Ad ances in Mic obiology, 2014, 4, 996-1016
Published Online Oc obe 2014 in SciRes. h p://www.sci p.o g/jou nal/aim
h p://dx.doi.o g/10.4236/aim.2014.414111
How o ci e his pape : Kahala, M., Ahola, V., Mäkima ila, E., Paulin, L. and Jou sjoki, V. (2014) The Use o Mac oa ay as a
Simple Tool o Follow he Me abolic P o ile o Lac obacillus plan a um du ing Fe men a ion. Ad ances in Mic obiology, 4,
996-1016. h p://dx.doi.o g/10.4236/aim.2014.414111
The Use o Mac oa ay as a Simple Tool
o Follow he Me abolic P o ile o
Lac obacillus plan a um du ing
Fe men a ion
Minna Kahala1, Vi pi Ahola2, Elina Mäkima ila1, La s Paulin3, Vesa Jou sjoki1
1Bio echnology and Food Resea ch, MTT Ag i ood Resea ch Finland, Jokioinen, Finland
2Depa men o Biosciences, Uni e si y o Helsinki, Helsinki, Finland
3Ins i u e o Bio echnology, Uni e si y o Helsinki, Helsinki, Finland
Email: [email p o ec ed]
Recei ed 25 June 2014; e ised 11 July 2014; accep ed 16 Augus 2014
Copy igh © 2014 by au ho s and Scien i ic Resea ch Publishing Inc.
This wo k is licensed unde he C ea i e Commons A ibu ion In e na ional License (CC BY).
h p://c ea i ecommons.o g/licenses/by/4.0/
Abs ac
This s udy ocused on de ining he di e ences in L. plan a um gene exp ession le els in di e en
media and in di e en g ow h phases using an easy and cos -e icien moni o ing o gene exp es-
sion. A mac oa ay based on a g oup o selec ed L. plan a um genes, 178 genes belonging o 18
main g oups, p in ed on o a ni ocellulose il e was designed in his wo k. Using he mac o il e s
designed, he exp ession o a selec ed se o L. plan a um genes was assayed in syn he ic MRS me-
dium and in ex ac ed ca o juice. To compa e he po en ial di e ences o s a e gene exp es-
sion in hygienic and con amina ed cul i a ion media, he L. plan a um s ain was cul i a ed in
bo h s e ile and con amina ed (yeas and Esche ichia coli) MRS and ca o juice. The numbe o
genes ound o be egula ed as a unc ion o g ow h was clea ly highe in MRS-based g ow h me-
dium han in ca o juice, In ca o juice, exp ession o he gene encoding malolac ic enzyme
(MLE), which makes L. plan a um an ad an ageous mic obe in e.g. wine making, was ound o be
up egula ed in loga i hmic phase o g ow h. The cu en s udy demons a ed ha mac oa ays
p in ed on ni ocellulose il e s wi h simple obo ic sys ems can be analyzed by s anda d labo a-
o y equipmen and me hods usually a ailable in molecula labo a o ies. Using his echnology,
apid and cos -e icien analysis o genome unc ion o L. plan a um can be ca ied ou e.g. in de-
eloping egions, whe e lac ic acid e men a ion o ood and eed ma ices is a common p ac ice.
Keywo ds
Mac oa ay, Gene Exp ession, L. plan a um
M. Kahala e al.
997
1. In oduc ion
Lac ic acid bac e ia (LAB) a e widely used o he p ese a ion o ood and eed aw ma e ials and o in ensi y
he la ou and ex u e o e men ed p oduc s. O he lac obacilli commonly used in ood p ocesses, Lac obacil-
lus plan a um is impo an in he p oduc ion o many e men ed oods o bo h plan (pickled ege ables, silage,
sou dough) and animal (d y e men sausages, e men ed ish, cheese) o igin [1]. This e sa ili y and ecological
lexibili y is mos likely associa ed wi h he genome size o L. plan a um, which is one o he la ges known
among LAB [2]. Based on comple e genome sequencing, L. plan a um has a capaci y o use a la ge a ie y o
ca bon sou ces and encompasses a ela i ely high numbe o egula o y unc ions concen a ed wi hin a de ined
genomic egion, which was designa ed he li es yle adap a ion egion [3]. These genomic ea u es exhibi an e -
icien adap a ion capaci y o L. plan a um o e sa ile en i onmen al condi ions.
Due o he abili y o main ain pH homeos asis a low ex e nal pH, L. plan a um is ole an o acidic en i on-
men and o en becomes he dominan LAB a he end o spon aneous ege able e men a ion [4]. The e o e, his
species is common in ege able and silage e men a ions. Ye , spon aneous e men a ion is gene ally poo ly con-
olled and uns able, and he quali y o p oduc s a ies depending on e men ed ma e ial and inhe en mic obio a.
Spon aneously e men ed ege ables may also con ain among o he hings biogenic amines, which ha e been asso-
cia ed wi h ce ain oxicological cha ac e is ics and ou b eaks o ood poisoning. The o ma ion o biogenic amines
has been ep essed by he use o a pu e L. plan a um s a e ins ead o spon aneous e men a ion [5]. Fo he abo e
easons, well-cha ac e ized s a e cul u es wi h desi able p ope ies would be o pa icula impo ance.
P e iously, he echnological p ope ies o po en ial s a e LAB could be de e mined almos exclusi ely in
pilo - and ull-scale ood and eed p oduc ion expe imen s. Today, he de elopmen o molecula echniques has
made possible he exploi a ion o genomic and p o eomic da a o he obse a ion o po en ial geno ypic and
pheno ypic di e ences be ween indi idual s ains in speci ic g ow h condi ions. S udies based on L. plan a um
DNA-mic oa ays [6], p o eomic pa e ns [7]-[10] and sequencing echnologies, like me agenomic sequencing
and RNAseq [11]-[13] and ansc ip ional p o iling [14]-[17] ha e been ca ied ou o elucida e s ain-speci ic
di e ences in genome composi ion and adap a ion o a ious g ow h condi ions.
Bo h mic oa ay and p o eomic s udies equi e speci ic labo a o y acili ies and expe ise, which may no be
a ailable in all esea ch labo a o ies. Ye , L. plan a um is used wo ldwide o ood and eed e men a ions and
he e is a g owing demand o he design o s a e cul u es wi h well-cha ac e ized echnological p ope ies. Fo
easy and cos -e icien moni o ing o gene exp ession in L. plan a um, a mac oa ay based on a g oup o se-
lec ed L. plan a um genes p in ed on o a ni ocellulose il e was designed in his wo k. Using he mac o il e s
designed, he exp ession o a selec ed se o L. plan a um genes was assayed in syn he ic MRS medium and in
ex ac ed ca o juice. To compa e he po en ial di e ences o s a e gene exp ession in hygienic and con ami-
na ed cul i a ion media, he s udied L. plan a um s ain was cul i a ed in bo h s e ile and con amina ed (yeas
and Esche ichia coli) MRS and ca o juice.
2. Ma e ials and Me hods
2.1. Bac e ial S ains and G ow h Condi ions
L. plan a um s ain MLBPL1 has been isola ed om saue k au [18] [19]. The s ain was ou inely g own in mi-
c oae ophilic condi ions a 32˚C and main ained in MRS b o h (Di co, BD, F anklin Lakes, NJ, USA). Fo pla -
ing, MRS was solidi ied wi h 1.5% aga . E. coli DH5
α
, ca ying he plasmid ec o pBluesc ip , was g own in
Lu ia Be ani b o h supplemen ed wi h ampicillin (50 µg/ml) as a selec i e agen a 37˚C 200 pm. Fo con-
amina ion cul i a ions, a yeas and an E. coli s ain o igina ing om spoiled ege ables we e p opaga ed in
YGC b o h a 30˚C and in Lu ia Be ani b o h a 37˚C, espec i ely.
Fo mac oa ay analyses, L. plan a um s ain MLBPL1 was g own in syn he ic medium MRS and ca o juice.
To simula e con amina ed g ow h condi ions, he spoiling E. coli and yeas s ains we e inocula ed in o MRS
and ca o juice. Cul i a ions we e pe o med using Spec a/Po Floa -A-Lyze dialysis ube (MWCO 100 kDa,
Spec um Labo a o ies, Rancho Dominguez, CA, USA) in o de o make i easie o sepa a e he L. plan a um
cells, he ege able ma ix and he spoiling s ains o yeas and E. coli. By using he dialysis ube, no il e ing o
plan ma e ial was needed and in addi ion, he cells o con amina ing s ains didn’ in e e e wi h he ex ac ion
o RNA. Ca o juice was p epa ed om esh ege ables wi h a juice ex ac o . The ex ac ed juice was cen i-
uged a 18,500 g o 40 min and pas eu ized in a wa e ba h a 95˚C o 30 min.
An o e nigh cul u e o MLBPL1, g own in MRS-medium a 32˚C, was used o inocula e MRS b o h and
M. Kahala e al.
998
ca o juice. Fo MRS cul i a ion, a 1% inoculumn was used. Fo ca o juice cul i a ion and con amina ion cul-
i a ions, he inoculumn was cen i uged a 13,000 g o 3 min and he pelle was suspended in o cen i uged
(18,500 g o 40 min) and il e -s e ilized (0.8/0.2 µm po e sizes) ca o juice (ca o cul i a ions) o MRS b o h
(MRS con amina ion cul i a ion), a e which he suspension was ans e ed o a Spec a/Po Floa -A-Lyze dia-
lysis ube. The ube was hen ans e ed o a bo le con aining ca o juice, con amina ed MRS b o h o con-
amina ed ca o juice. In con amina ion cul i a ions, MRS b o h and ca o juice we e con amina ed by inocu-
la ing hem wi h 1% E. coli and yeas . The cul i a ions we e pe o med a 32˚C. The g ow h was de e mined by
pla ing on o MRS aga pla es app op ia e dilu ions om he samples aken du ing he g ow h. The pla es we e
incuba ed a 32˚C o 48 h, un il single bac e ial colonies appea ed.
2.2. Ex ac ion and Labeling o RNA
Bac e ial cells o he L. plan a um s ain MLBPL1 g own in MRS b o h and ca o juice we e ha es ed a ex-
ponen ial (6 h) and s a iona y phase (14 h) o g ow h by cen i uga ion o 3 min a 4˚C a 11,000 g. The col-
lec ed cells we e ozen immedia ely in liquid ni ogen and s o ed a −70˚C. Ex ac ion o o al RNA was ca ied
ou wi h SV o al RNA isola ion sys em (P omega, Madison, WI, USA) wi h some modi ica ions o he p o ocol
on he dis up ion o he cells. B ie ly, bac e ial cells hawed slowly on ice we e i s washed wi h s e ile wa e
ea ed wi h die hyl py oca bona e (DEPC) and collec ed by cen i uga ion. Nex , he pelle was esuspended
in o 225 µl o SV RNA lysis bu e o he P omega ki and ans e ed o an eppendo ube con aining 100 µl o
ni ic acid-washed glass beads. The cells we e dis up ed wi h glass beads in a cell homogenize as desc ibed be-
o e (Kahala, e al., 2008). A e ha , he lysa e was ans e ed o a new ube and 350 µl o SV RNA dilu ion
bu e o he P omega ki was added pe 175 µl o lysa e. F om his s ep on, he ex ac ion was ca ied on as
ecommended by he manu ac u e . Two echnical duplica es om he RNA ex ac ion on each cul u e medium
and ha es ing poin we e made. mRNA was en iched om o al RNA samples by emo ing he 16S and 23S
RNAs wi h MICROB Exp ess Bac e ial mRNA Pu i ica ion ki (Ambion, Aus in, TX, USA) acco ding o he
ins uc ions o he manu ac u e . The RNA concen a ion was de e mined spec opho ome ically a 260 nm.
The in eg i y o he isola ed p oka yo ic RNA was de e mined by o al RNA gel elec opho esis and No he n
blo ca ied ou as desc ibed by [20]. To al RNA samples, dena u ed wi h glyoxal and dime hylsulphoxide, we e
sepa a ed by size in a 1.0% (w/ ) aga ose gel in 10 mM sodium phospha e bu e , pH 6.5 ollowed by a ans e
o a posi i ely cha ged nylon memb ane (Roche) and hyb idiza ion wi h a ldhD-speci ic 736 bp p obe, ampli ied
wi h p ime pai 5’-AAGTTAGCCGACGAAGGG-3’ and 5’-CCATGTTGTGAACGGCAG-3’ a ge ed o L.
plan a um s ain D90339.1. The p obe was labelled wi h digoxigenin-dUTP acco ding o he ins uc ions o he
manu ac u e (Roche). Luminescen DIG de ec ion ki (Roche) was used o hyb id de ec ion. To de ec he po-
en ial esidual ch omosomal DNA in he isola ed mRNA sample, p ime s 5’-AAGTTAGCCGACGAAGGG-3’
and 5’-GGGCGTATAATTCGTCCAAA-3’ designed o p oduce a 403 bp agmen om he a ge ldhD gene
o L. plan a um s ain D90339.1 we e used. PCR-p ocedu e using Dynazyme II DNA polyme ase (Finnzymes,
Espoo, Finland) was ca ied ou in he eac ion condi ions ecommended by he enzyme manu ac u e .
cDNA was syn hesized by RT om DNA- ee mRNA and cDNA labelling was pe o med wi h an alkalilabile
digoxigenin-11-dUTP (DIG) (Roche, Basel, Swi ze land) in a e e se ansc ip ion eac ion wi h Im-P om-II
Re e se T ansc ip ion Sys em ki (P omega) as ollows: 1 µg o mRNA was mixed wi h 0.5 µg o andom
hexame p ime s p o ided by he ki manu ac u e . The mix u e was hea ed a 70˚C o 5 min and chilled on ice
o 5 min. cDNA syn hesis was ca ied ou by combining RNA-p ime mix u e wi h 1 × ImP om-II eac ion
bu e , 5 mM MgCl2, 0.5 mM dATP, 0.5 mM dGTP, 0.5 mM dCTP, 0.325 mM dTTP, 0.175 mM DIG-11-
dUTP, 1 U/µl RNasin Ribonuclease Inhibi o , and 1 µl ImP om-II Re e se T ansc ip ase. Annealing was pe -
o med a 25˚C o 5 min, ollowed by ex ension a 43˚C o 1h and enzyme inac i a ion a 70˚C o 15 min. The
labeled cDNA was pu i ied wi h Mic oa ay Ta ge Pu i ica ion ki (Roche) acco ding o he ins uc ions o he
manu ac u e .
2.3. PCR and Labeling o he Posi i e Con ol o Mac oa ay
Human-based HbGAM (hepa in-binding g ow h-associa ed molecule) gene [21] inse ed in o he plasmid
pBluesc ip (Agilen Technologies, San a Cla a, CA) was ampli ied wi h polyme ase chain eac ion (PCR) o be
used as a posi i e con ol in mac oa ay analyses. PCR eac ions we e ca ied ou wi h Dynazyme II DNA po-
lyme ase (Finnzymes, Espoo, Finland) using he eac ion condi ions ecommended by he manu ac u e . Bac e-
M. Kahala e al.
999
ial lysa e o he E. coli s ain DH5α, ha bou ing he ecombinan pBluesc ip -HbGAM plasmid o be used as a
empla e o PCR, was ob ained by dis up ing he cells wi h glass beads. To ampli y he HbGAM gene, he p i-
me pai 5’-GTAAAACGACGGCCAG-3’ and 5’-CAGGAAACAGCTATGAC-3’ a ge ing he plasmid was
used. The ampli ied PCR p oduc was pu i ied wi h Wiza d® SV Gel and PCR Clean-Up Sys em (P omega) and
labelled wi h DIG-11-dUTP using DIG-High P ime labeling ki (Roche).
2.4. Ampli ica ion o L. plan a um MLBPL1 Genes and Mac oa ay P in ing
P ime s we e designed o he ampli ica ion o selec ed genes om he ully sequenced genome o L. plan a um
WCFS1 [3]. The gene lis and designed p ime s a e lis ed in Supplemen 1. To enable an easy e-ampli ica ion
o he PCR-p oduc s, uni e sal nucleo ide sequences we e added o he 5’ e mini o he speci ic o wa d and
e e se p ime s. A nucleo ide sequence 5’ CCGCTGCTAGGCGCGCCGTG was added o he o wa d p ime s
and, espec i ely, a nucleo ide sequence 5’ GCAGGGATGCGGCCGCTGAC was added o he e e se p ime s.
Ampli ica ion o he selec ed genes was done as desc ibed o he posi i e con ol o mac oa ay. Fo he PCR
eac ion, a 10 pmol p ime concen a ion and 20 ng o co esponding genomic empla e DNA we e used in a 100
µl eac ion olume in a 96 well PCR pla e. The success o he PCR ampli ica ion was checked by analyzing 5 µl
om he eac ions on a 1% aga ose gel. The ob ained PCR p oduc s we e pu i ied using Mon age PCR Pu i ica-
ion 96 Well Pla es (Millipo e).
PCR agmen s in he 96 well pla es we e ans e ed o 384 pla es o p in ing on he ni ocellulose mac oa -
ay (Supplemen 2). Pu i ied PCR agmen s we e g idded in duplica e on ni ocellulose memb anes wi h a
QPix au oma ed colony picke (Gene ix L d., UK) using a 384-pin g idding head as desc ibed in [22].
2.5. Hyb idiza ion and De ec ion
Mac oa ays we e p ehyb idized o 2 h a 60˚C wi h 20 ml o DIG Easy Hyb bu e (Roche). Hyb idiza ions
we e pe o med o e nigh a 60˚C wi h 6 ml DIG Easy Hyb bu e (Roche) con aining 5 µl o labeled cDNA
p obe and HbGAM which was used as a posi i e con ol in hyb idiza ion eac ions. A e hyb idiza ion,
mac oa ays we e washed wice a oom empe a u e o 5 min wi h washing solu ion con aining 2 × SSC (1 ×
SSC is 0.15 M NaCl and 15 mM sodium ci a e) and 0.1% sodium dodecyl sulpha e (SDS) and wice a 68˚C
o 15 min wi h washing solu ion (0.1 × SSC, 0.1% SDS). Hyb idized spo s we e de ec ed wi h chemilumi-
nesence-based DIG de ec ion ki (Roche) using CDP-S a (Roche) as a subs a e and chemiluminescence
p oduced was de ec ed by Fluo Chem (Alpha Inno ech Co p., San Leand o, CA) gel image sys em. Fo e-
p obing, he DIG-labelled p obe was emo ed wi h a ollowing p ocedu e. The memb ane was insed ho -
oughly in s e ile wa e , washed wice wi h 0.2 M NaOH con aining 0.1% SDS a 37˚C o 20 min and insed
wi h 2 × SSC o 5 min.
2.6. S a is ical Me hods
The DNA p obes spo ed on he mac oa ay we e selec ed using esul s om he p e ious p o eomics esul s us-
ing 2-DE and HPLC-ESI-MS/MS [8]. Addi ionally, compu a ionally p edic ed exp ession alues we e used o
choosing he emaining p obes. Codon usage di e ences (codon bias) we e used o p edic ing gene exp ession
le els o all 3009 genes o L. plan a um (C) [3], and he se o 63 genes encoding ibosomal p o eins (RB).
Codon bias o a gene g wi h espec o gene se G was calcula ed by he o mula
( )
( ) ( ) ( )
( )
,,
,, ,,
a xyz a
BgG pag xyz gxyz
=

= −



∑∑
(1)
whe e (x,y,z) deno es a no malized equency o he codon iple (x,y,z) coding o an amino acid a in a gene g,
g(x,y,z) deno es he equency o he codon iple (x,y,z) in he gene se G, and pa(g) is he ac ion o he amino
acid a in he gene g [23].
The gene g was p edic ed as highly exp essed i he ela i e codon bias
( )
( )
B gC
RCB B g RB
=
(2)
exceeded 1.05. The genes ob aining he g ea es RCB alues we e chosen o he DNA mac oa ay il e in addi-
M. Kahala e al.
1000
ion o hose iden i ied by he HPLC-ESI-MS/MS.
A e scanning o he mac oa ay images, he quan i ica ion o he hyb idized signals and backg ound sub-
ac ion we e done by he TIGR Spo inde image p ocessing so wa e [24]. A e quan i ica ion and backg ound
co ec ion, he signals we e no malized using median a ay in ensi ies. Finally, he exp ession le els o each
gene and sample was ob ained by aking median o he no malized in ensi y alues ac oss he wo eplica es o
each sample. Gene exp ession le els we e compa ed be ween MRS, ca o juice and con amina ed e sions o
he g ow h media in exponen ial (6 h) and s a iona y (14 h) g ow h phases. The pai -wise compa isons we e
made using old changes, a ios o he mean exp ession le els. Fold changes g ea e han wo a e epo ed in he
esul s. All genes in he a ay we e g ouped in o unc ional g oups acco ding o hei main oles. Gene se
en ichmen analysis was made o he gene se s wi h old change g ea e han wo in o de o es whe he any
unc ional g oup is o e ep esen ed among he di e en ially exp essed genes be ween wo g ow h media. Ana-
lyses we e made using SAS® (SAS o Windows 9.1).
3. Resul s
G ow h a e o L. plan a um MLBPL1 cells was simila in MRS and ca o juice (Figu e 1). In eg i y and pu i y
o he isola ed RNA we e demons a ed by No he n blo and PCR o he ldhD gene (da a no shown).
The mac oa ay included 178 genes belonging o 18 main g oups. The la ges g oups we e ene gy me abolism
(59 genes), p o ein syn hesis (30 genes), p o ein a e (10 genes), egula o y unc ions (10 genes), cell en elope
(9 genes) and DNA me abolism (9 genes). O he 178 genes es ed, 18 (10%) showed a mean old change
g ea e han 2.0 in a leas one o he en compa isons be ween g ow h media o g ow h phases (Table 1). The
mos equen unc ions included we e ene gy me abolism, cell en elope, p o ein a e and nucleo ide me a-
bolism.
3.1. Exp ession Le els o he Genes as a Func ion o G ow h
The majo i y o he genes s udied on he memb anes showed no signi ican change in le els o exp ession du ing
he g ow h o be ween he g ow h media. The numbe o he genes ound o be egula ed as a unc ion o g ow h
was clea ly highe in MRS-based g ow h medium han in ca o juice, in which only genes in ol ed in a y acid
and phospholipid me abolism showed di e en ial exp ession in di e en g ow h phases. The unc ion o he
genes showing up egula ion in loga i hmic phase in MRS medium was mos ly ela ed o ene gy me abolism, bu
also o cell di ision, cell en elope biosyn hesis and py imidine ibonucleo ide biosyn hesis. Gene a ion o su i-
cien ene gy o g ow h in loga i hmic phase is impo an and was e idenced in he MRS based medium.
In MRS cul i a ion, when en e ing in he s a iona y phase o g ow h, ansc ip ion o genes in ol ed in ene gy
me abolic pa hways dec eased and highe exp ession le els we e ound o genes in ol ed in p o ein a e, p o-
ein olding and s abiliza ion, like “ olding” chape ones DnaK and G oEL. In con amina ed MRS medium, es-
pecially he exp ession le els o genes in ol ed in suga me abolism pa hways (galK, lacM) we e ound o be
highe in loga i hmic phase. This e lec s highe demand o ene gy in he loga i hmic phase and p obably
compe i ion be ween he Lac obacillus and con amina ing s ains in he u iliza ion o suga s ha a e needed
o g ow h.
Figu e 1. G ow h o L. plan a um MLBPL1 in wo g ow h media.
1.0E+06
1.0E+07
1.0E+08
1.0E+09
1.0E+10
0 5 10 15 20 25
CFU/ml
ime/h
MRS
Ca o

M. Kahala e al.
1001
Table 1. Genes and hei main oles showing mean old change > 2.0 in en compa isons among g ow h media and wo
g ow h phases. Minus and plus signs show which o he compa ed g oups has highe exp ession: +: shows highe exp ession
in he i s ; −: in he second g oup.
Main ole
gene
ORF
gene p oduc
MRS s MRS
con . 6 h
MRS s MRS
con . 14 h
Ca o juice s Ca o
juice con . 6 h
Ca o juice s Ca o
juice con . 14 h
MRS s Ca o
juice 6 h
MRS s Ca o
juice 14 h
MRS 6h s 14 h
MRS con . 6 h
s 14 h
Ca o juice 6 h s
14 h
Ca o juice con
6 h s 14 h
Ene gy me abolism—
Py u a e dehyd ogenase
pdhB
lp_2153
py u a e dehyd ogenase
complex, E1 componen ,
be a subuni −2.20 - - - - - - - - -
Ene gy me abolism—
Suga s
galK
lp_3482 galac okinase −3.01 - - - - - - +2.13 - -
lacM
lp_3484 be a-galac osidase,
small subuni −2.30 - - - - - - +2.43 - -
Ene gy me abolism—
Glycolysis/
gluconeogenesis
pyk
lp_1897 py u a e kinase - - - - - −2.32
- - - -
Ene gy me abolism—
Pen ose phospha e
pa hway
piA1
lp_0602 ibose 5-phospha e
epime ase - - - - - - +2.02 - - -
DNA me abolism—
DNA eplica ion,
ecombina ion
dnaN
lp_0002
DNA-di ec ed DNA
polyme ase III, be a
chain
- - - - - - - - - +2.15
Cellula p ocesses—
Cell di ision sH
lp_0547
cell di ision p o ein
F sH, ATP-dependen
zinc me allopep idase - −2.06 - - - - +2.28 - - -
Cell en elope—
Biosyn hesis and
deg ada ion lp_0304 ex acellula p o ein - - - - - - +2.16 - - -
Cell en elope—O he lp_2290
in eg al memb ane
p o ein
- - - - - - +2.41 - - -
Signal ansduc ion—
PTS p s16ABC
lp_2097 uc ose PTS, EIIABC - −2.50 - - - −2.86
- - - -
Enzymes o unknown
speci ici y mleS
lp_1118 malolac ic enzyme - - +2.32 +2.17 −2.56 −2.28
- - - -
Fa y acid and
phospholipid
me abolism—
Biosyn hesis
abF
lp_1675 3-oxoacyl-[acyl-ca ie
p o ein] syn hase II - - - - - - - - +2.18
Pu ines, py imidines,
nucleosides, and
nucleo ides—
Py imidine
ibonucleo ide
biosyn hesis
py D,
lp_2697
py C,
lp_2699
dihyd oo o a e oxidase,
dihyd oo o ase
-
-
-
-
-
-
-
-
+3.74
+3.36
-
-
-
+2.54
+2.02
-
-
-
-
-
T anspo and binding
p o eins—
Amino acids,
pep ides
oppA
lp_1261
oligopep ide ABC
anspo e , subs a e
binding p o ein
- - - - −2.41 - - - - -
P o ein a e—
P o ein olding and
s abiliza ion
g oEL
lp_0728
dnaK
lp_2027
G oEL chape onin
hea shock p o ein DnaK
-
-
-
-
-
-
-
-
-
-
-
-
−2.25
−2.17
-
-
-
-
-
-
Unknown unc ion
ypA
lp_2146
lp_3092
GTP-binding p o ein
TypA
uma a e educ ase,
la op o ein subuni
p ecu so , N- e minally
unca ed
-
-
-
-
-
-
-
-
-
-
-
-
+2.45
−2.13
-
-
-
-
-
-
M. Kahala e al.
1002
3.2. Exp ession Le els o he Genes be ween Di e en G ow h Media
The mRNA le el o se e al genes was shown o be egula ed in esponse o di e en g ow h media. A he ex-
ponen ial (6 h) phase o g ow h, he genes encoding dihyd oo o a e oxidase and dihyd oo o ase enzymes we e
di e en ially exp essed in MRS and ca o juice. They showed 3.7- and 3.4- old highe exp ession in he MRS
compa ed o ca o juice g ow h medium, espec i ely (Table 1). Di e en ial exp ession (p = 0.015) o hese
genes encoding p o eins in ol ed in py imidine ibonucleo ide biosyn hesis is an indica ion o dis inc gene eg-
ula ion and, consequen ly, po en ially di e en a e o py imidine biosyn hesis in syn he ic MRS compa ed o
ege able-based ca o juice cul i a ion medium.
Exp ession o malolac ic enzyme (mle) gene was clea ly highe in loga i hmic phase when g own in plan
based medium. Up egula ion o cell di ision p o ein F sH was obse ed in con amina ed MRS 14 h compa ed o
MRS 14 h, p obably indica ing highe s ess esponse in con amina ed MRS.
4. Discussion
This s udy ocused on de ining he di e ences in L. plan a um gene exp ession le els in di e en media and in
di e en g ow h phases by he use o a simple and low-cos mac oa ay echnique. P e iously desc ibed DNA
mac oa ay echnique [22] has been u he de eloped o s udying gene exp ession p o ile o he indus ially
impo an lac ic acid bac e ium.
Fe men a ion condi ions may d ama ically a ec unc ional cha ac e is ics o LAB [13]. Ma ked changes in
exp ession le els upon en y in he s a iona y phase ha e been ound ou [25] [26]. Highly exp essed genes a e
u ned o o ma kedly ep essed and genes, mos ly inac i e in he g owing cells, begin o be exp essed in he
s a iona y phase [25] [26]. In his s udy, ansc ip ion o genes in ol ed in ene gy me abolic pa hways dec eased
in s a iona y phase and highe exp ession le els we e ound o genes like “ olding” chape ones DnaK and
G oEL. G oEL basal exp ession is enhanced by en i onmen al s ess, including ele a ed empe a u e, oxygen
limi a ion, and nu ien dep i a ion [27] [28]. DnaK plays a cen al ole in p o ein olding, e olding, ansloca-
ion and in he s ess condi ions. The ele a ed exp ession o hese genes is p obably a esponse o he diminish-
ing nu ien s and high concen a ion o lac ic acid in he medium which is known o cause s ess especially in he
la e-s a iona y phase [29].
P o eomic s udies by [10] has e ealed signi ican changes on e men a ion p o iles o L. plan a um s ains
p e iously g own unde ood-like condi ions compa ed o cul i a ion in MRS b o h. In ou s udy, exp ession o
a malolac ic enzyme (mle) gene in plan -based medium was ound o be up egula ed in loga i hmic phase o
g ow h. Mle enzymes, in ol ed in deca boxyla ion o L-malic acid o L-lac ic acid and CO2 [30], ha e been pu-
i ied om se e al lac ic acid bac e ia, including Leuconos oc mesen e oides, L. plan a um, and Leuconos oc
oenos [31]. In se e al s udies, L. plan a um has been shown o ha e malolac ic ac i i y and he e o e is o in e -
es in wine p oduc ion [32]. The signi icance o malolac ic ac i i y o LAB in saue k au e men a ion has also
been epo ed. Con e sion o malic acid in o lac ic acid be o e signi ican suga me abolism may play some ole
in ea ly e men a ion [30] [33].
Highe exp ession o cell di ision p o ein F sH in con amina ed MRS compa ed o MRS p obably indica ed
highe s ess esponse in con amina ed MRS. Func ional s udies ha e e ealed an impo an ole o F sH in he
bac e ial s ess esponse. In se e al bac e ia, including E. coli, B. sub ilis, Lac ococcus lac is, O. oeni, Helico-
bac e pylo i, and L. plan a um, sH exp ession is induced in esponse o hea and o he s ess ac o s con olled
by addi ional egula o s [34].
Mac oa ay was ound o be an applicable me hod o s udying exp ession o de ined genes o L. plan a um
du ing e men a ion. Mac oa ay echnology has been success ully applied also e.g. o he de ec ion o pa ho-
gens in chicken samples [35] and s udies on en i onmen al samples o he p esence o speci ic an ibio ic esis-
ance genes [36] communi ies o diazo ophs [37], and exp ession o 375 genes in L. lac is subsp. lac is IL1403
du ing s ess condi ions [38].
L. plan a um is encoun e ed in a a ie y o en i onmen al niches, which include dai y, mea and many ege-
able o plan e men a ions as well as he human gas oin es inal ac . Because o his lexibili y and e sa ili y,
s ains o his species ha e been adi ionally used o ood and eed p ese a ion and as s a e s in he manu ac-
u e o e men ed p oduc s. Fo me ly, he echnological p ope ies and sui abili y o ce ain s ains o selec ed
applica ions could be ensu ed almos exclusi ely by labo ious and ime-consuming ood p ocessing and p ese -
a ion expe imen s. Today, he long his o y o use and on he o he hand he de elopmen o molecula and ge-
M. Kahala e al.
1003
nomic echniques ha e made L. plan a um one o he mos s udies ood mic obes. Mode n DNA mic oa ay [6],
nex -gene a ion sequencing echnologies [39] and especially ansc ip omic s udies a e accu a e and sensi i e
and ha e enabled he de ailed examina ion o L. plan a um genome s uc u e and unc ion. The mos ad anced
echnologies, howe e , equi e speci ic ins umen a ion and ha e o en high unning cos s, which may ule ou
hei use in many cases. The cu en s udy demons a ed ha mac oa ays p in ed on ni ocellulose il e s wi h
simple obo ic sys ems can be analyzed by s anda d labo a o y equipmen and me hods usually a ailable in mo-
lecula labo a o ies. Using his echnology, apid and cos -e icien analysis o genome unc ion o L. plan a um
can be ca ied ou e.g. in de eloping egions, whe e lac ic acid e men a ion o ood an eed ma ices is a com-
mon p ac ice, bu esea ch and analysis labo a o ies o en lack he mos expensi e speci ic labo a o y ins u-
men a ion.
Acknowledgemen s
Tekes, he Finnish Funding Agency o Technology and Inno a ion, is g a e ully acknowledged o he inancial
suppo o his wo k. The au ho s wish o hank Anneli Paloposki o he skil ul echnical assis ance, A i-Ma i
Sa én o designing he p ime s, Ma kku Ala-Pan i and Hannu Väänänen o p in ing he memb anes.
Re e ences
[1] Rose, A. (1982) His o y and Scien i ic Basis o Mic obial Ac i i y in Fe men ed Foods. In: Rose, A., Ed., Fe men ed
Foods, Academic P ess, New Yo k, 1-13.
[2] Che allie , B., Hube , J.C. and Kamme e , B. (1994) De e mina ion o Ch omosome Size and Numbe o n Loci in
Lac obacillus plan a um by Pulsed-Field Gel Elec opho esis. FEMS Mic obiology Le e s, 120, 51-56.
h p://dx.doi.o g/doi:10.1111/j.1574-6968.1994. b07006.x
[3] Klee ebezem, M., Boekho s , J., an K anenbu g, R., Molenaa , D., Kuipe s, O.P., Lee , R., Ta chini, R., Pe e s, S.A.,
Sandb ink H.M., Fie s, M., S iekema, W., Lankho s , R., B on, P., Ho e , S., G oo , M., Ke kho en, R., de V ies, M.,
U sing, B., de Vos, W.M. and Siezen, R.J. (2003) Comple e Genome Sequence o Lac obacillus plan a um WCFS1.
P oceedings o he Na ional Academy o Sciences o he Uni ed S a es o Ame ica, 100, 1990-1995.
h p://dx.doi.o g/10.1073/pnas.0337704100
[4] McDonald, L.C., Fleming, H.P. and Hassan, H.M. (1990) Acid Tole ance o Leuconos oc mesen e oides and Lac oba-
cillus plan a um. Applied and En i onmen al Mic obiology, 56, 2120-2124.
[5] Mäki, M. (2004) Lac ic Acid Bac e ia in Vege able Fe men a ions. In: Salminen, S., on W igh , A. and Ouwehand, A.,
Eds., Lac ic Acid Bac e ia: Mic obiological and Func ional Aspec s, 2nd Edi ion, Ma cel Dekke , Inc., New Yo k,
419-430. h p://dx.doi.o g/10.1201/9780824752033.ch14
[6] Molenaa , D., B ingel, F., Schu en, F.H., De Vos, W.M., Siezen, R.J. and Klee ebezem, M. (2005) Explo ing Lac oba-
cillus plan a um Genome Di e si y by Using Mic oa ays. Jou nal o Bac e iology, 187, 6119-6127.
[7] Kois inen, K.M., Plumed-Fe e , C., Lehes an a, S.J., Kä enlampi, S.O. and on W igh , A. (2007) Compa ison o
G ow h-Phase-Dependen Cy osolic P o eomes o Two Lac obacillus plan a um S ains Used in Food and Feed Fe -
men a ions. FEMS Mic obiology Le e s, 273, 12-21. h p://dx.doi.o g/10.1111/j.1574-6968.2007.00775.x
[8] Plumed-Fe e , C., Kois inen, K.M., Tolonen, T.L., Lehes an a, S.J., Kä enlampi, S.O., Mäkima ila, E., Jou sjoki, V.,
Vi anen, V. and on W igh , A. (2008) Compa a i e S udy o Suga Fe men a ion and P o ein Exp ession Pa e ns o
Two Lac obacillus plan a um S ains G own in Th ee Di e en Media. Applied and En i onmen al Mic obiology, 74,
5349-5358. h p://dx.doi.o g/10.1128/AEM.00324-08
[9] Di Cagno, R., Su ico, R.F., Si agusa, S., De Angelis, M., Pa adiso, A., Mine ini, F., De Ga a, L. and Gobbe i, M.
(2008) Selec ion and Use o Au och honous Mixed S a e o Lac ic Acid Fe men a ion o Ca o s, F ench Beans o
Ma ows. In e na ional Jou nal o Food Mic obiology, 127, 220-228.
h p://dx.doi.o g/10.1016/j.ij oodmic o.2008.07.010
[10] Si agusa, S., De Angelis, M., Calasso, M., Campanella, D., Mine ini, F., Di Cagno, R. and Gobbe i, M. (2013) Fe -
men a ion and P o eome P o iles o Lac obacillus plan a um S ains du ing G ow h unde Food-Like Condi ions. Jou -
nal o P o eomics, 96, 366-380. h p://dx.doi.o g/10.1016/j.jp o .2013.11.003
[11] S e ens, M.J.A., Wie sma, A., de Vos, W.M., Kuipe s, O.P., Smid, E.J., Molenaa , D. and Klee ebezem, M. (2008) Im-
p o emen o Lac obacillus plan a um Ae obic G ow h as Di ec ed by Comp ehensi e T ansc ip ome Analysis. Ap-
plied and En i onmen al Mic obiology, 74, 4776-4778. h p://dx.doi.o g/10.1128/AEM.00136-08
[12] Wels, M., O e ma s, L., F ancke, C., Klee ebezem, M. and Siezen, R.J. (2011) Recons uc ion o he Regula o y Ne -
wo k o Lac obacillus plan a um WCFS1 on Basis o Co ela ed Gene Exp ession and Conse ed Regula o y Mo i s.
M. Kahala e al.
1004
Mic obial Bio echnology, 4, 333-344. h p://dx.doi.o g/10.1111/j.1751-7915.2010.00217.x
[13] B on, P.A., Wels, M., Bonge s, R.S., de Veen, H., Wie sma, A., O e ma s, L., Ma co, M.L. and Klee ebezem, M.
(2012) T ansc ip omes Re eal Gene ic Signa u es Unde lying Physiological Va ia ions Imposed by Di e en Fe men-
a ion Condi ions in Lac obacillus plan a um. PloS ONE, 7, e38720. h p://dx.doi.o g/10.1371/jou nal.pone.0038720
[14] Re e ón, I., Ri as, B., Muñoz, R. and de Felipe, F.L. (2012) Genome-Wide T ansc ip omic Responses o a Human Iso-
la e o Lac obacillus plan a um Exposed o p-Couma ic Acid S ess. Molecula Nu i ion & Food Resea ch, 56, 1848-
1859. h p://dx.doi.o g/10.1002/mn .201200384
[15] Tod , T.J., Wels, M., Bonge s, R.S., Siezen, R.S., an Hijum, S.A.F.T. and Klee ebezem, M. (2012) Genome-Wide
P edic ion and Valida ion o Sigma70 P omo e s in Lac obacillus plan a um WCFS1. PloS ONE, 7, e45097.
h p://dx.doi.o g/10.1371/jou nal.pone.0045097
[16] de Veen, H., Abee, T., Tempelaa s, M., B on, P.A., Klee ebezem, M. and Ma co, M.L. (2011) Sho - and Long-Te m
Adap a ion o E hanol S ess and I s C oss-P o ec i e Consequences in Lac obacillus plan a um. Applied and En i on-
men al Mic obiology, 77, 5247-5256. h p://dx.doi.o g/10.1128/AEM.00515-11
[17] Wegkamp, A., Ma s, A.E., Faijes, M., Molenaa , D., de Vos, R.C.H., Klaus, S.M.J., Hanson, A.D., de Vos, W.M. and
Smid, E.J. (2010) Physiological Responses o Fola e O e p oduc ion in Lac obacillus plan a um WCFS1. Mic obial
Cell Fac o ies, 9, 100. h p://dx.doi.o g/10.1186/1475-2859-9-100
[18] Tamminen, M., Mäki, M. and Jou sjoki, T. (2003) Di e en ia ion o Lac obacilli Rela ed o Lac obacillus plan a um
om Na u ally Fe men ed Cucumbe s and Whi e Cabbage. Applied Bio echnology, Food Science and Policy, 1, 125-
128.
[19] Tamminen, M., Jou sjoki, T., Sjöblom, M., Jou sen, M., Pal a, A., Ryhänen, E.L. and Jou sjoki, V. (2004) Sc eening o
Lac ic Acid Bac e ia om Fe men ed Vege ables by Ca bohyd a e P o iling and PCR-ELISA. Le e s in Applied Mi-
c obiology, 39, 439-444. h p://dx.doi.o g/10.1111/j.1472-765X.2004.01607.x
[20] Hames, B. and Higgins, S. (1985) Nucleic Acid Hyb idiza ion: A P ac ical App oach. IRL P ess, Ox o d.
[21] Raulo, E., Che nouso , M.A., Ca ey, D.J., Nolo, R. and Rau ala, H. (1994) Isola ion o a Neu onal Cell Su ace Re-
cep o o Hepa in Binding G ow h-Associa ed Molecule (HB-GAM). Iden i ica ion as N-Syndecan (Syndecan-3). The
Jou nal o Biological Chemis y, 269, 12999-13004.
[22] Hul man, J., Pi kä an a, M., Roman schuk, M., Au inen, P. and Paulin, L. (2008) P obe-Based Nega i e Selec ion o
Unde ep esen ed Phylo ypes in La ge En i onmen al Clone Lib a ies. Jou nal o Mic obiological Me hods, 75, 457-
463. h p://dx.doi.o g/10.1016/j.mime .2008.07.016
[23] Ka lin, S. and M ázek, J. (2000) P edic ed Highly Exp essed Genes o Di e se P oka yo ic Genomes. Jou nal o Bac-
e iology, 182, 5238-5250. h p://dx.doi.o g/10.1128/JB.182.18.5238-5250.2000
[24] Saeed, A.I., Sha o , V., Whi e, J., Li, J., Liang, W., Bhagaba i, N., B ais ed, J., Klapa, M., Cu ie , T., Thiaga ajan, M.,
S u n, A., Snu in, M., Rezan se , A., Popo , D., Ryl so , A., Kos uko ich, E., Bo iso sky, I., Liu, Z., Vinsa ich, A.,
T ush, V. and Quackenbush, J. (2003) TM4: A F ee, Open-Sou ce Sys em o Mic oa ay Da a Managemen and Ana-
lysis. BioTechniques, 34, 374-378. h p://dx.doi. g/12613259
[25] Ishihama, A. (1997) Adap a ion o Gene Exp ession in S a iona y Phase Bac e ia. Cu en Opinion in Gene ics and
De elopmen , 7, 582-588. h p://dx.doi.o g/10.1016/S0959-437X(97)80003-2
[26] Ishihama, A. (1999) Modula ion o he Nucleoid, he T ansc ip ion Appa a us, and he T ansla ion Machine y in Bac-
e ia o S a iona y Phase Su i al. Genes o Cells, 4, 135-143. h p://dx.doi.o g/10.1046/j.1365-2443.1999.00247.x
[27] Be gonzelli, G.E., G ana o, D., P idmo e, R.D., Ma in-Guy, L.F., Donnicola, D. and Co hésy-Theulaz, I.E. (2006)
G oEL o Lac obacillus johnsonii La1 (NCC 533) Is Cell Su ace Associa ed: Po en ial Role in In e ac ions wi h he
Hos and he Gas ic Pa hogen Helicobac e pylo i. In ec ion and Immuni y, 74, 425-434.
h p://dx.doi.o g/10.1128/IAI.74.1.425-434.2006
[28] Lambe i, C., Mangiapane, E., Pessione, A., Mazzoli, R., Giun a, C. and Pessione, E. (2011) P o eomic Cha ac e iza-
ion o a Selenium-Me abolizing P obio ic Lac obacillus eu e i Lb2 BM o Nu aceu ical Applica ions. P o eomics,
11, 2212-2221. h p://dx.doi.o g/10.1002/pmic.201000747
[29] Cohen, D.P.A., Renes, J., Bouwman, F.G., Zoe endal, E.G., Ma iman, E., de Vos, W.M. and Vaughan, E.E. (2006)
P o eomic Analysis o Log o S a iona y G ow h Phase Lac obacillus plan a um Cells and a 2-DE Da abase. P o eo-
mics, 6, 6485-6493. h p://dx.doi.o g/10.1002/pmic.200600361
[30] Johanningsmeie , S.D., Fleming, H.P. and B eid J ., F. (2004) Malolac ic Ac i i y o Lac ic Acid Bac e ia du ing
Saue k au Fe men a ion. Jou nal o Food Science, 69, M222-M227.
h p://dx.doi.o g/10.1111/j.1365-2621.2004. b09891.x
[31] Laba e, C., Guzzo, J., Ca in, J.F., Di iès, C., Laba e, C. and Guzzo, J. (1996) Cloning and Cha ac e iza ion o he
Genes Encoding he Malolac ic Enzyme and he Mala e Pe mease o Leuconos oc oenos. Applied and En i onmen al
Mic obiology, 62, 1274-1282.
M. Kahala e al.
1011
Con inued
lp_2256
2039314
2040324
337 - ccpA ca aboli e con ol p o ein A 625
AGGCTAAGATT
CCGTTTGAC
1008
AATCAGCAGACTT
GGTTGAG
383
lp_2301
2078957
2080099
381 - ecA ecombinase A 678
GCAGAACAGAT
CAAGGAAGG
1077
TACTTTGACCTTT
ACTGCCA
399
lp_2323
2100621
2101115
165 - px hiol pe oxidase 150
ATGCCAGATAT
TGATACGCG
463
GCAACGTAATTTG
GCTCGTG
313
lp_2345
2120498
2121610
371 - ddl
D-alanine-D-alanine
ligase
616
CCGATGCGTTC
AAATATGAC
1021
GCCGTATAACTAA
TGCCCGA
405
lp_2349
2123935
2124852
306 - hicD3
L-2-hyd oxyisocap oa e
dehyd ogenase
467
AAAGTATGTCG
GACAAGCAG
863
TAACGACGCTCGT
TCATCAG
396
lp_2359
2130199
2131200
334 - m eB2 cell shape de e mining
p o ein M eB 467 GACTAGTGATA
TCGCTGTCC 853
CCACCAGTCAACG
TAATTCC 386
lp_2366
2137118
2138632
505 - a pA
H(+)- anspo ing wo-sec o
ATPase, alpha subuni
950
AATTATCGAAA
CGCAAGCTG
1364
ACGGGCAATATCA
TCAACTG
414
lp_2544
2269594
2270949
452 + np 2 NADH pe oxidase 848
GACCTTAGTCC
CATTTGCCC
1264
GCTAAGTCAGCAA
CAGTCAG
416
lp_2596
2313948
2314751
268 - p lA1
o ma e ace yl ans e ase
ac i a ing enzyme
374
TGAGACAACTG
GTTACGCAC
793
TTCACCCGTACTT
TAACACC
419
lp_2598
2315865
2318309
815 + p lB1 o ma e C-ace yl ans e ase 1991
AACCTCTTCTAT
TTCGGCCA
2404
GTTTCTTTGGATA
GGCCCAC
413
lp_2681
2380421
2381905
495 + gpd
glucose-6-phospha e
1-dehyd ogenase
937
CTTTCGTCGCTG
GTAAAGTC
1355
AACGAATTTCCAC
GAATCGG
418
lp_2690
2398345
2398983
213 - py E
o o a e
phospho ibosyl ans e ase 97
GTATTCGCCAA
CCAGAACAG 490
GTACCGGCATCAT
TGATCAG 393
lp_2697
2398345
2398983
213 - py E
o o a e
phospho ibosyl ans e ase 97
GTATTCGCCAA
CCAGAACAG 490
GTACCGGCATCAT
TGATCAG 393
lp_2699
2399695
2400612
306 - py D dihyd oo o a e oxidase 124
TGACGATTTCTT
ATCCGGCG
527
GTTGGACAAACTG
AACAGCG
403
lp_2702
2404915
2406207
431 - py C dihyd oo o ase 422
ATTTGGAACTG
ATCCAGCGA
838
ATGTCTGTACAAG
CAGTCGG
416
lp_2703
2406211
2407146
312 - py B
aspa a e
ca bamoyl ans e ase
869
GTTAGTTGCGG
GATTGTTGG
1284
GCGTTTCCTTTCC
ATATGCC
415
lp_2704
2407293
2407835
181 - py R1
py imidine ope on
egula o
554
CAAAGAATGGT
ATGGCCGTG
932
AACCTCCACTTGA
GTTGCTG
378
lp_2728
2428365
2429495
377 - pu K1
phospho ibosylaminoimidazole
ca boxylase,
ATPase subuni
11 AGTCGTTGATG
CAATGACCA 411 GTCCACGATCGAC
TAAGACC 400
lp_2766
2457282
2458373
364 +
hypo he ical p o ein 680
AGCTAATGTTC
AGCCCAGTG
1073
TAATACGGTGACA
TGACCCA
393
lp_2807
2504803
2506059
419 - y S y osine- RNA ligase 540
TCAAATGATGC
GACTTATGG
950
GTATTGCCCAAAC
TCATCGT
410
lp_2873
2558269
2559309
347 - adh2 alcohol dehyd ogenase 760
TCAACCAGGAT
GATCGAGAC
1144
CCATTGATTCGAA
TCGCACC
384
lp_3051
2712741
2713913
391 + dhaT
1,3-p opanediol
dehyd ogenase
440
AGCCTTAGCTG
ACGTAATGG
856
CGTAAGCCAATGT
TCTTCCA
416
lp_3092
2751334
2752746
471 + gabD
succina e-semialdehyde
dehyd ogenase (NAD(P)+)
682
AAACATCATTA
CGCGAAGCC
1092
CGTCTTTAAGCGC
ATTAGTC
410
lp_3125
2791021
2792502
494 +
uma a e educ ase,
la op o ein subuni
p ecu so , N- e minally
unca ed
864 AAATTAGTCCC
TGGCGATCC 1270
AGTTCTGGTAAGG
AGCTGAG 406
lp_3265
2904444
2905385
314 +
cell su ace hyd olase,
memb ane-bound
(pu a i e)
960 GGGAACTTCAT
GGGCTTAGG 1371
ACGTATCACCAGT
TAGTCCA 411
lp_3270
2910392
2911681
430 + pu A adenylosuccina e syn hase 474
CGTCACACGGA
TATCATCCT
896
TTGATACTCGGCA
GGATCGA
422
lp_3314
2951354
2952175
274 + p lA2
o ma e ace yl ans e ase
ac i a ing enzyme
850
AAGTCGGTGAT
TTCATTCGT
1266
TAACGTTAGTTTG
TTGGCGA
416
lp_3352
2981556
2981999
148 - hsp3 small hea shock p o ein 398
GTTCGAACGTC
TAATGAAGG
794
CTTGTACCCGTTG
TAATCAG
396
lp_3403
3017894
3018754
287 -
oxido educ ase 64
TGGACGATTTG
GTTAATGGA
431
AATATGATGGGTA
TCCGCAG
367
lp_3480
3089259
3090263
335 - UTP-galac ose-1-P
u idylyl ans e ase 321
GTTGACCTCTAC
TTGATCCA 711 AGAAACCGTGTTG
TAATGAC 390
lp_3484
3093639
3094598
320 + lacM
be a-galac osidase, small
subuni
486
GGTCTGCGGTTT
ATCATACC
882
AACTATCAATGCC
ACCGACC
396

M. Kahala e al.
1012
Con inued
lp_3534
3151784
3154084
767 + agl5 alpha-glucosidase 1834
GTGACGACATAC
TAGTTGCC
2242
AATTCAACTGTGA
TCTGCTG
408
lp_3544
3163853
3164476
208 - gph3
phosphoglycola e
phospha ase (pu a i e)
143
CGGTGAGATGAT
CCTGAGAG
517
CCTGCATTCTTTG
AAGCCTG
374
lp_3545
3164582
3165640
353 - gu B L-idi ol 2-dehyd ogenase 575
TGTTTCTGGGAT
CACTAAGG
969
AGTGTTCAAGATC
AAAGACC
394
lp_3549
3168152
3168919
256 +
ansc ip ion egula o 285
TTCCTAGATTAT
GGCACCAC
685
GCGTCCACGTTAC
TAATGTC
400
lp_3555
3174155
3174883
243 - a aD
L- ibulose 5-phospha e
4-epime ase
305
CTATGCAGCTGC
TCAAATGG
716
TGCATGATCCTTA
GAATGCG
411
lp_3583
3199392
3201506
705 - clpL
ATP-dependen Clp
p o ease, ATP-binding
subuni ClpL
1698 ATCGCTACTTCT
AATGCTGG 2110
GCTGCCGATATCA
CAATCTC 412
lp_3586
3202767
3203867
367 - lox lac a e oxidase 628
TCATGGAAATCT
ATGCTGCT
1029
GCTCATCATTAAG
GTGACTC
401
lp_3589
3206328
3208139
604 - pox5 py u a e oxidase 1319
GGTGTTTAATCT
GGCTGGTG
1734
AATCTTGAGCTTC
ATACCGT
415
lp_3592
3209669
3210514
282 - haD
hamnulose-1-phospha e
aldolase
376
CTCGGTTGAAGC
AAGATCCT
783
AACGCTTGATTAA
GTCACGG
407
lp_3603
3219914
3220636
241 +
suga -phospha e aldolase 258
CAACAAATTGAC
GGTGTAGG
685
TGGTACTGCTTAA
TTAGCCC
427
Supplemen 2. T ans e o he ampli ied PCR p oduc s o 348 well pla es o 384-pin g idding on o ni ocellulose mem-
b anes.
ORF Gene P oduc Pla e_96 96 Well Ta ge Pla e 384 Well 384 Well
lp_0175 malE
mal ose/mal odex in ABC anspo e , subs a e
binding p o ein
M2_1_96 A01 Pla e_1 A01 A16
lp_0230 p s2CB
manni ol PTS, EIICB
M2_1_96 B01 Pla e_1 C01 C16
lp_0233 m lD
manni ol
-1-phospha e 5-dehyd ogenase M2_1_96 C01 Pla e_1 E01 E16
lp_0257 pepM
me hionyl aminopep idase
M2_1_96 D01 Pla e_1 G01 G16
lp_0302
ex acellula p o ein
M2_1_96 E01 Pla e_1 I01 I16
lp_0304
ex acellula p o ein
M2_1_96 F01 Pla e_1 K01 K16
lp_0330 ba
uc ose
-bisphospha e aldolase M2_1_96 G01 Pla e_1 M01 M16
lp_0447 m aA
hyd oxyme hylglu a yl
-CoA educ ase M2_1_96 H01 Pla e_1 O01 O16
lp_0480 poE
DNA
-di ec ed RNA polyme ase, del a subuni M2_1_96 A02 Pla e_1 A02 A17
lp_0537 ldhL1
L
-lac a e dehyd ogenase M2_1_96 B02 Pla e_1 C02 C17
lp_0539 m d
ansc ip ion
- epai coupling ac o M2_1_96 C02 Pla e_1 E02 E17
lp_0547 sH
cell di ision p o ein F sH, ATP-dependen zinc
me allopep idase
M2_1_96 D02 Pla e_1 G02 G17
lp_0576 p s9C
mannose PTS, EIIC
M2_1_96 E02 Pla e_1 I02 I17
lp_0577 p s9D
mannose PTS, EIID
M2_1_96 F02 Pla e_1 K02 K17
lp_0601 pepC1
cys eine aminopep idase
M2_1_96 G02 Pla e_1 M02 M17
lp_0609 gl X
glu ama e
- RNA ligase M2_1_96 H02 Pla e_1 O02 O17
lp_0619 plK
ibosomal p o ein L11
M2_1_96 A03 Pla e_1 A03 A18
lp_0620 plA
ibosomal p o ein L1
M2_1_96 B03 Pla e_1 C03 C18
lp_0621 plJ
ibosomal p o ein L10
M2_1_96 C03 Pla e_1 E03 E18
lp_0690
in eg al memb ane p o ein (pu a i e)
M2_1_96 D03 Pla e_1 G03 G18
lp_0692 n dF
ibonucleoside
-diphospha e educ ase, be a chain M2_1_96 E03 Pla e_1 I03 I18
lp_0715 phnD
phosphona es ABC anspo e , subs a e binding
p o ein (pu a i e)
M2_1_96 F03 Pla e_1 K03 K18
lp_0728 g oEL
G oEL chape onin
M2_1_96 G03 Pla e_1 M03 M18
lp_0757 galU
UTP
-glucose-1-phospha e u idylyl ans e ase M2_1_96 H03 Pla e_1 O03 O18
lp_0786 clpP
endopep idase Clp, p o eoly ic subuni
M2_1_96 A04 Pla e_1 A04 A19
M. Kahala e al.
1013
Con inued
lp_0789 gapB
glyce aldehyde 3
-phospha e dehyd ogenase M2_1_96 B04 Pla e_1 C04 C19
lp_0790 pgk
phosphoglyce a e kinase
M2_1_96 C04 Pla e_1 E04 E19
lp_0791 piA
iosephospha e isome ase
M2_1_96 D04 Pla e_1 G04 G19
lp_0792 enoA1
phosphopy u a e hyd a ase
M2_1_96 E04 Pla e_1 I04 I19
lp_0800
cell su ace p o ein p ecu so
M2_1_96 F04 Pla e_1 K04 K19
lp_0923
cell su ace p o ein p ecu so
M2_1_96 G04 Pla e_1 M04 M19
lp_0938 hsdR
ype I si e
-speci ic deoxy ibonuclease, HsdR subuni M2_1_96 H04 Pla e_1 O04 O19
lp_0959 pepD3
dipep idase
M2_1_96 A05 Pla e_1 A05 A20
lp_1012 se S2
se ine
- RNA ligase M2_1_96 B05 Pla e_1 C05 C20
lp_1021 poB
DNA
-di ec ed RNA polyme ase, be a subuni M2_1_96 C05 Pla e_1 E05 E20
lp_1022 poC
DNA
-di ec ed RNA polyme ase, be a’ subuni M2_1_96 D05 Pla e_1 G05 G20
lp_1025 psL
ibosomal p o ein S12
M2_1_96 E05 Pla e_1 I05 I20
lp_1026 psG
ibosomal p o ein S7
M2_1_96 F05 Pla e_1 K05 K20
lp_1027 usA2
elonga ion ac o G
M2_1_96 G05 Pla e_1 M05 M20
lp_1033 plC
ibosomal p o ein L3
M2_1_96 H05 Pla e_1 O05 O20
lp_1034 plD
ibosomal p o ein L4
M2_1_96 A06 Pla e_1 A06 A21
lp_1036 plB
ibosomal p o ein L2
M2_1_96 B06 Pla e_1 C06 C21
lp_1040 psC
ibosomal p o ein S3
M2_1_96 C06 Pla e_1 E06 E21
lp_1041 plP
ibosomal p o ein L16
M2_1_96 D06 Pla e_1 G06 G21
lp_1047 plE
ibosomal p o ein L5
M2_1_96 E06 Pla e_1 I06 I21
lp_1051 plF
ibosomal p o ein L6
M2_1_96 F06 Pla e_1 K06 K21
lp_1053 psE
ibosomal p o ein S5
M2_1_96 G06 Pla e_1 M06 M21
lp_1055 plO
ibosomal p o ein L15
M2_1_96 H06 Pla e_1 O06 O21
lp_1058 adk
adenyla e kinase
M2_1_96 A07 Pla e_1 A07 A22
lp_1062 poA
DNA
-di ec ed RNA polyme ase, alpha subuni M2_1_96 B07 Pla e_1 C07 C22
lp_1070
lipop o ein p ecu so
M2_1_96 C07 Pla e_1 E07 E22
lp_1077 plM
ibosomal p o ein L13
M2_1_96 D07 Pla e_1 G07 G22
lp_1118 mleS
malolac ic enzyme
M2_1_96 E07 Pla e_1 I07 I22
lp_1261 oppA
oligopep ide ABC anspo e , subs a e binding p o ein
M2_1_96 F07 Pla e_1 K07 K22
lp_1274 p sI
phosphoenolpy u a e
-p o ein phospha ase M2_1_96 G07 Pla e_1 M07 M22
lp_1316 leuS
leucine
- RNA ligase M2_1_96 H07 Pla e_1 O07 O22
lp_1329 dgk2
deoxyguanosine kinase
M2_1_96 A08 Pla e_1 A08 A23
lp_1468
ABC anspo e , ATP
-binding p o ein M2_1_96 B08 Pla e_1 C08 C23
lp_1508 polA
DNA
-di ec ed DNA polyme ase I M2_1_96 C08 Pla e_1 E08 E23
lp_1514 h S
h eonine
- RNA ligase 1 M2_1_96 D08 Pla e_1 G08 G23
lp_1615 p iA
p imosomal p o ein N
' M2_1_96 E08 Pla e_1 I08 I23
lp_1632 smc
cell di ision p o ein Smc
M2_1_96 F08 Pla e_1 K08 K23
lp_1643
cell su ace p o ein p ecu so
M2_1_96 G08 Pla e_1 M08 M23
lp_1767
lysin
M2_1_96 H08 Pla e_1 O08 O23
lp_1882 psA
ibosomal p o ein S1
M2_1_96 A09 Pla e_1 A09 A24
lp_1897 pyk
py u a e kinase
M2_1_96 B09 Pla e_1 C09 C24
lp_1899 dnaE
DNA
-di ec ed DNA polyme ase III, alpha chain M2_1_96 C09 Pla e_1 E09 E24
lp_1941 nox4
NADH oxidase
M2_1_96 D09 Pla e_1 G09 G24
M. Kahala e al.
1014
Con inued
lp_2027 dnaK hea shock p o ein DnaK M2_1_96 E09 Pla e_1 I09 I24
lp_2054 s elonga ion ac o TS M2_1_96 F09 Pla e_1 K09 K24
lp_2055 psB ibosomal p o ein S2 M2_1_96 G09 Pla e_1 M09 M24
lp_2057 ldhD D-lac a e dehyd ogenase M2_1_96 H09 Pla e_1 O09 O24
lp_0002 dnaN DNA-di ec ed DNA polyme ase III, be a chain M2_2_96 A01 Pla e_1 B01 B16
lp_0006 gy B DNA gy ase, B subuni M2_2_96 B01 Pla e_1 D01 D16
lp_0061
ace oace a e deca boxylase (pu a i e) M2_2_96 C01 Pla e_1 F01 F16
lp_0129 hsp1 small hea shock p o ein M2_2_96 D01 Pla e_1 H01 H16
lp_0184 sacK1 uc okinase M2_2_96 E01 Pla e_1 J01 J16
lp_0210 ack1 ace a e kinase M2_2_96 F01 Pla e_1 L01 L16
lp_0233 m lD manni ol-1-phospha e 5-dehyd ogenase M2_2_96 G01 Pla e_1 N01 N16
lp_0244
oxido educ ase (pu a i e) M2_2_96 H01 Pla e_1 P01 P16
lp_0301
memb ane-bound p o ease, CAAX amily M2_2_96 A02 Pla e_1 B02 B17
lp_0313 ndh1 NADH dehyd ogenase M2_2_96 B02 Pla e_1 D02 D17
lp_0329 acdH ace aldehyde dehyd ogenase M2_2_96 C02 Pla e_1 F02 F17
lp_0466 pu R pu ine biosyn hesis ope on ep esso M2_2_96 D02 Pla e_1 H02 H17
lp_0481 py G CTP syn hase M2_2_96 E02 Pla e_1 J02 J17
lp_0566 nadE NAD syn hase M2_2_96 F02 Pla e_1 L02 L17
lp_0575 p s9AB mannose PTS, EIIAB M2_2_96 G02 Pla e_1 N02 N17
lp_0585
ansc ip ion egula o M2_2_96 H02 Pla e_1 P02 P17
lp_0597 pgm2 phosphoglyce a e mu ase M2_2_96 A03 Pla e_1 B03 B18
lp_0602 piA1 ibose 5-phospha e epime ase M2_2_96 B03 Pla e_1 D03 D18
lp_0725
hypo he ical p o ein M2_2_96 C03 Pla e_1 F03 F18
lp_0737
ibosomal p o ein S30EA M2_2_96 D03 Pla e_1 H03 H18
lp_0754 hp K
bi unc ional p o ein: HP kinase,
P-se -
HP phospha ase
M2_2_96 E03 Pla e_1 J03 J18
lp_0807 p a phospha e ace yl ans e ase M2_2_96 F03 Pla e_1 L03 L18
lp_0852 pox2 py u a e oxidase M2_2_96 G03 Pla e_1 N03 N18
lp_0853 pepR1 p olyl aminopep idase M2_2_96 H03 Pla e_1 P03 P18
lp_1005 als ace olac a e syn hase M2_2_96 A04 Pla e_1 B04 B19
lp_1090 dA L(+)- a a e dehyd a ase, subuni A M2_2_96 B04 Pla e_1 D04 D19
lp_1101 ldhL2 L-lac a e dehyd ogenase M2_2_96 C04 Pla e_1 F04 F19
lp_1108 ci E ci a e lyase, be a chain M2_2_96 D04 Pla e_1 H04 H19
lp_1148 ga A glu amyl- RNA amido ans e ase, subuni A M2_2_96 E04 Pla e_1 J04 J19
lp_1149 ga B glu amyl- RNA amido ans e ase, subuni B M2_2_96 F04 Pla e_1 L04 L19
lp_1200 galE2 UDP-glucose 4-epime ase M2_2_96 G04 Pla e_1 N04 N19
lp_1250 gn K gluconokinase M2_2_96 H04 Pla e_1 P04 P19
lp_1273 hp phosphoca ie p o ein Hp M2_2_96 A05 Pla e_1 B05 B20
lp_1301 me K me hionine adenosyl ans e ase M2_2_96 B05 Pla e_1 D05 D20
lp_1500 na I ni a e educ ase, gamma chain M2_2_96 C05 Pla e_1 F05 F20
lp_1521
oxido educ ase M2_2_96 D05 Pla e_1 H05 H20
lp_1541 gnd2 phosphoglucona e dehyd ogenase (deca boxyla ing) M2_2_96 E05 Pla e_1 J05 J20
lp_1563 g eA2 ansc ip ion elonga ion ac o G eA M2_2_96 F05 Pla e_1 L05 L20
lp_1665 adh1 alcohol dehyd ogenase M2_2_96 G05 Pla e_1 N05 N20
M. Kahala e al.
1015
Con inued
lp_1675 abF
3
-oxoacyl-[acyl-ca ie p o ein] syn hase II M2_2_96 H05 Pla e_1 P05 P20
lp_1779 hs
o ma e
- e ahyd o ola e ligase M2_2_96 A06 Pla e_1 B06 B21
lp_1783 py AA2
ca bamoyl-phospha e syn hase
(glu amine-hyd olysing), small chain
M2_2_96 B06 Pla e_1 D06 D21
lp_1817
ibi ol
-5-phospha e 2-dehyd ogenase (pu a i e) M2_2_96 C06 Pla e_1 F06 F21
lp_1898 p k
6
-phospho uc okinase M2_2_96 D06 Pla e_1 H06 H21
lp_1981 hisS
his idine
- RNA ligase M2_2_96 E06 Pla e_1 J06 J21
lp_2030 aldB
alpha
-ace olac a e deca boxylase M2_2_96 F06 Pla e_1 L06 L21
lp_2052
ibosome ecycling ac o
M2_2_96 G06 Pla e_1 N06 N21
lp_2086 ap
adenine phospho ibosyl ans e ase
M2_2_96 H06 Pla e_1 P06 P21
lp_2094
GTP
-binding p o ein M2_2_96 A07 Pla e_1 B07 B22
lp_2096 uK
1
-phospho uc okinase M2_2_96 B07 Pla e_1 D07 D22
lp_2123 dapA1
dihyd odipicolina e syn hase
M2_2_96 C07 Pla e_1 F07 F22
lp_2153 pdhB
py u a e dehyd ogenase complex, E1 componen ,
be a subuni
M2_2_96 D07 Pla e_1 H07 H22
lp_2154 pdhA
py u a e dehyd ogenase complex, E1 componen ,
alpha subuni
M2_2_96 E07 Pla e_1 J07 J22
lp_2189 di IVA
cell di ision ini ia ion p o ein Di IVA
M2_2_96 F07 Pla e_1 L07 L22
lp_2231c ppiB
pep idylp olyl isome ase
M2_2_96 G07 Pla e_1 N07 N22
lp_2256 ccpA
ca aboli e con ol p o ein A
M2_2_96 H07 Pla e_1 P07 P22
lp_2301 ecA
ecombinase A
M2_2_96 A08 Pla e_1 B08 B23
lp_2323 px
hiol pe oxidase
M2_2_96 B08 Pla e_1 D08 D23
lp_2345 ddl
D
-alanine-D-alanine ligase M2_2_96 C08 Pla e_1 F08 F23
lp_2349 hicD3
L
-2-hyd oxyisocap oa e dehyd ogenase M2_2_96 D08 Pla e_1 H08 H23
lp_2359 m eB2
cell shape de e mining p o ein M eB
M2_2_96 E08 Pla e_1 J08 J23
lp_2366 a pA
H(+)
- anspo ing wo-sec o ATPase, alpha subuni M2_2_96 F08 Pla e_1 L08 L23
lp_2544 np 2
NADH
pe oxidase M2_2_96 G08 Pla e_1 N08 N23
lp_2596 p lA1
o ma e ace yl ans e ase ac i a ing enzyme
M2_2_96 H08 Pla e_1 P08 P23
lp_2598 p lB1
o ma e C
-ace yl ans e ase M2_2_96 A09 Pla e_1 B09 B24
lp_2681 gpd
glucose
-6-phospha e 1-dehyd ogenase M2_2_96 B09 Pla e_1 D09 D24
lp_2690 py E
o o a e phospho ibosyl ans e ase
M2_2_96 C09 Pla e_1 F09 F24
lp_2697 py D
dihyd oo o a e oxidase
M2_2_96 D09 Pla e_1 H09 H24
lp_2699 py C
dihyd oo o ase
M2_2_96 E09 Pla e_1 J09 J24
lp_2702 py B
aspa a e
ca bamoyl ans e ase M2_2_96 F09 Pla e_1 L09 L24
lp_2703 py R1
py imidine ope on egula o
M2_2_96 G09 Pla e_1 N09 N24
lp_2704 pu K1
phospho ibosylaminoimidazole ca boxylase, ATPase
subuni
M2_2_96 H09 Pla e_1 P09 P24
lp_2097 p s16ABC
uc ose PTS,
EIIABC M2_1_96 A10 Pla e_2 A01 A22
lp_2118 ig
igge ac o
M2_1_96 B10 Pla e_2 C01 C22
lp_2119 u
elonga ion ac o Tu
M2_1_96 C10 Pla e_2 E01 E22
lp_2146 ypA
GTP
-binding p o ein TypA M2_1_96 D10 Pla e_2 G01 G22
lp_2193 sZ
cell di ision p o ein
F sZ M2_1_96 E10 Pla e_2 I01 I22
lp_2290
in eg al memb ane p o ein
M2_1_96 F10 Pla e_2 K01 K22
lp_2324 gshA
glu ama e
-cys eine ligase (pu a i e) M2_1_96 G10 Pla e_2 M01 M22
lp_2331 psD
ibosomal p o ein S4
M2_1_96 H10 Pla e_2 O01 O22
lp_2486
cell
su ace p o ein p ecu so , GY amily M2_1_96 A11 Pla e_2 A02 A23
M. Kahala e al.
1016
Con inued
lp_2502 pgi
glucose
-6-phospha e isome ase M2_1_96 B11 Pla e_2 C02 C23
lp_2659 xpk1
phosphoke olase
M2_1_96 C11 Pla e_2 E02 E23
lp_2694 exB
ATP
-dependen nuclease, subuni B M2_1_96 D11 Pla e_2 G02 G23
lp_3001
cell su ace p o ein p ecu so (pu a i e)
M2_1_96 E11 Pla e_2 I02 I23
lp_3075
cell su ace p o ein (pu a i e)
M2_1_96 F11 Pla e_2 K02 K23
lp_3114
cell su ace p o ein p ecu so
M2_1_96 G11 Pla e_2 M02 M23
lp_3170 pmg9
phosphoglyce a e mu ase
M2_1_96 H11 Pla e_2 O02 O23
lp_3174 c a2
cyclop opane
- a y-acyl-phospholipid syn hase M2_1_96 A12 Pla e_2 A03 A24
lp_3204 nupC
nucleoside anspo p o ein
M2_1_96 B12 Pla e_2 C03 C24
lp_3313 p lB2
o ma e
C-ace yl ans e ase M2_1_96 C12 Pla e_2 E03 E24
lp_3421
ex acellula p o ein, gamma-D-glu ama e-
meso-diaminopimela e mu opep idase (pu a i e)
M2_1_96 D12 Pla e_2 G03 G24
lp_3485 melA
alpha
-galac osidase M2_1_96 E12 Pla e_2 I03 I24
lp_3551 xpk2
phosphoke olase
M2_1_96 F12 Pla e_2 K03 K24
lp_3662 adhE
bi unc ional p o ein: alcohol dehyd ogenase,
ace aldehyde dehyd ogenase
M2_1_96 G12 Pla e_2 M03 M24
lp_3665 pdc
p
-couma ic acid deca boxylase M2_1_96 H12 Pla e_2 O03 O24
lp_2728
hypo he ical
p o ein M2_2_96 A10 Pla e_2 B01 B22
lp_2766 y S
y osine
- RNA ligase M2_2_96 B10 Pla e_2 D01 D22
lp_2807 adh2
alcohol dehyd ogenase
M2_2_96 C10 Pla e_2 F01 F22
lp_2873 dhaT
1,3
-p opanediol dehyd ogenase M2_2_96 D10 Pla e_2 H01 H22
lp_3051 gabD
succina e
-semialdehyde dehyd ogenase (NAD(P)+) M2_2_96 E10 Pla e_2 J01 J22
lp_3092
uma a e educ ase, la op o ein subuni p ecu so ,
N- e minally unca ed
M2_2_96 F10 Pla e_2 L01 L22
lp_3125
cell su ace hyd olase, memb ane
-bound (pu a i e) M2_2_96 G10 Pla e_2 N01 N22
lp_3265 pu A
adenylosuccina e syn hase
M2_2_96 H10 Pla e_2 P01 P22
lp_3270 p lA2
o ma e ace yl ans e ase ac i a ing enzyme
M2_2_96 A11 Pla e_2 B02 B23
lp_3314 hsp3
small hea shock p o ein
M2_2_96 B11 Pla e_2 D02 D23
lp_3352
oxido educ ase
M2_2_96 C11 Pla e_2 F02 F23
lp_3403 galE4
UDP
-glucose 4-epime ase M2_2_96 D11 Pla e_2 H02 H23
lp_3482 galK
galac okinase
M2_2_96 E11 Pla e_2 J02 J23
lp_3484 lacM
be a
-galac osidase, small subuni M2_2_96 F11 Pla e_2 L02 L23
lp_3534 agl5
alpha
-glucosidase M2_2_96 G11 Pla e_2 N02 N23
lp_3544 gph3
phosphoglycola e phospha ase (pu a i e)
M2_2_96 H11 Pla e_2 P02 P23
lp_3545 gu B
L
-idi ol 2-dehyd ogenase M2_2_96 A12 Pla e_2 B03 B24
lp_3549
ansc ip ion egula o
M2_2_96 B12 Pla e_2 D03 D24
lp_3555 a aD
L
- ibulose 5-phospha e 4-epime ase M2_2_96 C12 Pla e_2 F03 F24
lp_3583 clpL
ATP-dependen Clp p o ease, ATP-binding subuni
ClpL
M2_2_96 D12 Pla e_2 H03 H24
lp_3586 lox
lac a e oxidase
M2_2_96 E12 Pla e_2 J03 J24
lp_3589 pox5
py u a e
oxidase M2_2_96 F12 Pla e_2 L03 L24
lp_3592 haD
hamnulose
-1-phospha e aldolase M2_2_96 G12 Pla e_2 N03 N24
lp_3603
suga
-phospha e aldolase M2_2_96 H12 Pla e_2 P03 P24