A frameshift mutation in ARMC3 is associated with a tail stump sperm defect in Swedish Red (Bos taurus) cattle

RESEARCH ARTICLE Open Access A ameshi mu a ion in ARMC3 is associa ed wi h a ail s ump spe m de ec in Swedish Red (Bos au us) ca le Hube Pausch 1* , Heli Venho an a 2 , Ch is ine Wu mse 1 , Kalle Hakala 2 , Te hi Iso-Tou u 3 , Anu Si onen 3 , Rikke K. Vingbo g 4 , Hannes Lohi 5 , Lenna Söde quis 6 , Ruedi F ies 1 and Magnus Ande sson 2 Abs ac Backg ound: A i icial insemina ion is widely used in many ca le b eeding p og ams. Semen samples o b eeding bulls a e collec ed and closely examined immedia ely a e collec ion a a i icial insemina ion cen e s. Only ejacula es wi hou anomalous indings a e e ained o a i icial insemina ion. Al hough mo phological abe a ions o he spe ma ozoa a e a equen eason o disca ding ejacula es, he gene ic de e minan s unde lying poo semen quali y a e sca cely unde s ood. Resul s: A ail s ump spe m de ec was obse ed in h ee bulls o he Swedish Red ca le b eed. The spe ma ozoa o a ec ed bulls we e immo ile because o se e ely diso ganized ails indica ing dis u bed spe ma ogenesis. We geno yped h ee a ec ed bulls and 18 una ec ed male hal -sibs a 46,035 SNPs and pe o med homozygosi y mapping o map he e ili y diso de o an 8.42 Mb in e al on bo ine ch omosome 13. The analysis o whole-genome e-sequencing da a o an a ec ed bull and 300 una ec ed animals om ele en ca le b eeds o he han Swedish Red e ealed a 1 bp dele ion (Ch 13: 24,301,425 bp, ss1815612719) in he ele en h exon o he a madillo epea con aining 3-encoding gene (ARMC3) ha was compa ible wi h he supposed ecessi e mode o inhe i ance. The dele ion is expec ed o al e he eading ame and o induce p ema u e ansla ion e mina ion (p.A451 s26). The mu a ed p o ein is sho ened by 401 amino acids (46 %) and lacks domains ha a e likely essen ial o no mal p o ein unc ion. Conclusions: We epo he pheno ypic and gene ic cha ac e iza ion o a s e ilizing ail s ump spe m de ec in he Swedish Red ca le b eed. Exploi ing high-densi y geno ypes and massi e e-sequencing da a enabled us o iden i y he mos likely causal mu a ion o he e ili y diso de in bo ine ARMC3. Ou esul s p o ide he basis o moni o ing he mu a ed a ian in he Swedish Red ca le popula ion and o he ea ly iden i ica ion o in e ile animals. Keywo ds: ARMC3, Tail s ump spe m de ec , Swedish Red ca le, MMAF, Flagellum, Male in e ili y, Spe ma ogenesis Backg ound A i icial insemina ion (AI) is widely used ins ead o na - u al ma ing in many ca le b eeding popula ions. Ejacu- la es o b eeding bulls a e collec ed once o wice a week and closely examined immedia ely a e semen col- lec ion a highly specialized AI cen e s. Only ejacula es wi hou appa en abno mali ies a e e ained o AI. Up o 20 % o all collec ed ejacula es a e ejec ed because hey do no comply wi h cu en s anda ds o AI [1]. Diagnoses o insu icien semen quali y in ol e he ab- sence o spe ma ozoa, low spe m concen a ion, educed mo ili y o iabili y and mo phological abe a ions o spe ma ozoa [2]. A mo ile spe m lagellum is essen ial o he e iliza ion in i o. Mo phological abe a ions o he spe m ail com- p omise spe m mo ili y and impai e iliza ion. Such abe a ions a e collec i ely e e ed o as mul iple mo - phological abno mali ies o he lagella (MMAF, [3]). Diag- noses o MMAF in ol e s ump and sho ail spe ma ozoa and dysplasia o he ib ous shea h. Sequence a ian s causing MMAF ha e been iden i ied in, e.g.,humans[3– 5], pigs [6, 7] and mice [8–10]. Howe e , sequence * Co espondence: [email p o ec ed] 1 Leh s uhl ue Tie zuch , Technische Uni e si ae Muenchen, 85354 F eising, Ge many Full lis o au ho in o ma ion is a ailable a he end o he a icle © 2016 Pausch e al. Open Access This a icle is dis ibu ed unde he e ms o he C ea i e Commons A ibu ion 4.0 In e na ional License (h p://c ea i ecommons.o g/licenses/by/4.0/), which pe mi s un es ic ed use, dis ibu ion, and ep oduc ion in any medium, p o ided you gi e app op ia e c edi o he o iginal au ho (s) and he sou ce, p o ide a link o he C ea i e Commons license, and indica e i changes we e made. The C ea i e Commons Public Domain Dedica ion wai e (h p://c ea i ecommons.o g/publicdomain/ze o/1.0/) applies o he da a made a ailable in his a icle, unless o he wise s a ed. Pausch e al. BMC Gene ics (2016) 17:49 DOI 10.1186/s12863-016-0356-7 a ian s causing MMAF ha e no been iden i ied in ca le so a . Bulls wi h MMAF ha e been obse ed in Hols ein- F iesian, Ay shi e and Indob asil ca le [11–15]. The a - ec ed bulls we e isola ed cases wi hin hei b eeds wi h- ou known ela ionship among each o he indica ing a he e ogeneous gene ic e iology o MMAF ac oss b eeds. Howe e , Alanko e al. [16] epo ed h ee ela ed bulls om he Ay shi e ca le b eed wi h a s e ilizing ail s ump spe m de ec sugges ing ha such condi ions may be inhe i ed in an au osomal ecessi e ashion in ca le. He e we p esen he pheno ypic mani es a ion and he gene ic analysis o a ecessi ely inhe i ed ail s ump spe m de ec in he Swedish Red ca le b eed. The appli- ca ion o homozygosi y mapping acili a ed he mapping o he e ili y diso de o a sho segmen on bo ine ch omosome 13. The analysis o comp ehensi e whole- genome sequence da a e ealed a ameshi mu a ion in ARMC3 ha mos likely causes he spe m ail diso de in Swedish Red ca le. Resul s A ecessi ely inhe i ed ail s ump spe m de ec in he Swedish Red ca le b eed Th ee young bulls (11 mon hs) o he Swedish Red ca le b eed bo n in 2008, 2009 and 2012, we e epo ed om an AI cen e because hey p oduced ejacula es wi h im- mo ile spe ma ozoa du ing a semen collec ion pe iod o 5 mon hs. Examina ion o he bulls’ esh ejacula es e- ealed a educed spe m concen a ion (~140 million spe ma ozoa pe ml) despi e no mal ejacula e olume (~4 ml). The spe m coun was only 10–20 % o he a e - age spe m coun o con ol bulls. All spe ma ozoa we e immo ile because o mul iple lagella abno mali ies such as udimen a y (less han 5 % o he no mal leng h), sho leng h and absen ails. A p oximal d ople su - ounded mos udimen a y ails (Fig. 1a-b). The p opo - ion o spe ma ozoa wi h abno mal heads anged om 47 o 62 %, which is en imes highe han in no mal ejacula es (Table 1). None o he spe ma ozoa we e mo ile. His ological sec ions o he es icles e ealed a lack o ull-leng h spe m ails in he luminal pa o he ubuli semini e i indica ing dis u bed spe ma o- genesis (Fig. 1c-d). The analysis o he pedig ee eco ds o h ee a ec ed bulls e ealed a common ances o (bo n in 1987) in hei pa e nal and ma e nal pa h (see Addi ional ile 1). Eigh een male hal -sibs o he a ec ed bulls we e used o AI. The quali y o hei ejacula es was no mal and hei e ili y eco ds we e wi hin e e ence anges indi- ca ing undis u bed ep oduc i e pe o mance. Based on hese indings, an au osomal ecessi e mode o inhe i - ance was assumed o he ail s ump spe m de ec . The ail s ump spe m de ec maps o bo ine ch omosome 13 To iden i y he genomic egion associa ed wi h he ail s ump spe m de ec , h ee a ec ed and 18 una ec ed male hal -sibs we e geno yped wi h he Illumina Bo i- neSNP50 geno yping a ay. A e quali y con ol, geno- ypes a 46,035 SNPs we e sc eened o he p esence o long uns o homozygosi y (ROH) in h ee a ec ed bulls. Fig. 1 Pheno ypic mani es a ion o he ail s ump spe m de ec . Rep esen a i e igu es o spe ma ozoa o a con ol (a) and an a ec ed bull (b). Spe ma ozoa o a ec ed bulls had mul iple abe a ions such as sho ails (blue s a ), udimen a y ails wi h p oximal d ople (a ows), udimen a y ails wi hou p oximal d ople (yellow iangle) and coiled ails ( ed s a ). His ological sec ions o he es icles o a con ol (c) and an a ec ed (d) bull. Nume ous ull-leng h spe m ails a e p esen in he luminal pa o he ubuli semini e i in he con ol bull, whe eas ull-leng h spe m ails a e absen in he a ec ed bull Pausch e al. BMC Gene ics (2016) 17:49 Page 2 o 9 Only wo genomic egions we e consis en ly homozy- gous in all a ec ed animals: a 1.13 Mb segmen on BTA22 ( om 48,349,750 bp o 49,479,051 bp) and an 8.42 Mb segmen on BTA13 ( om 22,308,682 bp o 30,733,648 bp) (Fig. 2a). The segmen on BTA22 was also homozygous in six e ile hal -sibs p ecluding an as- socia ion wi h he ail s ump spe m de ec . In con as , he 8.42 Mb segmen on BTA13 was ne e ound in he homozygous s a e in eigh een una ec ed hal -sibs co e- sponding o an au osomal ecessi e inhe i ance (Fig. 2b). A 1 bp dele ion in ARMC3 is associa ed wi h he ail s ump spe m de ec To pinpoin he mu a ion causing he ail s ump spe m de ec , he whole genome o an a ec ed bull was se- quenced o an a e age ead dep h o 9.29. In addi ion, we exploi ed da a o 300 p e iously sequenced animals om ele en ca le b eeds o he han Swedish Red o he iden i ica ion o he mu a ion. Dele e ious ecessi e mu a ions a e assumed o ha e occu ed a e b eed o - ma ion and a e hus likely o be b eed-speci ic. Thus we assumed ha he causal mu a ion should no seg ega e among he sequenced con ol animals. Mul i-sample a ian calling in he 8.42 Mb egion o ex ended homo- zygosi y on BTA13 yielded geno ypes a 81,925 single nucleo ide and sho inse ion and dele ion polymo - phisms (74,385 SNPs, 7540 Indels). In addi ion, 11,505 s uc u al a ian s we e de ec ed in he genome-wide se- quence da a o he a ec ed bull and 226 con ol animals wi h genome co e age o a leas eigh - old. Se en y-se en a ian s we e compa ible wi h ecessi e inhe i ance ha is homozygous o he e e ence allele in 300 con ol animals and homozygous o he al e na e allele in he a ec ed bull. Bioin o ma ic analysis e ealed ha 76 a ian s we e loca ed in non-coding egions o he genome and one a ian esided in he coding egion o he a madillo epea con aining 3-encoding gene (ARMC3, Ch 13: 24,301,425 bp, ss1815612719, Fig. 3a, see Addi ional iles 2 and 3). To u he educe he numbe o plausible candida e causal mu a ions, we exploi ed whole-genome sequence da a o 1147 animals om 29 ca le b eeds ha had been sequenced o Run4 o he 1000 bull genomes p ojec [17]. Because o he close ela ionship among animals o h ee No dic Red ca le b eeds, we excluded 56 sequenced animals om he Ay shi e, Swedish Red and Danish Red ca le b eed o a ian il e ing. Thi y- i e ou o 77 com- pa ible a ian s also seg ega ed among 1009 animals om b eeds o he han No dic Red (see Addi ional ile 4). In Table 1 Spe m mo phology in esh ejacula es o h ee a ec ed AI bulls Pheno ype Bull 1 Bull 2 Bull 3 Tail mo phology No mal ails 0 % 0 % 0 % Absen ails 2 % 3 % 4 % Rudimen a y ails 45 % 63 % 28 % Sho s aigh ails 27 % 15 % 29 % Folded o coiled sho ails 26 % 19 % 39 % Head mo phology No mal heads 42 % 53 % 38 % Abno mal heads 58 % 47 % 62 % Fig. 2 Homozygosi y mapping in h ee animals wi h a s e ilizing ail s ump spe m de ec . aShades o blue ep esen long uns o homozygosi y (ROH) in h ee animals along he 29 au osomes. The ed bo de s highligh wo egions on BTA13 and BTA22 wi h ROH in all a ec ed animals. bAu ozygosi y mapping on BTA13 in h ee a ec ed animals. Blue and pale blue ep esen homozygous geno ypes (AA and BB), he e ozygous geno ypes (AB) a e displayed in ligh g ey. Whi e colo indica es missing geno ypes. The ed ba indica es a common 8.42 Mb segmen o homozygosi y Pausch e al. BMC Gene ics (2016) 17:49 Page 3 o 9 conclusion, he coding a ian in ARMC3 and 41 non- coding a ian s we e conside ed as candida e causal a i- an s o he ail s ump spe m de ec . The bo ine ARMC3 gene consis s o 19 exons encod- ing 876 amino acids (Fig. 3b). The a ian compa ible wi h ecessi e inhe i ance (ss1815612719) is a 1 bp dele- ion in he ele en h exon o ARMC3 a ec ing he hi d base o codon 450 (ENSBTAT00000061467:c.1350_1351- delGGinsG). Sange sequencing con i med homozygosi y o he dele ion a ian in wo bulls wi h he ail s ump spe m de ec . The 1 bp dele ion is expec ed o al e he eading ame and o change he amino acid sequence om posi ion 451 onwa ds esul ing in a p ema u e ansla ion e mina ion a posi ion 476 (p.A451 s26). The mu a ed p o ein should be sho ened by 401 amino acids (46 %). Bioin o ma ic analysis e ealed ha he p o ein se- quence o bo ine ARMC3 con ains en a madillo/be a-ca- enin-like (ARM) epea s (Fig. 3c). The dele ion a ian esides wi hin he highly conse ed a madillo epea con- aining domain. Due o he ameshi wi h p ema u e ansla ion e mina ion, he mu a ed p o ein is expec ed o lack one ARM epea (Fig. 3d). We geno yped 97 AI bulls om he Swedish Red ca le b eed wi h no mal e ili y a ss1815612719 using Fig. 3 A 1 bp dele ion in ARMC3 induces p ema u e ansla ion e mina ion. aSnapsho om he In eg a ed Genomics Viewe (IGV, [51]) showing a homozygous 1 bp dele ion on ch omosome 13 a 24,301,425 bp in an animal wi h he ail s ump spe m de ec . bGenomic s uc u e o bo ine ARMC3. Bo ine ARMC3 consis s o 19 exons ( e ical ba s) and i s ansla ion s a s in exon 2. The ed e ical ba ep esen s he ele en h exon whe e he 1 bp dele ion is loca ed. The coo dina es o en A madillo (ARM) epea s we e de e mined using he Simple Modula A chi ec u e Resea ch Tool [50]. Blue a ows ep esen he posi ion o he s a and s op codons. cThe bo ine ARMC3 p o ein sequence consis s o 876 amino acids and i con ains en ARM epea s (g een boxes). The ed iangle ep esen s he s a o he shi in ansla ion esul ing om he 1 bp dele ion. dMul i-species alignmen o a pa o he ARMC3 p o ein sequence. Blue colou highligh s he p o ein sequence o he en h ARM epea , which is absen in he mu a ed (m ) bo ine sequence Pausch e al. BMC Gene ics (2016) 17:49 Page 4 o 9 cus omized geno yping assays. None o he bulls was homozygous o he dele ion a ian . Se en y- ou bulls we e homozygous o he e e ence allele and 23 bulls we e he e ozygous ca ie s o he 1 bp dele ion yielding a equency o he dele ion o 11.9 %. Discussion Al hough he e is conside able pheno ypic a ia ion bo h in semen quali y and insemina ion success o AI bulls, he gene ic de e minan s unde lying male ep oduc i e ai s a e sca cely unde s ood [18]. Low he i abili y o e ili y ai s and small-sized samples complica ed he mapping o causal sequence a ian s in he pas . Mo e- o e , e ili y-associa ed a ian s did no each con in- cing le els o signi icance in eplica ion s udies [19, 20]. Recen ly, he a ailabili y o comp ehensi e geno ype and massi e e-sequencing da a enabled he iden i ica ion o a ecessi ely inhe i ed a ian o idiopa hic male sub e i- li y in ca le [21]. Howe e , o ou knowledge, ou s udy is he i s o e eal a mu a ion ha mani es s in mo pho- logical abe a ions o he spe ma ozoa in ca le. The analysis o pedig ee eco ds indica ed ha he spe m ail diso de is inhe i ed in an au osomal ecessi e ashion. Sequence a ian s unde lying ecessi e ai s a e adi ionally iden i ied by compa ing allele coun s o dense molecula ma ke s in a ec ed and una ec ed indi- iduals (e.g., [21]). The likelihood o map a mendelian ai in a genome-wide case/con ol-associa ion s udy depends on he numbe o a ec ed indi iduals [22]. The ail s ump spe m de ec is a a e diso de in he Swedish Red ca le b eed. Assuming a equency o he dele e i- ous allele o 12 % in he popula ion, andom ma ing and 100 bulls ha a e annually pu chased by he Swedish AI cen e , one would expec only one o hem o be a ec ed by he ail s ump spe m de ec . Acco dingly, only h ee a ec ed bulls we e ecognized in he pas 10 yea s. We geno yped hose bulls wi h a geno yping a ay and eso ed o pe o m homozygosi y mapping, which acili- a es pinpoin ing genomic egions unde lying ecessi e ai s wi h a small numbe o a ec ed indi iduals [23]. Th ee a ec ed bulls had a common 8.42 Mb segmen o ex ended homozygosi y which is a ypical leng h ob- se ed in s udies ha a e based on ew a ec ed animals [23–26]. Compa ible wi h ecessi e inhe i ance, none o he e ile hal -sibs was homozygous. Nex gene a ion se- quencing o an a ec ed bull e ealed a ameshi mu a- ion in ARMC3 (ss1815612719, c.1350delG, p.A451 s26) ha seg ega ed wi h he ail s ump spe m de ec . Fo y- one a ian s in non-p o ein-coding egions we e also as- socia ed wi h he diso de . Howe e , we conside he ameshi in ARMC3 as he mos likely causal mu a ion because i is p edic ed o esul in a p o ein ha lacks 401 amino acids. The unc ion o he unca ed ARMC3 p o ein may be se e ely comp omised, since i lacks domains ha a e likely equi ed o no mal p o ein unc- ion [27]. Absence o impai ed unc ion o ARMC3 possibly p e- en s physiological spe ma ogenesis esul ing in mo - phological abe a ions o he spe ma ozoa. The spe m ails o homozygous bulls we e se e ely diso ganized and all spe ma ozoa we e immo ile p ecluding success ul e iliza ion in i o. Apa om immo ile spe ma ozoa, he bulls we e heal hy. The mo phological abe a ions o he spe ma ozoa a e simila o hose obse ed in he Ay shi e ca le b eed [12–14, 16]. Because Swedish Red ca le a e closely ela ed o Ay shi e ca le [28, 29], i is possible ha he ameshi mu a ion in ARMC3 oc- cu ed in a common ances o o he wo b eeds and ha i migh also be associa ed wi h he spe m ail diso de in Ay shi e ca le. Howe e , he gene ic unde pinnings o appa en ly simila pheno ypes may be comple ely di - e en ac oss b eeds (e.g., [24, 30, 31]). In any case, i is ecommended o su ey sequence a ian s in ARMC3 in bulls wi h e ili y diso de s in ca le b eeds o he han Swedish Red. To ou knowledge, ou s udy e eals o he i s ime an associa ion o a mu a ion in ARMC3 wi h mo pho- logical abno mali ies o he spe m lagellum. Howe e , dele e ious mu a ions in o he genes encoding a madillo epea -con aining p o eins ha e al eady been shown o comp omise spe m mo ili y [8, 32]. In ou s udy, he spe ma ozoa o bulls ha we e homozygous o he ameshi mu a ion in ARMC3 we e immo ile because o se e e lagella abno mali ies. A p e ious s udy dem- ons a ed ha dys unc ion o ARMC4, a pa alog o ARMC3, impai s physiological unc ion o he cilia and spe m lagella in humans [33]. P ope unc ion o Gudu, a gene highly homologous o ARMC4, is essen ial o an undis u bed spe ma ogenesis in D osophila melanogas e [34]. Ou in es iga ions also e idenced an impai ed spe ma ogenesis in bulls homozygous o he ameshi mu a ion in ARMC3. Such indings sugges a c ucial ole o ARMC3 o physiological spe ma ogenesis. The mo phological abe a ions o he spe ma ozoa ob- se ed in ou s udy a e simila o hose obse ed in Yo kshi e boa s wi h a loss o unc ion mu a ion in SPEF2 [6]. Bo h de ec s mani es in immo ile spe ma o- zoa p ecluding e iliza ion in i o bo h in na u al se - ice and AI. The pheno ypic mani es a ions o he wo de ec s di e only sligh ly. Spe ma ozoa o animals being homozygous o he ARMC3 ameshi mu a ion mos ly lack he midpiece wi h mi ochond ia, which is, howe e , commonly p esen in spe ma ozoa o animals homozy- gous o he SPEF2 mu a ion [6]. Conclusions The combina ion o high-densi y geno ype and whole- genome e-sequencing da a e ealed a ecessi ely inhe i ed Pausch e al. BMC Gene ics (2016) 17:49 Page 5 o 9 ameshi mu a ion in bo ine ARMC3 ha mos likely causes a s e ilizing ail s ump spe m de ec in Swedish Red ca le. Ou indings sugges ha impai ed unc ion o ARMC3 comp omises spe ma ogenesis and he eby e- sul s in se e ely diso ganized spe m ails, which p e en s success ul e iliza ion in i o. Compa ed o mu a ions ha mani es in idiopa hic male sub- o in e ili y [21], spe m- a ozoa o a ec ed animals ha e s iking mo phological ab- e a ions ha acili a e o unambiguously iden i y homozygous bulls a AI cen e s. Howe e , ou indings a- cili a e o iden i y a ec ed young bulls be o e hey a e pu - chased by AI cen e s using e.g., geno yping assays on cus omized geno yping a ays. Me hods Animal e hics s a emen All animals we e housed a an app o ed comme cial AI cen e in Ö ns o, Sweden. Semen samples we e collec ed by employees o he AI cen e as pa o hei egula b eeding and ep oduc i e measu es in ca le indus y. Bulls wi h he ail s ump spe m de ec we e slaugh e ed because hei semen was no sui able o a i icial insem- ina ion. The decision o slaugh e he bulls was made solely by he owne (i.e., AI cen e ) o he bulls. None o he au ho s o he p esen s udy was in ol ed in he de- cision o slaugh e he bulls. Tes icles o an a ec ed bull we e collec ed a e slaugh e . Consen om he owne o he bulls was ob ained o use he semen and issue samples o his s udy. No e hical app o al was equi ed o his s udy. Animals Th ee bulls o he Swedish Red ca le b eed bo n be ween 2008 and 2012 wi h a s e ilizing ail s ump spe m de ec we e included in he s udy oge he wi h 18 una ec ed e ile male hal -sibs. The bulls we e housed in an AI bull cen e in Ö ns o, Sweden. The age o he bulls du ing semen collec ion anged om 11 o 16 mon hs. Em- ployees om he AI cen e collec ed semen app oxima ely wice a week as pa o hei egula p ac ice. Spe m mo ili y, mo phology and es icula his ology We examined en ejacula es pe bull. Aliquo s o esh semen we e pu in o ials o measu e spe m concen a ion using a pho ome ic me hod and a haemocy ome e (Bü - ke chambe ). A d op o semen (app oxima ely 7 μlwas pu on a p e-wa med slide o e alua e spe m mo phology. Head and spe m ail mo phology o 200 spe ma ozoa was assessed om slides s ained wi h he Williams s ain (b igh ield mic oscopy) and om a we moun o mol-saline sample using a phase con as mic oscope wi h 1000× magni ica ion, espec i ely. Mo eo e , spe m head mo ph- ology was assessed in d y smea s s ained wi h ca bol uch- sin acco ding o Williams [35] and Lage lö [36]. Tes icles om an a ec ed bull we e collec ed a e slaugh e . His o- logical specimens we e aken om he es icles, ixed in Bouin’s solu ion and embedded in pa a in. Sec ions (5 μm) we e cu and s ained wi h haema oxylin and eosin. Geno yping o a ec ed and una ec ed animals Twen y-one bulls ( h ee a ec ed, 18 una ec ed) o he Swedish Red ca le b eed we e geno yped using he Illu- mina Bo ineSNP50 Bead chip (Illumina, Inc., San Diego, CA, USA). The ch omosomal posi ion o he SNPs co esponded o he UMD3.1 assembly o he bo ine gen- ome [37]. Mi ochond ial, X-ch omosomal, Y-ch omosomal SNPs and SNPs wi h unknown ch omosomal posi ion we e no conside ed o u he analyses. A e quali y con- ol (pe SNP and pe indi idual call- a e highe han 90 %, no de ia ion om he Ha dy-Weinbe g equilib ium (P> 0.0001)), 46,035 SNPs we e e ained o u he analyses. Beagle gene ic analysis so wa e [38] was used o impu e spo adically missing geno ypes and o in e haplo ypes. Homozygosi y mapping Segmen s o ex ended homozygosi y we e iden i ied in h ee a ec ed bulls using he homozyg- unc ion imple- men ed in he whole genome associa ion analysis oolse PLINK [39, 40]. Due o he ela i ely spa se genome co e age o he geno ype da a (1 SNP pe 56 kb), we e- s ic ed ou analysis o uns o homozygosi y (ROH) wi h a minimum numbe o 20 con iguous homozygous SNPs and a minimum leng h o 500 kb. Gene a ion o sequence da a Genomic DNA o an a ec ed bull was p epa ed om a semen sample ollowing s anda d p o ocols using p o- einase K diges ion and phenol-chlo o o m ex ac ion. A gDNA sequencing lib a y wi h 420 bp inse size was p epa ed using he T uSeq DNA Sample P epa a ion Ki (Illumina inc., San Diego, CA, USA). The sample was se- quenced on an Illumina HiSeq2500 sys em using T uSeq SBS 3 chemis y (Illumina inc., San Diego, CA, USA) and he 2x100 bp pai ed-end ead module. The as q- iles we e gene a ed wi h he CASAVA bcl2 as q con e - sion so wa e ( e sion 1.8.3, Illumina inc., San Diego, CA, USA). The alignmen o he eads o he Uni e si y o Ma yland e e ence sequence (UMD3.1, [37]) was pe - o med wi h he Bu ows-Wheele Aligne [41]. The esul ing SAM ile was con e ed in o a BAM ile wi h SAM ools [42]. Duplica e eads we e iden i ied and ma ked wi h he Ma kDuplica es command o Pica d- ools [43]. Iden i ica ion o candida e causal a ian s Single nucleo ide and sho inse ion and dele ion poly- mo phisms we e geno yped in he a ec ed bull oge he wi h 300 p e iously sequenced animals om ele en Pausch e al. BMC Gene ics (2016) 17:49 Page 6 o 9 ca le b eeds (Gelb ieh (n= 12), No dic Finnca le (n=6), Fleck ieh (n= 153), O iginal Simmen al (n=15), Hols ein-F iesian (n= 31), B own Swiss (n=50),Mu nau- We den else (n= 2), Ay shi e (n= 2), Red-Hols ein (n= 21), O iginal B aun ieh (n= 8)) o he han Swedish Red [44] using he mul i-sample app oach implemen ed in he mpileup unc ion o SAM ools [42] and a a ian calling pipeline as de ailed by Jansen e al. [25]. La ge inse ions and dele ions and s uc u al ea angemen s we e iden i- ied in he a ec ed animal and 226 sequenced con ol ani- mals wi h an a e age genome co e age abo e 8- old using he Pindel so wa e package [45]. To iden i y mu a ions compa ible wi h ecessi e inhe i ance, all polymo phic si es we e il e ed o a ian s ha we e homozygous o he al e na e allele in he a ec ed bull and homozygous o he e e ence allele in 300 sequenced con ol animals. Candida e causal a ian s we e anno a ed using he Va i- an E ec P edic o ool [46, 47]. Addi ionally, sequence a ian s o 1147 animals om 29 b eeds ha we e se- quenced o he 1000 bull genomes p ojec [17] we e ana- lyzed o ob ain geno ypes o compa ible a ian s in a la ge coho . The animals o he 1000 bull genomes p o- jec we e mos ly in luen ial si es ha had been widely used o a i icial insemina ion. Valida ion o he ss1815612719 polymo phism PCR p ime s TTCAGTGCCAGGTTCATTGC and TTG GCTGGATGAGGTCAGTT we e designed wi h P ime 3 [48] o sc u inize he ss1815612719 polymo phism by Sange sequencing in wo a ec ed bulls and 97 una ec ed a i icial insemina ion bulls o he Swedish Red ca le b eed. DNA was ex ac ed om semen samples ollowing s anda d p o ocols using p o einase K diges ion and phenol-chlo o o m ex ac ion. Genomic PCR p oduc s we e sequenced using a 3730x1 DNA Analyze (Applied Biosys ems) and da a we e analyzed wi h he Va ian Re- po e 1.0 p og am (Applied Biosys ems). Bioin o ma ic analysis o ARMC3 The ARMC3 p o ein sequence was ob ained om ensembl (ENSBTAT00000061467) and he Clus alW2 ool [49] was used o mul iple species alignmen . The anno a- ion o ARMC3 p o ein domains was ca ied ou using he Simple Modula A chi ec u e Resea ch Tool [50]. A ailabili y o suppo ing da a The da a suppo ing he esul s o his a icle a e in- cluded wi hin he a icle and i s addi ional iles. Whole- genome sequencing da a o a bull wi h he ail s ump spe m de ec we e deposi ed in he Eu opean Nucleo ide A chi e (h p://www.ebi.ac.uk/ena) unde accession numbe PRJEB12739. Addi ional iles Addi ional ile 1: Pedig ee o h ee bulls wi h he ail s ump spe m de ec . Red and blue colo ep esen s h ee a ec ed bulls and hei common ances o . The d awn pedig ee includes only obliga e mu a ion ca ie s. (PNG 27 kb) Addi ional ile 2: Sequence a ian s iden i ied using he SAM ools so wa e package ha we e compa ible wi h ecessi e inhe i ance. G ey backg ound indica es 15 sequence a ian s ha we e no polymo phic among 1147 animals o he 1000 bull genomes p ojec . Red colo indica es a coding a ian compa ible wi h ecessi e inhe i ance. The unc ional consequence o he al e na i e allele was p edic ed using he Va ian E ec P edic o om Ensembl (see Me hods). (XLSX 61 kb) Addi ional ile 3: S uc u al sequence a ian s ha we e compa ible wi h ecessi e inhe i ance. G ey backg ound indica es an in e genic sequence a ian ha was no polymo phic among 1147 animals o he 1000 bull genomes p ojec . (XLSX 36 kb) Addi ional ile 4: Geno ype dis ibu ion o 73 candida e causal mu a ions o he ail s ump spe m de ec in 1147 animals om he 1000 bull genomes p ojec . Al e na e allele equency and geno ype dis ibu ion o 73 a ian s in 29 b eeds (homozygous animals o he e e ence allele | he e ozygous animals | homozygous animals o he al e na e allele). G ey colo indica es a ian s ha we e conside ed as candida e causal mu a ions. Red colo indica es he dele ion mu a ion in he coding sequence o ARMC3. (XLSX 49 kb) Abb e ia ions AI: a i icial insemina ion; ARM: a madillo; MMAF: mul iple mo phological abno mali ies o he lagella; ROH: uns o homozygosi y; SNP: single nucleo ide polymo phism. Compe ing in e es s The au ho s decla e ha hey ha e no compe ing in e es s Au ho s’con ibu ions HP analyzed he SNP and NGS da a, pa icipa ed in he s udy design and d a ed he manusc ip . HV pa icipa ed in molecula gene ic analyses and e ised he manusc ip . KH pe o med molecula gene ic in es iga ions. CW gene a ed NGS da a. TIT and AS analyzed SNP da a and ca e ully e ised he manusc ip . RKV p o ided SNP da a o a ec ed animals. HL con ibu ed o s udy design and molecula gene ic analyses and ca e ully e ised he manusc ip . LS iden i ied and examined he h ee a ec ed bulls and ook he pho os o he s ained spe ma ozoa and es icles. RF analyzed NGS da a. MA concei ed he s udy pa icipa ed in he s udy design, sample collec ion, da a analysis and p epa a ion o he manusc ip . All au ho s ead and app o ed he inal manusc ip . Acknowledgemen s We hank Auli Himanen, Jonas K an z, Ande s Edman, Hans S ålhamma and Sø en Bo che sen om Viking Gene ics o hei in aluable help o ob ain biological ma e ial o he s udy. The ou s anding labo a o y help p o ided by M s. Annika Rikbe g and Ka in Selin-W e ling a he Spe m Labo a o y o he Di ision o Rep oduc ion a Uni e si y o Ag icul u al Sciences (SLU), Uppsala is highly acknowledged. We hank he 1000 Bull Genomes conso ium o sha ing sequence a ian s o 1147 animals. This wo k was suppo ed by he Finnish Ve e ina y Founda ion. Au ho de ails 1 Leh s uhl ue Tie zuch , Technische Uni e si ae Muenchen, 85354 F eising, Ge many. 2 Depa men o P oduc ion Animal Medicine, Facul y o Ve e ina y Medicine, Uni e si y o Helsinki, 04920 Saa en aus, Finland. 3 Na u al Resou ces Ins i u e Finland (Luke), G een Technology, 31600 Jokioinen, Finland. 4 Genoskan A/S, 8830 Tjele, Denma k. 5 Depa men o Ve e ina y Biosciences and Resea ch P og ams Uni , Molecula Neu ology, Uni e si y o Helsinki and Folkhälsan Resea ch Cen e , 00290 Helsinki, Finland. 6 Di ision o Rep oduc ion, Depa men o Clinical Sciences, Swedish Uni e si y o Ag icul u al Sciences, SE-750 07 Uppsala, Sweden. Pausch e al. BMC Gene ics (2016) 17:49 Page 7 o 9 Recei ed: 22 Oc obe 2015 Accep ed: 17 Feb ua y 2016 Re e ences 1. Vincen P, Unde wood SL, Dolbec C, Boucha d N, K oe sch T, Blondin P. Bo ine semen quali y con ol in a i icial insemina ion cen e s. Anim Rep od. 2012;9:153–165. 2. Tanghe S, Van Soom A, S e ckx V, Maes D, de K ui A. Assessmen o di e en spe m quali y pa ame e s o p edic in i o e ili y o bulls. Rep od Domes Anim. 2002;37:127–32. 3. Ben Kheli a M, Cou on C, Zoua i R, Ka aouzène T, Rendu J, Bida M, e al. Mu a ions in DNAH1, which encodes an inne a m hea y chain dynein, lead o male in e ili y om mul iple mo phological abno mali ies o he spe m lagella. Am J Hum Gene . 2014;94:95–104. 4. Bacce i B, Collodel G, Es enoz M, Manca D, Mo e i E, Piomboni P. Gene dele ions in an in e ile man wi h spe m ib ous shea h dysplasia. Hum Rep od. 2005;20:2790–4. 5. Me eille A-C, Da is EE, Becke -Heck A, Legend e M, Ami a I, Ba aille G, e al. CCDC39 is equi ed o assembly o inne dynein a ms and he dynein egula o y complex and o no mal cilia y mo ili y in humans and dogs. Na Gene . 2011;43:72–8. 6. Si onen A, Thomsen B, Ande sson M, Ahola V, Vilkki J. An in onic inse ion in KPL2 esul s in abe an splicing and causes he immo ile sho - ail spe m de ec in he pig. P Na l Acad Sci USA. 2006;103:5006–11. 7. Si onen A, Uima i P, Venho an a H, Ande sson M, Vilkki J. An exonic inse ion wi hin Tex14 gene causes spe ma ogenic a es in pigs. BMC Genomics. 2011;12:591. 8. Sapi o R, Kos e skii I, Olds-Cla ke P, Ge on GL, Radice GL, S auss III JF. Male in e ili y, impai ed spe m mo ili y, and hyd ocephalus in mice de icien in spe m-associa ed an igen 6. Mol Cell Biol. 2002;22:6298–305. 9. Nakamu a N, Dai Q, Williams J, Goulding EH, Willis WD, B own PR, e al. Dis up ion o a spe ma ogenic cell-speci ic mouse enolase 4 (eno4) gene causes spe m s uc u al de ec s and male in e ili y. Biol Rep od. 2013;88:90. 10. Campbell PK, Waymi e KG, Heie RL, Sha e C, Day DE, Reimann H, e al. Mu a ion o a no el gene esul s in abno mal de elopmen o spe ma id lagella, loss o in e male agg ession and educed body a in mice. Gene ics. 2002;162:307–20. 11. Blom E. A s e ilizing ail s ump spe m de ec in a Hols ein-F iesian bull. No d Ve Med. 1976;28:295–8. 12. Vie ula M, Alanko M, Remes E, Vanha-Pe ula T. Ul as uc u e o a ail s ump spe m de ec in an Ay shi e bull. And ologia. 1983;15:303–9. 13. Vie ula M, Alanko M, Ande sson M, Vanha-Pe ula T. Tail S ump Spe m De ec in Ay shi e Bulls: Mo phogenesis o he De ec . And ologia. 1987;19: 207–16. 14. Foo e RH, Hough SR, Johnson LA, Kap o h M. Elec on mic oscopy and pedig ee s udy in an Ay shi e bull wi h ail-s ump spe m de ec s. Ve Rec. 1992;130:578–9. 15. Chacón J, Rod íguez-Ma ínez H. Tail S ump Spe m De ec as a Cause o S e ili y in an Indob asil (Bos indicus) Bull. Rep od Dom Anim. 1998;33:405–7. 16. Alanko M, Vie ula M, Remes E. Tail s ump spe m de ec in Ay shi e bulls: spe m mo phology and inhe i ance o he de ec . 10 h In e na ional Cong ess on Animal Rep oduc ion and A i icial Insemina ion, Uni e si y o Illinois a U bana-Champaign, Illinois. 1984;abs ac 522. 17. Dae wyle HD, Capi an A, Pausch H, S o ha d P, an Binsbe gen R, B øndum RF, e al. Whole-genome sequencing o 234 bulls acili a es mapping o monogenic and complex ai s in ca le. Na Gene . 2014;46:858–65. 18. D ue T, F i z S, Sellem E, Basso B, Gé a d O, Salas-Co es L, e al. Es ima ion o gene ic pa ame e s and genome scan o 15 semen cha ac e is ics ai s o Hols ein bulls. J Anim B eed Gene . 2009;126:269–77. 19. Lan XY, Peñaga icano F, Dejung L, Weigel KA, Kha ib H. Sho communica ion: A missense mu a ion in he PROP1 (p ophe o Pi 1) gene a ec s male e ili y and milk p oduc ion ai s in he US Hols ein popula ion. J Dai y Sci. 2013;96:1255–7. 20. Pausch H, Wu mse C, Reinha d F, Emme ling R, F ies R. Sho communica ion: Valida ion o 4 candida e causa i e ai a ian s in 2 ca le b eeds using a ge ed sequence impu a ion. J Dai y Sci. 2015;98:4162–7. 21. Pausch H, Kölle S, Wu mse C, Schwa zenbache H, Emme ling R, Jansen S, e al. A Nonsense Mu a ion in TMEM95 Encoding a Nondesc ip T ansmemb ane P o ein Causes Idiopa hic Male Sub e ili y in Ca le. PLoS Gene . 2014;10:e1004044. 22. Sham PC, Pu cell SM. S a is ical powe and signi icance es ing in la ge-scale gene ic s udies. Na Re Gene . 2014;15:335–46. 23. Cha lie C, Coppie e s W, Rollin F, Desmech D, Age holm JS, Cambisano N, e al. Highly e ec i e SNP-based associa ion mapping and managemen o ecessi e de ec s in li es ock. Na Gene . 2008;40:449–54. 24. Jung S, Pausch H, Langenmaye MC, Schwa zenbache H, Majzoub-Al weck M, Gollnick NS, e al. A nonsense mu a ion in PLD4 is associa ed wi h a zinc de iciency-like synd ome in Fleck ieh ca le. BMC Genomics. 2014;15:623. 25. Jansen S, Aigne B, Pausch H, Wysocki M, Eck S, Bene -Pagès A, e al. Assessmen o he genomic a ia ion in a ca le popula ion by e- sequencing o key animals a low o medium co e age. BMC Genomics. 2013;14:446. 26. Mu giano L, Jaganna han V, Calde oni V, Joechle M, Gen ile A, D ögemülle C. Looking he Cow in he Eye: Dele ion in he NID1 Gene Is Associa ed wi h Recessi e Inhe i ed Ca a ac in Romagnola Ca le. PLoS ONE. 2014;9:e110628. 27. Tewa i R, Bailes E, Bun ing KA, Coa es JC. A madillo- epea p o ein unc ions: ques ions o li le c ea u es. T ends Cell Biol. 2010;20:470–81. 28. Dohne JV. The Encyclopedia o His o ic and Endange ed Li es ock and Poul y B eeds. Fi s Edi ion. New Ha en: Yale Uni e si y P ess; 2001. 29. Makgahlela ML, Män ysaa i EA, S andén I, Koi ula M, Nielsen US, Sillanpää MJ, e al. Ac oss b eed mul i- ai andom eg ession genomic p edic ions in he No dic Red dai y ca le. J Anim B eed Gene . 2013;130:10–9. 30. D ögemülle C, Te ens J, Sigu dsson S, Gen ile A, Tes oni S, Lindblad-Toh K, e al. Iden i ica ion o he bo ine A achnomelia mu a ion by massi ely pa allel sequencing implica es sul i e oxidase (SUOX) in bone de elopmen . PLoS Gene . 2010;6:e1001079. 31. Bui kamp J, Semme J, Gö z K-U. A achnomelia synd ome in Simmen al ca le is caused by a homozygous 2-bp dele ion in he molybdenum co ac o syn hesis s ep 1 gene (MOCS1). BMC Gene ics. 2011;12:11. 32. Pul e s JN, B yk J, Fish JL, Wilsch-B äuninge M, A ai Y, Sch eie D, e al. Mu a ions in mouse Aspm (abno mal spindle-like mic ocephaly associa ed) cause no only mic ocephaly bu also majo de ec s in he ge mline. P Na l Acad Sci USA. 2010;107:16595–600. 33. Onou iadis A, Shoema k A, Munye MM, James CT, Schmid s M, Pa el M, e al. Combined exome and whole-genome sequencing iden i ies mu a ions in ARMC4 as a cause o p ima y cilia y dyskinesia wi h de ec s in he ou e dynein a m. J Med Gene . 2014;51:61–7. 34. Cheng W, Ip YT, Xu Z. Gudu, an A madillo epea -con aining p o ein, is equi ed o spe ma ogenesis in D osophila. Gene. 2013;531:294–300. 35. Williams W. Technique o collec ing semen o labo a o y examina ion wi h a e iew o se e al diseased bulls. Co nell Ve e ina ian. 1920;10:87–94. 36. Lage lö N. Mo phological s udies o changes in spe m mo phology and in he es es o bulls wi h lowe ed o no e ili y. Ac a Pa h Mic obiol Scand. 1934;19:254 (Suppl.). 37. Zimin AV, Delche AL, Flo ea L, Kelley DR, Scha z MC, Puiu D, e al. A whole- genome assembly o he domes ic cow. Bos au us Genome Biol. 2009; 10:R42. 38. B owning BL, B owning SR. A Uni ied App oach o Geno ype Impu a ion and Haplo ype-Phase In e ence o La ge Da a Se s o T ios and Un ela ed Indi iduals. Am J Hum Gene . 2009;84:210–23. 39. Pu cell S, Neale B, Todd-B own K, Thomas L, Fe ei a MAR, Bende D, e al. PLINK: a ool se o whole-genome associa ion and popula ion-based linkage analyses. Am J Hum Gene . 2007;81:559–75. 40. Chang CC, Chow CC, Tellie LC, Va iku i S, Pu cell SM, Lee JJ. Second- gene a ion PLINK: ising o he challenge o la ge and iche da ase s. GigaScience. 2015;4:7. 41. Li H, Du bin R. Fas and accu a e sho ead alignmen wi h Bu ows–Wheele ans o m. Bioin o ma ics. 2009;25:1754–60. 42. Li H, Handsake B, Wysoke A, Fennell T, Ruan J, Home N, e al. The Sequence Alignmen /Map o ma and SAM ools. Bioin o ma ics. 2009;25: 2078–9. 43. Pica d Tools - By B oad Ins i u e. h p://b oadins i u e.gi hub.io/pica d/. Accessed 15 Janua y 2016 44. Pausch H, Schwa zenbache H, Bu gs alle J, Flisikowski K, Wu mse C, Jansen S, e al. Homozygous haplo ype de iciency e eals dele e ious mu a ions comp omising ep oduc i e and ea ing success in ca le. BMC Genomics. 2015;16:312. 45. Ye K, Schulz MH, Long Q, Apweile R, Ning Z. Pindel: a pa e n g ow h app oach o de ec b eak poin s o la ge dele ions and medium sized inse ions om pai ed-end sho eads. Bioin o ma ics. 2009;25:2865–71. Pausch e al. BMC Gene ics (2016) 17:49 Page 8 o 9 46. McLa en W, P i cha d B, Rios D, Chen Y, Flicek P, Cunningham F. De i ing he consequences o genomic a ian s wi h he Ensembl API and SNP E ec P edic o . Bioin o ma ics. 2010;26:2069–70. 47. Va ian E ec P edic o . h p://www.ensembl.o g/Tools/VEP. Accessed 15 Janua y 2016 48. Un e gasse A, Cu cu ache I, Ko essaa T, Ye J, Fai clo h BC, Remm M, e al. P ime 3–new capabili ies and in e aces. Nucleic Acids Res. 2012;40:e115. 49. La kin MA, Blackshields G, B own NP, Chenna R, McGe igan PA, McWilliam H, e al. Clus al W and Clus al X e sion 2.0. Bioin o ma ics. 2007;23:2947–8. 50. Le unic I, Doe ks T, Bo k P. SMART: ecen upda es, new de elopmen s and s a us in 2015. Nucl Acids Res. 2015;43:D257–60. 51. Robinson JT, Tho aldsdó i H, Winckle W, Gu man M, Lande ES, Ge z G, e al. In eg a i e genomics iewe . Na Bio echnol. 2011;29:24–6. • We accep p e-submission inqui ies • Ou selec o ool helps you o ind he mos ele an jou nal • We p o ide ound he clock cus ome suppo • Con enien online submission • Tho ough pee e iew • Inclusion in PubMed and all majo indexing se ices • Maximum isibili y o you esea ch Submi you manusc ip a www.biomedcen al.com/submi Submi you nex manusc ip o BioMed Cen al and we will help you a e e y s ep: Pausch e al. BMC Gene ics (2016) 17:49 Page 9 o 9