The use of macroarray as a simple tool to follow the metabolic profile of Lactobacillus plantarum during fermentation

Ad ances in Mic obiology, 2014, 4, 996-1016 Published Online Oc obe 2014 in SciRes. h p://www.sci p.o g/jou nal/aim h p://dx.doi.o g/10.4236/aim.2014.414111 How o ci e his pape : Kahala, M., Ahola, V., Mäkima ila, E., Paulin, L. and Jou sjoki, V. (2014) The Use o Mac oa ay as a Simple Tool o Follow he Me abolic P o ile o Lac obacillus plan a um du ing Fe men a ion. Ad ances in Mic obiology, 4, 996-1016. h p://dx.doi.o g/10.4236/aim.2014.414111 The Use o Mac oa ay as a Simple Tool o Follow he Me abolic P o ile o Lac obacillus plan a um du ing Fe men a ion Minna Kahala1, Vi pi Ahola2, Elina Mäkima ila1, La s Paulin3, Vesa Jou sjoki1 1Bio echnology and Food Resea ch, MTT Ag i ood Resea ch Finland, Jokioinen, Finland 2Depa men o Biosciences, Uni e si y o Helsinki, Helsinki, Finland 3Ins i u e o Bio echnology, Uni e si y o Helsinki, Helsinki, Finland Email: [email p o ec ed] Recei ed 25 June 2014; e ised 11 July 2014; accep ed 16 Augus 2014 Copy igh © 2014 by au ho s and Scien i ic Resea ch Publishing Inc. This wo k is licensed unde he C ea i e Commons A ibu ion In e na ional License (CC BY). h p://c ea i ecommons.o g/licenses/by/4.0/ Abs ac This s udy ocused on de ining he di e ences in L. plan a um gene exp ession le els in di e en media and in di e en g ow h phases using an easy and cos -e icien moni o ing o gene exp es- sion. A mac oa ay based on a g oup o selec ed L. plan a um genes, 178 genes belonging o 18 main g oups, p in ed on o a ni ocellulose il e was designed in his wo k. Using he mac o il e s designed, he exp ession o a selec ed se o L. plan a um genes was assayed in syn he ic MRS me- dium and in ex ac ed ca o juice. To compa e he po en ial di e ences o s a e gene exp es- sion in hygienic and con amina ed cul i a ion media, he L. plan a um s ain was cul i a ed in bo h s e ile and con amina ed (yeas and Esche ichia coli) MRS and ca o juice. The numbe o genes ound o be egula ed as a unc ion o g ow h was clea ly highe in MRS-based g ow h me- dium han in ca o juice, In ca o juice, exp ession o he gene encoding malolac ic enzyme (MLE), which makes L. plan a um an ad an ageous mic obe in e.g. wine making, was ound o be up egula ed in loga i hmic phase o g ow h. The cu en s udy demons a ed ha mac oa ays p in ed on ni ocellulose il e s wi h simple obo ic sys ems can be analyzed by s anda d labo a- o y equipmen and me hods usually a ailable in molecula labo a o ies. Using his echnology, apid and cos -e icien analysis o genome unc ion o L. plan a um can be ca ied ou e.g. in de- eloping egions, whe e lac ic acid e men a ion o ood and eed ma ices is a common p ac ice. Keywo ds Mac oa ay, Gene Exp ession, L. plan a um M. Kahala e al. 997 1. In oduc ion Lac ic acid bac e ia (LAB) a e widely used o he p ese a ion o ood and eed aw ma e ials and o in ensi y he la ou and ex u e o e men ed p oduc s. O he lac obacilli commonly used in ood p ocesses, Lac obacil- lus plan a um is impo an in he p oduc ion o many e men ed oods o bo h plan (pickled ege ables, silage, sou dough) and animal (d y e men sausages, e men ed ish, cheese) o igin [1]. This e sa ili y and ecological lexibili y is mos likely associa ed wi h he genome size o L. plan a um, which is one o he la ges known among LAB [2]. Based on comple e genome sequencing, L. plan a um has a capaci y o use a la ge a ie y o ca bon sou ces and encompasses a ela i ely high numbe o egula o y unc ions concen a ed wi hin a de ined genomic egion, which was designa ed he li es yle adap a ion egion [3]. These genomic ea u es exhibi an e - icien adap a ion capaci y o L. plan a um o e sa ile en i onmen al condi ions. Due o he abili y o main ain pH homeos asis a low ex e nal pH, L. plan a um is ole an o acidic en i on- men and o en becomes he dominan LAB a he end o spon aneous ege able e men a ion [4]. The e o e, his species is common in ege able and silage e men a ions. Ye , spon aneous e men a ion is gene ally poo ly con- olled and uns able, and he quali y o p oduc s a ies depending on e men ed ma e ial and inhe en mic obio a. Spon aneously e men ed ege ables may also con ain among o he hings biogenic amines, which ha e been asso- cia ed wi h ce ain oxicological cha ac e is ics and ou b eaks o ood poisoning. The o ma ion o biogenic amines has been ep essed by he use o a pu e L. plan a um s a e ins ead o spon aneous e men a ion [5]. Fo he abo e easons, well-cha ac e ized s a e cul u es wi h desi able p ope ies would be o pa icula impo ance. P e iously, he echnological p ope ies o po en ial s a e LAB could be de e mined almos exclusi ely in pilo - and ull-scale ood and eed p oduc ion expe imen s. Today, he de elopmen o molecula echniques has made possible he exploi a ion o genomic and p o eomic da a o he obse a ion o po en ial geno ypic and pheno ypic di e ences be ween indi idual s ains in speci ic g ow h condi ions. S udies based on L. plan a um DNA-mic oa ays [6], p o eomic pa e ns [7]-[10] and sequencing echnologies, like me agenomic sequencing and RNAseq [11]-[13] and ansc ip ional p o iling [14]-[17] ha e been ca ied ou o elucida e s ain-speci ic di e ences in genome composi ion and adap a ion o a ious g ow h condi ions. Bo h mic oa ay and p o eomic s udies equi e speci ic labo a o y acili ies and expe ise, which may no be a ailable in all esea ch labo a o ies. Ye , L. plan a um is used wo ldwide o ood and eed e men a ions and he e is a g owing demand o he design o s a e cul u es wi h well-cha ac e ized echnological p ope ies. Fo easy and cos -e icien moni o ing o gene exp ession in L. plan a um, a mac oa ay based on a g oup o se- lec ed L. plan a um genes p in ed on o a ni ocellulose il e was designed in his wo k. Using he mac o il e s designed, he exp ession o a selec ed se o L. plan a um genes was assayed in syn he ic MRS medium and in ex ac ed ca o juice. To compa e he po en ial di e ences o s a e gene exp ession in hygienic and con ami- na ed cul i a ion media, he s udied L. plan a um s ain was cul i a ed in bo h s e ile and con amina ed (yeas and Esche ichia coli) MRS and ca o juice. 2. Ma e ials and Me hods 2.1. Bac e ial S ains and G ow h Condi ions L. plan a um s ain MLBPL1 has been isola ed om saue k au [18] [19]. The s ain was ou inely g own in mi- c oae ophilic condi ions a 32˚C and main ained in MRS b o h (Di co, BD, F anklin Lakes, NJ, USA). Fo pla - ing, MRS was solidi ied wi h 1.5% aga . E. coli DH5 α , ca ying he plasmid ec o pBluesc ip , was g own in Lu ia Be ani b o h supplemen ed wi h ampicillin (50 µg/ml) as a selec i e agen a 37˚C 200 pm. Fo con- amina ion cul i a ions, a yeas and an E. coli s ain o igina ing om spoiled ege ables we e p opaga ed in YGC b o h a 30˚C and in Lu ia Be ani b o h a 37˚C, espec i ely. Fo mac oa ay analyses, L. plan a um s ain MLBPL1 was g own in syn he ic medium MRS and ca o juice. To simula e con amina ed g ow h condi ions, he spoiling E. coli and yeas s ains we e inocula ed in o MRS and ca o juice. Cul i a ions we e pe o med using Spec a/Po Floa -A-Lyze dialysis ube (MWCO 100 kDa, Spec um Labo a o ies, Rancho Dominguez, CA, USA) in o de o make i easie o sepa a e he L. plan a um cells, he ege able ma ix and he spoiling s ains o yeas and E. coli. By using he dialysis ube, no il e ing o plan ma e ial was needed and in addi ion, he cells o con amina ing s ains didn’ in e e e wi h he ex ac ion o RNA. Ca o juice was p epa ed om esh ege ables wi h a juice ex ac o . The ex ac ed juice was cen i- uged a 18,500 g o 40 min and pas eu ized in a wa e ba h a 95˚C o 30 min. An o e nigh cul u e o MLBPL1, g own in MRS-medium a 32˚C, was used o inocula e MRS b o h and M. Kahala e al. 998 ca o juice. Fo MRS cul i a ion, a 1% inoculumn was used. Fo ca o juice cul i a ion and con amina ion cul- i a ions, he inoculumn was cen i uged a 13,000 g o 3 min and he pelle was suspended in o cen i uged (18,500 g o 40 min) and il e -s e ilized (0.8/0.2 µm po e sizes) ca o juice (ca o cul i a ions) o MRS b o h (MRS con amina ion cul i a ion), a e which he suspension was ans e ed o a Spec a/Po Floa -A-Lyze dia- lysis ube. The ube was hen ans e ed o a bo le con aining ca o juice, con amina ed MRS b o h o con- amina ed ca o juice. In con amina ion cul i a ions, MRS b o h and ca o juice we e con amina ed by inocu- la ing hem wi h 1% E. coli and yeas . The cul i a ions we e pe o med a 32˚C. The g ow h was de e mined by pla ing on o MRS aga pla es app op ia e dilu ions om he samples aken du ing he g ow h. The pla es we e incuba ed a 32˚C o 48 h, un il single bac e ial colonies appea ed. 2.2. Ex ac ion and Labeling o RNA Bac e ial cells o he L. plan a um s ain MLBPL1 g own in MRS b o h and ca o juice we e ha es ed a ex- ponen ial (6 h) and s a iona y phase (14 h) o g ow h by cen i uga ion o 3 min a 4˚C a 11,000 g. The col- lec ed cells we e ozen immedia ely in liquid ni ogen and s o ed a −70˚C. Ex ac ion o o al RNA was ca ied ou wi h SV o al RNA isola ion sys em (P omega, Madison, WI, USA) wi h some modi ica ions o he p o ocol on he dis up ion o he cells. B ie ly, bac e ial cells hawed slowly on ice we e i s washed wi h s e ile wa e ea ed wi h die hyl py oca bona e (DEPC) and collec ed by cen i uga ion. Nex , he pelle was esuspended in o 225 µl o SV RNA lysis bu e o he P omega ki and ans e ed o an eppendo ube con aining 100 µl o ni ic acid-washed glass beads. The cells we e dis up ed wi h glass beads in a cell homogenize as desc ibed be- o e (Kahala, e al., 2008). A e ha , he lysa e was ans e ed o a new ube and 350 µl o SV RNA dilu ion bu e o he P omega ki was added pe 175 µl o lysa e. F om his s ep on, he ex ac ion was ca ied on as ecommended by he manu ac u e . Two echnical duplica es om he RNA ex ac ion on each cul u e medium and ha es ing poin we e made. mRNA was en iched om o al RNA samples by emo ing he 16S and 23S RNAs wi h MICROB Exp ess Bac e ial mRNA Pu i ica ion ki (Ambion, Aus in, TX, USA) acco ding o he ins uc ions o he manu ac u e . The RNA concen a ion was de e mined spec opho ome ically a 260 nm. The in eg i y o he isola ed p oka yo ic RNA was de e mined by o al RNA gel elec opho esis and No he n blo ca ied ou as desc ibed by [20]. To al RNA samples, dena u ed wi h glyoxal and dime hylsulphoxide, we e sepa a ed by size in a 1.0% (w/ ) aga ose gel in 10 mM sodium phospha e bu e , pH 6.5 ollowed by a ans e o a posi i ely cha ged nylon memb ane (Roche) and hyb idiza ion wi h a ldhD-speci ic 736 bp p obe, ampli ied wi h p ime pai 5’-AAGTTAGCCGACGAAGGG-3’ and 5’-CCATGTTGTGAACGGCAG-3’ a ge ed o L. plan a um s ain D90339.1. The p obe was labelled wi h digoxigenin-dUTP acco ding o he ins uc ions o he manu ac u e (Roche). Luminescen DIG de ec ion ki (Roche) was used o hyb id de ec ion. To de ec he po- en ial esidual ch omosomal DNA in he isola ed mRNA sample, p ime s 5’-AAGTTAGCCGACGAAGGG-3’ and 5’-GGGCGTATAATTCGTCCAAA-3’ designed o p oduce a 403 bp agmen om he a ge ldhD gene o L. plan a um s ain D90339.1 we e used. PCR-p ocedu e using Dynazyme II DNA polyme ase (Finnzymes, Espoo, Finland) was ca ied ou in he eac ion condi ions ecommended by he enzyme manu ac u e . cDNA was syn hesized by RT om DNA- ee mRNA and cDNA labelling was pe o med wi h an alkalilabile digoxigenin-11-dUTP (DIG) (Roche, Basel, Swi ze land) in a e e se ansc ip ion eac ion wi h Im-P om-II Re e se T ansc ip ion Sys em ki (P omega) as ollows: 1 µg o mRNA was mixed wi h 0.5 µg o andom hexame p ime s p o ided by he ki manu ac u e . The mix u e was hea ed a 70˚C o 5 min and chilled on ice o 5 min. cDNA syn hesis was ca ied ou by combining RNA-p ime mix u e wi h 1 × ImP om-II eac ion bu e , 5 mM MgCl2, 0.5 mM dATP, 0.5 mM dGTP, 0.5 mM dCTP, 0.325 mM dTTP, 0.175 mM DIG-11- dUTP, 1 U/µl RNasin Ribonuclease Inhibi o , and 1 µl ImP om-II Re e se T ansc ip ase. Annealing was pe - o med a 25˚C o 5 min, ollowed by ex ension a 43˚C o 1h and enzyme inac i a ion a 70˚C o 15 min. The labeled cDNA was pu i ied wi h Mic oa ay Ta ge Pu i ica ion ki (Roche) acco ding o he ins uc ions o he manu ac u e . 2.3. PCR and Labeling o he Posi i e Con ol o Mac oa ay Human-based HbGAM (hepa in-binding g ow h-associa ed molecule) gene [21] inse ed in o he plasmid pBluesc ip (Agilen Technologies, San a Cla a, CA) was ampli ied wi h polyme ase chain eac ion (PCR) o be used as a posi i e con ol in mac oa ay analyses. PCR eac ions we e ca ied ou wi h Dynazyme II DNA po- lyme ase (Finnzymes, Espoo, Finland) using he eac ion condi ions ecommended by he manu ac u e . Bac e- M. Kahala e al. 999 ial lysa e o he E. coli s ain DH5α, ha bou ing he ecombinan pBluesc ip -HbGAM plasmid o be used as a empla e o PCR, was ob ained by dis up ing he cells wi h glass beads. To ampli y he HbGAM gene, he p i- me pai 5’-GTAAAACGACGGCCAG-3’ and 5’-CAGGAAACAGCTATGAC-3’ a ge ing he plasmid was used. The ampli ied PCR p oduc was pu i ied wi h Wiza d® SV Gel and PCR Clean-Up Sys em (P omega) and labelled wi h DIG-11-dUTP using DIG-High P ime labeling ki (Roche). 2.4. Ampli ica ion o L. plan a um MLBPL1 Genes and Mac oa ay P in ing P ime s we e designed o he ampli ica ion o selec ed genes om he ully sequenced genome o L. plan a um WCFS1 [3]. The gene lis and designed p ime s a e lis ed in Supplemen 1. To enable an easy e-ampli ica ion o he PCR-p oduc s, uni e sal nucleo ide sequences we e added o he 5’ e mini o he speci ic o wa d and e e se p ime s. A nucleo ide sequence 5’ CCGCTGCTAGGCGCGCCGTG was added o he o wa d p ime s and, espec i ely, a nucleo ide sequence 5’ GCAGGGATGCGGCCGCTGAC was added o he e e se p ime s. Ampli ica ion o he selec ed genes was done as desc ibed o he posi i e con ol o mac oa ay. Fo he PCR eac ion, a 10 pmol p ime concen a ion and 20 ng o co esponding genomic empla e DNA we e used in a 100 µl eac ion olume in a 96 well PCR pla e. The success o he PCR ampli ica ion was checked by analyzing 5 µl om he eac ions on a 1% aga ose gel. The ob ained PCR p oduc s we e pu i ied using Mon age PCR Pu i ica- ion 96 Well Pla es (Millipo e). PCR agmen s in he 96 well pla es we e ans e ed o 384 pla es o p in ing on he ni ocellulose mac oa - ay (Supplemen 2). Pu i ied PCR agmen s we e g idded in duplica e on ni ocellulose memb anes wi h a QPix au oma ed colony picke (Gene ix L d., UK) using a 384-pin g idding head as desc ibed in [22]. 2.5. Hyb idiza ion and De ec ion Mac oa ays we e p ehyb idized o 2 h a 60˚C wi h 20 ml o DIG Easy Hyb bu e (Roche). Hyb idiza ions we e pe o med o e nigh a 60˚C wi h 6 ml DIG Easy Hyb bu e (Roche) con aining 5 µl o labeled cDNA p obe and HbGAM which was used as a posi i e con ol in hyb idiza ion eac ions. A e hyb idiza ion, mac oa ays we e washed wice a oom empe a u e o 5 min wi h washing solu ion con aining 2 × SSC (1 × SSC is 0.15 M NaCl and 15 mM sodium ci a e) and 0.1% sodium dodecyl sulpha e (SDS) and wice a 68˚C o 15 min wi h washing solu ion (0.1 × SSC, 0.1% SDS). Hyb idized spo s we e de ec ed wi h chemilumi- nesence-based DIG de ec ion ki (Roche) using CDP-S a (Roche) as a subs a e and chemiluminescence p oduced was de ec ed by Fluo Chem (Alpha Inno ech Co p., San Leand o, CA) gel image sys em. Fo e- p obing, he DIG-labelled p obe was emo ed wi h a ollowing p ocedu e. The memb ane was insed ho - oughly in s e ile wa e , washed wice wi h 0.2 M NaOH con aining 0.1% SDS a 37˚C o 20 min and insed wi h 2 × SSC o 5 min. 2.6. S a is ical Me hods The DNA p obes spo ed on he mac oa ay we e selec ed using esul s om he p e ious p o eomics esul s us- ing 2-DE and HPLC-ESI-MS/MS [8]. Addi ionally, compu a ionally p edic ed exp ession alues we e used o choosing he emaining p obes. Codon usage di e ences (codon bias) we e used o p edic ing gene exp ession le els o all 3009 genes o L. plan a um (C) [3], and he se o 63 genes encoding ibosomal p o eins (RB). Codon bias o a gene g wi h espec o gene se G was calcula ed by he o mula ( ) ( ) ( ) ( ) ( ) ,, ,, ,, a xyz a BgG pag xyz gxyz =  = −    ∑∑ (1) whe e (x,y,z) deno es a no malized equency o he codon iple (x,y,z) coding o an amino acid a in a gene g, g(x,y,z) deno es he equency o he codon iple (x,y,z) in he gene se G, and pa(g) is he ac ion o he amino acid a in he gene g [23]. The gene g was p edic ed as highly exp essed i he ela i e codon bias ( ) ( ) B gC RCB B g RB = (2) exceeded 1.05. The genes ob aining he g ea es RCB alues we e chosen o he DNA mac oa ay il e in addi- M. Kahala e al. 1000 ion o hose iden i ied by he HPLC-ESI-MS/MS. A e scanning o he mac oa ay images, he quan i ica ion o he hyb idized signals and backg ound sub- ac ion we e done by he TIGR Spo inde image p ocessing so wa e [24]. A e quan i ica ion and backg ound co ec ion, he signals we e no malized using median a ay in ensi ies. Finally, he exp ession le els o each gene and sample was ob ained by aking median o he no malized in ensi y alues ac oss he wo eplica es o each sample. Gene exp ession le els we e compa ed be ween MRS, ca o juice and con amina ed e sions o he g ow h media in exponen ial (6 h) and s a iona y (14 h) g ow h phases. The pai -wise compa isons we e made using old changes, a ios o he mean exp ession le els. Fold changes g ea e han wo a e epo ed in he esul s. All genes in he a ay we e g ouped in o unc ional g oups acco ding o hei main oles. Gene se en ichmen analysis was made o he gene se s wi h old change g ea e han wo in o de o es whe he any unc ional g oup is o e ep esen ed among he di e en ially exp essed genes be ween wo g ow h media. Ana- lyses we e made using SAS® (SAS o Windows 9.1). 3. Resul s G ow h a e o L. plan a um MLBPL1 cells was simila in MRS and ca o juice (Figu e 1). In eg i y and pu i y o he isola ed RNA we e demons a ed by No he n blo and PCR o he ldhD gene (da a no shown). The mac oa ay included 178 genes belonging o 18 main g oups. The la ges g oups we e ene gy me abolism (59 genes), p o ein syn hesis (30 genes), p o ein a e (10 genes), egula o y unc ions (10 genes), cell en elope (9 genes) and DNA me abolism (9 genes). O he 178 genes es ed, 18 (10%) showed a mean old change g ea e han 2.0 in a leas one o he en compa isons be ween g ow h media o g ow h phases (Table 1). The mos equen unc ions included we e ene gy me abolism, cell en elope, p o ein a e and nucleo ide me a- bolism. 3.1. Exp ession Le els o he Genes as a Func ion o G ow h The majo i y o he genes s udied on he memb anes showed no signi ican change in le els o exp ession du ing he g ow h o be ween he g ow h media. The numbe o he genes ound o be egula ed as a unc ion o g ow h was clea ly highe in MRS-based g ow h medium han in ca o juice, in which only genes in ol ed in a y acid and phospholipid me abolism showed di e en ial exp ession in di e en g ow h phases. The unc ion o he genes showing up egula ion in loga i hmic phase in MRS medium was mos ly ela ed o ene gy me abolism, bu also o cell di ision, cell en elope biosyn hesis and py imidine ibonucleo ide biosyn hesis. Gene a ion o su i- cien ene gy o g ow h in loga i hmic phase is impo an and was e idenced in he MRS based medium. In MRS cul i a ion, when en e ing in he s a iona y phase o g ow h, ansc ip ion o genes in ol ed in ene gy me abolic pa hways dec eased and highe exp ession le els we e ound o genes in ol ed in p o ein a e, p o- ein olding and s abiliza ion, like “ olding” chape ones DnaK and G oEL. In con amina ed MRS medium, es- pecially he exp ession le els o genes in ol ed in suga me abolism pa hways (galK, lacM) we e ound o be highe in loga i hmic phase. This e lec s highe demand o ene gy in he loga i hmic phase and p obably compe i ion be ween he Lac obacillus and con amina ing s ains in he u iliza ion o suga s ha a e needed o g ow h. Figu e 1. G ow h o L. plan a um MLBPL1 in wo g ow h media. 1.0E+06 1.0E+07 1.0E+08 1.0E+09 1.0E+10 0 5 10 15 20 25 CFU/ml ime/h MRS Ca o M. Kahala e al. 1001 Table 1. Genes and hei main oles showing mean old change > 2.0 in en compa isons among g ow h media and wo g ow h phases. Minus and plus signs show which o he compa ed g oups has highe exp ession: +: shows highe exp ession in he i s ; −: in he second g oup. Main ole gene ORF gene p oduc MRS s MRS con . 6 h MRS s MRS con . 14 h Ca o juice s Ca o juice con . 6 h Ca o juice s Ca o juice con . 14 h MRS s Ca o juice 6 h MRS s Ca o juice 14 h MRS 6h s 14 h MRS con . 6 h s 14 h Ca o juice 6 h s 14 h Ca o juice con 6 h s 14 h Ene gy me abolism— Py u a e dehyd ogenase pdhB lp_2153 py u a e dehyd ogenase complex, E1 componen , be a subuni −2.20 - - - - - - - - - Ene gy me abolism— Suga s galK lp_3482 galac okinase −3.01 - - - - - - +2.13 - - lacM lp_3484 be a-galac osidase, small subuni −2.30 - - - - - - +2.43 - - Ene gy me abolism— Glycolysis/ gluconeogenesis pyk lp_1897 py u a e kinase - - - - - −2.32 - - - - Ene gy me abolism— Pen ose phospha e pa hway piA1 lp_0602 ibose 5-phospha e epime ase - - - - - - +2.02 - - - DNA me abolism— DNA eplica ion, ecombina ion dnaN lp_0002 DNA-di ec ed DNA polyme ase III, be a chain - - - - - - - - - +2.15 Cellula p ocesses— Cell di ision sH lp_0547 cell di ision p o ein F sH, ATP-dependen zinc me allopep idase - −2.06 - - - - +2.28 - - - Cell en elope— Biosyn hesis and deg ada ion lp_0304 ex acellula p o ein - - - - - - +2.16 - - - Cell en elope—O he lp_2290 in eg al memb ane p o ein - - - - - - +2.41 - - - Signal ansduc ion— PTS p s16ABC lp_2097 uc ose PTS, EIIABC - −2.50 - - - −2.86 - - - - Enzymes o unknown speci ici y mleS lp_1118 malolac ic enzyme - - +2.32 +2.17 −2.56 −2.28 - - - - Fa y acid and phospholipid me abolism— Biosyn hesis abF lp_1675 3-oxoacyl-[acyl-ca ie p o ein] syn hase II - - - - - - - - +2.18 Pu ines, py imidines, nucleosides, and nucleo ides— Py imidine ibonucleo ide biosyn hesis py D, lp_2697 py C, lp_2699 dihyd oo o a e oxidase, dihyd oo o ase - - - - - - - - +3.74 +3.36 - - - +2.54 +2.02 - - - - - T anspo and binding p o eins— Amino acids, pep ides oppA lp_1261 oligopep ide ABC anspo e , subs a e binding p o ein - - - - −2.41 - - - - - P o ein a e— P o ein olding and s abiliza ion g oEL lp_0728 dnaK lp_2027 G oEL chape onin hea shock p o ein DnaK - - - - - - - - - - - - −2.25 −2.17 - - - - - - Unknown unc ion ypA lp_2146 lp_3092 GTP-binding p o ein TypA uma a e educ ase, la op o ein subuni p ecu so , N- e minally unca ed - - - - - - - - - - - - +2.45 −2.13 - - - - - - M. Kahala e al. 1002 3.2. Exp ession Le els o he Genes be ween Di e en G ow h Media The mRNA le el o se e al genes was shown o be egula ed in esponse o di e en g ow h media. A he ex- ponen ial (6 h) phase o g ow h, he genes encoding dihyd oo o a e oxidase and dihyd oo o ase enzymes we e di e en ially exp essed in MRS and ca o juice. They showed 3.7- and 3.4- old highe exp ession in he MRS compa ed o ca o juice g ow h medium, espec i ely (Table 1). Di e en ial exp ession (p = 0.015) o hese genes encoding p o eins in ol ed in py imidine ibonucleo ide biosyn hesis is an indica ion o dis inc gene eg- ula ion and, consequen ly, po en ially di e en a e o py imidine biosyn hesis in syn he ic MRS compa ed o ege able-based ca o juice cul i a ion medium. Exp ession o malolac ic enzyme (mle) gene was clea ly highe in loga i hmic phase when g own in plan based medium. Up egula ion o cell di ision p o ein F sH was obse ed in con amina ed MRS 14 h compa ed o MRS 14 h, p obably indica ing highe s ess esponse in con amina ed MRS. 4. Discussion This s udy ocused on de ining he di e ences in L. plan a um gene exp ession le els in di e en media and in di e en g ow h phases by he use o a simple and low-cos mac oa ay echnique. P e iously desc ibed DNA mac oa ay echnique [22] has been u he de eloped o s udying gene exp ession p o ile o he indus ially impo an lac ic acid bac e ium. Fe men a ion condi ions may d ama ically a ec unc ional cha ac e is ics o LAB [13]. Ma ked changes in exp ession le els upon en y in he s a iona y phase ha e been ound ou [25] [26]. Highly exp essed genes a e u ned o o ma kedly ep essed and genes, mos ly inac i e in he g owing cells, begin o be exp essed in he s a iona y phase [25] [26]. In his s udy, ansc ip ion o genes in ol ed in ene gy me abolic pa hways dec eased in s a iona y phase and highe exp ession le els we e ound o genes like “ olding” chape ones DnaK and G oEL. G oEL basal exp ession is enhanced by en i onmen al s ess, including ele a ed empe a u e, oxygen limi a ion, and nu ien dep i a ion [27] [28]. DnaK plays a cen al ole in p o ein olding, e olding, ansloca- ion and in he s ess condi ions. The ele a ed exp ession o hese genes is p obably a esponse o he diminish- ing nu ien s and high concen a ion o lac ic acid in he medium which is known o cause s ess especially in he la e-s a iona y phase [29]. P o eomic s udies by [10] has e ealed signi ican changes on e men a ion p o iles o L. plan a um s ains p e iously g own unde ood-like condi ions compa ed o cul i a ion in MRS b o h. In ou s udy, exp ession o a malolac ic enzyme (mle) gene in plan -based medium was ound o be up egula ed in loga i hmic phase o g ow h. Mle enzymes, in ol ed in deca boxyla ion o L-malic acid o L-lac ic acid and CO2 [30], ha e been pu- i ied om se e al lac ic acid bac e ia, including Leuconos oc mesen e oides, L. plan a um, and Leuconos oc oenos [31]. In se e al s udies, L. plan a um has been shown o ha e malolac ic ac i i y and he e o e is o in e - es in wine p oduc ion [32]. The signi icance o malolac ic ac i i y o LAB in saue k au e men a ion has also been epo ed. Con e sion o malic acid in o lac ic acid be o e signi ican suga me abolism may play some ole in ea ly e men a ion [30] [33]. Highe exp ession o cell di ision p o ein F sH in con amina ed MRS compa ed o MRS p obably indica ed highe s ess esponse in con amina ed MRS. Func ional s udies ha e e ealed an impo an ole o F sH in he bac e ial s ess esponse. In se e al bac e ia, including E. coli, B. sub ilis, Lac ococcus lac is, O. oeni, Helico- bac e pylo i, and L. plan a um, sH exp ession is induced in esponse o hea and o he s ess ac o s con olled by addi ional egula o s [34]. Mac oa ay was ound o be an applicable me hod o s udying exp ession o de ined genes o L. plan a um du ing e men a ion. Mac oa ay echnology has been success ully applied also e.g. o he de ec ion o pa ho- gens in chicken samples [35] and s udies on en i onmen al samples o he p esence o speci ic an ibio ic esis- ance genes [36] communi ies o diazo ophs [37], and exp ession o 375 genes in L. lac is subsp. lac is IL1403 du ing s ess condi ions [38]. L. plan a um is encoun e ed in a a ie y o en i onmen al niches, which include dai y, mea and many ege- able o plan e men a ions as well as he human gas oin es inal ac . Because o his lexibili y and e sa ili y, s ains o his species ha e been adi ionally used o ood and eed p ese a ion and as s a e s in he manu ac- u e o e men ed p oduc s. Fo me ly, he echnological p ope ies and sui abili y o ce ain s ains o selec ed applica ions could be ensu ed almos exclusi ely by labo ious and ime-consuming ood p ocessing and p ese - a ion expe imen s. Today, he long his o y o use and on he o he hand he de elopmen o molecula and ge- M. Kahala e al. 1003 nomic echniques ha e made L. plan a um one o he mos s udies ood mic obes. Mode n DNA mic oa ay [6], nex -gene a ion sequencing echnologies [39] and especially ansc ip omic s udies a e accu a e and sensi i e and ha e enabled he de ailed examina ion o L. plan a um genome s uc u e and unc ion. The mos ad anced echnologies, howe e , equi e speci ic ins umen a ion and ha e o en high unning cos s, which may ule ou hei use in many cases. The cu en s udy demons a ed ha mac oa ays p in ed on ni ocellulose il e s wi h simple obo ic sys ems can be analyzed by s anda d labo a o y equipmen and me hods usually a ailable in mo- lecula labo a o ies. Using his echnology, apid and cos -e icien analysis o genome unc ion o L. plan a um can be ca ied ou e.g. in de eloping egions, whe e lac ic acid e men a ion o ood an eed ma ices is a com- mon p ac ice, bu esea ch and analysis labo a o ies o en lack he mos expensi e speci ic labo a o y ins u- men a ion. Acknowledgemen s Tekes, he Finnish Funding Agency o Technology and Inno a ion, is g a e ully acknowledged o he inancial suppo o his wo k. The au ho s wish o hank Anneli Paloposki o he skil ul echnical assis ance, A i-Ma i Sa én o designing he p ime s, Ma kku Ala-Pan i and Hannu Väänänen o p in ing he memb anes. Re e ences [1] Rose, A. (1982) His o y and Scien i ic Basis o Mic obial Ac i i y in Fe men ed Foods. In: Rose, A., Ed., Fe men ed Foods, Academic P ess, New Yo k, 1-13. [2] Che allie , B., Hube , J.C. and Kamme e , B. (1994) De e mina ion o Ch omosome Size and Numbe o n Loci in Lac obacillus plan a um by Pulsed-Field Gel Elec opho esis. FEMS Mic obiology Le e s, 120, 51-56. h p://dx.doi.o g/doi:10.1111/j.1574-6968.1994. b07006.x [3] Klee ebezem, M., Boekho s , J., an K anenbu g, R., Molenaa , D., Kuipe s, O.P., Lee , R., Ta chini, R., Pe e s, S.A., Sandb ink H.M., Fie s, M., S iekema, W., Lankho s , R., B on, P., Ho e , S., G oo , M., Ke kho en, R., de V ies, M., U sing, B., de Vos, W.M. and Siezen, R.J. (2003) Comple e Genome Sequence o Lac obacillus plan a um WCFS1. P oceedings o he Na ional Academy o Sciences o he Uni ed S a es o Ame ica, 100, 1990-1995. h p://dx.doi.o g/10.1073/pnas.0337704100 [4] McDonald, L.C., Fleming, H.P. and Hassan, H.M. (1990) Acid Tole ance o Leuconos oc mesen e oides and Lac oba- cillus plan a um. Applied and En i onmen al Mic obiology, 56, 2120-2124. [5] Mäki, M. (2004) Lac ic Acid Bac e ia in Vege able Fe men a ions. In: Salminen, S., on W igh , A. and Ouwehand, A., Eds., Lac ic Acid Bac e ia: Mic obiological and Func ional Aspec s, 2nd Edi ion, Ma cel Dekke , Inc., New Yo k, 419-430. h p://dx.doi.o g/10.1201/9780824752033.ch14 [6] Molenaa , D., B ingel, F., Schu en, F.H., De Vos, W.M., Siezen, R.J. and Klee ebezem, M. (2005) Explo ing Lac oba- cillus plan a um Genome Di e si y by Using Mic oa ays. Jou nal o Bac e iology, 187, 6119-6127. [7] Kois inen, K.M., Plumed-Fe e , C., Lehes an a, S.J., Kä enlampi, S.O. and on W igh , A. (2007) Compa ison o G ow h-Phase-Dependen Cy osolic P o eomes o Two Lac obacillus plan a um S ains Used in Food and Feed Fe - men a ions. FEMS Mic obiology Le e s, 273, 12-21. h p://dx.doi.o g/10.1111/j.1574-6968.2007.00775.x [8] Plumed-Fe e , C., Kois inen, K.M., Tolonen, T.L., Lehes an a, S.J., Kä enlampi, S.O., Mäkima ila, E., Jou sjoki, V., Vi anen, V. and on W igh , A. (2008) Compa a i e S udy o Suga Fe men a ion and P o ein Exp ession Pa e ns o Two Lac obacillus plan a um S ains G own in Th ee Di e en Media. Applied and En i onmen al Mic obiology, 74, 5349-5358. h p://dx.doi.o g/10.1128/AEM.00324-08 [9] Di Cagno, R., Su ico, R.F., Si agusa, S., De Angelis, M., Pa adiso, A., Mine ini, F., De Ga a, L. and Gobbe i, M. (2008) Selec ion and Use o Au och honous Mixed S a e o Lac ic Acid Fe men a ion o Ca o s, F ench Beans o Ma ows. In e na ional Jou nal o Food Mic obiology, 127, 220-228. h p://dx.doi.o g/10.1016/j.ij oodmic o.2008.07.010 [10] Si agusa, S., De Angelis, M., Calasso, M., Campanella, D., Mine ini, F., Di Cagno, R. and Gobbe i, M. (2013) Fe - men a ion and P o eome P o iles o Lac obacillus plan a um S ains du ing G ow h unde Food-Like Condi ions. Jou - nal o P o eomics, 96, 366-380. h p://dx.doi.o g/10.1016/j.jp o .2013.11.003 [11] S e ens, M.J.A., Wie sma, A., de Vos, W.M., Kuipe s, O.P., Smid, E.J., Molenaa , D. and Klee ebezem, M. (2008) Im- p o emen o Lac obacillus plan a um Ae obic G ow h as Di ec ed by Comp ehensi e T ansc ip ome Analysis. Ap- plied and En i onmen al Mic obiology, 74, 4776-4778. h p://dx.doi.o g/10.1128/AEM.00136-08 [12] Wels, M., O e ma s, L., F ancke, C., Klee ebezem, M. and Siezen, R.J. (2011) Recons uc ion o he Regula o y Ne - wo k o Lac obacillus plan a um WCFS1 on Basis o Co ela ed Gene Exp ession and Conse ed Regula o y Mo i s. M. Kahala e al. 1004 Mic obial Bio echnology, 4, 333-344. h p://dx.doi.o g/10.1111/j.1751-7915.2010.00217.x [13] B on, P.A., Wels, M., Bonge s, R.S., de Veen, H., Wie sma, A., O e ma s, L., Ma co, M.L. and Klee ebezem, M. (2012) T ansc ip omes Re eal Gene ic Signa u es Unde lying Physiological Va ia ions Imposed by Di e en Fe men- a ion Condi ions in Lac obacillus plan a um. PloS ONE, 7, e38720. h p://dx.doi.o g/10.1371/jou nal.pone.0038720 [14] Re e ón, I., Ri as, B., Muñoz, R. and de Felipe, F.L. (2012) Genome-Wide T ansc ip omic Responses o a Human Iso- la e o Lac obacillus plan a um Exposed o p-Couma ic Acid S ess. Molecula Nu i ion & Food Resea ch, 56, 1848- 1859. h p://dx.doi.o g/10.1002/mn .201200384 [15] Tod , T.J., Wels, M., Bonge s, R.S., Siezen, R.S., an Hijum, S.A.F.T. and Klee ebezem, M. (2012) Genome-Wide P edic ion and Valida ion o Sigma70 P omo e s in Lac obacillus plan a um WCFS1. PloS ONE, 7, e45097. h p://dx.doi.o g/10.1371/jou nal.pone.0045097 [16] de Veen, H., Abee, T., Tempelaa s, M., B on, P.A., Klee ebezem, M. and Ma co, M.L. (2011) Sho - and Long-Te m Adap a ion o E hanol S ess and I s C oss-P o ec i e Consequences in Lac obacillus plan a um. Applied and En i on- men al Mic obiology, 77, 5247-5256. h p://dx.doi.o g/10.1128/AEM.00515-11 [17] Wegkamp, A., Ma s, A.E., Faijes, M., Molenaa , D., de Vos, R.C.H., Klaus, S.M.J., Hanson, A.D., de Vos, W.M. and Smid, E.J. (2010) Physiological Responses o Fola e O e p oduc ion in Lac obacillus plan a um WCFS1. Mic obial Cell Fac o ies, 9, 100. h p://dx.doi.o g/10.1186/1475-2859-9-100 [18] Tamminen, M., Mäki, M. and Jou sjoki, T. (2003) Di e en ia ion o Lac obacilli Rela ed o Lac obacillus plan a um om Na u ally Fe men ed Cucumbe s and Whi e Cabbage. Applied Bio echnology, Food Science and Policy, 1, 125- 128. [19] Tamminen, M., Jou sjoki, T., Sjöblom, M., Jou sen, M., Pal a, A., Ryhänen, E.L. and Jou sjoki, V. (2004) Sc eening o Lac ic Acid Bac e ia om Fe men ed Vege ables by Ca bohyd a e P o iling and PCR-ELISA. Le e s in Applied Mi- c obiology, 39, 439-444. h p://dx.doi.o g/10.1111/j.1472-765X.2004.01607.x [20] Hames, B. and Higgins, S. (1985) Nucleic Acid Hyb idiza ion: A P ac ical App oach. IRL P ess, Ox o d. [21] Raulo, E., Che nouso , M.A., Ca ey, D.J., Nolo, R. and Rau ala, H. (1994) Isola ion o a Neu onal Cell Su ace Re- cep o o Hepa in Binding G ow h-Associa ed Molecule (HB-GAM). Iden i ica ion as N-Syndecan (Syndecan-3). The Jou nal o Biological Chemis y, 269, 12999-13004. [22] Hul man, J., Pi kä an a, M., Roman schuk, M., Au inen, P. and Paulin, L. (2008) P obe-Based Nega i e Selec ion o Unde ep esen ed Phylo ypes in La ge En i onmen al Clone Lib a ies. Jou nal o Mic obiological Me hods, 75, 457- 463. h p://dx.doi.o g/10.1016/j.mime .2008.07.016 [23] Ka lin, S. and M ázek, J. (2000) P edic ed Highly Exp essed Genes o Di e se P oka yo ic Genomes. Jou nal o Bac- e iology, 182, 5238-5250. h p://dx.doi.o g/10.1128/JB.182.18.5238-5250.2000 [24] Saeed, A.I., Sha o , V., Whi e, J., Li, J., Liang, W., Bhagaba i, N., B ais ed, J., Klapa, M., Cu ie , T., Thiaga ajan, M., S u n, A., Snu in, M., Rezan se , A., Popo , D., Ryl so , A., Kos uko ich, E., Bo iso sky, I., Liu, Z., Vinsa ich, A., T ush, V. and Quackenbush, J. (2003) TM4: A F ee, Open-Sou ce Sys em o Mic oa ay Da a Managemen and Ana- lysis. BioTechniques, 34, 374-378. h p://dx.doi. g/12613259 [25] Ishihama, A. (1997) Adap a ion o Gene Exp ession in S a iona y Phase Bac e ia. Cu en Opinion in Gene ics and De elopmen , 7, 582-588. h p://dx.doi.o g/10.1016/S0959-437X(97)80003-2 [26] Ishihama, A. (1999) Modula ion o he Nucleoid, he T ansc ip ion Appa a us, and he T ansla ion Machine y in Bac- e ia o S a iona y Phase Su i al. Genes o Cells, 4, 135-143. h p://dx.doi.o g/10.1046/j.1365-2443.1999.00247.x [27] Be gonzelli, G.E., G ana o, D., P idmo e, R.D., Ma in-Guy, L.F., Donnicola, D. and Co hésy-Theulaz, I.E. (2006) G oEL o Lac obacillus johnsonii La1 (NCC 533) Is Cell Su ace Associa ed: Po en ial Role in In e ac ions wi h he Hos and he Gas ic Pa hogen Helicobac e pylo i. In ec ion and Immuni y, 74, 425-434. h p://dx.doi.o g/10.1128/IAI.74.1.425-434.2006 [28] Lambe i, C., Mangiapane, E., Pessione, A., Mazzoli, R., Giun a, C. and Pessione, E. (2011) P o eomic Cha ac e iza- ion o a Selenium-Me abolizing P obio ic Lac obacillus eu e i Lb2 BM o Nu aceu ical Applica ions. P o eomics, 11, 2212-2221. h p://dx.doi.o g/10.1002/pmic.201000747 [29] Cohen, D.P.A., Renes, J., Bouwman, F.G., Zoe endal, E.G., Ma iman, E., de Vos, W.M. and Vaughan, E.E. (2006) P o eomic Analysis o Log o S a iona y G ow h Phase Lac obacillus plan a um Cells and a 2-DE Da abase. P o eo- mics, 6, 6485-6493. h p://dx.doi.o g/10.1002/pmic.200600361 [30] Johanningsmeie , S.D., Fleming, H.P. and B eid J ., F. (2004) Malolac ic Ac i i y o Lac ic Acid Bac e ia du ing Saue k au Fe men a ion. Jou nal o Food Science, 69, M222-M227. h p://dx.doi.o g/10.1111/j.1365-2621.2004. b09891.x [31] Laba e, C., Guzzo, J., Ca in, J.F., Di iès, C., Laba e, C. and Guzzo, J. (1996) Cloning and Cha ac e iza ion o he Genes Encoding he Malolac ic Enzyme and he Mala e Pe mease o Leuconos oc oenos. Applied and En i onmen al Mic obiology, 62, 1274-1282. M. Kahala e al. 1011 Con inued lp_2256 2039314 2040324 337 - ccpA ca aboli e con ol p o ein A 625 AGGCTAAGATT CCGTTTGAC 1008 AATCAGCAGACTT GGTTGAG 383 lp_2301 2078957 2080099 381 - ecA ecombinase A 678 GCAGAACAGAT CAAGGAAGG 1077 TACTTTGACCTTT ACTGCCA 399 lp_2323 2100621 2101115 165 - px hiol pe oxidase 150 ATGCCAGATAT TGATACGCG 463 GCAACGTAATTTG GCTCGTG 313 lp_2345 2120498 2121610 371 - ddl D-alanine-D-alanine ligase 616 CCGATGCGTTC AAATATGAC 1021 GCCGTATAACTAA TGCCCGA 405 lp_2349 2123935 2124852 306 - hicD3 L-2-hyd oxyisocap oa e dehyd ogenase 467 AAAGTATGTCG GACAAGCAG 863 TAACGACGCTCGT TCATCAG 396 lp_2359 2130199 2131200 334 - m eB2 cell shape de e mining p o ein M eB 467 GACTAGTGATA TCGCTGTCC 853 CCACCAGTCAACG TAATTCC 386 lp_2366 2137118 2138632 505 - a pA H(+)- anspo ing wo-sec o ATPase, alpha subuni 950 AATTATCGAAA CGCAAGCTG 1364 ACGGGCAATATCA TCAACTG 414 lp_2544 2269594 2270949 452 + np 2 NADH pe oxidase 848 GACCTTAGTCC CATTTGCCC 1264 GCTAAGTCAGCAA CAGTCAG 416 lp_2596 2313948 2314751 268 - p lA1 o ma e ace yl ans e ase ac i a ing enzyme 374 TGAGACAACTG GTTACGCAC 793 TTCACCCGTACTT TAACACC 419 lp_2598 2315865 2318309 815 + p lB1 o ma e C-ace yl ans e ase 1991 AACCTCTTCTAT TTCGGCCA 2404 GTTTCTTTGGATA GGCCCAC 413 lp_2681 2380421 2381905 495 + gpd glucose-6-phospha e 1-dehyd ogenase 937 CTTTCGTCGCTG GTAAAGTC 1355 AACGAATTTCCAC GAATCGG 418 lp_2690 2398345 2398983 213 - py E o o a e phospho ibosyl ans e ase 97 GTATTCGCCAA CCAGAACAG 490 GTACCGGCATCAT TGATCAG 393 lp_2697 2398345 2398983 213 - py E o o a e phospho ibosyl ans e ase 97 GTATTCGCCAA CCAGAACAG 490 GTACCGGCATCAT TGATCAG 393 lp_2699 2399695 2400612 306 - py D dihyd oo o a e oxidase 124 TGACGATTTCTT ATCCGGCG 527 GTTGGACAAACTG AACAGCG 403 lp_2702 2404915 2406207 431 - py C dihyd oo o ase 422 ATTTGGAACTG ATCCAGCGA 838 ATGTCTGTACAAG CAGTCGG 416 lp_2703 2406211 2407146 312 - py B aspa a e ca bamoyl ans e ase 869 GTTAGTTGCGG GATTGTTGG 1284 GCGTTTCCTTTCC ATATGCC 415 lp_2704 2407293 2407835 181 - py R1 py imidine ope on egula o 554 CAAAGAATGGT ATGGCCGTG 932 AACCTCCACTTGA GTTGCTG 378 lp_2728 2428365 2429495 377 - pu K1 phospho ibosylaminoimidazole ca boxylase, ATPase subuni 11 AGTCGTTGATG CAATGACCA 411 GTCCACGATCGAC TAAGACC 400 lp_2766 2457282 2458373 364 + hypo he ical p o ein 680 AGCTAATGTTC AGCCCAGTG 1073 TAATACGGTGACA TGACCCA 393 lp_2807 2504803 2506059 419 - y S y osine- RNA ligase 540 TCAAATGATGC GACTTATGG 950 GTATTGCCCAAAC TCATCGT 410 lp_2873 2558269 2559309 347 - adh2 alcohol dehyd ogenase 760 TCAACCAGGAT GATCGAGAC 1144 CCATTGATTCGAA TCGCACC 384 lp_3051 2712741 2713913 391 + dhaT 1,3-p opanediol dehyd ogenase 440 AGCCTTAGCTG ACGTAATGG 856 CGTAAGCCAATGT TCTTCCA 416 lp_3092 2751334 2752746 471 + gabD succina e-semialdehyde dehyd ogenase (NAD(P)+) 682 AAACATCATTA CGCGAAGCC 1092 CGTCTTTAAGCGC ATTAGTC 410 lp_3125 2791021 2792502 494 + uma a e educ ase, la op o ein subuni p ecu so , N- e minally unca ed 864 AAATTAGTCCC TGGCGATCC 1270 AGTTCTGGTAAGG AGCTGAG 406 lp_3265 2904444 2905385 314 + cell su ace hyd olase, memb ane-bound (pu a i e) 960 GGGAACTTCAT GGGCTTAGG 1371 ACGTATCACCAGT TAGTCCA 411 lp_3270 2910392 2911681 430 + pu A adenylosuccina e syn hase 474 CGTCACACGGA TATCATCCT 896 TTGATACTCGGCA GGATCGA 422 lp_3314 2951354 2952175 274 + p lA2 o ma e ace yl ans e ase ac i a ing enzyme 850 AAGTCGGTGAT TTCATTCGT 1266 TAACGTTAGTTTG TTGGCGA 416 lp_3352 2981556 2981999 148 - hsp3 small hea shock p o ein 398 GTTCGAACGTC TAATGAAGG 794 CTTGTACCCGTTG TAATCAG 396 lp_3403 3017894 3018754 287 - oxido educ ase 64 TGGACGATTTG GTTAATGGA 431 AATATGATGGGTA TCCGCAG 367 lp_3480 3089259 3090263 335 - UTP-galac ose-1-P u idylyl ans e ase 321 GTTGACCTCTAC TTGATCCA 711 AGAAACCGTGTTG TAATGAC 390 lp_3484 3093639 3094598 320 + lacM be a-galac osidase, small subuni 486 GGTCTGCGGTTT ATCATACC 882 AACTATCAATGCC ACCGACC 396 M. Kahala e al. 1012 Con inued lp_3534 3151784 3154084 767 + agl5 alpha-glucosidase 1834 GTGACGACATAC TAGTTGCC 2242 AATTCAACTGTGA TCTGCTG 408 lp_3544 3163853 3164476 208 - gph3 phosphoglycola e phospha ase (pu a i e) 143 CGGTGAGATGAT CCTGAGAG 517 CCTGCATTCTTTG AAGCCTG 374 lp_3545 3164582 3165640 353 - gu B L-idi ol 2-dehyd ogenase 575 TGTTTCTGGGAT CACTAAGG 969 AGTGTTCAAGATC AAAGACC 394 lp_3549 3168152 3168919 256 + ansc ip ion egula o 285 TTCCTAGATTAT GGCACCAC 685 GCGTCCACGTTAC TAATGTC 400 lp_3555 3174155 3174883 243 - a aD L- ibulose 5-phospha e 4-epime ase 305 CTATGCAGCTGC TCAAATGG 716 TGCATGATCCTTA GAATGCG 411 lp_3583 3199392 3201506 705 - clpL ATP-dependen Clp p o ease, ATP-binding subuni ClpL 1698 ATCGCTACTTCT AATGCTGG 2110 GCTGCCGATATCA CAATCTC 412 lp_3586 3202767 3203867 367 - lox lac a e oxidase 628 TCATGGAAATCT ATGCTGCT 1029 GCTCATCATTAAG GTGACTC 401 lp_3589 3206328 3208139 604 - pox5 py u a e oxidase 1319 GGTGTTTAATCT GGCTGGTG 1734 AATCTTGAGCTTC ATACCGT 415 lp_3592 3209669 3210514 282 - haD hamnulose-1-phospha e aldolase 376 CTCGGTTGAAGC AAGATCCT 783 AACGCTTGATTAA GTCACGG 407 lp_3603 3219914 3220636 241 + suga -phospha e aldolase 258 CAACAAATTGAC GGTGTAGG 685 TGGTACTGCTTAA TTAGCCC 427 Supplemen 2. T ans e o he ampli ied PCR p oduc s o 348 well pla es o 384-pin g idding on o ni ocellulose mem- b anes. ORF Gene P oduc Pla e_96 96 Well Ta ge Pla e 384 Well 384 Well lp_0175 malE mal ose/mal odex in ABC anspo e , subs a e binding p o ein M2_1_96 A01 Pla e_1 A01 A16 lp_0230 p s2CB manni ol PTS, EIICB M2_1_96 B01 Pla e_1 C01 C16 lp_0233 m lD manni ol -1-phospha e 5-dehyd ogenase M2_1_96 C01 Pla e_1 E01 E16 lp_0257 pepM me hionyl aminopep idase M2_1_96 D01 Pla e_1 G01 G16 lp_0302 ex acellula p o ein M2_1_96 E01 Pla e_1 I01 I16 lp_0304 ex acellula p o ein M2_1_96 F01 Pla e_1 K01 K16 lp_0330 ba uc ose -bisphospha e aldolase M2_1_96 G01 Pla e_1 M01 M16 lp_0447 m aA hyd oxyme hylglu a yl -CoA educ ase M2_1_96 H01 Pla e_1 O01 O16 lp_0480 poE DNA -di ec ed RNA polyme ase, del a subuni M2_1_96 A02 Pla e_1 A02 A17 lp_0537 ldhL1 L -lac a e dehyd ogenase M2_1_96 B02 Pla e_1 C02 C17 lp_0539 m d ansc ip ion - epai coupling ac o M2_1_96 C02 Pla e_1 E02 E17 lp_0547 sH cell di ision p o ein F sH, ATP-dependen zinc me allopep idase M2_1_96 D02 Pla e_1 G02 G17 lp_0576 p s9C mannose PTS, EIIC M2_1_96 E02 Pla e_1 I02 I17 lp_0577 p s9D mannose PTS, EIID M2_1_96 F02 Pla e_1 K02 K17 lp_0601 pepC1 cys eine aminopep idase M2_1_96 G02 Pla e_1 M02 M17 lp_0609 gl X glu ama e - RNA ligase M2_1_96 H02 Pla e_1 O02 O17 lp_0619 plK ibosomal p o ein L11 M2_1_96 A03 Pla e_1 A03 A18 lp_0620 plA ibosomal p o ein L1 M2_1_96 B03 Pla e_1 C03 C18 lp_0621 plJ ibosomal p o ein L10 M2_1_96 C03 Pla e_1 E03 E18 lp_0690 in eg al memb ane p o ein (pu a i e) M2_1_96 D03 Pla e_1 G03 G18 lp_0692 n dF ibonucleoside -diphospha e educ ase, be a chain M2_1_96 E03 Pla e_1 I03 I18 lp_0715 phnD phosphona es ABC anspo e , subs a e binding p o ein (pu a i e) M2_1_96 F03 Pla e_1 K03 K18 lp_0728 g oEL G oEL chape onin M2_1_96 G03 Pla e_1 M03 M18 lp_0757 galU UTP -glucose-1-phospha e u idylyl ans e ase M2_1_96 H03 Pla e_1 O03 O18 lp_0786 clpP endopep idase Clp, p o eoly ic subuni M2_1_96 A04 Pla e_1 A04 A19 M. Kahala e al. 1013 Con inued lp_0789 gapB glyce aldehyde 3 -phospha e dehyd ogenase M2_1_96 B04 Pla e_1 C04 C19 lp_0790 pgk phosphoglyce a e kinase M2_1_96 C04 Pla e_1 E04 E19 lp_0791 piA iosephospha e isome ase M2_1_96 D04 Pla e_1 G04 G19 lp_0792 enoA1 phosphopy u a e hyd a ase M2_1_96 E04 Pla e_1 I04 I19 lp_0800 cell su ace p o ein p ecu so M2_1_96 F04 Pla e_1 K04 K19 lp_0923 cell su ace p o ein p ecu so M2_1_96 G04 Pla e_1 M04 M19 lp_0938 hsdR ype I si e -speci ic deoxy ibonuclease, HsdR subuni M2_1_96 H04 Pla e_1 O04 O19 lp_0959 pepD3 dipep idase M2_1_96 A05 Pla e_1 A05 A20 lp_1012 se S2 se ine - RNA ligase M2_1_96 B05 Pla e_1 C05 C20 lp_1021 poB DNA -di ec ed RNA polyme ase, be a subuni M2_1_96 C05 Pla e_1 E05 E20 lp_1022 poC DNA -di ec ed RNA polyme ase, be a’ subuni M2_1_96 D05 Pla e_1 G05 G20 lp_1025 psL ibosomal p o ein S12 M2_1_96 E05 Pla e_1 I05 I20 lp_1026 psG ibosomal p o ein S7 M2_1_96 F05 Pla e_1 K05 K20 lp_1027 usA2 elonga ion ac o G M2_1_96 G05 Pla e_1 M05 M20 lp_1033 plC ibosomal p o ein L3 M2_1_96 H05 Pla e_1 O05 O20 lp_1034 plD ibosomal p o ein L4 M2_1_96 A06 Pla e_1 A06 A21 lp_1036 plB ibosomal p o ein L2 M2_1_96 B06 Pla e_1 C06 C21 lp_1040 psC ibosomal p o ein S3 M2_1_96 C06 Pla e_1 E06 E21 lp_1041 plP ibosomal p o ein L16 M2_1_96 D06 Pla e_1 G06 G21 lp_1047 plE ibosomal p o ein L5 M2_1_96 E06 Pla e_1 I06 I21 lp_1051 plF ibosomal p o ein L6 M2_1_96 F06 Pla e_1 K06 K21 lp_1053 psE ibosomal p o ein S5 M2_1_96 G06 Pla e_1 M06 M21 lp_1055 plO ibosomal p o ein L15 M2_1_96 H06 Pla e_1 O06 O21 lp_1058 adk adenyla e kinase M2_1_96 A07 Pla e_1 A07 A22 lp_1062 poA DNA -di ec ed RNA polyme ase, alpha subuni M2_1_96 B07 Pla e_1 C07 C22 lp_1070 lipop o ein p ecu so M2_1_96 C07 Pla e_1 E07 E22 lp_1077 plM ibosomal p o ein L13 M2_1_96 D07 Pla e_1 G07 G22 lp_1118 mleS malolac ic enzyme M2_1_96 E07 Pla e_1 I07 I22 lp_1261 oppA oligopep ide ABC anspo e , subs a e binding p o ein M2_1_96 F07 Pla e_1 K07 K22 lp_1274 p sI phosphoenolpy u a e -p o ein phospha ase M2_1_96 G07 Pla e_1 M07 M22 lp_1316 leuS leucine - RNA ligase M2_1_96 H07 Pla e_1 O07 O22 lp_1329 dgk2 deoxyguanosine kinase M2_1_96 A08 Pla e_1 A08 A23 lp_1468 ABC anspo e , ATP -binding p o ein M2_1_96 B08 Pla e_1 C08 C23 lp_1508 polA DNA -di ec ed DNA polyme ase I M2_1_96 C08 Pla e_1 E08 E23 lp_1514 h S h eonine - RNA ligase 1 M2_1_96 D08 Pla e_1 G08 G23 lp_1615 p iA p imosomal p o ein N ' M2_1_96 E08 Pla e_1 I08 I23 lp_1632 smc cell di ision p o ein Smc M2_1_96 F08 Pla e_1 K08 K23 lp_1643 cell su ace p o ein p ecu so M2_1_96 G08 Pla e_1 M08 M23 lp_1767 lysin M2_1_96 H08 Pla e_1 O08 O23 lp_1882 psA ibosomal p o ein S1 M2_1_96 A09 Pla e_1 A09 A24 lp_1897 pyk py u a e kinase M2_1_96 B09 Pla e_1 C09 C24 lp_1899 dnaE DNA -di ec ed DNA polyme ase III, alpha chain M2_1_96 C09 Pla e_1 E09 E24 lp_1941 nox4 NADH oxidase M2_1_96 D09 Pla e_1 G09 G24 M. Kahala e al. 1014 Con inued lp_2027 dnaK hea shock p o ein DnaK M2_1_96 E09 Pla e_1 I09 I24 lp_2054 s elonga ion ac o TS M2_1_96 F09 Pla e_1 K09 K24 lp_2055 psB ibosomal p o ein S2 M2_1_96 G09 Pla e_1 M09 M24 lp_2057 ldhD D-lac a e dehyd ogenase M2_1_96 H09 Pla e_1 O09 O24 lp_0002 dnaN DNA-di ec ed DNA polyme ase III, be a chain M2_2_96 A01 Pla e_1 B01 B16 lp_0006 gy B DNA gy ase, B subuni M2_2_96 B01 Pla e_1 D01 D16 lp_0061 ace oace a e deca boxylase (pu a i e) M2_2_96 C01 Pla e_1 F01 F16 lp_0129 hsp1 small hea shock p o ein M2_2_96 D01 Pla e_1 H01 H16 lp_0184 sacK1 uc okinase M2_2_96 E01 Pla e_1 J01 J16 lp_0210 ack1 ace a e kinase M2_2_96 F01 Pla e_1 L01 L16 lp_0233 m lD manni ol-1-phospha e 5-dehyd ogenase M2_2_96 G01 Pla e_1 N01 N16 lp_0244 oxido educ ase (pu a i e) M2_2_96 H01 Pla e_1 P01 P16 lp_0301 memb ane-bound p o ease, CAAX amily M2_2_96 A02 Pla e_1 B02 B17 lp_0313 ndh1 NADH dehyd ogenase M2_2_96 B02 Pla e_1 D02 D17 lp_0329 acdH ace aldehyde dehyd ogenase M2_2_96 C02 Pla e_1 F02 F17 lp_0466 pu R pu ine biosyn hesis ope on ep esso M2_2_96 D02 Pla e_1 H02 H17 lp_0481 py G CTP syn hase M2_2_96 E02 Pla e_1 J02 J17 lp_0566 nadE NAD syn hase M2_2_96 F02 Pla e_1 L02 L17 lp_0575 p s9AB mannose PTS, EIIAB M2_2_96 G02 Pla e_1 N02 N17 lp_0585 ansc ip ion egula o M2_2_96 H02 Pla e_1 P02 P17 lp_0597 pgm2 phosphoglyce a e mu ase M2_2_96 A03 Pla e_1 B03 B18 lp_0602 piA1 ibose 5-phospha e epime ase M2_2_96 B03 Pla e_1 D03 D18 lp_0725 hypo he ical p o ein M2_2_96 C03 Pla e_1 F03 F18 lp_0737 ibosomal p o ein S30EA M2_2_96 D03 Pla e_1 H03 H18 lp_0754 hp K bi unc ional p o ein: HP kinase, P-se - HP phospha ase M2_2_96 E03 Pla e_1 J03 J18 lp_0807 p a phospha e ace yl ans e ase M2_2_96 F03 Pla e_1 L03 L18 lp_0852 pox2 py u a e oxidase M2_2_96 G03 Pla e_1 N03 N18 lp_0853 pepR1 p olyl aminopep idase M2_2_96 H03 Pla e_1 P03 P18 lp_1005 als ace olac a e syn hase M2_2_96 A04 Pla e_1 B04 B19 lp_1090 dA L(+)- a a e dehyd a ase, subuni A M2_2_96 B04 Pla e_1 D04 D19 lp_1101 ldhL2 L-lac a e dehyd ogenase M2_2_96 C04 Pla e_1 F04 F19 lp_1108 ci E ci a e lyase, be a chain M2_2_96 D04 Pla e_1 H04 H19 lp_1148 ga A glu amyl- RNA amido ans e ase, subuni A M2_2_96 E04 Pla e_1 J04 J19 lp_1149 ga B glu amyl- RNA amido ans e ase, subuni B M2_2_96 F04 Pla e_1 L04 L19 lp_1200 galE2 UDP-glucose 4-epime ase M2_2_96 G04 Pla e_1 N04 N19 lp_1250 gn K gluconokinase M2_2_96 H04 Pla e_1 P04 P19 lp_1273 hp phosphoca ie p o ein Hp M2_2_96 A05 Pla e_1 B05 B20 lp_1301 me K me hionine adenosyl ans e ase M2_2_96 B05 Pla e_1 D05 D20 lp_1500 na I ni a e educ ase, gamma chain M2_2_96 C05 Pla e_1 F05 F20 lp_1521 oxido educ ase M2_2_96 D05 Pla e_1 H05 H20 lp_1541 gnd2 phosphoglucona e dehyd ogenase (deca boxyla ing) M2_2_96 E05 Pla e_1 J05 J20 lp_1563 g eA2 ansc ip ion elonga ion ac o G eA M2_2_96 F05 Pla e_1 L05 L20 lp_1665 adh1 alcohol dehyd ogenase M2_2_96 G05 Pla e_1 N05 N20 M. Kahala e al. 1015 Con inued lp_1675 abF 3 -oxoacyl-[acyl-ca ie p o ein] syn hase II M2_2_96 H05 Pla e_1 P05 P20 lp_1779 hs o ma e - e ahyd o ola e ligase M2_2_96 A06 Pla e_1 B06 B21 lp_1783 py AA2 ca bamoyl-phospha e syn hase (glu amine-hyd olysing), small chain M2_2_96 B06 Pla e_1 D06 D21 lp_1817 ibi ol -5-phospha e 2-dehyd ogenase (pu a i e) M2_2_96 C06 Pla e_1 F06 F21 lp_1898 p k 6 -phospho uc okinase M2_2_96 D06 Pla e_1 H06 H21 lp_1981 hisS his idine - RNA ligase M2_2_96 E06 Pla e_1 J06 J21 lp_2030 aldB alpha -ace olac a e deca boxylase M2_2_96 F06 Pla e_1 L06 L21 lp_2052 ibosome ecycling ac o M2_2_96 G06 Pla e_1 N06 N21 lp_2086 ap adenine phospho ibosyl ans e ase M2_2_96 H06 Pla e_1 P06 P21 lp_2094 GTP -binding p o ein M2_2_96 A07 Pla e_1 B07 B22 lp_2096 uK 1 -phospho uc okinase M2_2_96 B07 Pla e_1 D07 D22 lp_2123 dapA1 dihyd odipicolina e syn hase M2_2_96 C07 Pla e_1 F07 F22 lp_2153 pdhB py u a e dehyd ogenase complex, E1 componen , be a subuni M2_2_96 D07 Pla e_1 H07 H22 lp_2154 pdhA py u a e dehyd ogenase complex, E1 componen , alpha subuni M2_2_96 E07 Pla e_1 J07 J22 lp_2189 di IVA cell di ision ini ia ion p o ein Di IVA M2_2_96 F07 Pla e_1 L07 L22 lp_2231c ppiB pep idylp olyl isome ase M2_2_96 G07 Pla e_1 N07 N22 lp_2256 ccpA ca aboli e con ol p o ein A M2_2_96 H07 Pla e_1 P07 P22 lp_2301 ecA ecombinase A M2_2_96 A08 Pla e_1 B08 B23 lp_2323 px hiol pe oxidase M2_2_96 B08 Pla e_1 D08 D23 lp_2345 ddl D -alanine-D-alanine ligase M2_2_96 C08 Pla e_1 F08 F23 lp_2349 hicD3 L -2-hyd oxyisocap oa e dehyd ogenase M2_2_96 D08 Pla e_1 H08 H23 lp_2359 m eB2 cell shape de e mining p o ein M eB M2_2_96 E08 Pla e_1 J08 J23 lp_2366 a pA H(+) - anspo ing wo-sec o ATPase, alpha subuni M2_2_96 F08 Pla e_1 L08 L23 lp_2544 np 2 NADH pe oxidase M2_2_96 G08 Pla e_1 N08 N23 lp_2596 p lA1 o ma e ace yl ans e ase ac i a ing enzyme M2_2_96 H08 Pla e_1 P08 P23 lp_2598 p lB1 o ma e C -ace yl ans e ase M2_2_96 A09 Pla e_1 B09 B24 lp_2681 gpd glucose -6-phospha e 1-dehyd ogenase M2_2_96 B09 Pla e_1 D09 D24 lp_2690 py E o o a e phospho ibosyl ans e ase M2_2_96 C09 Pla e_1 F09 F24 lp_2697 py D dihyd oo o a e oxidase M2_2_96 D09 Pla e_1 H09 H24 lp_2699 py C dihyd oo o ase M2_2_96 E09 Pla e_1 J09 J24 lp_2702 py B aspa a e ca bamoyl ans e ase M2_2_96 F09 Pla e_1 L09 L24 lp_2703 py R1 py imidine ope on egula o M2_2_96 G09 Pla e_1 N09 N24 lp_2704 pu K1 phospho ibosylaminoimidazole ca boxylase, ATPase subuni M2_2_96 H09 Pla e_1 P09 P24 lp_2097 p s16ABC uc ose PTS, EIIABC M2_1_96 A10 Pla e_2 A01 A22 lp_2118 ig igge ac o M2_1_96 B10 Pla e_2 C01 C22 lp_2119 u elonga ion ac o Tu M2_1_96 C10 Pla e_2 E01 E22 lp_2146 ypA GTP -binding p o ein TypA M2_1_96 D10 Pla e_2 G01 G22 lp_2193 sZ cell di ision p o ein F sZ M2_1_96 E10 Pla e_2 I01 I22 lp_2290 in eg al memb ane p o ein M2_1_96 F10 Pla e_2 K01 K22 lp_2324 gshA glu ama e -cys eine ligase (pu a i e) M2_1_96 G10 Pla e_2 M01 M22 lp_2331 psD ibosomal p o ein S4 M2_1_96 H10 Pla e_2 O01 O22 lp_2486 cell su ace p o ein p ecu so , GY amily M2_1_96 A11 Pla e_2 A02 A23 M. Kahala e al. 1016 Con inued lp_2502 pgi glucose -6-phospha e isome ase M2_1_96 B11 Pla e_2 C02 C23 lp_2659 xpk1 phosphoke olase M2_1_96 C11 Pla e_2 E02 E23 lp_2694 exB ATP -dependen nuclease, subuni B M2_1_96 D11 Pla e_2 G02 G23 lp_3001 cell su ace p o ein p ecu so (pu a i e) M2_1_96 E11 Pla e_2 I02 I23 lp_3075 cell su ace p o ein (pu a i e) M2_1_96 F11 Pla e_2 K02 K23 lp_3114 cell su ace p o ein p ecu so M2_1_96 G11 Pla e_2 M02 M23 lp_3170 pmg9 phosphoglyce a e mu ase M2_1_96 H11 Pla e_2 O02 O23 lp_3174 c a2 cyclop opane - a y-acyl-phospholipid syn hase M2_1_96 A12 Pla e_2 A03 A24 lp_3204 nupC nucleoside anspo p o ein M2_1_96 B12 Pla e_2 C03 C24 lp_3313 p lB2 o ma e C-ace yl ans e ase M2_1_96 C12 Pla e_2 E03 E24 lp_3421 ex acellula p o ein, gamma-D-glu ama e- meso-diaminopimela e mu opep idase (pu a i e) M2_1_96 D12 Pla e_2 G03 G24 lp_3485 melA alpha -galac osidase M2_1_96 E12 Pla e_2 I03 I24 lp_3551 xpk2 phosphoke olase M2_1_96 F12 Pla e_2 K03 K24 lp_3662 adhE bi unc ional p o ein: alcohol dehyd ogenase, ace aldehyde dehyd ogenase M2_1_96 G12 Pla e_2 M03 M24 lp_3665 pdc p -couma ic acid deca boxylase M2_1_96 H12 Pla e_2 O03 O24 lp_2728 hypo he ical p o ein M2_2_96 A10 Pla e_2 B01 B22 lp_2766 y S y osine - RNA ligase M2_2_96 B10 Pla e_2 D01 D22 lp_2807 adh2 alcohol dehyd ogenase M2_2_96 C10 Pla e_2 F01 F22 lp_2873 dhaT 1,3 -p opanediol dehyd ogenase M2_2_96 D10 Pla e_2 H01 H22 lp_3051 gabD succina e -semialdehyde dehyd ogenase (NAD(P)+) M2_2_96 E10 Pla e_2 J01 J22 lp_3092 uma a e educ ase, la op o ein subuni p ecu so , N- e minally unca ed M2_2_96 F10 Pla e_2 L01 L22 lp_3125 cell su ace hyd olase, memb ane -bound (pu a i e) M2_2_96 G10 Pla e_2 N01 N22 lp_3265 pu A adenylosuccina e syn hase M2_2_96 H10 Pla e_2 P01 P22 lp_3270 p lA2 o ma e ace yl ans e ase ac i a ing enzyme M2_2_96 A11 Pla e_2 B02 B23 lp_3314 hsp3 small hea shock p o ein M2_2_96 B11 Pla e_2 D02 D23 lp_3352 oxido educ ase M2_2_96 C11 Pla e_2 F02 F23 lp_3403 galE4 UDP -glucose 4-epime ase M2_2_96 D11 Pla e_2 H02 H23 lp_3482 galK galac okinase M2_2_96 E11 Pla e_2 J02 J23 lp_3484 lacM be a -galac osidase, small subuni M2_2_96 F11 Pla e_2 L02 L23 lp_3534 agl5 alpha -glucosidase M2_2_96 G11 Pla e_2 N02 N23 lp_3544 gph3 phosphoglycola e phospha ase (pu a i e) M2_2_96 H11 Pla e_2 P02 P23 lp_3545 gu B L -idi ol 2-dehyd ogenase M2_2_96 A12 Pla e_2 B03 B24 lp_3549 ansc ip ion egula o M2_2_96 B12 Pla e_2 D03 D24 lp_3555 a aD L - ibulose 5-phospha e 4-epime ase M2_2_96 C12 Pla e_2 F03 F24 lp_3583 clpL ATP-dependen Clp p o ease, ATP-binding subuni ClpL M2_2_96 D12 Pla e_2 H03 H24 lp_3586 lox lac a e oxidase M2_2_96 E12 Pla e_2 J03 J24 lp_3589 pox5 py u a e oxidase M2_2_96 F12 Pla e_2 L03 L24 lp_3592 haD hamnulose -1-phospha e aldolase M2_2_96 G12 Pla e_2 N03 N24 lp_3603 suga -phospha e aldolase M2_2_96 H12 Pla e_2 P03 P24