Ge many
Re iewed by:
Pa icia Schul e,
Uni e si y o B i ish Columbia, Canada
Chia a Pape i,
Uni e si y o Pado a, I aly
S ephan F ickenhaus,
Al ed Wegene Ins i u e o Pola and
Ma ine Resea ch, Ge many
*Co espondence:
Ma io Lewis
[email p o ec ed]
Special y sec ion:
This a icle was submi ed o
Aqua ic Physiology,
a sec ion o he jou nal
F on ie s in Physiology
Recei ed: 15 July 2016
Accep ed: 19 Oc obe 2016
Published: 07 No embe 2016
Ci a ion:
Lewis M, Gö ing M, An ila K,
Kane a M, P okkola JM,
Seppänen E, Kola i I and Nikinmaa M
(2016) Di e en Rela ionship be ween
hsp70 mRNA and hsp70 Le els in he
Hea Shock Response o Two
Salmonids wi h Dissimila Tempe a u e
P e e ence. F on . Physiol. 7:511.
doi: 10.3389/ phys.2016.00511
Di e en Rela ionship be ween hsp70
mRNA and hsp70 Le els in he Hea
Shock Response o Two Salmonids
wi h Dissimila Tempe a u e
P e e ence
Ma io Lewis1*, Mi iam Gö ing1, Ka ja An ila1, Mi ella Kane a1, Jenni M. P okkola1,
Eila Seppänen2, I ma Kola i2and Mikko Nikinmaa1
1Labo a o y o Animal Physiology, Depa men o Biology, Uni e si y o Tu ku, Tu ku, Finland, 2Na u al Resou ces Ins i u e
Finland (Luke), Enonkoski, Finland
The hea shock esponse (HSR) e e s o he apid p oduc ion o hea shock p o eins
(hsps) in esponse o a sudden inc ease in empe a u e. I s egula ion by hea shock
ac o s is a good example o how gene exp ession is ansc ip ionally egula ed by
en i onmen al s esses. In con as , li le is known abou pos - ansc ip ional egula ion
o he esponse. The hea shock esponse is o en used o cha ac e ize he empe a u e
ole ance o species wi h he a ionale ha whene e he esponse se s on, a species is
app oaching i s le hal empe a u e. I has commonly been conside ed ha an inc ease in
hsp mRNA gi es an accu a e indica ion ha he same happens o he p o ein le el, bu
his need no be he case. Wi h clima e change, unde s anding he e ec s o empe a u e
on gene exp ession o especially pola o ganisms has become impe a i e o e alua e
how bo h biodi e si y and comme cially impo an species espond, since empe a u e
inc eases a e expec ed o be la ges in pola a eas. He e we s udied he HSR o wo
phylogene ically ela ed A c ic species, which di e in hei empe a u e ole ance wi h
A c ic cha ha ing lowe maximally ole a ed empe a u e han A lan ic salmon. A c ic
cha acclima ed o 15◦C and exposed o 7◦C empe a u e inc ease o 30 min showed
bo h an inc ease in hsp70 mRNA and hsp70 whe eas in salmon only hsp70 mRNA
inc eased. Ou esul s indica e ha he empe a u e o ansc ip ional induc ion o hsp
can be di e en om he one equi ed o a measu able change in inducible hsp le el.
The species wi h lowe empe a u e ole ance, A c ic cha , a e expe iencing empe a u e
s ess al eady a he highe acclima ion empe a u e, 15◦C, as hei hsp70 mRNA and
hsp70 le els we e highe , and hey g ow less han ish a 8◦C (whe eas o salmon
he opposi e is ue). Consequen ly, cha expe ience mo e d as ic hea shock han
salmon. Al hough u he s udies a e needed o es ablish he empe a u e ange and
leng h o exposu e whe e hsp mRNA and hsp le el a e disconnec ed, he obse a ion
sugges s ha by measu ing bo h hsp mRNA and hsp le el, one can e alua e i a
species is app oaching he highe end o i s empe a u e ole ance, and hus e alua e he
ulne abili y o an o ganism o he challenges imposed by ele a ed wa e empe a u e.
Keywo ds: hea shock esponse, hea shock p o eins, salmonids, clima e change, chape ones, empe a u e
acclima ion
Lewis e al. Hea Shock Response in Salmonids
INTRODUCTION
The egula ion o hea shock p o ein exp ession is one o he
mos s udied sys ems o gene exp ession, and he unc ion and
induc ion o hea shock p o eins has been e iewed in de ail om
bo h basic and compa a i e angle (Lindquis and C aig, 1988;
Fede and Ho mann, 1999; Basu e al., 2002; Rich e e al., 2010;
Deane and Woo, 2011). Especially he ansc ip ional induc ion
o hea shock genes has been ully cha ac e ized, and he ole
o hea shock ac o s—p o o ypes o ansc ip ional ac i a o s—
in he esponse has been de ailed (Lindquis , 1986; Mo imo o,
1993; Sis onen e al., 1994; P ahlad and Mo imo o, 2009).
In compa ison, pos - ansc ip ional egula ion o hea shock
p o ein p oduc ion has been li le s udied (Sil e and Noble,
2012), al hough i is clea ha i also con ibu es o he hsp le el
a e apid empe a u e inc ease (Theodo akis and Mo imo o,
1987). Pa icula ly he s abili y o mRNAs o genes encoding
inducible hea shock p o eins appea s e y empe a u e-sensi i e
(Theodo akis and Mo imo o, 1987).
On he basis o a ailable li e a u e, pos - ansc ip ional
egula ion o he hea shock esponse plays a ole in hsp
accumula ion in e eb a es (Sil e and Noble, 2012), e.g., a
he high p essu e expe ienced by chond ocy es (Kaa ni an a
e al., 1998) and in exe cise adap a ion (Melling e al., 2007).
Fu he , di e ences be ween cell ypes wi h ega d o pos -
ansc ip ional egula ion o he HSR in mammals ha e been
epo ed (Kaa ni an a e al., 2002). In Xenopus oocy es hea
shock p o ein p oduc ion is comple ely ansla ionally egula ed:
upon adequa e inc ease in empe a u e, ep ession o hea
shock p o ein p oduc ion is eleased, and p emade mRNA is
ansla ed o hea shock p o ein (Bienz and Gu don, 1982).
Uncoupling o he ansc ip ion o genes encoding hea shock
p o eins and he ac ual p o ein p oduc ion has no been much
s udied in ish. Howe e , wo s udies ha e shown ha such
disconnec ion o mRNA and p o ein p oduc ion may ake place.
Fi s , Lund e al. (2002) ha e obse ed ha in salmon a highe
empe a u e seems o be equi ed o inducible hea shock
p o ein p oduc ion han o he induc ion o mRNA p oduc ion
om he hsp gene. Second, Ho mann e al. (2005), s udying wo
New Zealand no o henioids Bo ich us a iega us Richa dson,
1846 and No o henia angus a a Hu on, 1875, showed ha in he
o me species bo h he hsp and hsp mRNA p oduc ion inc eased
in hea shock, whe eas in he la e only hsp mRNA p oduc ion
inc eased. Fu he , e en in B. a iega us he empe a u e o hsp
p o ein and mRNA induc ion may ha e been di e en .
Tho ough unde s anding o he egula ion o he hea shock
esponse in aqua ic poikilo he ms has become impe a i e wi h
clima e change, since he empe a u e esponses o a species
will a ec i s capabili y o acclima e o wa ming wa e . Also,
inding esponses which change wi h small empe a u e inc ease
a e mos aluable, as hey can show a pe u ba ion in he
li ing condi ions o a species wi h likely occu ing nea - u u e
condi ions. Al eady ea lie i has become clea ha acclima ion
o di e en empe a u es a ec s bo h he empe a u e whe e he
hea shock esponse is induced and whe e i is maximal (Die z
and Some o, 1992), and ha phylogene ically ela ed o ganisms
inhabi ing di e en empe a u es (e.g., in di e en idal zones
in he same a ea) exhibi di e en induc ion empe a u es
(Pod absky and Some o, 2004; Tomanek, 2010). We ha e s udied
he hea shock esponse using wo phylogene ically ela ed
salmonids, he A c ic cha (Sal elinus alpinus) and A lan ic
salmon (Salmo sala m. sebago) wi h o e lapping dis ibu ions.
The popula ions used in ou s udy o igina e om he same
lake a ea. Bo h species inhabi A c ic a eas, whe e empe a u e
inc ease has been g ea es in he ecen pas (e.g., Belkin, 2004;
Wanishsakpong e al., 2016). Thus, he dis ibu ion o hese ish
can be d as ically a ec ed by clima e change. No ably, he A c ic
cha has become an impo an aquacul u e species, bu s a s
o su e i he ea ing empe a u e exceeds 14◦C (Quinn e al.,
2011). The acu e ole ance o A lan ic salmon and A c ic cha
o empe a u e change (as measu ed by he loss o equilib ium
wi h inc eased empe a u e) is di e en wi h lowe empe a u es
ole a ed by cha (An ila e al., 2015).
We s udied he inducible hsp70 gene, pa icula ly he one
o which a speci ic an ibody is comme cially a ailable, as i
has been commonly used in empe a u e s udies o salmonids
(e.g., Lund e al., 2002), and since hsp70 mRNAs we e ea lie
shown o inc ease mos when A c ic cha we e exposed o 15–
19◦C (Quinn e al., 2011). We hypo hesized ha he le els o
hsp mRNAs and p o eins a e acclima ion o 8 and 15◦C o a
mon h and he hea shock esponses o A c ic cha and A lan ic
salmon a e di e en . We ocussed especially on he ques ion, i
he induc ion o p o ein and mRNA p oduc ion o he hsp70
gene can occu a di e en empe a u es and be di e en in
he wo species. This was done especially, since, al hough i is
known ha he mRNA and p o ein p oduc ion o he genes a e
o en uncoupled (e.g., Jayapal e al., 2008; Logan and Buckley,
2015), i is commonly conside ed ha in he case o hea shock
p o eins de e mining only he mRNA le el su ices o conclude
ha also he p o ein le el has inc eased (e.g., Deane and Woo,
2011) despi e he in o ma ion ha disconnec ion be ween he
wo may occu (Lund e al., 2002; Ho mann e al., 2005). We
u he p edic ed ha he di e ences be ween he species can
be ela ed o hei ea lie de e mined empe a u e ole ance. As
a consequence, he s udy o ms a basis o u he in es iga ions
es ablishing he u ili y o hea shock esponse componen s in
de e mining he posi ion o a salmonid in i s he mal ole ance
window. Ea lie , he in e ac ions be ween he mal ole ance and
hea shock esponse componen s in ish ha e mainly been s udied
wi h Fundulus he e ocli us (e.g., Healy e al., 2010), and, o
example, diu nal a ia ions in he inc ease o mRNA le el a e
a sligh hea shock ha e been obse ed (Healy and Schul e,
2012).
MATERIAL AND METHODS
Expe imen al Animals, Acclima ion and
Hea Shock P ocedu e
The expe imen s we e conduc ed a he Na u al Resou ces
Ins i u e Finland in Enonkoski, eas e n Finland, om 1s July
o 10 h Augus 2013. All p ocedu es we e app o ed by he
Finnish Animal Expe imen Boa d (ESAVI/4068/04.10.07/2013).
A c ic cha and A lan ic salmon o igina ed om Lake Saimaa
F on ie s in Physiology | www. on ie sin.o g 2No embe 2016 | Volume 7 | A icle 511
Lewis e al. Hea Shock Response in Salmonids
(62◦04′N; 28◦33′E) and we e ea ed unde a na u al pho ope iod
a he Na u al Resou ces Ins i u e Finland ha che y o 3 and
1 gene a ions, espec i ely. Ju enile (∼1-yea -old) cha and
salmon we e kep sepa a ely in 320 L cylind ical (90 cm diame e )
anks wi h cons an ly lowing, il e ed, ae a ed, and empe a u e-
con olled wa e om Lake Pahkajä i. A 100 ish pe ank o
each species we e acclima ed o ei he 8◦C (body mass 26.6 ±
1.3 g and o k leng h 14.5 ±0.2 cm o cha and 22.8 ±0.6 g
and 12.8 ±0.1 cm o salmon; mean ±SEM. a he end o
acclima ion) o 15◦C (22.9 ±1 g and 13.8 ±0.2 cm o cha ,
and 27.5 ±1 g and 13.6 ±0.2 cm o salmon) o 4 weeks and
ed comme cial ish pelle s (Raisio G oup, Finland) ad libi um.
The 4-week acclima ion pe iod was conside ed o be adequa e
o any acclima ion esponses o ake place, and is also close o
he longes pe iod o ime ha he empe a u e can be expec ed
o emain cons an in na u e. The pho ope iod was ∼17:7 L:D
du ing sampling. Feeding was s opped 24 h p io o sampling and
ish we e sac i iced in 200 ppm icaine me hanesul ona e (MS-
222, Sigma-Ald ich USA) bu e ed wi h sodium bica bona e. Fish
mass and o k leng h we e measu ed be o e gills and li e issue
we e excised and immedia ely ozen in liquid ni ogen. Fo y
ish pe acclima ion g oup we e used o ob aining undis u bed
alues, and o gans we e aken a 1, 8, 16, and 21 h a e he s a
o he ligh pe iod, whe eby he las sample was aken in he da k
pe iod. The hsp70 mRNA and p o ein alues we e de e mined
om 7 o gans a e e y ime poin . The emaining 60 ish we e
subjec ed o a non-le hal hea shock. The shock was o exac ly
he same magni ude a bo h empe a u es and o bo h species.
This ac ually makes he hea shock mo e obus o A c ic cha
han o A lan ic salmon, since he CTmax o cha is 1–2◦C
lowe o cha han o salmon: 26.7 ±0.07◦C and 27.6 ±
0.07◦C (SEM) in 8◦C acclima ed cha and salmon, espec i ely;
28.0 ±0.07◦C and 29.8 ±0.08◦C in 15◦C-acclima ed cha and
salmon, espec i ely (An ila e al., 2015), Wa e empe a u e
was con olled using a 2 kW wa e hea e (RC20 WGW Lauda,
Ge many). Subme sible ai -pumps and wa e -pumps we e used
o main ain oxygen sa u a ion and p e en s a i ica ion o wa e
empe a u e, espec i ely. Because handling has been shown no
o a ec he hea shock esponse (Vijayan e al., 1997), a he s a
o he ligh pe iod he ish om each acclima ion g oup we e
ans e ed o an expe imen al ank wi h wa e empe a u e 7◦C
highe han he acclima ion empe a u e. Fish we e kep a he
hea shock empe a u e o 30 min be o e being e u ned o he
acclima ion anks o eco e y. The leng h o he hea shock and
ollow-up pe iod we e chosen a bi a ily, bu i was checked ha
hey we e adequa e o see a esponse bo h a mRNA and p o ein
le el in cha . Since i is p obable ha he ul ima e signal o hsp
p oduc ion is he amoun o mis olded p o ein, he magni ude
o he esponse will be a ec ed by he ini ial empe a u e, he
empe a u e change in he hea shock, and he leng h o he
exposu e o inc eased empe a u e. Gills and li e issue (chosen
o ep esen wo di e en issues, one in di ec con ac wi h he
en i onmen and he o he being me abolically a e y ac i e
one) we e subsequen ly excised a 1, 2, 4, 8, 16, and 24 h pos -
hea shock and lash ozen in liquid ni ogen o downs eam
analyses. We de e mined he mRNA le els using quan i a i e eal
ime PCR and p o ein le els wi h wes e n blo ing om 7 ish pe
ime poin .
Gene Cloning, Sequence Valida ion and
P ime Design
P ime s used o ampli y salmonid inducible hsp70 we e designed
based on alignmen s o se e al salmonid hsp70 mRNA sequences
a ailable a NCBI (www.ncbi.nlm.nih.go ), wi h accession
numbe s NM_001124228, NM_001124745 and AB062281.1
(Onco hynchus mykiss), KF783199.1 (Sal elinus on inalis),
AJ632154.1 (Salmo sala ) and OTU35064 (Onco hynchus
schawy scha). P ime s used o ampli y an 812 base-pai (bp)
gene agmen o hsp70 in bo h cha and salmon a e: Fo —CCT
CTACATTCATAAACTGCAACT, Re —CTGGCTGATGTC
CTTCTTGTGT. To ensu e ha only he inducible hsp70 iso o m
is ampli ied, a egion wi h su icien misma ch base-pai ings wi h
S. sala hsc70 (BT059361) was selec ed o qPCR p ime design.
P ime s o β-ac in we e designed based on mRNA sequences
wi h accession numbe s AB196465.1 (O. mykiss), AB111057.1
(Onco hynchus ne ka), JR540730.1 (Sal elinus alpinus) and
NM_001123525.1 (S. sala ). P ime s used o ampli y a 1128 bp
gene agmen o β-ac in in bo h species a e: Fo —ATGGAAGAT
GAAATCGCCGCAC, Re —TTAGAAGCATTTACGGTGGAC
G. PCR p oduc s we e ob ained om cDNA e e se ansc ibed
om 1 µg o al RNA ex ac ed om bo h species. RNA isola ion
and cDNA syn hesis me hodology is de ailed in he succeeding
sec ion. Ampli ica ion o he gene o in e es and e e ence gene
was pe o med using a KAPA HiFi Ho S a PCR Ki (KAPA
Biosys ems, USA) wi h he ollowing he mal cycling pa ame e s:
1 cycle o ini ial dena u a ion o 3 min a 95◦C, hen 30 cycles
each o second dena u a ion a 98◦C o 20 s, annealing a 60◦C
o 15 s and ex ension a 72◦C o 60 s/kb. PCR p oduc s we e
size sepa a ed by elec opho esis in 1.5% aga ose gel s ained wi h
e hidium b omide, ollowed by gel ex ac ion using a NucleoSpin
gel and PCR clean up ki (Mache ey-Nagel, Ge many).
Gene agmen s we e liga ed on o a pJET1.2/blun cloning
ec o wi h a CloneJe PCR Cloning ki (The moScien i ic,
USA), p opaga ed in CaCl2compe en DH5αE. coli and
sc eened on LB-aga con aining ampicillin. Posi i e colonies
we e selec ed o u he p opaga ion hen pu i ied wi h a
NucleoSpin Plasmid EasyPu e Ki (Mache ey-Nagel, Ge many).
Sequencing was pe o med on pu i ied plasmids a he Eu opean
Cus om Sequencing Cen e (GATC Bio ech AG, Köln Ge many)
and ob ained sequences (Hsp70—KU885452 o S. alpinus
and KU885451 o S. sala ; β-ac in—KU885450 o S. alpinus
and KU885449 o S. sala ) we e aligned and con i med
wi h homologous sequences using NCBI BLAST. Phylogene ic
analysis o he hsp70 sequences om cha and salmon,
done acco ding o Me zge e al. (2016), con i med ha
he cloned genes belong o he inducible hsp70 iso o ms,
bu ou analysis could no di e en ia e be ween hsp70-
1and hsp70-2. Species and gene-speci ic Taqman qPCR
p ime s and luo escence p obes we e designed using he
Uni e sal P obe Lib a y Assay Design Cen e websi e (Roche
Diagnos ics). Taqman p ime s (hsp70 Fo —AGCTAAAGGCCC
GTCTATCG, Re —AACACCCCCACACAGGAGTA, P obe #
104 ca . no. 04692225001; Roche Diagnos ics); β-ac in Fo —
CCAAAGCCAACAGGGAGA,Re —GTACATGGCAGGGGT
GTTG o cha and Re —GTACATGGCGGGGGTGTTG o
salmon, P obe # 115 ca .no. 04693493001; Roche Diagnos ics)
we e designed o ampli y a 60–65 bp amplicon and a u he
F on ie s in Physiology | www. on ie sin.o g 3No embe 2016 | Volume 7 | A icle 511
Lewis e al. Hea Shock Response in Salmonids
alignmen o p obe # 104 wi h S. sala hsc70 was conduc ed
o con i m ha he p obe did no bind o he ansc ip s o
he cons i u i ely exp essed iso o m. All p ime s we e es ed o
e iciency and ampli ica ion signals ob ained we e wi hin he
quan i iable ange o p ime e iciencies (90–110%).
Quan i a i e Real-Time PCR P ocedu e o
hsp70 mRNA De e mina ion
To al RNA was ex ac ed om issues using he guanidine
iso hiocyana e me hod (Chomczynski and Sacchi, 1987) wi h
TRI Reagen (Molecula Resea ch Cen e, USA), acco ding o
he manu ac u e ’s ins uc ions wi h addi ional pu i ica ion s eps.
F ozen issues we e placed in TRI Reagen and homogenized
mechanically wi h a TissueLyse (Qiagen, USA) a 30 shakes/s
o 2 min. Phase sepa a ion o RNA was pe o med using 1-
b omo-3-chlo op opane, ollowed by isop opanol p ecipi a ion,
washing wi h 75% e hanol, hen he RNA was dissol ed in RNase
ee wa e . To emo e esidual genomic DNA con amina ion,
DNase I (P omega, USA) was added (1 µg) in solu ion o an
aliquo o RNA and incuba ed o 10 min a 37◦C, ollowed by
ano he ound o phase sepa a ion, p ecipi a ion and washing.
The pu i ied RNA was s o ed o e nigh a +4◦C in 75% e hanol
o ensu e he ho ough emo al o po en ial con aminan s,
hen cen i uged a 7500 RCF o 5 min, subsequen ly ai -d ied
and e-dissol ed in RNase ee wa e . RNA concen a ion and
pu i y we e measu ed using a Nanod op 2000 spec opho ome e
(The moScien i ic, USA). Only samples wi h an A260/280 a io
o ≥1.8 we e used in downs eam applica ions.
RNA in eg i y was con i med by aga ose gel elec opho esis
using sodium hypochlo i e as a dena u an , as desc ibed
p e iously (A anda e al., 2012). An aliquo o RNA (600 ng) om
each sample was mixed wi h 10X loading bu e (1.9 mM xylene
cyanol, 1.5 mM b omophenol blue, 25% glyce ol) and pipe ed
on o a gel comp ised o 1% aga ose, 1% comme cial bleach
(Kiil o, Finland) con aining 6% sodium hypochlo i e and s ained
wi h e hidium b omide. To es o genomic con amina ion,
qPCR was pe o med wi hou e e se ansc ip ion on each RNA
sample in iplica e in a inal eac ion olume o 10 µl pe well,
including 2 ng o RNA, 0.3 µM o hsp70 o wa d and e e se
p ime s, 0.1 µM o p obe # 104 and 5 µl 2X KAPA P obe Fas
qPCR ki mas e mix (KAPA Biosys ems, USA). The mal cycling
pa ame e s a e he same as in he qPCR me hodology de ailed
in he succeeding sec ion. Samples which did no ampli y a e
40 cycles we e deemed ee o genomic DNA and samples which
ampli ied we e e- ea ed wi h DNase I and pu i ied as desc ibed
abo e.
An aliquo o RNA (100 ng) om each sample was used o
cDNA syn hesis using a PTC-150 MiniCycle (MJ Resea ch,
USA), wi h a DyNAmo cDNA syn hesis ki (The moScien i ic,
USA) acco ding o he manu ac u e ’s ins uc ions, in a inal
eac ion olume o 20 µl inclusi e o andom hexame s, e e se
ansc ip ion bu e wi h dNTP mix and MgCl2, M-MuLV
RNase H+ e e se ansc ip ase and he ollowing he mal
cycling pa ame e s: P ime ex ension a 25◦C o 10 min, cDNA
syn hesis a 37◦C o 1 h and eac ion e mina ion a 85◦C o
5 min. Resul an cDNAs we e subsequen ly s o ed a −20◦C.
qPCR was conduc ed using a 7900HT Fas Real-Time PCR
Sys em (Applied Biosys ems, USA) o he undis u bed da a
and Quan S udio 12K Flex Real Time PCR Sys em (Applied
Biosys ems, USA) o he hea shock da a, in a inal eac ion
olume o 10 µl, wi h 1 ng o cDNA, 0.3 µM o wa d and e e se
p ime s, 0.1 µM p obe and 5 µl 2X KAPA P obe Fas qPCR
mas e mix (KAPA Biosys ems, USA), wi h he ollowing he mal
cycling pa ame e s: S age 1 (enzyme ac i a ion) a 50◦C o
2 min. S age 2 (dena u a ion) a 95◦C o 10 min, and 40 cycles
o S age 3 a 95◦C o 15 s, hen 60◦C o 1 min (annealing and
ex ension). Tempe a u e changes we e kep a a cons an 1.6◦C/s.
Ta ge and e e ence gene eac ion quan i ies we e de e mined
om a s anda d cu e gene a ed om a 1:2 (undis u bed)
and a 1:5 (hea shocked) se ial dilu ion o andomly chosen
and pooled samples, and hsp70 alues we e no malized o β-
ac in o ob ain ela i e quan i ies. The sui abili y o β-ac in
as a consis en house-keeping e e ence gene was de e mined
using Bes Keepe (P a l e al., 2004). Because o he long
s abili y and la ge amoun o p e iously p oduced β-ac in mRNA,
ansc ip amoun s emained unchanged h oughou he s udy,
e en hough i is likely ha he o ma ion o new mRNA a ies
du ing he expe imen . In conclusion, he esul s gi e he ela i e
quan i ies as he a io be ween hsp70 and β-ac in mRNA le els.
Wes e n Blo ing o hsp70 De e mina ion
F ozen issues we e weighed and homogenized in 5 olumes
o lysis bu e (62.5 mM T is-HCl, 1µg/ml leupep in, peps a in,
an ipain and 1mM PMSF) using a TissueLyse (Qiagen, USA)
a 30 shakes/s o 2 min. Lysa es we e kep on ice o 30 min
p io o +4◦C cen i uga ion a 10,000 RCF o 30 min and
supe na an s o age a −80◦C. P o ein concen a ions we e
de e mined using he B ad o d me hod (B ad o d, 1976) and
a p o ein assay dye eagen (Bio-Rad, Ge many), wi h a se ial
dilu ion o bo ine se um albumin (1 mg/ml) as a s anda d.
Spec opho ome ic measu emen s we e pe o med a 595 nm
using a Wallac EnVision 2103 Mul ilabel Reade (Pe kinElme ,
Finland).
An equal amoun (20 µg) o p o ein pe sample was mixed
wi h 5X Laemmli bu e (Laemmli, 1970) and dena u ed o
5 min a 95◦C, hen loaded on o an SDS-PAGE gel comp ised
o 10% polyac ylamide. Gels we e placed in a Mini-P o ean
3 elec opho esis module (Bio-Rad, USA) and he p o eins
sepa a ed by size, i s a 100 V o 30 min hen 150 V o
1 h. P o eins we e ans e ed on o a ni ocellulose memb ane
(Pe kin Elme , USA) a 100 V o 1 h a +4◦C and incuba ed
in PBS blocking solu ion con aining 3% non- a powde ed milk
and 0.3% Tween o 1 h. Memb anes we e incuba ed o e nigh
simul aneously wi h abbi polyclonal an i-salmonid inducible
hsp70 (AS05061A) p ima y an ibody (1:10000) (Ag ise a,
Sweden), and abbi polyclonal an i-β-ac in (ab8227) p ima y
an ibody (1:5000) (Abcam, UK) in PBS-Tween wi h 3% milk a +
4◦C. The ea e , memb anes we e incuba ed in PBS-Tween wi h
3% milk wi h HRP-conjuga ed an i- abbi seconda y an ibody
(1:2500) (Sigma-Ald ich, USA) o 1 h a oom empe a u e,
hen washed and imme sed in Ame sham ECL P ime Wes e n
Blo ing De ec ion Reagen (GE Heal hca e, UK), ollowed by
exposu e o x- ay ilm. A sho exposu e (∼5 s) o β-ac in and
F on ie s in Physiology | www. on ie sin.o g 4No embe 2016 | Volume 7 | A icle 511
Lewis e al. Hea Shock Response in Salmonids
a longe exposu e (∼2 min) o hsp70 was used o acqui e a
quan i iable signal in undis u bed ish, while a sho exposu e
(∼5 s) was used o bo h β-ac in and hsp70 o hea shocked ish.
Thus, he da a do no allow he absolu e le els o he wo p o eins
o be compa ed, bu since all he expe imen al ime poin s we e
ea ed simila ly, he da a enable no maliza ion. Densi ome y
was pe o med using ImageJ 1.48 (NIH, USA) and ela i e
quan i ies we e ob ained by no malizing hsp70 alues o β-ac in.
The le els o β-ac in did no change signi ican ly o e ime and
be ween ea men s in bo h species, hus con i ming i s sui abili y
as a loading con ol and e e ence p o ein. Consequen ly, he
esul s gi e he ela i e quan i ies as he a io be ween hsp70 and
β-ac in bands.
S a is ics
I was ini ially es ed i ou da a we e no mally dis ibu ed
(Shapi o-Wilk’s es ) and had equal a iances be ween g oups
(B own-Fo sy he’s es ). Since he da a we e in mos cases no
no mally dis ibu ed, we i s ied simple da a ans o ma ions
(e.g., log ans o ma ion) o make he da a no mal. Howe e , his
was no he case e en a e he ans o ma ion o mos g oups o
da a. This p ecludes using mul i a ia e ANOVAs, which equi e
no mal dis ibu ion. Consequen ly, ei he pa ame ic ANOVA o
non-pa ame ic K uskal-Wallis es on anks was used on mRNA
and p o ein le els sepa a ely, wi h ei he acclima ion empe a u e
o ime as an independen ac o . We ollowed he sugges ed
pos -hoc es ing gi en by Sigmaplo 13 (Holm-Sidak es o
ANOVA, Dunn’s es o K uskal-Wallis on anks [[Figu es 2,
3]] o Dunne ’s [Figu es 5,6]) whene e signi ican e ec s we e
iden i ied. In Figu e 1 he weigh s o he ish o each species
we e sepa a ely compa ed a 8 and 15◦C using - es . Since no
changes occu ed as a esul o he 7◦C empe a u e inc ease
in cold-acclima ed specimens, he e ec o ime in he hea
shock expe imen s was only es ed in wa m-acclima ed animals
(The e was one excep ion o his gene aliza ion; he hsp70 le el
in salmon gills was signi ican ly highe p io o hea shock
han a subsequen ime poin s in cold-acclima ed specimens).
SigmaPlo 13 (SyS a So wa e, USA) was used o s a is ical
compa isons and p<0.05 was accep ed o indica e a s a is ically
signi ican e ec .
RESULTS
Fo he s udies, we acclima ed A c ic cha and salmon o 8
and 15◦C o 4 weeks. Figu e 1 gi es he weigh s o he ish
a e acclima ion. Eigh -deg ee-acclima ed cha we e hea ie
han hose acclima ed o 15◦C, whe eas he opposi e was ue
o salmon. Howe e , Ful on’s condi ion ac o (K=100 ×
weigh /leng h3) was essen ially independen o he acclima ion
empe a u e wi h alues o 0.809 ±0.2 and 0.808 ±0.01 (SEM)
o 8 and 15◦C-acclima ed cha , and 1.064 ±0.01 and 1.060 ±
0.01 o 8 and 15◦C-acclima ed salmon (N=100), espec i ely.
Using species-speci ic inducible hsp70 p ime s and an
an ibody ecognizing he inducible hsp70 in bo h species, o
qPCR and immunoblo ing, espec i ely, we i s checked i he
cons i u i e mRNA and p o ein exp ession a ied du ing he day.
This was deemed o be impo an , as ligh hy hm a ia ions in
FIGURE 1 | The body masses o A c ic cha and A lan ic salmon a e
1-mon h acclima ion o 8 o 15◦C. Be o e he pe iod o acclima ion he ish
in each species we e held in one pa ch, so ha any di e ences e lec he
e ec s o acclima ion pe iod. Th oughou acclima ion he ish we e ed daily ad
libi um. The s a is ical signi icance o he di e ence in weigh be ween 8 and
15◦C-acclima ed ish was es ed wi h - es . p<0.05 was accep ed as a
s a is ically signi ican e ec , indica ed wi h * in he igu e, mean ±SEM; N=
100.
he A c ic a e p onounced, and ligh - empe a u e ela ionship
will change as a consequence o clima e change. Fu he , s udies
by Healy and Schul e (2012) ha e shown ha hsp70 le el can
show ci cadian luc ua ions in Fundulus he e ocli us.Figu es 2,
3indica e ha nei he he hsp70 mRNA no he p o ein
le els showed s ong ci cadian luc ua ions in ei he species,
empe a u e o issue (li e o gills) wi h he used ligh hy hm
and sampling p o ocol. The excep ion o his gene aliza ion is
he mRNA le el in wa m-acclima ed salmon li e (H3=11.339,
p=0.01). Howe e , he esul s show inc eased hsp70 mRNA
(H1=29.598, p<0.001 and H1=7.222, p=0.007 o gills
and li e , espec i ely) and p o ein le els (H1=15.726, p<
0.001 and H1=5.491, p=0.019 o gills and li e , espec i ely)
in 15◦C-acclima ed cha as compa ed o 8◦C-acclima ed cha
(Figu es 2,4). In con as , in salmon he hsp70 mRNA (H1=
4.129, p=0.042 and H1=23.846, p<0.001 o gills and li e ,
espec i ely) and p o ein le els (F1=19.921, p<0.001 and H1
=5.962, p=0.015 o gills and li e , espec i ely) we e highe a
he lowe han a he highe acclima ion empe a u e (Figu es 3,
4). Fu he , i is possible ha he mRNA-p o ein exp ession
ela ionship is di e en in he wo issues in salmon.
To s udy he hea shock esponse, ish we e exposed o 30 min
o a empe a u e 7◦C highe han he acclima ion empe a u e,
whe ea e hey we e e u ned and he esponses ollowed a he
acclima ion empe a u e. An acu e inc ease in empe a u e om
8 o 15◦C did no cause changes in ei he species in ei he mRNA
o p o ein le els (Figu es 5,6). Howe e , when he empe a u e
inc ease was om 15 o 22◦C, hsp70 mRNA inc eased d as ically
in bo h species. P e-exposu e alues we e es o ed by 8 h a e
he ish we e e u ned o he acclima ion empe a u e. The apid
empe a u e-dependen ansc ip ional induc ion is he hallma k
o he hea shock esponse (Lindquis , 1986). In con as , he hea
F on ie s in Physiology | www. on ie sin.o g 5No embe 2016 | Volume 7 | A icle 511

Lewis e al. Hea Shock Response in Salmonids
FIGURE 2 | Hsp70 mRNA and p o ein le els a di e en imes o he 24-h ligh /da k cycle in undis u bed A c ic cha . Rela i e quan i ies (mean ±SEM; n
=7) a e gi en. Whene e ANOVA o K uskal-Wallis on anks [pa ame ic (p) o non-pa ame ic (n-p), espec i ely] indica ed s a is ically signi ican di e ences pos -hoc
es ing (Holm-Sidak o Dunn’s me hod) was conduc ed. * indica es signi ican di e ences be ween acclima ion empe a u es a he same ime poin (p<0.05 was
accep ed as s a is ically signi ican e ec ). The e we e no signi ican di e ences be ween ime poin s wi hin an acclima ion empe a u e. Da k pe iod is indica ed by
g ay shading.
shock p o ein esponse was ma kedly di e en in he wo species.
A c ic cha showed he adi ional pa e n, whe e ansc ip ional
induc ion was ollowed by p o ein p oduc ion (Figu e 5). The
speed o p o ein accumula ion was ma kedly di e en in li e
and gills. Thus, in li e , he majo de oxi ying issue (Hin on
e al., 2008), he highes hsp70 le el was eached al eady 2 h a e
he hea shock, whe eas in gills he highes p o ein le el was
seen a e 16 h (Figu e 5). Con e sely, in he 15◦C-acclima ed
salmon subjec ed o a 7◦C empe a u e inc ease hsp70 did no
accumula e despi e ansc ip ional induc ion (Figu e 6).
DISCUSSION
The majo inding o he p esen s udy was ha despi e he
inc ease o hsp70 mRNA he p o ein le el did no inc ease in
he 15◦C-acclima ed salmon. This esul indica es ha he e
a e condi ions when he no ion ha an inc ease in hsp mRNA
indica es ha also hsp inc eases in ish does no hold, a inding
ex ending om hose o Lund e al. (2002) and Ho mann e al.
(2005). Ea lie , i has been shown o Xenopus oocy es ha he
p oduc ion o hsp mRNA and p o ein a e uncoupled (Bienz
and Gu don, 1982), he hea shock esponse being egula ed
ansla ionally ( he hea shock esponse in ol es an inc ease in
hea shock p o ein le el bu no change in mRNA). Ou esul
gi es a new dimension o he o e all egula ion o he hea shock
esponse. While in bo h cha and salmon he hea shock gene
is clea ly ansc ip ionally egula ed, as shown by he inc ease in
mRNA in bo h species, he hsp le el need no inc ease, as he
esul wi h salmon indica es. Na u ally, ou esul s a e es ic ed
o he induc ion ime (30 min), and he ollowing ollow-up ime
(24 h). We canno be ce ain ha inc easing he leng h o ei he
would no be seen as inc eased p o ein p oduc ion in salmon.
Howe e , we conside i imp obable ha inc easing he ollow-up
ime would ha e esul ed in inc eased hsp70 le el, as a signi ican
p o ein le el change occu ed in 2 h in cha li e bu no a e
F on ie s in Physiology | www. on ie sin.o g 6No embe 2016 | Volume 7 | A icle 511
Lewis e al. Hea Shock Response in Salmonids
FIGURE 3 | Hsp70 mRNA and p o ein le els a di e en imes o he 24-h ligh /da k cycle in undis u bed A lan ic salmon. Rela i e quan i ies (mean ±
SEM; n=7) a e gi en. Whene e ANOVA o K uskal-Wallis on anks [pa ame ic (p) o non-pa ame ic (n-p), espec i ely] indica ed s a is ically signi ican di e ences
pos -hoc es ing (Holm-Sidak o Dunn’s me hod) was conduc ed. *indica es signi ican di e ences be ween acclima ion empe a u es a he same ime poin , and
di e en le e s indica e ha he means in hose ime poin s di e om each o he (p<0.05 was accep ed as s a is ically signi ican e ec ). Da k pe iod is indica ed by
g ay shading.
24 h in salmon li e . In con as , i is possible ha inc easing he
leng h o exposu e could ha e caused he salmon hsp70 le el o
inc ease, as he signal o hsp accumula ion is mos likely he
amoun o mis olded p o ein, which inc eases wi h ime.
The abo e conclusion also depends c i ically on whe he he
p o ein ecognized by he an ibody is inducible in bo h cha
and salmon. This is mos p obable as he an ibody used has
ea lie success ully been used o p obe inducible hsp70 le el in
salmon (Tunnah e al., 2016), whe e he inc ease o p o ein le el
was no obse ed in he p esen s udy. In addi ion, he an ibody
has success ully been used o documen hsp70 induc ion in he
cen al mudminnow (Umb a limi) (Cu ie e al., 2010). I should
be no ed ha a leas in insec s he p oduc ion o hea shock
p o ein is ela ed o he s eady-s a e ( es ing) le el o he p o ein:
i he es ing le el is high, hsp p oduc ion may no ake place
(Za sepina e al., 2016).
The ques ion is hen why he e should be such a p e en ion
o hea shock p o ein p oduc ion. The eason may be ela ed
o he ac ha du ing hea shock only hea shock p o eins
a e ansla ed, wi h hei p e e en ial ansla ion going on upon
eco e y om hea shock (S o i e al., 1980). The ansla ion o
o he p o eins g adually inc eases du ing eco e y. Depending
on he se e i y o shock he hea shock p o ein p oduc ion can
be sho - e m o sus ained (Gedamu e al., 1983). I only hea
shock p o eins can be p oduced ins ead o o he needed p o eins,
a se ious cos is incu ed. Such a cos would no ake place i he
p oduc ion o hea shock p o eins did no occu . The ollowing
wo easons ha e been ea lie sugges ed as possible easons why
hea shock p o eins a e no always p oduced abundan ly: i s , in
la ge amoun s hsps migh dis u b he no mal cellula /o ganismal
unc ions, o , second, he p oduc ion and deg ada ion o hsps
could cause in ole able inc ease in cellula ene gy consump ion
F on ie s in Physiology | www. on ie sin.o g 7No embe 2016 | Volume 7 | A icle 511
Lewis e al. Hea Shock Response in Salmonids
FIGURE 4 | Hsp70 mRNA and p o ein le els o undis u bed A c ic cha and A lan ic salmon a e 1-mon h acclima ion o 8 o 15◦C in gills and li e .
Rela i e quan i ies a e gi en. The igu e ep oduces da a o Figu es 2,3 o gi ing he eade a clea pic u e how hsp70 mRNA and p o ein changes be ween
acclima ion empe a u es in he wo species and issues (gills o li e ).
FIGURE 5 | Time cou se o hea shock induced hsp70 mRNA and p o ein syn hesis in A c ic cha . Rela i e quan i ies (mean ±SEM; n=7) in (A) gills and
(B) li e . Rela i e quan i ies o hsp70 a e based on hsp/β-ac in a ios in he wes e n blo s. Rep esen a i e examples o wes e n blo s o gills a e gi en in (C) and li e in
(D). Whene e ANOVA o K uskal-Wallis on anks [pa ame ic (p) o non-pa ame ic (n-p), espec i ely] indica ed s a is ically signi ican di e ences pos -hoc es ing
(Dunne ’s me hod) was conduc ed. A le e abo e a symbol indica es ha he le els a ha ime poin a e signi ican ly di e en om le els be o e he hea shock (p<
0.05).
(Fede and Ho mann, 1999). The ac ha he hea shock
esponse is o en absen in ea ly de elopmen o o ganisms wi h
o he wise p onounced p o ein syn hesis ( e iewed in Fede and
Ho mann, 1999), (e.g., ansc ip ional induc ion o hsp70 gene
does no occu in ea ly de elopmen o Xenopus;Heikkila e al.,
1987), sugges s ha he compe i ion o ansla ion may be a
signi ican eason o p e en ing hea shock p o ein p oduc ion.
Ou esul s add o he possibili ies o egula ing he hea
shock esponse u ilizing hsp70 a di e en le els. Fi s , he
ansc ip ional induc ion empe a u e o he genes encoding
hea shock p o eins di e s be ween species and popula ions
(Fede and Ho mann, 1999; Buckley and Ho mann, 2004), and
is also a ec ed by he acclima ion empe a u e o he o ganisms
(Tomanek and Some o, 1999, 2002; Pod absky and Some o,
F on ie s in Physiology | www. on ie sin.o g 8No embe 2016 | Volume 7 | A icle 511
Lewis e al. Hea Shock Response in Salmonids
FIGURE 6 | Time cou se o hea shock induced hsp70 mRNA and p o ein syn hesis in A lan ic salmon. Rela i e quan i ies (mean ±SEM, n=7) in (A) gills
and (B) li e . Rela i e quan i ies o hsp70 a e based on hsp/β-ac in a ios in he wes e n blo s. Rep esen a i e examples o wes e n blo s o gills a e gi en in (C) and
li e in (D). Whene e ANOVA o K uskal-Wallis on anks [pa ame ic (p) o non-pa ame ic (n-p), espec i ely] indica ed s a is ically signi ican di e ences pos -hoc
es ing (Dunne ’s me hod) was conduc ed. A le e abo e a symbol indica es ha he alues a ha ime poin a e signi ican ly di e en om he alues be o e he hea
shock. *abo e he symbol in he hsp70 da a o gills indica es he one signi ican di e ence ound in cold-acclima ed ish (p<0.05).
2004) wi h he comple e lack o induc ion in some s eno he mal
o ganisms (Tomanek, 2010). Second, he e a e clea ly se e al
di e en p o eins in he hsp70 amily, which may ha e di e en
ansc ip ional induc ion empe a u es. Such a si ua ion can
be he basis o popula ion di e ences in he induc ion o
he esponse (Fangue e al., 2006). Ou inding shows ha
he hea shock p o ein syn hesis can also be con olled pos -
ansc ip ionally in ish. He e one has o no e ha he wo k was
done e y close o he empe a u e whe e he mRNA induc ion
in A lan ic salmon is obse ed (see Lund e al., 2002), bu much
abo e he empe a u e equi ed o mRNA accumula ion in cha
(Quinn e al., 2011). Consequen ly, he esul s canno indica e
wha he empe a u e di e ence be ween ha ing bo h he hsp70
mRNA and p o ein accumula e, o ha ing only he mRNA le el
o inc ease is.
The esul s hus indica e an ob ious se o u u e expe imen s:
ca ying ou acclima ion o a species in a se o empe a u es
wi h consequen empe a u e inc eases o di e en magni udes
and di e en leng hs. Based on ou esul s we p edic ha (1)
a gi en inc ease in empe a u e causes nei he ansc ip ional
no ansla ional induc ion o he hea shock gene a low
acclima ion empe a u e. (2) Wi h an inc ease in empe a u e,
he hea shock genes a e i s induced ansc ip ionally bu no
ansla ionally. (3) When he acclima ion empe a u e is high
enough, bo h ansc ip ional and ansla ional induc ion occu .
The empe a u e di e ence be ween possibili ies 2 and 3 is e y
in e es ing, as i a ec s he signi icance and use o he esponse.
I he di e ence is species-dependen , la ge in some and small
in o he s, a signi ican impo ance o i being an impo an s ep
in he egula ion o he hea shock esponse can be a ached.
I he empe a u e di e ence be ween 2 and 3 is na ow in all
species, hen he esponse can be used o p obe i small inc eases
in en i onmen al empe a u es ha e an e ec on ish.
The esul s o he p esen s udy also show a clea ime lag
be ween ansc ip ional induc ion and p o ein p oduc ion. The
ime lag has been expe imen ally shown (Buckley e al., 2006), bu
is inadequa ely cha ac e ized and aken in o accoun (Logan and
Buckley, 2015). Fo example, wi h ci cadian changes o p o ein
le els he ele an ansc ip ion mus ake place se e al hou s
be o e he maximal amoun o p o ein is equi ed. This means
ha he cue o inc eased ansc ip ion canno be he same as
he eason o maximal p o ein le el in he ci cadian cycle. Ou
esul s also indica e ha he ime lag be ween ansc ip ion and
ansla ion is, no su p isingly, cell ype-speci ic. The simples
explana ion o his is ha he a ailabili y o ibosomes is he
limi ing ac o and he ime lag is sho es in cells wi h high
p obabili y o inducible p o ein p oduc ion such as hepa ocy es
wi h hei inducible de oxi ica ion machine y (Hin on e al.,
2008). Fu he , he ype o ansla ed p o ein will a ec he ime
lag. Wi h ega d o inducible hea shock p o eins, he ime lag is
excep ionally sho , which was hough o be due o hem lacking
in ons (Molina e al., 2000). Howe e , al hough mammalian and
D osophila hsp genes lack in ons, hey a e p esen in ish genes
(Me zge e al., 2016).
In an a emp o explaining he di e ence be ween he
esponses o he wo species, he body mass da a a e use ul. Since
F on ie s in Physiology | www. on ie sin.o g 9No embe 2016 | Volume 7 | A icle 511