Different relationship between hsp70 mRNA and hsp70 levels in the heat shock response of two salmonids with dissimilar temperature preference

ORIGINAL RESEARCH published: 07 No embe 2016 doi: 10.3389/ phys.2016.00511 F on ie s in Physiology | www. on ie sin.o g 1No embe 2016 | Volume 7 | A icle 511 Edi ed by: Hans O. Poe ne , Al ed Wegene Ins i u e o Pola and Ma ine Resea ch, Ge many Re iewed by: Pa icia Schul e, Uni e si y o B i ish Columbia, Canada Chia a Pape i, Uni e si y o Pado a, I aly S ephan F ickenhaus, Al ed Wegene Ins i u e o Pola and Ma ine Resea ch, Ge many *Co espondence: Ma io Lewis [email p o ec ed] Special y sec ion: This a icle was submi ed o Aqua ic Physiology, a sec ion o he jou nal F on ie s in Physiology Recei ed: 15 July 2016 Accep ed: 19 Oc obe 2016 Published: 07 No embe 2016 Ci a ion: Lewis M, Gö ing M, An ila K, Kane a M, P okkola JM, Seppänen E, Kola i I and Nikinmaa M (2016) Di e en Rela ionship be ween hsp70 mRNA and hsp70 Le els in he Hea Shock Response o Two Salmonids wi h Dissimila Tempe a u e P e e ence. F on . Physiol. 7:511. doi: 10.3389/ phys.2016.00511 Di e en Rela ionship be ween hsp70 mRNA and hsp70 Le els in he Hea Shock Response o Two Salmonids wi h Dissimila Tempe a u e P e e ence Ma io Lewis1*, Mi iam Gö ing1, Ka ja An ila1, Mi ella Kane a1, Jenni M. P okkola1, Eila Seppänen2, I ma Kola i2and Mikko Nikinmaa1 1Labo a o y o Animal Physiology, Depa men o Biology, Uni e si y o Tu ku, Tu ku, Finland, 2Na u al Resou ces Ins i u e Finland (Luke), Enonkoski, Finland The hea shock esponse (HSR) e e s o he apid p oduc ion o hea shock p o eins (hsps) in esponse o a sudden inc ease in empe a u e. I s egula ion by hea shock ac o s is a good example o how gene exp ession is ansc ip ionally egula ed by en i onmen al s esses. In con as , li le is known abou pos - ansc ip ional egula ion o he esponse. The hea shock esponse is o en used o cha ac e ize he empe a u e ole ance o species wi h he a ionale ha whene e he esponse se s on, a species is app oaching i s le hal empe a u e. I has commonly been conside ed ha an inc ease in hsp mRNA gi es an accu a e indica ion ha he same happens o he p o ein le el, bu his need no be he case. Wi h clima e change, unde s anding he e ec s o empe a u e on gene exp ession o especially pola o ganisms has become impe a i e o e alua e how bo h biodi e si y and comme cially impo an species espond, since empe a u e inc eases a e expec ed o be la ges in pola a eas. He e we s udied he HSR o wo phylogene ically ela ed A c ic species, which di e in hei empe a u e ole ance wi h A c ic cha ha ing lowe maximally ole a ed empe a u e han A lan ic salmon. A c ic cha acclima ed o 15◦C and exposed o 7◦C empe a u e inc ease o 30 min showed bo h an inc ease in hsp70 mRNA and hsp70 whe eas in salmon only hsp70 mRNA inc eased. Ou esul s indica e ha he empe a u e o ansc ip ional induc ion o hsp can be di e en om he one equi ed o a measu able change in inducible hsp le el. The species wi h lowe empe a u e ole ance, A c ic cha , a e expe iencing empe a u e s ess al eady a he highe acclima ion empe a u e, 15◦C, as hei hsp70 mRNA and hsp70 le els we e highe , and hey g ow less han ish a 8◦C (whe eas o salmon he opposi e is ue). Consequen ly, cha expe ience mo e d as ic hea shock han salmon. Al hough u he s udies a e needed o es ablish he empe a u e ange and leng h o exposu e whe e hsp mRNA and hsp le el a e disconnec ed, he obse a ion sugges s ha by measu ing bo h hsp mRNA and hsp le el, one can e alua e i a species is app oaching he highe end o i s empe a u e ole ance, and hus e alua e he ulne abili y o an o ganism o he challenges imposed by ele a ed wa e empe a u e. Keywo ds: hea shock esponse, hea shock p o eins, salmonids, clima e change, chape ones, empe a u e acclima ion Lewis e al. Hea Shock Response in Salmonids INTRODUCTION The egula ion o hea shock p o ein exp ession is one o he mos s udied sys ems o gene exp ession, and he unc ion and induc ion o hea shock p o eins has been e iewed in de ail om bo h basic and compa a i e angle (Lindquis and C aig, 1988; Fede and Ho mann, 1999; Basu e al., 2002; Rich e e al., 2010; Deane and Woo, 2011). Especially he ansc ip ional induc ion o hea shock genes has been ully cha ac e ized, and he ole o hea shock ac o s—p o o ypes o ansc ip ional ac i a o s— in he esponse has been de ailed (Lindquis , 1986; Mo imo o, 1993; Sis onen e al., 1994; P ahlad and Mo imo o, 2009). In compa ison, pos - ansc ip ional egula ion o hea shock p o ein p oduc ion has been li le s udied (Sil e and Noble, 2012), al hough i is clea ha i also con ibu es o he hsp le el a e apid empe a u e inc ease (Theodo akis and Mo imo o, 1987). Pa icula ly he s abili y o mRNAs o genes encoding inducible hea shock p o eins appea s e y empe a u e-sensi i e (Theodo akis and Mo imo o, 1987). On he basis o a ailable li e a u e, pos - ansc ip ional egula ion o he hea shock esponse plays a ole in hsp accumula ion in e eb a es (Sil e and Noble, 2012), e.g., a he high p essu e expe ienced by chond ocy es (Kaa ni an a e al., 1998) and in exe cise adap a ion (Melling e al., 2007). Fu he , di e ences be ween cell ypes wi h ega d o pos - ansc ip ional egula ion o he HSR in mammals ha e been epo ed (Kaa ni an a e al., 2002). In Xenopus oocy es hea shock p o ein p oduc ion is comple ely ansla ionally egula ed: upon adequa e inc ease in empe a u e, ep ession o hea shock p o ein p oduc ion is eleased, and p emade mRNA is ansla ed o hea shock p o ein (Bienz and Gu don, 1982). Uncoupling o he ansc ip ion o genes encoding hea shock p o eins and he ac ual p o ein p oduc ion has no been much s udied in ish. Howe e , wo s udies ha e shown ha such disconnec ion o mRNA and p o ein p oduc ion may ake place. Fi s , Lund e al. (2002) ha e obse ed ha in salmon a highe empe a u e seems o be equi ed o inducible hea shock p o ein p oduc ion han o he induc ion o mRNA p oduc ion om he hsp gene. Second, Ho mann e al. (2005), s udying wo New Zealand no o henioids Bo ich us a iega us Richa dson, 1846 and No o henia angus a a Hu on, 1875, showed ha in he o me species bo h he hsp and hsp mRNA p oduc ion inc eased in hea shock, whe eas in he la e only hsp mRNA p oduc ion inc eased. Fu he , e en in B. a iega us he empe a u e o hsp p o ein and mRNA induc ion may ha e been di e en . Tho ough unde s anding o he egula ion o he hea shock esponse in aqua ic poikilo he ms has become impe a i e wi h clima e change, since he empe a u e esponses o a species will a ec i s capabili y o acclima e o wa ming wa e . Also, inding esponses which change wi h small empe a u e inc ease a e mos aluable, as hey can show a pe u ba ion in he li ing condi ions o a species wi h likely occu ing nea - u u e condi ions. Al eady ea lie i has become clea ha acclima ion o di e en empe a u es a ec s bo h he empe a u e whe e he hea shock esponse is induced and whe e i is maximal (Die z and Some o, 1992), and ha phylogene ically ela ed o ganisms inhabi ing di e en empe a u es (e.g., in di e en idal zones in he same a ea) exhibi di e en induc ion empe a u es (Pod absky and Some o, 2004; Tomanek, 2010). We ha e s udied he hea shock esponse using wo phylogene ically ela ed salmonids, he A c ic cha (Sal elinus alpinus) and A lan ic salmon (Salmo sala m. sebago) wi h o e lapping dis ibu ions. The popula ions used in ou s udy o igina e om he same lake a ea. Bo h species inhabi A c ic a eas, whe e empe a u e inc ease has been g ea es in he ecen pas (e.g., Belkin, 2004; Wanishsakpong e al., 2016). Thus, he dis ibu ion o hese ish can be d as ically a ec ed by clima e change. No ably, he A c ic cha has become an impo an aquacul u e species, bu s a s o su e i he ea ing empe a u e exceeds 14◦C (Quinn e al., 2011). The acu e ole ance o A lan ic salmon and A c ic cha o empe a u e change (as measu ed by he loss o equilib ium wi h inc eased empe a u e) is di e en wi h lowe empe a u es ole a ed by cha (An ila e al., 2015). We s udied he inducible hsp70 gene, pa icula ly he one o which a speci ic an ibody is comme cially a ailable, as i has been commonly used in empe a u e s udies o salmonids (e.g., Lund e al., 2002), and since hsp70 mRNAs we e ea lie shown o inc ease mos when A c ic cha we e exposed o 15– 19◦C (Quinn e al., 2011). We hypo hesized ha he le els o hsp mRNAs and p o eins a e acclima ion o 8 and 15◦C o a mon h and he hea shock esponses o A c ic cha and A lan ic salmon a e di e en . We ocussed especially on he ques ion, i he induc ion o p o ein and mRNA p oduc ion o he hsp70 gene can occu a di e en empe a u es and be di e en in he wo species. This was done especially, since, al hough i is known ha he mRNA and p o ein p oduc ion o he genes a e o en uncoupled (e.g., Jayapal e al., 2008; Logan and Buckley, 2015), i is commonly conside ed ha in he case o hea shock p o eins de e mining only he mRNA le el su ices o conclude ha also he p o ein le el has inc eased (e.g., Deane and Woo, 2011) despi e he in o ma ion ha disconnec ion be ween he wo may occu (Lund e al., 2002; Ho mann e al., 2005). We u he p edic ed ha he di e ences be ween he species can be ela ed o hei ea lie de e mined empe a u e ole ance. As a consequence, he s udy o ms a basis o u he in es iga ions es ablishing he u ili y o hea shock esponse componen s in de e mining he posi ion o a salmonid in i s he mal ole ance window. Ea lie , he in e ac ions be ween he mal ole ance and hea shock esponse componen s in ish ha e mainly been s udied wi h Fundulus he e ocli us (e.g., Healy e al., 2010), and, o example, diu nal a ia ions in he inc ease o mRNA le el a e a sligh hea shock ha e been obse ed (Healy and Schul e, 2012). MATERIAL AND METHODS Expe imen al Animals, Acclima ion and Hea Shock P ocedu e The expe imen s we e conduc ed a he Na u al Resou ces Ins i u e Finland in Enonkoski, eas e n Finland, om 1s July o 10 h Augus 2013. All p ocedu es we e app o ed by he Finnish Animal Expe imen Boa d (ESAVI/4068/04.10.07/2013). A c ic cha and A lan ic salmon o igina ed om Lake Saimaa F on ie s in Physiology | www. on ie sin.o g 2No embe 2016 | Volume 7 | A icle 511 Lewis e al. Hea Shock Response in Salmonids (62◦04′N; 28◦33′E) and we e ea ed unde a na u al pho ope iod a he Na u al Resou ces Ins i u e Finland ha che y o 3 and 1 gene a ions, espec i ely. Ju enile (∼1-yea -old) cha and salmon we e kep sepa a ely in 320 L cylind ical (90 cm diame e ) anks wi h cons an ly lowing, il e ed, ae a ed, and empe a u e- con olled wa e om Lake Pahkajä i. A 100 ish pe ank o each species we e acclima ed o ei he 8◦C (body mass 26.6 ± 1.3 g and o k leng h 14.5 ±0.2 cm o cha and 22.8 ±0.6 g and 12.8 ±0.1 cm o salmon; mean ±SEM. a he end o acclima ion) o 15◦C (22.9 ±1 g and 13.8 ±0.2 cm o cha , and 27.5 ±1 g and 13.6 ±0.2 cm o salmon) o 4 weeks and ed comme cial ish pelle s (Raisio G oup, Finland) ad libi um. The 4-week acclima ion pe iod was conside ed o be adequa e o any acclima ion esponses o ake place, and is also close o he longes pe iod o ime ha he empe a u e can be expec ed o emain cons an in na u e. The pho ope iod was ∼17:7 L:D du ing sampling. Feeding was s opped 24 h p io o sampling and ish we e sac i iced in 200 ppm icaine me hanesul ona e (MS- 222, Sigma-Ald ich USA) bu e ed wi h sodium bica bona e. Fish mass and o k leng h we e measu ed be o e gills and li e issue we e excised and immedia ely ozen in liquid ni ogen. Fo y ish pe acclima ion g oup we e used o ob aining undis u bed alues, and o gans we e aken a 1, 8, 16, and 21 h a e he s a o he ligh pe iod, whe eby he las sample was aken in he da k pe iod. The hsp70 mRNA and p o ein alues we e de e mined om 7 o gans a e e y ime poin . The emaining 60 ish we e subjec ed o a non-le hal hea shock. The shock was o exac ly he same magni ude a bo h empe a u es and o bo h species. This ac ually makes he hea shock mo e obus o A c ic cha han o A lan ic salmon, since he CTmax o cha is 1–2◦C lowe o cha han o salmon: 26.7 ±0.07◦C and 27.6 ± 0.07◦C (SEM) in 8◦C acclima ed cha and salmon, espec i ely; 28.0 ±0.07◦C and 29.8 ±0.08◦C in 15◦C-acclima ed cha and salmon, espec i ely (An ila e al., 2015), Wa e empe a u e was con olled using a 2 kW wa e hea e (RC20 WGW Lauda, Ge many). Subme sible ai -pumps and wa e -pumps we e used o main ain oxygen sa u a ion and p e en s a i ica ion o wa e empe a u e, espec i ely. Because handling has been shown no o a ec he hea shock esponse (Vijayan e al., 1997), a he s a o he ligh pe iod he ish om each acclima ion g oup we e ans e ed o an expe imen al ank wi h wa e empe a u e 7◦C highe han he acclima ion empe a u e. Fish we e kep a he hea shock empe a u e o 30 min be o e being e u ned o he acclima ion anks o eco e y. The leng h o he hea shock and ollow-up pe iod we e chosen a bi a ily, bu i was checked ha hey we e adequa e o see a esponse bo h a mRNA and p o ein le el in cha . Since i is p obable ha he ul ima e signal o hsp p oduc ion is he amoun o mis olded p o ein, he magni ude o he esponse will be a ec ed by he ini ial empe a u e, he empe a u e change in he hea shock, and he leng h o he exposu e o inc eased empe a u e. Gills and li e issue (chosen o ep esen wo di e en issues, one in di ec con ac wi h he en i onmen and he o he being me abolically a e y ac i e one) we e subsequen ly excised a 1, 2, 4, 8, 16, and 24 h pos - hea shock and lash ozen in liquid ni ogen o downs eam analyses. We de e mined he mRNA le els using quan i a i e eal ime PCR and p o ein le els wi h wes e n blo ing om 7 ish pe ime poin . Gene Cloning, Sequence Valida ion and P ime Design P ime s used o ampli y salmonid inducible hsp70 we e designed based on alignmen s o se e al salmonid hsp70 mRNA sequences a ailable a NCBI (www.ncbi.nlm.nih.go ), wi h accession numbe s NM_001124228, NM_001124745 and AB062281.1 (Onco hynchus mykiss), KF783199.1 (Sal elinus on inalis), AJ632154.1 (Salmo sala ) and OTU35064 (Onco hynchus schawy scha). P ime s used o ampli y an 812 base-pai (bp) gene agmen o hsp70 in bo h cha and salmon a e: Fo —CCT CTACATTCATAAACTGCAACT, Re —CTGGCTGATGTC CTTCTTGTGT. To ensu e ha only he inducible hsp70 iso o m is ampli ied, a egion wi h su icien misma ch base-pai ings wi h S. sala hsc70 (BT059361) was selec ed o qPCR p ime design. P ime s o β-ac in we e designed based on mRNA sequences wi h accession numbe s AB196465.1 (O. mykiss), AB111057.1 (Onco hynchus ne ka), JR540730.1 (Sal elinus alpinus) and NM_001123525.1 (S. sala ). P ime s used o ampli y a 1128 bp gene agmen o β-ac in in bo h species a e: Fo —ATGGAAGAT GAAATCGCCGCAC, Re —TTAGAAGCATTTACGGTGGAC G. PCR p oduc s we e ob ained om cDNA e e se ansc ibed om 1 µg o al RNA ex ac ed om bo h species. RNA isola ion and cDNA syn hesis me hodology is de ailed in he succeeding sec ion. Ampli ica ion o he gene o in e es and e e ence gene was pe o med using a KAPA HiFi Ho S a PCR Ki (KAPA Biosys ems, USA) wi h he ollowing he mal cycling pa ame e s: 1 cycle o ini ial dena u a ion o 3 min a 95◦C, hen 30 cycles each o second dena u a ion a 98◦C o 20 s, annealing a 60◦C o 15 s and ex ension a 72◦C o 60 s/kb. PCR p oduc s we e size sepa a ed by elec opho esis in 1.5% aga ose gel s ained wi h e hidium b omide, ollowed by gel ex ac ion using a NucleoSpin gel and PCR clean up ki (Mache ey-Nagel, Ge many). Gene agmen s we e liga ed on o a pJET1.2/blun cloning ec o wi h a CloneJe PCR Cloning ki (The moScien i ic, USA), p opaga ed in CaCl2compe en DH5αE. coli and sc eened on LB-aga con aining ampicillin. Posi i e colonies we e selec ed o u he p opaga ion hen pu i ied wi h a NucleoSpin Plasmid EasyPu e Ki (Mache ey-Nagel, Ge many). Sequencing was pe o med on pu i ied plasmids a he Eu opean Cus om Sequencing Cen e (GATC Bio ech AG, Köln Ge many) and ob ained sequences (Hsp70—KU885452 o S. alpinus and KU885451 o S. sala ; β-ac in—KU885450 o S. alpinus and KU885449 o S. sala ) we e aligned and con i med wi h homologous sequences using NCBI BLAST. Phylogene ic analysis o he hsp70 sequences om cha and salmon, done acco ding o Me zge e al. (2016), con i med ha he cloned genes belong o he inducible hsp70 iso o ms, bu ou analysis could no di e en ia e be ween hsp70- 1and hsp70-2. Species and gene-speci ic Taqman qPCR p ime s and luo escence p obes we e designed using he Uni e sal P obe Lib a y Assay Design Cen e websi e (Roche Diagnos ics). Taqman p ime s (hsp70 Fo —AGCTAAAGGCCC GTCTATCG, Re —AACACCCCCACACAGGAGTA, P obe # 104 ca . no. 04692225001; Roche Diagnos ics); β-ac in Fo — CCAAAGCCAACAGGGAGA,Re —GTACATGGCAGGGGT GTTG o cha and Re —GTACATGGCGGGGGTGTTG o salmon, P obe # 115 ca .no. 04693493001; Roche Diagnos ics) we e designed o ampli y a 60–65 bp amplicon and a u he F on ie s in Physiology | www. on ie sin.o g 3No embe 2016 | Volume 7 | A icle 511 Lewis e al. Hea Shock Response in Salmonids alignmen o p obe # 104 wi h S. sala hsc70 was conduc ed o con i m ha he p obe did no bind o he ansc ip s o he cons i u i ely exp essed iso o m. All p ime s we e es ed o e iciency and ampli ica ion signals ob ained we e wi hin he quan i iable ange o p ime e iciencies (90–110%). Quan i a i e Real-Time PCR P ocedu e o hsp70 mRNA De e mina ion To al RNA was ex ac ed om issues using he guanidine iso hiocyana e me hod (Chomczynski and Sacchi, 1987) wi h TRI Reagen (Molecula Resea ch Cen e, USA), acco ding o he manu ac u e ’s ins uc ions wi h addi ional pu i ica ion s eps. F ozen issues we e placed in TRI Reagen and homogenized mechanically wi h a TissueLyse (Qiagen, USA) a 30 shakes/s o 2 min. Phase sepa a ion o RNA was pe o med using 1- b omo-3-chlo op opane, ollowed by isop opanol p ecipi a ion, washing wi h 75% e hanol, hen he RNA was dissol ed in RNase ee wa e . To emo e esidual genomic DNA con amina ion, DNase I (P omega, USA) was added (1 µg) in solu ion o an aliquo o RNA and incuba ed o 10 min a 37◦C, ollowed by ano he ound o phase sepa a ion, p ecipi a ion and washing. The pu i ied RNA was s o ed o e nigh a +4◦C in 75% e hanol o ensu e he ho ough emo al o po en ial con aminan s, hen cen i uged a 7500 RCF o 5 min, subsequen ly ai -d ied and e-dissol ed in RNase ee wa e . RNA concen a ion and pu i y we e measu ed using a Nanod op 2000 spec opho ome e (The moScien i ic, USA). Only samples wi h an A260/280 a io o ≥1.8 we e used in downs eam applica ions. RNA in eg i y was con i med by aga ose gel elec opho esis using sodium hypochlo i e as a dena u an , as desc ibed p e iously (A anda e al., 2012). An aliquo o RNA (600 ng) om each sample was mixed wi h 10X loading bu e (1.9 mM xylene cyanol, 1.5 mM b omophenol blue, 25% glyce ol) and pipe ed on o a gel comp ised o 1% aga ose, 1% comme cial bleach (Kiil o, Finland) con aining 6% sodium hypochlo i e and s ained wi h e hidium b omide. To es o genomic con amina ion, qPCR was pe o med wi hou e e se ansc ip ion on each RNA sample in iplica e in a inal eac ion olume o 10 µl pe well, including 2 ng o RNA, 0.3 µM o hsp70 o wa d and e e se p ime s, 0.1 µM o p obe # 104 and 5 µl 2X KAPA P obe Fas qPCR ki mas e mix (KAPA Biosys ems, USA). The mal cycling pa ame e s a e he same as in he qPCR me hodology de ailed in he succeeding sec ion. Samples which did no ampli y a e 40 cycles we e deemed ee o genomic DNA and samples which ampli ied we e e- ea ed wi h DNase I and pu i ied as desc ibed abo e. An aliquo o RNA (100 ng) om each sample was used o cDNA syn hesis using a PTC-150 MiniCycle (MJ Resea ch, USA), wi h a DyNAmo cDNA syn hesis ki (The moScien i ic, USA) acco ding o he manu ac u e ’s ins uc ions, in a inal eac ion olume o 20 µl inclusi e o andom hexame s, e e se ansc ip ion bu e wi h dNTP mix and MgCl2, M-MuLV RNase H+ e e se ansc ip ase and he ollowing he mal cycling pa ame e s: P ime ex ension a 25◦C o 10 min, cDNA syn hesis a 37◦C o 1 h and eac ion e mina ion a 85◦C o 5 min. Resul an cDNAs we e subsequen ly s o ed a −20◦C. qPCR was conduc ed using a 7900HT Fas Real-Time PCR Sys em (Applied Biosys ems, USA) o he undis u bed da a and Quan S udio 12K Flex Real Time PCR Sys em (Applied Biosys ems, USA) o he hea shock da a, in a inal eac ion olume o 10 µl, wi h 1 ng o cDNA, 0.3 µM o wa d and e e se p ime s, 0.1 µM p obe and 5 µl 2X KAPA P obe Fas qPCR mas e mix (KAPA Biosys ems, USA), wi h he ollowing he mal cycling pa ame e s: S age 1 (enzyme ac i a ion) a 50◦C o 2 min. S age 2 (dena u a ion) a 95◦C o 10 min, and 40 cycles o S age 3 a 95◦C o 15 s, hen 60◦C o 1 min (annealing and ex ension). Tempe a u e changes we e kep a a cons an 1.6◦C/s. Ta ge and e e ence gene eac ion quan i ies we e de e mined om a s anda d cu e gene a ed om a 1:2 (undis u bed) and a 1:5 (hea shocked) se ial dilu ion o andomly chosen and pooled samples, and hsp70 alues we e no malized o β- ac in o ob ain ela i e quan i ies. The sui abili y o β-ac in as a consis en house-keeping e e ence gene was de e mined using Bes Keepe (P a l e al., 2004). Because o he long s abili y and la ge amoun o p e iously p oduced β-ac in mRNA, ansc ip amoun s emained unchanged h oughou he s udy, e en hough i is likely ha he o ma ion o new mRNA a ies du ing he expe imen . In conclusion, he esul s gi e he ela i e quan i ies as he a io be ween hsp70 and β-ac in mRNA le els. Wes e n Blo ing o hsp70 De e mina ion F ozen issues we e weighed and homogenized in 5 olumes o lysis bu e (62.5 mM T is-HCl, 1µg/ml leupep in, peps a in, an ipain and 1mM PMSF) using a TissueLyse (Qiagen, USA) a 30 shakes/s o 2 min. Lysa es we e kep on ice o 30 min p io o +4◦C cen i uga ion a 10,000 RCF o 30 min and supe na an s o age a −80◦C. P o ein concen a ions we e de e mined using he B ad o d me hod (B ad o d, 1976) and a p o ein assay dye eagen (Bio-Rad, Ge many), wi h a se ial dilu ion o bo ine se um albumin (1 mg/ml) as a s anda d. Spec opho ome ic measu emen s we e pe o med a 595 nm using a Wallac EnVision 2103 Mul ilabel Reade (Pe kinElme , Finland). An equal amoun (20 µg) o p o ein pe sample was mixed wi h 5X Laemmli bu e (Laemmli, 1970) and dena u ed o 5 min a 95◦C, hen loaded on o an SDS-PAGE gel comp ised o 10% polyac ylamide. Gels we e placed in a Mini-P o ean 3 elec opho esis module (Bio-Rad, USA) and he p o eins sepa a ed by size, i s a 100 V o 30 min hen 150 V o 1 h. P o eins we e ans e ed on o a ni ocellulose memb ane (Pe kin Elme , USA) a 100 V o 1 h a +4◦C and incuba ed in PBS blocking solu ion con aining 3% non- a powde ed milk and 0.3% Tween o 1 h. Memb anes we e incuba ed o e nigh simul aneously wi h abbi polyclonal an i-salmonid inducible hsp70 (AS05061A) p ima y an ibody (1:10000) (Ag ise a, Sweden), and abbi polyclonal an i-β-ac in (ab8227) p ima y an ibody (1:5000) (Abcam, UK) in PBS-Tween wi h 3% milk a + 4◦C. The ea e , memb anes we e incuba ed in PBS-Tween wi h 3% milk wi h HRP-conjuga ed an i- abbi seconda y an ibody (1:2500) (Sigma-Ald ich, USA) o 1 h a oom empe a u e, hen washed and imme sed in Ame sham ECL P ime Wes e n Blo ing De ec ion Reagen (GE Heal hca e, UK), ollowed by exposu e o x- ay ilm. A sho exposu e (∼5 s) o β-ac in and F on ie s in Physiology | www. on ie sin.o g 4No embe 2016 | Volume 7 | A icle 511 Lewis e al. Hea Shock Response in Salmonids a longe exposu e (∼2 min) o hsp70 was used o acqui e a quan i iable signal in undis u bed ish, while a sho exposu e (∼5 s) was used o bo h β-ac in and hsp70 o hea shocked ish. Thus, he da a do no allow he absolu e le els o he wo p o eins o be compa ed, bu since all he expe imen al ime poin s we e ea ed simila ly, he da a enable no maliza ion. Densi ome y was pe o med using ImageJ 1.48 (NIH, USA) and ela i e quan i ies we e ob ained by no malizing hsp70 alues o β-ac in. The le els o β-ac in did no change signi ican ly o e ime and be ween ea men s in bo h species, hus con i ming i s sui abili y as a loading con ol and e e ence p o ein. Consequen ly, he esul s gi e he ela i e quan i ies as he a io be ween hsp70 and β-ac in bands. S a is ics I was ini ially es ed i ou da a we e no mally dis ibu ed (Shapi o-Wilk’s es ) and had equal a iances be ween g oups (B own-Fo sy he’s es ). Since he da a we e in mos cases no no mally dis ibu ed, we i s ied simple da a ans o ma ions (e.g., log ans o ma ion) o make he da a no mal. Howe e , his was no he case e en a e he ans o ma ion o mos g oups o da a. This p ecludes using mul i a ia e ANOVAs, which equi e no mal dis ibu ion. Consequen ly, ei he pa ame ic ANOVA o non-pa ame ic K uskal-Wallis es on anks was used on mRNA and p o ein le els sepa a ely, wi h ei he acclima ion empe a u e o ime as an independen ac o . We ollowed he sugges ed pos -hoc es ing gi en by Sigmaplo 13 (Holm-Sidak es o ANOVA, Dunn’s es o K uskal-Wallis on anks [[Figu es 2, 3]] o Dunne ’s [Figu es 5,6]) whene e signi ican e ec s we e iden i ied. In Figu e 1 he weigh s o he ish o each species we e sepa a ely compa ed a 8 and 15◦C using - es . Since no changes occu ed as a esul o he 7◦C empe a u e inc ease in cold-acclima ed specimens, he e ec o ime in he hea shock expe imen s was only es ed in wa m-acclima ed animals (The e was one excep ion o his gene aliza ion; he hsp70 le el in salmon gills was signi ican ly highe p io o hea shock han a subsequen ime poin s in cold-acclima ed specimens). SigmaPlo 13 (SyS a So wa e, USA) was used o s a is ical compa isons and p<0.05 was accep ed o indica e a s a is ically signi ican e ec . RESULTS Fo he s udies, we acclima ed A c ic cha and salmon o 8 and 15◦C o 4 weeks. Figu e 1 gi es he weigh s o he ish a e acclima ion. Eigh -deg ee-acclima ed cha we e hea ie han hose acclima ed o 15◦C, whe eas he opposi e was ue o salmon. Howe e , Ful on’s condi ion ac o (K=100 × weigh /leng h3) was essen ially independen o he acclima ion empe a u e wi h alues o 0.809 ±0.2 and 0.808 ±0.01 (SEM) o 8 and 15◦C-acclima ed cha , and 1.064 ±0.01 and 1.060 ± 0.01 o 8 and 15◦C-acclima ed salmon (N=100), espec i ely. Using species-speci ic inducible hsp70 p ime s and an an ibody ecognizing he inducible hsp70 in bo h species, o qPCR and immunoblo ing, espec i ely, we i s checked i he cons i u i e mRNA and p o ein exp ession a ied du ing he day. This was deemed o be impo an , as ligh hy hm a ia ions in FIGURE 1 | The body masses o A c ic cha and A lan ic salmon a e 1-mon h acclima ion o 8 o 15◦C. Be o e he pe iod o acclima ion he ish in each species we e held in one pa ch, so ha any di e ences e lec he e ec s o acclima ion pe iod. Th oughou acclima ion he ish we e ed daily ad libi um. The s a is ical signi icance o he di e ence in weigh be ween 8 and 15◦C-acclima ed ish was es ed wi h - es . p<0.05 was accep ed as a s a is ically signi ican e ec , indica ed wi h * in he igu e, mean ±SEM; N= 100. he A c ic a e p onounced, and ligh - empe a u e ela ionship will change as a consequence o clima e change. Fu he , s udies by Healy and Schul e (2012) ha e shown ha hsp70 le el can show ci cadian luc ua ions in Fundulus he e ocli us.Figu es 2, 3indica e ha nei he he hsp70 mRNA no he p o ein le els showed s ong ci cadian luc ua ions in ei he species, empe a u e o issue (li e o gills) wi h he used ligh hy hm and sampling p o ocol. The excep ion o his gene aliza ion is he mRNA le el in wa m-acclima ed salmon li e (H3=11.339, p=0.01). Howe e , he esul s show inc eased hsp70 mRNA (H1=29.598, p<0.001 and H1=7.222, p=0.007 o gills and li e , espec i ely) and p o ein le els (H1=15.726, p< 0.001 and H1=5.491, p=0.019 o gills and li e , espec i ely) in 15◦C-acclima ed cha as compa ed o 8◦C-acclima ed cha (Figu es 2,4). In con as , in salmon he hsp70 mRNA (H1= 4.129, p=0.042 and H1=23.846, p<0.001 o gills and li e , espec i ely) and p o ein le els (F1=19.921, p<0.001 and H1 =5.962, p=0.015 o gills and li e , espec i ely) we e highe a he lowe han a he highe acclima ion empe a u e (Figu es 3, 4). Fu he , i is possible ha he mRNA-p o ein exp ession ela ionship is di e en in he wo issues in salmon. To s udy he hea shock esponse, ish we e exposed o 30 min o a empe a u e 7◦C highe han he acclima ion empe a u e, whe ea e hey we e e u ned and he esponses ollowed a he acclima ion empe a u e. An acu e inc ease in empe a u e om 8 o 15◦C did no cause changes in ei he species in ei he mRNA o p o ein le els (Figu es 5,6). Howe e , when he empe a u e inc ease was om 15 o 22◦C, hsp70 mRNA inc eased d as ically in bo h species. P e-exposu e alues we e es o ed by 8 h a e he ish we e e u ned o he acclima ion empe a u e. The apid empe a u e-dependen ansc ip ional induc ion is he hallma k o he hea shock esponse (Lindquis , 1986). In con as , he hea F on ie s in Physiology | www. on ie sin.o g 5No embe 2016 | Volume 7 | A icle 511 Lewis e al. Hea Shock Response in Salmonids FIGURE 2 | Hsp70 mRNA and p o ein le els a di e en imes o he 24-h ligh /da k cycle in undis u bed A c ic cha . Rela i e quan i ies (mean ±SEM; n =7) a e gi en. Whene e ANOVA o K uskal-Wallis on anks [pa ame ic (p) o non-pa ame ic (n-p), espec i ely] indica ed s a is ically signi ican di e ences pos -hoc es ing (Holm-Sidak o Dunn’s me hod) was conduc ed. * indica es signi ican di e ences be ween acclima ion empe a u es a he same ime poin (p<0.05 was accep ed as s a is ically signi ican e ec ). The e we e no signi ican di e ences be ween ime poin s wi hin an acclima ion empe a u e. Da k pe iod is indica ed by g ay shading. shock p o ein esponse was ma kedly di e en in he wo species. A c ic cha showed he adi ional pa e n, whe e ansc ip ional induc ion was ollowed by p o ein p oduc ion (Figu e 5). The speed o p o ein accumula ion was ma kedly di e en in li e and gills. Thus, in li e , he majo de oxi ying issue (Hin on e al., 2008), he highes hsp70 le el was eached al eady 2 h a e he hea shock, whe eas in gills he highes p o ein le el was seen a e 16 h (Figu e 5). Con e sely, in he 15◦C-acclima ed salmon subjec ed o a 7◦C empe a u e inc ease hsp70 did no accumula e despi e ansc ip ional induc ion (Figu e 6). DISCUSSION The majo inding o he p esen s udy was ha despi e he inc ease o hsp70 mRNA he p o ein le el did no inc ease in he 15◦C-acclima ed salmon. This esul indica es ha he e a e condi ions when he no ion ha an inc ease in hsp mRNA indica es ha also hsp inc eases in ish does no hold, a inding ex ending om hose o Lund e al. (2002) and Ho mann e al. (2005). Ea lie , i has been shown o Xenopus oocy es ha he p oduc ion o hsp mRNA and p o ein a e uncoupled (Bienz and Gu don, 1982), he hea shock esponse being egula ed ansla ionally ( he hea shock esponse in ol es an inc ease in hea shock p o ein le el bu no change in mRNA). Ou esul gi es a new dimension o he o e all egula ion o he hea shock esponse. While in bo h cha and salmon he hea shock gene is clea ly ansc ip ionally egula ed, as shown by he inc ease in mRNA in bo h species, he hsp le el need no inc ease, as he esul wi h salmon indica es. Na u ally, ou esul s a e es ic ed o he induc ion ime (30 min), and he ollowing ollow-up ime (24 h). We canno be ce ain ha inc easing he leng h o ei he would no be seen as inc eased p o ein p oduc ion in salmon. Howe e , we conside i imp obable ha inc easing he ollow-up ime would ha e esul ed in inc eased hsp70 le el, as a signi ican p o ein le el change occu ed in 2 h in cha li e bu no a e F on ie s in Physiology | www. on ie sin.o g 6No embe 2016 | Volume 7 | A icle 511 Lewis e al. Hea Shock Response in Salmonids FIGURE 3 | Hsp70 mRNA and p o ein le els a di e en imes o he 24-h ligh /da k cycle in undis u bed A lan ic salmon. Rela i e quan i ies (mean ± SEM; n=7) a e gi en. Whene e ANOVA o K uskal-Wallis on anks [pa ame ic (p) o non-pa ame ic (n-p), espec i ely] indica ed s a is ically signi ican di e ences pos -hoc es ing (Holm-Sidak o Dunn’s me hod) was conduc ed. *indica es signi ican di e ences be ween acclima ion empe a u es a he same ime poin , and di e en le e s indica e ha he means in hose ime poin s di e om each o he (p<0.05 was accep ed as s a is ically signi ican e ec ). Da k pe iod is indica ed by g ay shading. 24 h in salmon li e . In con as , i is possible ha inc easing he leng h o exposu e could ha e caused he salmon hsp70 le el o inc ease, as he signal o hsp accumula ion is mos likely he amoun o mis olded p o ein, which inc eases wi h ime. The abo e conclusion also depends c i ically on whe he he p o ein ecognized by he an ibody is inducible in bo h cha and salmon. This is mos p obable as he an ibody used has ea lie success ully been used o p obe inducible hsp70 le el in salmon (Tunnah e al., 2016), whe e he inc ease o p o ein le el was no obse ed in he p esen s udy. In addi ion, he an ibody has success ully been used o documen hsp70 induc ion in he cen al mudminnow (Umb a limi) (Cu ie e al., 2010). I should be no ed ha a leas in insec s he p oduc ion o hea shock p o ein is ela ed o he s eady-s a e ( es ing) le el o he p o ein: i he es ing le el is high, hsp p oduc ion may no ake place (Za sepina e al., 2016). The ques ion is hen why he e should be such a p e en ion o hea shock p o ein p oduc ion. The eason may be ela ed o he ac ha du ing hea shock only hea shock p o eins a e ansla ed, wi h hei p e e en ial ansla ion going on upon eco e y om hea shock (S o i e al., 1980). The ansla ion o o he p o eins g adually inc eases du ing eco e y. Depending on he se e i y o shock he hea shock p o ein p oduc ion can be sho - e m o sus ained (Gedamu e al., 1983). I only hea shock p o eins can be p oduced ins ead o o he needed p o eins, a se ious cos is incu ed. Such a cos would no ake place i he p oduc ion o hea shock p o eins did no occu . The ollowing wo easons ha e been ea lie sugges ed as possible easons why hea shock p o eins a e no always p oduced abundan ly: i s , in la ge amoun s hsps migh dis u b he no mal cellula /o ganismal unc ions, o , second, he p oduc ion and deg ada ion o hsps could cause in ole able inc ease in cellula ene gy consump ion F on ie s in Physiology | www. on ie sin.o g 7No embe 2016 | Volume 7 | A icle 511 Lewis e al. Hea Shock Response in Salmonids FIGURE 4 | Hsp70 mRNA and p o ein le els o undis u bed A c ic cha and A lan ic salmon a e 1-mon h acclima ion o 8 o 15◦C in gills and li e . Rela i e quan i ies a e gi en. The igu e ep oduces da a o Figu es 2,3 o gi ing he eade a clea pic u e how hsp70 mRNA and p o ein changes be ween acclima ion empe a u es in he wo species and issues (gills o li e ). FIGURE 5 | Time cou se o hea shock induced hsp70 mRNA and p o ein syn hesis in A c ic cha . Rela i e quan i ies (mean ±SEM; n=7) in (A) gills and (B) li e . Rela i e quan i ies o hsp70 a e based on hsp/β-ac in a ios in he wes e n blo s. Rep esen a i e examples o wes e n blo s o gills a e gi en in (C) and li e in (D). Whene e ANOVA o K uskal-Wallis on anks [pa ame ic (p) o non-pa ame ic (n-p), espec i ely] indica ed s a is ically signi ican di e ences pos -hoc es ing (Dunne ’s me hod) was conduc ed. A le e abo e a symbol indica es ha he le els a ha ime poin a e signi ican ly di e en om le els be o e he hea shock (p< 0.05). (Fede and Ho mann, 1999). The ac ha he hea shock esponse is o en absen in ea ly de elopmen o o ganisms wi h o he wise p onounced p o ein syn hesis ( e iewed in Fede and Ho mann, 1999), (e.g., ansc ip ional induc ion o hsp70 gene does no occu in ea ly de elopmen o Xenopus;Heikkila e al., 1987), sugges s ha he compe i ion o ansla ion may be a signi ican eason o p e en ing hea shock p o ein p oduc ion. Ou esul s add o he possibili ies o egula ing he hea shock esponse u ilizing hsp70 a di e en le els. Fi s , he ansc ip ional induc ion empe a u e o he genes encoding hea shock p o eins di e s be ween species and popula ions (Fede and Ho mann, 1999; Buckley and Ho mann, 2004), and is also a ec ed by he acclima ion empe a u e o he o ganisms (Tomanek and Some o, 1999, 2002; Pod absky and Some o, F on ie s in Physiology | www. on ie sin.o g 8No embe 2016 | Volume 7 | A icle 511 Lewis e al. Hea Shock Response in Salmonids FIGURE 6 | Time cou se o hea shock induced hsp70 mRNA and p o ein syn hesis in A lan ic salmon. Rela i e quan i ies (mean ±SEM, n=7) in (A) gills and (B) li e . Rela i e quan i ies o hsp70 a e based on hsp/β-ac in a ios in he wes e n blo s. Rep esen a i e examples o wes e n blo s o gills a e gi en in (C) and li e in (D). Whene e ANOVA o K uskal-Wallis on anks [pa ame ic (p) o non-pa ame ic (n-p), espec i ely] indica ed s a is ically signi ican di e ences pos -hoc es ing (Dunne ’s me hod) was conduc ed. A le e abo e a symbol indica es ha he alues a ha ime poin a e signi ican ly di e en om he alues be o e he hea shock. *abo e he symbol in he hsp70 da a o gills indica es he one signi ican di e ence ound in cold-acclima ed ish (p<0.05). 2004) wi h he comple e lack o induc ion in some s eno he mal o ganisms (Tomanek, 2010). Second, he e a e clea ly se e al di e en p o eins in he hsp70 amily, which may ha e di e en ansc ip ional induc ion empe a u es. Such a si ua ion can be he basis o popula ion di e ences in he induc ion o he esponse (Fangue e al., 2006). Ou inding shows ha he hea shock p o ein syn hesis can also be con olled pos - ansc ip ionally in ish. He e one has o no e ha he wo k was done e y close o he empe a u e whe e he mRNA induc ion in A lan ic salmon is obse ed (see Lund e al., 2002), bu much abo e he empe a u e equi ed o mRNA accumula ion in cha (Quinn e al., 2011). Consequen ly, he esul s canno indica e wha he empe a u e di e ence be ween ha ing bo h he hsp70 mRNA and p o ein accumula e, o ha ing only he mRNA le el o inc ease is. The esul s hus indica e an ob ious se o u u e expe imen s: ca ying ou acclima ion o a species in a se o empe a u es wi h consequen empe a u e inc eases o di e en magni udes and di e en leng hs. Based on ou esul s we p edic ha (1) a gi en inc ease in empe a u e causes nei he ansc ip ional no ansla ional induc ion o he hea shock gene a low acclima ion empe a u e. (2) Wi h an inc ease in empe a u e, he hea shock genes a e i s induced ansc ip ionally bu no ansla ionally. (3) When he acclima ion empe a u e is high enough, bo h ansc ip ional and ansla ional induc ion occu . The empe a u e di e ence be ween possibili ies 2 and 3 is e y in e es ing, as i a ec s he signi icance and use o he esponse. I he di e ence is species-dependen , la ge in some and small in o he s, a signi ican impo ance o i being an impo an s ep in he egula ion o he hea shock esponse can be a ached. I he empe a u e di e ence be ween 2 and 3 is na ow in all species, hen he esponse can be used o p obe i small inc eases in en i onmen al empe a u es ha e an e ec on ish. The esul s o he p esen s udy also show a clea ime lag be ween ansc ip ional induc ion and p o ein p oduc ion. The ime lag has been expe imen ally shown (Buckley e al., 2006), bu is inadequa ely cha ac e ized and aken in o accoun (Logan and Buckley, 2015). Fo example, wi h ci cadian changes o p o ein le els he ele an ansc ip ion mus ake place se e al hou s be o e he maximal amoun o p o ein is equi ed. This means ha he cue o inc eased ansc ip ion canno be he same as he eason o maximal p o ein le el in he ci cadian cycle. Ou esul s also indica e ha he ime lag be ween ansc ip ion and ansla ion is, no su p isingly, cell ype-speci ic. The simples explana ion o his is ha he a ailabili y o ibosomes is he limi ing ac o and he ime lag is sho es in cells wi h high p obabili y o inducible p o ein p oduc ion such as hepa ocy es wi h hei inducible de oxi ica ion machine y (Hin on e al., 2008). Fu he , he ype o ansla ed p o ein will a ec he ime lag. Wi h ega d o inducible hea shock p o eins, he ime lag is excep ionally sho , which was hough o be due o hem lacking in ons (Molina e al., 2000). Howe e , al hough mammalian and D osophila hsp genes lack in ons, hey a e p esen in ish genes (Me zge e al., 2016). In an a emp o explaining he di e ence be ween he esponses o he wo species, he body mass da a a e use ul. Since F on ie s in Physiology | www. on ie sin.o g 9No embe 2016 | Volume 7 | A icle 511