RESEARCH ARTICLE Open Access
A ameshi mu a ion in ARMC3 is
associa ed wi h a ail s ump spe m de ec
in Swedish Red (Bos au us) ca le
Hube Pausch
1*
, Heli Venho an a
2
, Ch is ine Wu mse
1
, Kalle Hakala
2
, Te hi Iso-Tou u
3
, Anu Si onen
3
,
Rikke K. Vingbo g
4
, Hannes Lohi
5
, Lenna Söde quis
6
, Ruedi F ies
1
and Magnus Ande sson
2
Abs ac
Backg ound: A i icial insemina ion is widely used in many ca le b eeding p og ams. Semen samples o b eeding
bulls a e collec ed and closely examined immedia ely a e collec ion a a i icial insemina ion cen e s. Only ejacula es
wi hou anomalous indings a e e ained o a i icial insemina ion. Al hough mo phological abe a ions o he
spe ma ozoa a e a equen eason o disca ding ejacula es, he gene ic de e minan s unde lying poo semen
quali y a e sca cely unde s ood.
Resul s: A ail s ump spe m de ec was obse ed in h ee bulls o he Swedish Red ca le b eed. The spe ma ozoa o
a ec ed bulls we e immo ile because o se e ely diso ganized ails indica ing dis u bed spe ma ogenesis. We
geno yped h ee a ec ed bulls and 18 una ec ed male hal -sibs a 46,035 SNPs and pe o med homozygosi y
mapping o map he e ili y diso de o an 8.42 Mb in e al on bo ine ch omosome 13. The analysis o whole-genome
e-sequencing da a o an a ec ed bull and 300 una ec ed animals om ele en ca le b eeds o he han Swedish Red
e ealed a 1 bp dele ion (Ch 13: 24,301,425 bp, ss1815612719) in he ele en h exon o he a madillo epea con aining
3-encoding gene (ARMC3) ha was compa ible wi h he supposed ecessi e mode o inhe i ance. The dele ion is
expec ed o al e he eading ame and o induce p ema u e ansla ion e mina ion (p.A451 s26). The mu a ed
p o ein is sho ened by 401 amino acids (46 %) and lacks domains ha a e likely essen ial o no mal p o ein unc ion.
Conclusions: We epo he pheno ypic and gene ic cha ac e iza ion o a s e ilizing ail s ump spe m de ec in he
Swedish Red ca le b eed. Exploi ing high-densi y geno ypes and massi e e-sequencing da a enabled us o iden i y
he mos likely causal mu a ion o he e ili y diso de in bo ine ARMC3. Ou esul s p o ide he basis o moni o ing
he mu a ed a ian in he Swedish Red ca le popula ion and o he ea ly iden i ica ion o in e ile animals.
Keywo ds: ARMC3, Tail s ump spe m de ec , Swedish Red ca le, MMAF, Flagellum, Male in e ili y, Spe ma ogenesis
Backg ound
A i icial insemina ion (AI) is widely used ins ead o na -
u al ma ing in many ca le b eeding popula ions. Ejacu-
la es o b eeding bulls a e collec ed once o wice a
week and closely examined immedia ely a e semen col-
lec ion a highly specialized AI cen e s. Only ejacula es
wi hou appa en abno mali ies a e e ained o AI. Up
o 20 % o all collec ed ejacula es a e ejec ed because
hey do no comply wi h cu en s anda ds o AI [1].
Diagnoses o insu icien semen quali y in ol e he ab-
sence o spe ma ozoa, low spe m concen a ion, educed
mo ili y o iabili y and mo phological abe a ions o
spe ma ozoa [2].
A mo ile spe m lagellum is essen ial o he e iliza ion
in i o. Mo phological abe a ions o he spe m ail com-
p omise spe m mo ili y and impai e iliza ion. Such
abe a ions a e collec i ely e e ed o as mul iple mo -
phological abno mali ies o he lagella (MMAF, [3]). Diag-
noses o MMAF in ol e s ump and sho ail spe ma ozoa
and dysplasia o he ib ous shea h. Sequence a ian s
causing MMAF ha e been iden i ied in, e.g.,humans[3–
5], pigs [6, 7] and mice [8–10]. Howe e , sequence
* Co espondence: [email p o ec ed]
1
Leh s uhl ue Tie zuch , Technische Uni e si ae Muenchen, 85354 F eising,
Ge many
Full lis o au ho in o ma ion is a ailable a he end o he a icle
© 2016 Pausch e al. Open Access This a icle is dis ibu ed unde he e ms o he C ea i e Commons A ibu ion 4.0
In e na ional License (h p://c ea i ecommons.o g/licenses/by/4.0/), which pe mi s un es ic ed use, dis ibu ion, and
ep oduc ion in any medium, p o ided you gi e app op ia e c edi o he o iginal au ho (s) and he sou ce, p o ide a link o
he C ea i e Commons license, and indica e i changes we e made. The C ea i e Commons Public Domain Dedica ion wai e
(h p://c ea i ecommons.o g/publicdomain/ze o/1.0/) applies o he da a made a ailable in his a icle, unless o he wise s a ed.
Pausch e al. BMC Gene ics (2016) 17:49
DOI 10.1186/s12863-016-0356-7
a ian s causing MMAF ha e no been iden i ied in ca le
so a .
Bulls wi h MMAF ha e been obse ed in Hols ein-
F iesian, Ay shi e and Indob asil ca le [11–15]. The a -
ec ed bulls we e isola ed cases wi hin hei b eeds wi h-
ou known ela ionship among each o he indica ing a
he e ogeneous gene ic e iology o MMAF ac oss b eeds.
Howe e , Alanko e al. [16] epo ed h ee ela ed bulls
om he Ay shi e ca le b eed wi h a s e ilizing ail
s ump spe m de ec sugges ing ha such condi ions may
be inhe i ed in an au osomal ecessi e ashion in ca le.
He e we p esen he pheno ypic mani es a ion and he
gene ic analysis o a ecessi ely inhe i ed ail s ump
spe m de ec in he Swedish Red ca le b eed. The appli-
ca ion o homozygosi y mapping acili a ed he mapping
o he e ili y diso de o a sho segmen on bo ine
ch omosome 13. The analysis o comp ehensi e whole-
genome sequence da a e ealed a ameshi mu a ion in
ARMC3 ha mos likely causes he spe m ail diso de
in Swedish Red ca le.
Resul s
A ecessi ely inhe i ed ail s ump spe m de ec in he
Swedish Red ca le b eed
Th ee young bulls (11 mon hs) o he Swedish Red ca le
b eed bo n in 2008, 2009 and 2012, we e epo ed om
an AI cen e because hey p oduced ejacula es wi h im-
mo ile spe ma ozoa du ing a semen collec ion pe iod o
5 mon hs. Examina ion o he bulls’ esh ejacula es e-
ealed a educed spe m concen a ion (~140 million
spe ma ozoa pe ml) despi e no mal ejacula e olume
(~4 ml). The spe m coun was only 10–20 % o he a e -
age spe m coun o con ol bulls. All spe ma ozoa we e
immo ile because o mul iple lagella abno mali ies such
as udimen a y (less han 5 % o he no mal leng h),
sho leng h and absen ails. A p oximal d ople su -
ounded mos udimen a y ails (Fig. 1a-b). The p opo -
ion o spe ma ozoa wi h abno mal heads anged om
47 o 62 %, which is en imes highe han in no mal
ejacula es (Table 1). None o he spe ma ozoa we e
mo ile. His ological sec ions o he es icles e ealed a
lack o ull-leng h spe m ails in he luminal pa o
he ubuli semini e i indica ing dis u bed spe ma o-
genesis (Fig. 1c-d).
The analysis o he pedig ee eco ds o h ee a ec ed
bulls e ealed a common ances o (bo n in 1987) in
hei pa e nal and ma e nal pa h (see Addi ional ile 1).
Eigh een male hal -sibs o he a ec ed bulls we e used
o AI. The quali y o hei ejacula es was no mal and
hei e ili y eco ds we e wi hin e e ence anges indi-
ca ing undis u bed ep oduc i e pe o mance. Based on
hese indings, an au osomal ecessi e mode o inhe i -
ance was assumed o he ail s ump spe m de ec .
The ail s ump spe m de ec maps o bo ine ch omosome
13
To iden i y he genomic egion associa ed wi h he ail
s ump spe m de ec , h ee a ec ed and 18 una ec ed
male hal -sibs we e geno yped wi h he Illumina Bo i-
neSNP50 geno yping a ay. A e quali y con ol, geno-
ypes a 46,035 SNPs we e sc eened o he p esence o
long uns o homozygosi y (ROH) in h ee a ec ed bulls.
Fig. 1 Pheno ypic mani es a ion o he ail s ump spe m de ec . Rep esen a i e igu es o spe ma ozoa o a con ol (a) and an a ec ed bull (b).
Spe ma ozoa o a ec ed bulls had mul iple abe a ions such as sho ails (blue s a ), udimen a y ails wi h p oximal d ople (a ows), udimen a y
ails wi hou p oximal d ople (yellow iangle) and coiled ails ( ed s a ). His ological sec ions o he es icles o a con ol (c) and an a ec ed (d)
bull. Nume ous ull-leng h spe m ails a e p esen in he luminal pa o he ubuli semini e i in he con ol bull, whe eas ull-leng h spe m ails
a e absen in he a ec ed bull
Pausch e al. BMC Gene ics (2016) 17:49 Page 2 o 9
Only wo genomic egions we e consis en ly homozy-
gous in all a ec ed animals: a 1.13 Mb segmen on
BTA22 ( om 48,349,750 bp o 49,479,051 bp) and an
8.42 Mb segmen on BTA13 ( om 22,308,682 bp o
30,733,648 bp) (Fig. 2a). The segmen on BTA22 was
also homozygous in six e ile hal -sibs p ecluding an as-
socia ion wi h he ail s ump spe m de ec . In con as ,
he 8.42 Mb segmen on BTA13 was ne e ound in he
homozygous s a e in eigh een una ec ed hal -sibs co e-
sponding o an au osomal ecessi e inhe i ance (Fig. 2b).
A 1 bp dele ion in ARMC3 is associa ed wi h he ail
s ump spe m de ec
To pinpoin he mu a ion causing he ail s ump spe m
de ec , he whole genome o an a ec ed bull was se-
quenced o an a e age ead dep h o 9.29. In addi ion,
we exploi ed da a o 300 p e iously sequenced animals
om ele en ca le b eeds o he han Swedish Red o
he iden i ica ion o he mu a ion. Dele e ious ecessi e
mu a ions a e assumed o ha e occu ed a e b eed o -
ma ion and a e hus likely o be b eed-speci ic. Thus we
assumed ha he causal mu a ion should no seg ega e
among he sequenced con ol animals. Mul i-sample
a ian calling in he 8.42 Mb egion o ex ended homo-
zygosi y on BTA13 yielded geno ypes a 81,925 single
nucleo ide and sho inse ion and dele ion polymo -
phisms (74,385 SNPs, 7540 Indels). In addi ion, 11,505
s uc u al a ian s we e de ec ed in he genome-wide se-
quence da a o he a ec ed bull and 226 con ol animals
wi h genome co e age o a leas eigh - old.
Se en y-se en a ian s we e compa ible wi h ecessi e
inhe i ance ha is homozygous o he e e ence allele
in 300 con ol animals and homozygous o he al e na e
allele in he a ec ed bull. Bioin o ma ic analysis e ealed
ha 76 a ian s we e loca ed in non-coding egions o
he genome and one a ian esided in he coding egion
o he a madillo epea con aining 3-encoding gene
(ARMC3, Ch 13: 24,301,425 bp, ss1815612719, Fig. 3a,
see Addi ional iles 2 and 3).
To u he educe he numbe o plausible candida e
causal mu a ions, we exploi ed whole-genome sequence
da a o 1147 animals om 29 ca le b eeds ha had been
sequenced o Run4 o he 1000 bull genomes p ojec
[17]. Because o he close ela ionship among animals o
h ee No dic Red ca le b eeds, we excluded 56 sequenced
animals om he Ay shi e, Swedish Red and Danish Red
ca le b eed o a ian il e ing. Thi y- i e ou o 77 com-
pa ible a ian s also seg ega ed among 1009 animals om
b eeds o he han No dic Red (see Addi ional ile 4). In
Table 1 Spe m mo phology in esh ejacula es o h ee a ec ed
AI bulls
Pheno ype Bull 1 Bull 2 Bull 3
Tail mo phology No mal ails 0 % 0 % 0 %
Absen ails 2 % 3 % 4 %
Rudimen a y ails 45 % 63 % 28 %
Sho s aigh ails 27 % 15 % 29 %
Folded o coiled sho ails 26 % 19 % 39 %
Head mo phology No mal heads 42 % 53 % 38 %
Abno mal heads 58 % 47 % 62 %
Fig. 2 Homozygosi y mapping in h ee animals wi h a s e ilizing ail s ump spe m de ec . aShades o blue ep esen long uns o homozygosi y
(ROH) in h ee animals along he 29 au osomes. The ed bo de s highligh wo egions on BTA13 and BTA22 wi h ROH in all a ec ed animals.
bAu ozygosi y mapping on BTA13 in h ee a ec ed animals. Blue and pale blue ep esen homozygous geno ypes (AA and BB), he e ozygous
geno ypes (AB) a e displayed in ligh g ey. Whi e colo indica es missing geno ypes. The ed ba indica es a common 8.42 Mb segmen o homozygosi y
Pausch e al. BMC Gene ics (2016) 17:49 Page 3 o 9
conclusion, he coding a ian in ARMC3 and 41 non-
coding a ian s we e conside ed as candida e causal a i-
an s o he ail s ump spe m de ec .
The bo ine ARMC3 gene consis s o 19 exons encod-
ing 876 amino acids (Fig. 3b). The a ian compa ible
wi h ecessi e inhe i ance (ss1815612719) is a 1 bp dele-
ion in he ele en h exon o ARMC3 a ec ing he hi d
base o codon 450 (ENSBTAT00000061467:c.1350_1351-
delGGinsG). Sange sequencing con i med homozygosi y
o he dele ion a ian in wo bulls wi h he ail s ump
spe m de ec . The 1 bp dele ion is expec ed o al e he
eading ame and o change he amino acid sequence
om posi ion 451 onwa ds esul ing in a p ema u e
ansla ion e mina ion a posi ion 476 (p.A451 s26). The
mu a ed p o ein should be sho ened by 401 amino acids
(46 %). Bioin o ma ic analysis e ealed ha he p o ein se-
quence o bo ine ARMC3 con ains en a madillo/be a-ca-
enin-like (ARM) epea s (Fig. 3c). The dele ion a ian
esides wi hin he highly conse ed a madillo epea con-
aining domain. Due o he ameshi wi h p ema u e
ansla ion e mina ion, he mu a ed p o ein is expec ed
o lack one ARM epea (Fig. 3d).
We geno yped 97 AI bulls om he Swedish Red ca le
b eed wi h no mal e ili y a ss1815612719 using
Fig. 3 A 1 bp dele ion in ARMC3 induces p ema u e ansla ion e mina ion. aSnapsho om he In eg a ed Genomics Viewe (IGV, [51]) showing
a homozygous 1 bp dele ion on ch omosome 13 a 24,301,425 bp in an animal wi h he ail s ump spe m de ec . bGenomic s uc u e o bo ine
ARMC3. Bo ine ARMC3 consis s o 19 exons ( e ical ba s) and i s ansla ion s a s in exon 2. The ed e ical ba ep esen s he ele en h exon
whe e he 1 bp dele ion is loca ed. The coo dina es o en A madillo (ARM) epea s we e de e mined using he Simple Modula A chi ec u e Resea ch
Tool [50]. Blue a ows ep esen he posi ion o he s a and s op codons. cThe bo ine ARMC3 p o ein sequence consis s o 876 amino acids and i
con ains en ARM epea s (g een boxes). The ed iangle ep esen s he s a o he shi in ansla ion esul ing om he 1 bp dele ion. dMul i-species
alignmen o a pa o he ARMC3 p o ein sequence. Blue colou highligh s he p o ein sequence o he en h ARM epea , which is absen in he
mu a ed (m ) bo ine sequence
Pausch e al. BMC Gene ics (2016) 17:49 Page 4 o 9
cus omized geno yping assays. None o he bulls was
homozygous o he dele ion a ian . Se en y- ou bulls
we e homozygous o he e e ence allele and 23 bulls
we e he e ozygous ca ie s o he 1 bp dele ion yielding
a equency o he dele ion o 11.9 %.
Discussion
Al hough he e is conside able pheno ypic a ia ion bo h
in semen quali y and insemina ion success o AI bulls,
he gene ic de e minan s unde lying male ep oduc i e
ai s a e sca cely unde s ood [18]. Low he i abili y o
e ili y ai s and small-sized samples complica ed he
mapping o causal sequence a ian s in he pas . Mo e-
o e , e ili y-associa ed a ian s did no each con in-
cing le els o signi icance in eplica ion s udies [19, 20].
Recen ly, he a ailabili y o comp ehensi e geno ype and
massi e e-sequencing da a enabled he iden i ica ion o
a ecessi ely inhe i ed a ian o idiopa hic male sub e i-
li y in ca le [21]. Howe e , o ou knowledge, ou s udy is
he i s o e eal a mu a ion ha mani es s in mo pho-
logical abe a ions o he spe ma ozoa in ca le.
The analysis o pedig ee eco ds indica ed ha he
spe m ail diso de is inhe i ed in an au osomal ecessi e
ashion. Sequence a ian s unde lying ecessi e ai s a e
adi ionally iden i ied by compa ing allele coun s o
dense molecula ma ke s in a ec ed and una ec ed indi-
iduals (e.g., [21]). The likelihood o map a mendelian
ai in a genome-wide case/con ol-associa ion s udy
depends on he numbe o a ec ed indi iduals [22]. The
ail s ump spe m de ec is a a e diso de in he Swedish
Red ca le b eed. Assuming a equency o he dele e i-
ous allele o 12 % in he popula ion, andom ma ing and
100 bulls ha a e annually pu chased by he Swedish AI
cen e , one would expec only one o hem o be a ec ed
by he ail s ump spe m de ec . Acco dingly, only h ee
a ec ed bulls we e ecognized in he pas 10 yea s. We
geno yped hose bulls wi h a geno yping a ay and
eso ed o pe o m homozygosi y mapping, which acili-
a es pinpoin ing genomic egions unde lying ecessi e
ai s wi h a small numbe o a ec ed indi iduals [23].
Th ee a ec ed bulls had a common 8.42 Mb segmen o
ex ended homozygosi y which is a ypical leng h ob-
se ed in s udies ha a e based on ew a ec ed animals
[23–26]. Compa ible wi h ecessi e inhe i ance, none o
he e ile hal -sibs was homozygous. Nex gene a ion se-
quencing o an a ec ed bull e ealed a ameshi mu a-
ion in ARMC3 (ss1815612719, c.1350delG, p.A451 s26)
ha seg ega ed wi h he ail s ump spe m de ec . Fo y-
one a ian s in non-p o ein-coding egions we e also as-
socia ed wi h he diso de . Howe e , we conside he
ameshi in ARMC3 as he mos likely causal mu a ion
because i is p edic ed o esul in a p o ein ha lacks
401 amino acids. The unc ion o he unca ed ARMC3
p o ein may be se e ely comp omised, since i lacks
domains ha a e likely equi ed o no mal p o ein unc-
ion [27].
Absence o impai ed unc ion o ARMC3 possibly p e-
en s physiological spe ma ogenesis esul ing in mo -
phological abe a ions o he spe ma ozoa. The spe m
ails o homozygous bulls we e se e ely diso ganized and
all spe ma ozoa we e immo ile p ecluding success ul
e iliza ion in i o. Apa om immo ile spe ma ozoa,
he bulls we e heal hy. The mo phological abe a ions o
he spe ma ozoa a e simila o hose obse ed in he
Ay shi e ca le b eed [12–14, 16]. Because Swedish Red
ca le a e closely ela ed o Ay shi e ca le [28, 29], i is
possible ha he ameshi mu a ion in ARMC3 oc-
cu ed in a common ances o o he wo b eeds and ha
i migh also be associa ed wi h he spe m ail diso de
in Ay shi e ca le. Howe e , he gene ic unde pinnings
o appa en ly simila pheno ypes may be comple ely di -
e en ac oss b eeds (e.g., [24, 30, 31]). In any case, i is
ecommended o su ey sequence a ian s in ARMC3 in
bulls wi h e ili y diso de s in ca le b eeds o he han
Swedish Red.
To ou knowledge, ou s udy e eals o he i s ime
an associa ion o a mu a ion in ARMC3 wi h mo pho-
logical abno mali ies o he spe m lagellum. Howe e ,
dele e ious mu a ions in o he genes encoding a madillo
epea -con aining p o eins ha e al eady been shown o
comp omise spe m mo ili y [8, 32]. In ou s udy, he
spe ma ozoa o bulls ha we e homozygous o he
ameshi mu a ion in ARMC3 we e immo ile because
o se e e lagella abno mali ies. A p e ious s udy dem-
ons a ed ha dys unc ion o ARMC4, a pa alog o
ARMC3, impai s physiological unc ion o he cilia and
spe m lagella in humans [33]. P ope unc ion o Gudu,
a gene highly homologous o ARMC4, is essen ial o an
undis u bed spe ma ogenesis in D osophila melanogas e
[34]. Ou in es iga ions also e idenced an impai ed
spe ma ogenesis in bulls homozygous o he ameshi
mu a ion in ARMC3. Such indings sugges a c ucial ole
o ARMC3 o physiological spe ma ogenesis.
The mo phological abe a ions o he spe ma ozoa ob-
se ed in ou s udy a e simila o hose obse ed in
Yo kshi e boa s wi h a loss o unc ion mu a ion in
SPEF2 [6]. Bo h de ec s mani es in immo ile spe ma o-
zoa p ecluding e iliza ion in i o bo h in na u al se -
ice and AI. The pheno ypic mani es a ions o he wo
de ec s di e only sligh ly. Spe ma ozoa o animals being
homozygous o he ARMC3 ameshi mu a ion mos ly
lack he midpiece wi h mi ochond ia, which is, howe e ,
commonly p esen in spe ma ozoa o animals homozy-
gous o he SPEF2 mu a ion [6].
Conclusions
The combina ion o high-densi y geno ype and whole-
genome e-sequencing da a e ealed a ecessi ely inhe i ed
Pausch e al. BMC Gene ics (2016) 17:49 Page 5 o 9

ameshi mu a ion in bo ine ARMC3 ha mos likely
causes a s e ilizing ail s ump spe m de ec in Swedish Red
ca le. Ou indings sugges ha impai ed unc ion o
ARMC3 comp omises spe ma ogenesis and he eby e-
sul s in se e ely diso ganized spe m ails, which p e en s
success ul e iliza ion in i o. Compa ed o mu a ions ha
mani es in idiopa hic male sub- o in e ili y [21], spe m-
a ozoa o a ec ed animals ha e s iking mo phological ab-
e a ions ha acili a e o unambiguously iden i y
homozygous bulls a AI cen e s. Howe e , ou indings a-
cili a e o iden i y a ec ed young bulls be o e hey a e pu -
chased by AI cen e s using e.g., geno yping assays on
cus omized geno yping a ays.
Me hods
Animal e hics s a emen
All animals we e housed a an app o ed comme cial AI
cen e in Ö ns o, Sweden. Semen samples we e collec ed
by employees o he AI cen e as pa o hei egula
b eeding and ep oduc i e measu es in ca le indus y.
Bulls wi h he ail s ump spe m de ec we e slaugh e ed
because hei semen was no sui able o a i icial insem-
ina ion. The decision o slaugh e he bulls was made
solely by he owne (i.e., AI cen e ) o he bulls. None o
he au ho s o he p esen s udy was in ol ed in he de-
cision o slaugh e he bulls. Tes icles o an a ec ed bull
we e collec ed a e slaugh e . Consen om he owne
o he bulls was ob ained o use he semen and issue
samples o his s udy. No e hical app o al was equi ed
o his s udy.
Animals
Th ee bulls o he Swedish Red ca le b eed bo n be ween
2008 and 2012 wi h a s e ilizing ail s ump spe m de ec
we e included in he s udy oge he wi h 18 una ec ed
e ile male hal -sibs. The bulls we e housed in an AI bull
cen e in Ö ns o, Sweden. The age o he bulls du ing
semen collec ion anged om 11 o 16 mon hs. Em-
ployees om he AI cen e collec ed semen app oxima ely
wice a week as pa o hei egula p ac ice.
Spe m mo ili y, mo phology and es icula his ology
We examined en ejacula es pe bull. Aliquo s o esh
semen we e pu in o ials o measu e spe m concen a ion
using a pho ome ic me hod and a haemocy ome e (Bü -
ke chambe ). A d op o semen (app oxima ely 7 μlwas
pu on a p e-wa med slide o e alua e spe m mo phology.
Head and spe m ail mo phology o 200 spe ma ozoa was
assessed om slides s ained wi h he Williams s ain (b igh
ield mic oscopy) and om a we moun o mol-saline
sample using a phase con as mic oscope wi h 1000×
magni ica ion, espec i ely. Mo eo e , spe m head mo ph-
ology was assessed in d y smea s s ained wi h ca bol uch-
sin acco ding o Williams [35] and Lage lö [36]. Tes icles
om an a ec ed bull we e collec ed a e slaugh e . His o-
logical specimens we e aken om he es icles, ixed in
Bouin’s solu ion and embedded in pa a in. Sec ions
(5 μm) we e cu and s ained wi h haema oxylin and eosin.
Geno yping o a ec ed and una ec ed animals
Twen y-one bulls ( h ee a ec ed, 18 una ec ed) o he
Swedish Red ca le b eed we e geno yped using he Illu-
mina Bo ineSNP50 Bead chip (Illumina, Inc., San Diego,
CA, USA). The ch omosomal posi ion o he SNPs
co esponded o he UMD3.1 assembly o he bo ine gen-
ome [37]. Mi ochond ial, X-ch omosomal, Y-ch omosomal
SNPs and SNPs wi h unknown ch omosomal posi ion
we e no conside ed o u he analyses. A e quali y con-
ol (pe SNP and pe indi idual call- a e highe han 90 %,
no de ia ion om he Ha dy-Weinbe g equilib ium (P>
0.0001)), 46,035 SNPs we e e ained o u he analyses.
Beagle gene ic analysis so wa e [38] was used o impu e
spo adically missing geno ypes and o in e haplo ypes.
Homozygosi y mapping
Segmen s o ex ended homozygosi y we e iden i ied in
h ee a ec ed bulls using he homozyg- unc ion imple-
men ed in he whole genome associa ion analysis oolse
PLINK [39, 40]. Due o he ela i ely spa se genome
co e age o he geno ype da a (1 SNP pe 56 kb), we e-
s ic ed ou analysis o uns o homozygosi y (ROH)
wi h a minimum numbe o 20 con iguous homozygous
SNPs and a minimum leng h o 500 kb.
Gene a ion o sequence da a
Genomic DNA o an a ec ed bull was p epa ed om a
semen sample ollowing s anda d p o ocols using p o-
einase K diges ion and phenol-chlo o o m ex ac ion. A
gDNA sequencing lib a y wi h 420 bp inse size was
p epa ed using he T uSeq DNA Sample P epa a ion Ki
(Illumina inc., San Diego, CA, USA). The sample was se-
quenced on an Illumina HiSeq2500 sys em using T uSeq
SBS 3 chemis y (Illumina inc., San Diego, CA, USA)
and he 2x100 bp pai ed-end ead module. The as q-
iles we e gene a ed wi h he CASAVA bcl2 as q con e -
sion so wa e ( e sion 1.8.3, Illumina inc., San Diego,
CA, USA). The alignmen o he eads o he Uni e si y
o Ma yland e e ence sequence (UMD3.1, [37]) was pe -
o med wi h he Bu ows-Wheele Aligne [41]. The
esul ing SAM ile was con e ed in o a BAM ile wi h
SAM ools [42]. Duplica e eads we e iden i ied and
ma ked wi h he Ma kDuplica es command o Pica d-
ools [43].
Iden i ica ion o candida e causal a ian s
Single nucleo ide and sho inse ion and dele ion poly-
mo phisms we e geno yped in he a ec ed bull oge he
wi h 300 p e iously sequenced animals om ele en
Pausch e al. BMC Gene ics (2016) 17:49 Page 6 o 9
ca le b eeds (Gelb ieh (n= 12), No dic Finnca le (n=6),
Fleck ieh (n= 153), O iginal Simmen al (n=15),
Hols ein-F iesian (n= 31), B own Swiss (n=50),Mu nau-
We den else (n= 2), Ay shi e (n= 2), Red-Hols ein (n=
21), O iginal B aun ieh (n= 8)) o he han Swedish Red
[44] using he mul i-sample app oach implemen ed in he
mpileup unc ion o SAM ools [42] and a a ian calling
pipeline as de ailed by Jansen e al. [25]. La ge inse ions
and dele ions and s uc u al ea angemen s we e iden i-
ied in he a ec ed animal and 226 sequenced con ol ani-
mals wi h an a e age genome co e age abo e 8- old using
he Pindel so wa e package [45]. To iden i y mu a ions
compa ible wi h ecessi e inhe i ance, all polymo phic
si es we e il e ed o a ian s ha we e homozygous o
he al e na e allele in he a ec ed bull and homozygous
o he e e ence allele in 300 sequenced con ol animals.
Candida e causal a ian s we e anno a ed using he Va i-
an E ec P edic o ool [46, 47]. Addi ionally, sequence
a ian s o 1147 animals om 29 b eeds ha we e se-
quenced o he 1000 bull genomes p ojec [17] we e ana-
lyzed o ob ain geno ypes o compa ible a ian s in a
la ge coho . The animals o he 1000 bull genomes p o-
jec we e mos ly in luen ial si es ha had been widely used
o a i icial insemina ion.
Valida ion o he ss1815612719 polymo phism
PCR p ime s TTCAGTGCCAGGTTCATTGC and TTG
GCTGGATGAGGTCAGTT we e designed wi h P ime 3
[48] o sc u inize he ss1815612719 polymo phism by
Sange sequencing in wo a ec ed bulls and 97 una ec ed
a i icial insemina ion bulls o he Swedish Red ca le
b eed. DNA was ex ac ed om semen samples ollowing
s anda d p o ocols using p o einase K diges ion and
phenol-chlo o o m ex ac ion. Genomic PCR p oduc s
we e sequenced using a 3730x1 DNA Analyze (Applied
Biosys ems) and da a we e analyzed wi h he Va ian Re-
po e 1.0 p og am (Applied Biosys ems).
Bioin o ma ic analysis o ARMC3
The ARMC3 p o ein sequence was ob ained om
ensembl (ENSBTAT00000061467) and he Clus alW2 ool
[49] was used o mul iple species alignmen . The anno a-
ion o ARMC3 p o ein domains was ca ied ou using he
Simple Modula A chi ec u e Resea ch Tool [50].
A ailabili y o suppo ing da a
The da a suppo ing he esul s o his a icle a e in-
cluded wi hin he a icle and i s addi ional iles. Whole-
genome sequencing da a o a bull wi h he ail s ump
spe m de ec we e deposi ed in he Eu opean Nucleo ide
A chi e (h p://www.ebi.ac.uk/ena) unde accession
numbe PRJEB12739.
Addi ional iles
Addi ional ile 1: Pedig ee o h ee bulls wi h he ail s ump spe m
de ec . Red and blue colo ep esen s h ee a ec ed bulls and hei
common ances o . The d awn pedig ee includes only obliga e mu a ion
ca ie s. (PNG 27 kb)
Addi ional ile 2: Sequence a ian s iden i ied using he SAM ools
so wa e package ha we e compa ible wi h ecessi e inhe i ance.
G ey backg ound indica es 15 sequence a ian s ha we e no polymo phic
among 1147 animals o he 1000 bull genomes p ojec . Red colo indica es
a coding a ian compa ible wi h ecessi e inhe i ance. The unc ional
consequence o he al e na i e allele was p edic ed using he Va ian E ec
P edic o om Ensembl (see Me hods). (XLSX 61 kb)
Addi ional ile 3: S uc u al sequence a ian s ha we e compa ible
wi h ecessi e inhe i ance. G ey backg ound indica es an in e genic
sequence a ian ha was no polymo phic among 1147 animals o he
1000 bull genomes p ojec . (XLSX 36 kb)
Addi ional ile 4: Geno ype dis ibu ion o 73 candida e causal
mu a ions o he ail s ump spe m de ec in 1147 animals om he
1000 bull genomes p ojec . Al e na e allele equency and geno ype
dis ibu ion o 73 a ian s in 29 b eeds (homozygous animals o he
e e ence allele | he e ozygous animals | homozygous animals o he
al e na e allele). G ey colo indica es a ian s ha we e conside ed as
candida e causal mu a ions. Red colo indica es he dele ion mu a ion in
he coding sequence o ARMC3. (XLSX 49 kb)
Abb e ia ions
AI: a i icial insemina ion; ARM: a madillo; MMAF: mul iple mo phological
abno mali ies o he lagella; ROH: uns o homozygosi y; SNP: single
nucleo ide polymo phism.
Compe ing in e es s
The au ho s decla e ha hey ha e no compe ing in e es s
Au ho s’con ibu ions
HP analyzed he SNP and NGS da a, pa icipa ed in he s udy design and
d a ed he manusc ip . HV pa icipa ed in molecula gene ic analyses and
e ised he manusc ip . KH pe o med molecula gene ic in es iga ions. CW
gene a ed NGS da a. TIT and AS analyzed SNP da a and ca e ully e ised he
manusc ip . RKV p o ided SNP da a o a ec ed animals. HL con ibu ed o
s udy design and molecula gene ic analyses and ca e ully e ised he
manusc ip . LS iden i ied and examined he h ee a ec ed bulls and ook he
pho os o he s ained spe ma ozoa and es icles. RF analyzed NGS da a. MA
concei ed he s udy pa icipa ed in he s udy design, sample collec ion, da a
analysis and p epa a ion o he manusc ip . All au ho s ead and app o ed
he inal manusc ip .
Acknowledgemen s
We hank Auli Himanen, Jonas K an z, Ande s Edman, Hans S ålhamma and
Sø en Bo che sen om Viking Gene ics o hei in aluable help o ob ain
biological ma e ial o he s udy. The ou s anding labo a o y help p o ided
by M s. Annika Rikbe g and Ka in Selin-W e ling a he Spe m Labo a o y o
he Di ision o Rep oduc ion a Uni e si y o Ag icul u al Sciences (SLU),
Uppsala is highly acknowledged. We hank he 1000 Bull Genomes conso ium
o sha ing sequence a ian s o 1147 animals. This wo k was suppo ed by he
Finnish Ve e ina y Founda ion.
Au ho de ails
1
Leh s uhl ue Tie zuch , Technische Uni e si ae Muenchen, 85354 F eising,
Ge many.
2
Depa men o P oduc ion Animal Medicine, Facul y o Ve e ina y
Medicine, Uni e si y o Helsinki, 04920 Saa en aus, Finland.
3
Na u al
Resou ces Ins i u e Finland (Luke), G een Technology, 31600 Jokioinen,
Finland.
4
Genoskan A/S, 8830 Tjele, Denma k.
5
Depa men o Ve e ina y
Biosciences and Resea ch P og ams Uni , Molecula Neu ology, Uni e si y o
Helsinki and Folkhälsan Resea ch Cen e , 00290 Helsinki, Finland.
6
Di ision o
Rep oduc ion, Depa men o Clinical Sciences, Swedish Uni e si y o
Ag icul u al Sciences, SE-750 07 Uppsala, Sweden.
Pausch e al. BMC Gene ics (2016) 17:49 Page 7 o 9
Recei ed: 22 Oc obe 2015 Accep ed: 17 Feb ua y 2016
Re e ences
1. Vincen P, Unde wood SL, Dolbec C, Boucha d N, K oe sch T, Blondin P.
Bo ine semen quali y con ol in a i icial insemina ion cen e s. Anim Rep od.
2012;9:153–165.
2. Tanghe S, Van Soom A, S e ckx V, Maes D, de K ui A. Assessmen o
di e en spe m quali y pa ame e s o p edic in i o e ili y o bulls.
Rep od Domes Anim. 2002;37:127–32.
3. Ben Kheli a M, Cou on C, Zoua i R, Ka aouzène T, Rendu J, Bida M, e al.
Mu a ions in DNAH1, which encodes an inne a m hea y chain dynein, lead
o male in e ili y om mul iple mo phological abno mali ies o he spe m
lagella. Am J Hum Gene . 2014;94:95–104.
4. Bacce i B, Collodel G, Es enoz M, Manca D, Mo e i E, Piomboni P. Gene
dele ions in an in e ile man wi h spe m ib ous shea h dysplasia. Hum
Rep od. 2005;20:2790–4.
5. Me eille A-C, Da is EE, Becke -Heck A, Legend e M, Ami a I, Ba aille G, e
al. CCDC39 is equi ed o assembly o inne dynein a ms and he dynein
egula o y complex and o no mal cilia y mo ili y in humans and dogs. Na
Gene . 2011;43:72–8.
6. Si onen A, Thomsen B, Ande sson M, Ahola V, Vilkki J. An in onic inse ion
in KPL2 esul s in abe an splicing and causes he immo ile sho - ail spe m
de ec in he pig. P Na l Acad Sci USA. 2006;103:5006–11.
7. Si onen A, Uima i P, Venho an a H, Ande sson M, Vilkki J. An exonic
inse ion wi hin Tex14 gene causes spe ma ogenic a es in pigs. BMC
Genomics. 2011;12:591.
8. Sapi o R, Kos e skii I, Olds-Cla ke P, Ge on GL, Radice GL, S auss III JF. Male
in e ili y, impai ed spe m mo ili y, and hyd ocephalus in mice de icien in
spe m-associa ed an igen 6. Mol Cell Biol. 2002;22:6298–305.
9. Nakamu a N, Dai Q, Williams J, Goulding EH, Willis WD, B own PR, e al.
Dis up ion o a spe ma ogenic cell-speci ic mouse enolase 4 (eno4) gene
causes spe m s uc u al de ec s and male in e ili y. Biol Rep od. 2013;88:90.
10. Campbell PK, Waymi e KG, Heie RL, Sha e C, Day DE, Reimann H, e al.
Mu a ion o a no el gene esul s in abno mal de elopmen o spe ma id
lagella, loss o in e male agg ession and educed body a in mice.
Gene ics. 2002;162:307–20.
11. Blom E. A s e ilizing ail s ump spe m de ec in a Hols ein-F iesian bull. No d
Ve Med. 1976;28:295–8.
12. Vie ula M, Alanko M, Remes E, Vanha-Pe ula T. Ul as uc u e o a ail
s ump spe m de ec in an Ay shi e bull. And ologia. 1983;15:303–9.
13. Vie ula M, Alanko M, Ande sson M, Vanha-Pe ula T. Tail S ump Spe m
De ec in Ay shi e Bulls: Mo phogenesis o he De ec . And ologia. 1987;19:
207–16.
14. Foo e RH, Hough SR, Johnson LA, Kap o h M. Elec on mic oscopy and
pedig ee s udy in an Ay shi e bull wi h ail-s ump spe m de ec s. Ve Rec.
1992;130:578–9.
15. Chacón J, Rod íguez-Ma ínez H. Tail S ump Spe m De ec as a Cause o
S e ili y in an Indob asil (Bos indicus) Bull. Rep od Dom Anim. 1998;33:405–7.
16. Alanko M, Vie ula M, Remes E. Tail s ump spe m de ec in Ay shi e bulls:
spe m mo phology and inhe i ance o he de ec . 10 h In e na ional
Cong ess on Animal Rep oduc ion and A i icial Insemina ion, Uni e si y o
Illinois a U bana-Champaign, Illinois. 1984;abs ac 522.
17. Dae wyle HD, Capi an A, Pausch H, S o ha d P, an Binsbe gen R, B øndum
RF, e al. Whole-genome sequencing o 234 bulls acili a es mapping o
monogenic and complex ai s in ca le. Na Gene . 2014;46:858–65.
18. D ue T, F i z S, Sellem E, Basso B, Gé a d O, Salas-Co es L, e al. Es ima ion
o gene ic pa ame e s and genome scan o 15 semen cha ac e is ics ai s
o Hols ein bulls. J Anim B eed Gene . 2009;126:269–77.
19. Lan XY, Peñaga icano F, Dejung L, Weigel KA, Kha ib H. Sho
communica ion: A missense mu a ion in he PROP1 (p ophe o Pi 1) gene
a ec s male e ili y and milk p oduc ion ai s in he US Hols ein
popula ion. J Dai y Sci. 2013;96:1255–7.
20. Pausch H, Wu mse C, Reinha d F, Emme ling R, F ies R. Sho
communica ion: Valida ion o 4 candida e causa i e ai a ian s in 2 ca le
b eeds using a ge ed sequence impu a ion. J Dai y Sci. 2015;98:4162–7.
21. Pausch H, Kölle S, Wu mse C, Schwa zenbache H, Emme ling R, Jansen S,
e al. A Nonsense Mu a ion in TMEM95 Encoding a Nondesc ip
T ansmemb ane P o ein Causes Idiopa hic Male Sub e ili y in Ca le. PLoS
Gene . 2014;10:e1004044.
22. Sham PC, Pu cell SM. S a is ical powe and signi icance es ing in la ge-scale
gene ic s udies. Na Re Gene . 2014;15:335–46.
23. Cha lie C, Coppie e s W, Rollin F, Desmech D, Age holm JS, Cambisano N,
e al. Highly e ec i e SNP-based associa ion mapping and managemen o
ecessi e de ec s in li es ock. Na Gene . 2008;40:449–54.
24. Jung S, Pausch H, Langenmaye MC, Schwa zenbache H, Majzoub-Al weck
M, Gollnick NS, e al. A nonsense mu a ion in PLD4 is associa ed wi h a zinc
de iciency-like synd ome in Fleck ieh ca le. BMC Genomics. 2014;15:623.
25. Jansen S, Aigne B, Pausch H, Wysocki M, Eck S, Bene -Pagès A, e al.
Assessmen o he genomic a ia ion in a ca le popula ion by e-
sequencing o key animals a low o medium co e age. BMC Genomics.
2013;14:446.
26. Mu giano L, Jaganna han V, Calde oni V, Joechle M, Gen ile A, D ögemülle
C. Looking he Cow in he Eye: Dele ion in he NID1 Gene Is Associa ed
wi h Recessi e Inhe i ed Ca a ac in Romagnola Ca le. PLoS ONE.
2014;9:e110628.
27. Tewa i R, Bailes E, Bun ing KA, Coa es JC. A madillo- epea p o ein unc ions:
ques ions o li le c ea u es. T ends Cell Biol. 2010;20:470–81.
28. Dohne JV. The Encyclopedia o His o ic and Endange ed Li es ock and Poul y
B eeds. Fi s Edi ion. New Ha en: Yale Uni e si y P ess; 2001.
29. Makgahlela ML, Män ysaa i EA, S andén I, Koi ula M, Nielsen US, Sillanpää
MJ, e al. Ac oss b eed mul i- ai andom eg ession genomic p edic ions in
he No dic Red dai y ca le. J Anim B eed Gene . 2013;130:10–9.
30. D ögemülle C, Te ens J, Sigu dsson S, Gen ile A, Tes oni S, Lindblad-Toh K,
e al. Iden i ica ion o he bo ine A achnomelia mu a ion by massi ely
pa allel sequencing implica es sul i e oxidase (SUOX) in bone de elopmen .
PLoS Gene . 2010;6:e1001079.
31. Bui kamp J, Semme J, Gö z K-U. A achnomelia synd ome in Simmen al
ca le is caused by a homozygous 2-bp dele ion in he molybdenum
co ac o syn hesis s ep 1 gene (MOCS1). BMC Gene ics. 2011;12:11.
32. Pul e s JN, B yk J, Fish JL, Wilsch-B äuninge M, A ai Y, Sch eie D, e al.
Mu a ions in mouse Aspm (abno mal spindle-like mic ocephaly associa ed)
cause no only mic ocephaly bu also majo de ec s in he ge mline. P Na l
Acad Sci USA. 2010;107:16595–600.
33. Onou iadis A, Shoema k A, Munye MM, James CT, Schmid s M, Pa el M, e al.
Combined exome and whole-genome sequencing iden i ies mu a ions in
ARMC4 as a cause o p ima y cilia y dyskinesia wi h de ec s in he ou e dynein
a m. J Med Gene . 2014;51:61–7.
34. Cheng W, Ip YT, Xu Z. Gudu, an A madillo epea -con aining p o ein, is
equi ed o spe ma ogenesis in D osophila. Gene. 2013;531:294–300.
35. Williams W. Technique o collec ing semen o labo a o y examina ion wi h
a e iew o se e al diseased bulls. Co nell Ve e ina ian. 1920;10:87–94.
36. Lage lö N. Mo phological s udies o changes in spe m mo phology and in
he es es o bulls wi h lowe ed o no e ili y. Ac a Pa h Mic obiol Scand.
1934;19:254 (Suppl.).
37. Zimin AV, Delche AL, Flo ea L, Kelley DR, Scha z MC, Puiu D, e al. A whole-
genome assembly o he domes ic cow. Bos au us Genome Biol. 2009;
10:R42.
38. B owning BL, B owning SR. A Uni ied App oach o Geno ype Impu a ion
and Haplo ype-Phase In e ence o La ge Da a Se s o T ios and Un ela ed
Indi iduals. Am J Hum Gene . 2009;84:210–23.
39. Pu cell S, Neale B, Todd-B own K, Thomas L, Fe ei a MAR, Bende D, e al.
PLINK: a ool se o whole-genome associa ion and popula ion-based
linkage analyses. Am J Hum Gene . 2007;81:559–75.
40. Chang CC, Chow CC, Tellie LC, Va iku i S, Pu cell SM, Lee JJ. Second-
gene a ion PLINK: ising o he challenge o la ge and iche da ase s.
GigaScience. 2015;4:7.
41. Li H, Du bin R. Fas and accu a e sho ead alignmen wi h Bu ows–Wheele
ans o m. Bioin o ma ics. 2009;25:1754–60.
42. Li H, Handsake B, Wysoke A, Fennell T, Ruan J, Home N, e al. The
Sequence Alignmen /Map o ma and SAM ools. Bioin o ma ics. 2009;25:
2078–9.
43. Pica d Tools - By B oad Ins i u e. h p://b oadins i u e.gi hub.io/pica d/.
Accessed 15 Janua y 2016
44. Pausch H, Schwa zenbache H, Bu gs alle J, Flisikowski K, Wu mse C,
Jansen S, e al. Homozygous haplo ype de iciency e eals dele e ious
mu a ions comp omising ep oduc i e and ea ing success in ca le. BMC
Genomics. 2015;16:312.
45. Ye K, Schulz MH, Long Q, Apweile R, Ning Z. Pindel: a pa e n g ow h
app oach o de ec b eak poin s o la ge dele ions and medium sized
inse ions om pai ed-end sho eads. Bioin o ma ics. 2009;25:2865–71.
Pausch e al. BMC Gene ics (2016) 17:49 Page 8 o 9
46. McLa en W, P i cha d B, Rios D, Chen Y, Flicek P, Cunningham F. De i ing
he consequences o genomic a ian s wi h he Ensembl API and SNP
E ec P edic o . Bioin o ma ics. 2010;26:2069–70.
47. Va ian E ec P edic o . h p://www.ensembl.o g/Tools/VEP. Accessed 15
Janua y 2016
48. Un e gasse A, Cu cu ache I, Ko essaa T, Ye J, Fai clo h BC, Remm M, e al.
P ime 3–new capabili ies and in e aces. Nucleic Acids Res. 2012;40:e115.
49. La kin MA, Blackshields G, B own NP, Chenna R, McGe igan PA, McWilliam
H, e al. Clus al W and Clus al X e sion 2.0. Bioin o ma ics. 2007;23:2947–8.
50. Le unic I, Doe ks T, Bo k P. SMART: ecen upda es, new de elopmen s and
s a us in 2015. Nucl Acids Res. 2015;43:D257–60.
51. Robinson JT, Tho aldsdó i H, Winckle W, Gu man M, Lande ES, Ge z G,
e al. In eg a i e genomics iewe . Na Bio echnol. 2011;29:24–6.
• We accep p e-submission inqui ies
• Ou selec o ool helps you o ind he mos ele an jou nal
• We p o ide ound he clock cus ome suppo
• Con enien online submission
• Tho ough pee e iew
• Inclusion in PubMed and all majo indexing se ices
• Maximum isibili y o you esea ch
Submi you manusc ip a
www.biomedcen al.com/submi
Submi you nex manusc ip o BioMed Cen al
and we will help you a e e y s ep:
Pausch e al. BMC Gene ics (2016) 17:49 Page 9 o 9