RESEARCH ARTICLE Open Access
Mapping o QTL a ec ing incidence o blood and
mea inclusions in egg laye s
Me i Honka ukia
1*
, Ma ia Tuiskula-Haa is o
1
, Vi pi Ahola
1,2
, Pekka Uima i
1
, Ma hias Schmu z
3
, Rudol P eisinge
3
,
Da id Ca e o
3
, Pia Venne s öm
4
, Jesus A ango
5
, Neil O’Sulli an
5
, Jane Ful on
5
and Johanna Vilkki
1
Abs ac
Backg ound: Occu ence o blood and mea inclusions is an in e nal egg quali y de ec . Mass candling e eals
mos o he spo s, bu because b own eggshell hampe s selec ion in b own chicken lines i has no been possible
o elimina e he de ec by selec ion. Es ima ed equency o blood and mea inclusions in b own laye s is abou
18% whe eas i is 0.5% in whi e egg laye s. Se e al ac o s a e known o inc ease he incidence o his aul :
gene ic backg ound, low le el o i amin A and/o D, s ess o in ec ions, o ins ance. To s udy he gene ic
backg ound o he de ec , a mapping popula ion o 1599 F
2
hens om a c oss o Whi e Rock and Rhode Island
Red lines was se up.
Resul s: Ou his opa hological analyses show ha blood spo s consis o mainly e y h ocy es and ha mea spo s
a e accumula ions o nec o ic ma e ial. Linkage analysis o 27 ch omosomes wi h 162 mic osa elli e ma ke s
e ealed one signi ican quan i a i e ai locus (QTL) a ec ing blood spo and mea spo equency. We sequenced
a agmen o a candida e gene wi hin he egion, ZO-2, coding o a igh junc ion p o ein. Nine polymo phisms
we e de ec ed and wo o hem we e included in ine-mapping and associa ion analysis. Fine-mapping de ined he
QTL esul . To u he e i y he QTL, associa ion analyses we e ca ied ou in wo independen comme cial
b eeding lines wi h he ma ke MCW241 and su ounding SNPs. Associa ion was ound mainly in a 0.8 Mb-wide
ch omosomal a ea on GGAZ.
Conclusions: The e was good ag eemen be ween he loca ion o he QTL egion on ch omosome Z and he
associa ion esul s in he comme cial b eeds analyzed. Va ia ions ound in igh junc ion p o ein ZO-2 and mic oRNA
gga-mi -1556 may p edispose egg laye s o blood and mea spo de ec s. This pape desc ibes he i s esul s o
de ailed QTL analyses o he blood and mea spo s ai (s) in chickens.
Backg ound
Egg quali y has ecei ed mo e a en ion due o inc eased
demands o sa e y and high-quali y eggs by consume s.
In e nal egg quali y in ol es unc ional, aes he ic and
mic obiological p ope ies o he egg yolk and albumen.
In e nal inclusions (blood and mea spo s) in he egg
ha e been ecognized as quali y de ec s since 1899 [1].
In addi ion o being an aes he ic and e hical p oblem,
he e is indica ion ha blood o pieces o issue inside
he egg may inc ease he isk o in ec ions such as sal-
monella [2] and educe ha chabili y o eggs [3].
Blood spo s a e d ople s o blood ound usually on he
su ace o he yolk [4,5]. Mea spo s appea as ed,
b own o whi e spo s in he albumen. They a e ei he
pieces o issue om ep oduc i e o gans o blood spo s
ha ha e changed colou due o dilu ion. The ac o s
causing inclusions a e unknown. They eme ge du ing
he o ula ion p ocess in he o a y o la e in he o i-
duc . Blood on he yolk o igina es om bleeding o he
small essels in he o a y o in he o iduc [5]. When
blood is ound adhe ing o he yolk, bleeding has
occu ed in he o a y a he ime when he yolk was
eleased om he ollicle. The ollicle has a dense
ne wo k o blood essels, aside om an a ascula a ea
o he ollicula wall, called he s igma. The ollicle sac
up u es a he s igma du ing o ula ion. I any blood
essels c oss he s igma, a small d op o blood may be
deposi ed on he yolk as i is eleased om he ollicle.
Al e na i ely, bleeding may occu be o e o ula ion on
* Co espondence: me i.honka ukia@m . i
1
Bio echnology and Food Resea ch, MTT, Jokioinen, 31600, Finland
Full lis o au ho in o ma ion is a ailable a he end o he a icle
Honka ukia e al.BMC Gene ics 2011, 12:55
h p://www.biomedcen al.com/1471-2156/12/55
© 2011 Honka ukia e al; licensee BioMed Cen al L d. This is an Open Access a icle dis ibu ed unde he e ms o he C ea i e
Commons A ibu ion License (h p://c ea i ecommons.o g/licenses/by/2.0), which pe mi s un es ic ed use, dis ibu ion, and
ep oduc ion in any medium, p o ided he o iginal wo k is p ope ly ci ed.
he i elline memb ane, he s uc u e di ec ly adjacen
o he ou e su ace o he yolk. In ha case, blood
spo s a e ound in he space be ween he ollicula wall
and he i elline memb ane [4]. Blood in he albumen
indica es bleeding sho ly a e he elease o he yolk
in o he o iduc , a he ime when he yolk is coa ed
wi h albumen. Mea spo s in he albumen can be
o med om a bi o ep oduc i e issue while he egg is
passing h ough he o iduc . As an egg ages, he yolk
akes up wa e om he albumen, which in u n dilu es
blood spo s and makes hem look like mea spo s.
In gene al he equency o blood and mea inclusions
is less han 1% in all eggs laid in p esen comme cial
lines [2]. Howe e , he incidence o spo s a ies g ea ly:
i is abou 18% in b own laye s, whe eas i is only 0.5%
in whi e egg laye s [6]. In some b own laye lines he
equency can be as high as 30% [6]. The incidence o
spo s seems o inc ease when he hen ages [7]. Inc eased
equency also appea s a he s a o laying.
Di e en ypes o ac o s, including nu i ional, en i -
onmen al and he edi a y ac o s, igge he incidence o
spo s. P obably he mos impo an nu i ional ac o is
a lack o i amins A and D [3, 8, 9, 10]. The e is a phy-
siological h eshold o he amoun o i amin A. When
he supply is su icien , he chicken has a low p obabili y
o ha ing blood spo s [11]. En i onmen al ac o s, like
sudden loud noises, empe a u e changes and in ec ions,
induce an inc ease in he incidence o spo s [4,6,12].
Fu he mo e, he p oblem has a gene ic backg ound.
The es ima es o he i abili y o inclusion ai s ange
om 0.07 up o 0.6 [11,13,14]. In con en ional b eeding
p ac ices, selec ion agains inclusions is usually done by
elimina ing amilies ha ha e inc eased incidence o
inclusions om he b eeding popula ion (Schmu z, M.,
pe sonal communica ion).
In e nal inclusions a e de ec ed ia mass candling.
This p ocess e eals mos o he spo s, bu occasionally
aul y eggs pass he con ol checks and end up in he
consume ’s hands. This has been a p oblem especially in
b own laye lines, because b own shells hampe spo
de ec ion.
Inc eased in e es in sa e y and high-quali y eggs mo i-
a ed us o s udy he gene ic backg ound o he inci-
dence o blood spo s in chicken eggs. So a , he e ha e
been no a emp s o map QTL o in e nal inclusions.
The ul ima e objec i e was o ind ma ke s sui able o
use in a comme cial selec ion p og amme and o iden-
i y genes a ec ing he de ec .
Resul s
His opa hologic s udy
In he analyzed b oile eggs, he spo s ha we e col-
lec ed close o he su ace o he yolk, mac oscopically
looking like blood s ains, we e accumula ions o
e y h ocy es su ounded by a hin eosinophilic acellula
memb ane. Spo s ound in he albumen, mac oscopically
looking like a g eyish mass, we e accumula ions o
nec o ic ma e ial su ounded by a hin acellula mem-
b ane. The nec o ic ma e ial consis ed o ine g anula
eosinophilic and b own deb is.
Gene ic pa ame e s, he i abili ies and gene ic co ela ions
The he i abili y es ima es in pu e lines o blood spo
sco e and blood spo combina ion (numbe *size) we e
0.05 and 0.04, espec i ely, in Lohmann B own. In
Whi e Rock he he i abili y o blood spo sco e was
0.01. The he i abili y o mea spo combina ion (num-
be *size) was e alua ed o be 0.01 in Lohmann B own
(no da a a ailable o Whi e Rock). The gene ic co ela-
ion be ween inclusion ai s a ied g ea ly: i was highly
nega i e (-0.90) be ween wo blood spo ai s (sco e
and combina ion) and be ween blood spo sco e and
mea spo combina ion (-0.70), whe eas i was posi i e
(0.83) be ween blood spo combina ion and mea spo
combina ion (see addi ional ile 1, Table S1).
Genome scan
One genome-wide signi ican QTL a ec ing incidence o
in e nal inclusions was disco e ed (Table 1). The highes
F- a io, 18.59, occu ed a 69 cM, in he a ea lanked
by ma ke s MCW258 and MCW241 (21,403,330-
34,264,330 Mb) on ch omosome Z. The addi i e e ec
was 3.61 wi h 0.84 SE, co esponding o a di e ence o
0.036 in he a e age sco e om h ee consecu i e eggs
( his ai has an a e age o 1.02, wi h a s anda d de ia-
ion o 0.24). I explains 1% o he o al pheno ypic
a iance.
O he sugges i e (genome-wide 10% signi icance) QTL
we e ound on ch omosome 1 a he posi ion o 429 cM
be ween ma ke s MCW23 and MCW145 (156,472,062-
162,032,936 Mb), on ch omosome 2 a he beginning o
he linkage map a he ma ke MCW82 (5,313,874-
5,313,971 Mb), and on ch omosome 4 a he ma ke
ADL331 (63,195,046-63,195,223 Mb). The QTL e ec
on ch omosome 1 is dominan while i is addi i e o
he o he wo egions.
Sequencing o ZO-2
A pu a i e candida e gene, ZO-2 (NP_990249), a key
gene con olling adhesion be ween neighbou ing epi he-
lial cells, was ound o be loca ed wi hin he QTL egion
on ch omosome Z. The ma ke MCW241 showing sig-
ni ican associa ion o blood and mea inclusions was
loca ed inside his gene. We sequenced a agmen o
549 bp om se e al indi iduals om his candida e
gene among Lohmann B own and Hy-Line popula ions
(106 and 20, espec i ely). We disco e ed nine poly-
mo phic si es (Table 2). Th ee o he a ia ions we e
Honka ukia e al.BMC Gene ics 2011, 12:55
h p://www.biomedcen al.com/1471-2156/12/55
Page 2 o 10
loca ed in exon 18. One o he p e iously epo ed
SNPs, s10724503 h p://www.ensembl.o g/Gallus_gal-
lus/ was con i med and used as a ma ke (ZO-2 snupe)
in he ollowing associa ion s udy. The o he epo ed
ameshi mu a ion s16767170 h p://www.ensembl.
o g/Gallus_gallus/) was no de ec ed among his ma e-
ial. Two new in onic a ia ions (SNP6, posi ion
34,315,888 and SNP7, posi ion 34,315, 890 in Table 2)
we e ound o be loca ed wi hin a mic oRNA (gga-mi -
1556). These polymo phisms we e loca ed in he
p edic ed s em-loop s uc u e o he mic oRNA
(Figu e 1). Such a ia ion migh a ec he s abili y o
he s em-loop s uc u e and hus also he unc ion o
he miRNA in gene egula ion. One o hese a ia ions
was used in he associa ion s udy (SNP7, ‘miRNA’). The
a ia ions ha e been submi ed o GeneBank (BankI
1438826, JF509397).
Fine-mapping o ch omosome Z
When a la ge sample o animals was geno yped o a
dense map o he QTL egion on ch omosome Z, a gen-
ome-wide highly signi ican QTL (F- a io 32.9) was seen
a he ma ke posi ion MCW241, a he posi ion 54 cM
on he linkage map (genomic loca ion Z: 34.26 Mb)
wi h he addi i e e ec o 3.75 uni s (Figu e 2). Com-
pa ed o he ini ial QTL scan, mo e ma ke s we e added
o he dis al end o he map o lank he QTL. As a
esul , he highes peak o F- a io shi ed ou side o he
p e iously mapped a ea, bu i was success ully lanked
wi h new ma ke s. The e ec o he QTL was now
es ima ed o be 2% o he pheno ypic a iance.
Associa ion
Associa ion was s udied wi h a se o SNP ma ke s
(including miRNA a ia ion) and he mos signi ican
mic osa elli e ma ke MCW241 (Table 3). The s udied
SNP ma ke s we e loca ed be ween bp 31,855,282 and
36,533,455 o ch omosome Z. Associa ions we e ound
mainly in a 0.8 Mb-wide ch omosomal a ea loca ed
be ween 33,508,907 - 34,315,890 o GGAZ (Table 3).
The associa ed loci a ied acco ding o he s udied
pheno ype and popula ion. Fo ins ance, in he Hy-Line
popula ion only he mea spo ai was ound o
be associa ed o SNP ‘ s14761267’,whe easSNP
Table 1 Summa y o QTL esul s o blood and mea spo ai (BMS
F2
) om he F
2
genome scan
Ch om. pos
cM
Flanking ma ke s and genomic posi ions F
(1)
1%
(2)
5%
(2)
10%
(2)
Add.
(4)
SE
(5)
Dom.
(4)
SE R
2(3)
1 429 MCW0023-MCW0145
156,472,062 - 162,032,735
5,86 8,64 7,52 4,33 -2,27 1,48 7,07 2,35 2%
2 0 MCW0082
5,313,874
6,90 10,90 8,60 4,90 -4,32 1,43 4,38 2,19 2%
4 113 MCW0284-ADL331
54,907,139 - 63,195,046
6,25 10,33 8,00 5,18 -3,64 1,30 -3,87 1,90 2%
Z 69 MCW258-MCW241
21,403,330 - 34,264,059
18,59 16,24 13,63 12,2 3,61 0,84 na na 1%
The e ec was calcula ed as he e ec o he allele o igina ing om he pa en al RIR line. The ma ke map used in he Z-ch omosome was: ADL117-(22cM)-
MCW331-(12 cM)-MCW55-(16cM)-MCW258-(38cM)-MCW241.
1
F- a io o he eg ession analysis.
2
Genome wide signi ican le els
3
R
2
is he educ ion (in %) o o al pheno ypic a iance due o he p esence o he QTL.
4
Real e ec is he alue di ided by 100 (Add = addi i e e ec , Dom = dominance e ec )
5
SE = s anda d e o
Table 2 Va ia ion ound in he ZO-2 gene
SNP # genomic loca ion exon/in on addi ional in o ma ion lanking sequence
134,315,482 in on17-18 TCTGAATGCA[A/G]TATAACTGTA
234,315,545 in on17-18 ATAAGATGTT[C/T]CACACCCTGC
334,315,708 exon18 s10724503 GTAAGCAGGG[C/T]GTGAAAACGA
434,315,757 exon18 AAAAGCTCGA[A/G]GAAGCTTTAT
534,315,792 exon18 AGCTGAAGAA[A/G]ACTTGTTCCC
634,315,888 in on18-19 gga-mi -1556 TTACTGCTCT[C/G]CGTATTAACT
734,315,890 in on18-19 gga-mi -1556 ACTGCTCTGC[G/A]TATTAACTCA
834,315,932 in on18-19 GTGTGAAAGT[A/G]TGGTCATGAG
934,315,953 in on18-19 CAATCTCTGA[C/T]TTCCTCTCAA
Loca ions o polymo phisms a e shown oge he wi h he lanking sequences.
Honka ukia e al.BMC Gene ics 2011, 12:55
h p://www.biomedcen al.com/1471-2156/12/55
Page 3 o 10
‘ s14761196’was linked o bo h he mea and blood spo
ai s. Mos o he associa ions we e ela ed o he p e-
alence o he spo s (sco e o numbe o he spo s). The
allelic e ec s a ied be ween 0.13 and 0.5 SD, depending
on bo h ai and popula ion.
Discussion and conclusions
The e ha e been no epo s so a o QTL o blood and
mea inclusions in eggs o laying hens. This pape
desc ibes he i s esul s o de ailed analyses o he
in e nal inclusion ai s in chickens. QTL we e i s
localized h ough linkage analysis in a genome scan.
This analysis e ealed one highly signi ican QTL on
ch omosome Z and h ee sugges i e QTLs on ch omo-
somes 1, 2 and 4. The QTL on ch omosome Z was ine-
mapped and alida ed wi h a con i ma ion s udy in wo
independen comme cial popula ions. The associa ion o
ma ke s wi h he ai in hese independen samples
suppo ed he loca ion o he QTL on ch omosome Z.
Ma ke s MCW241 and s14761267 showed mos con-
g uen associa ion o inclusion ai s in he wo es ed
comme cial popula ions. Thus hese ma ke s could be
conside ed as ha ing he bes po en ial o selec ing
agains in e nal inclusions.
The co ec de ini ion o inclusion pheno ype is
usually demanding i eggs a e no s udied soon a e lay-
ing. Some imes he wo ypes can ha e simila appea -
ance (i.e. dilu ion o blood spo s o pale mea spo s).
Combining mea and blood spo s o a single a iable is
a common p ocedu e in b eeding companies. Howe e ,
in QTL mapping his may in oduce a bias, especially
when one o he componen s is weigh ed mo e han he
o he a iable. Acco ding o ou esul s, blood and mea
spo s a e sepa a e en i ies. The o igin o blood spo s is
ed cells, and mea spo s a e cell masses o epi helium.
Dis inc sou ces o he wo spo ypes a e suppo ed by
hei sepa a e loca ions wi hin he egg. Simila conclu-
sions can be ound om [15] o [16]. Campo e al. [6]
sugges ed ha in e nal inclusions a e ela ed o shell
pigmen a ion. In ano he s udy, a p o opo phy in
mu an ha educed shell colo signi ican ly also
showed a educ ion in mea spo s [17]. Howe e ,
acco ding o ou esul s, he e a e no signs o pigmen ed
cells in he inclusions.
Ou esul s om he F
2
and LB da a ( ea ing blood
and mea spo s as one ai , wi h weigh on blood
spo s), migh be pulled owa ds loci a ec ing blood
spo s ins ead o mea spo s. Ye , he esul s in Hy-Line,
whe e hose wo ai s a e ea ed sepa a ely, a e indica -
ing ha he same ch omosomal a ea has an impac on
bo h spo ypes.
Nume ous iden i ied genes can be ound om he
Ensembl genome da abase in he QTL egion. ZO-2 was
one o hese genes. I was chosen o u he s udies
Figu e 1 Hai pin s uc u e o MI0007281 (mi -gga-1556).The
p edic ion o he s uc u e is cons uc ed wi h RNA old web se e .
Va ia ions ound by sequencing a e indica ed wi h a ows.
Honka ukia e al.BMC Gene ics 2011, 12:55
h p://www.biomedcen al.com/1471-2156/12/55
Page 4 o 10
because o i s known biological unc ion oge he wi h
co-loca ion o mic osa elli e ma ke MCW241. ZO-2
belongs o he igh junc ion p o ein amily, which is
in ol ed in he o ganiza ion o epi helial and endo helial
in e cellula junc ions. I has an impo an ole in ba -
ie o ma ion. Blood spo s in he eggs may be due o
he agili y o blood essel walls in he o a ies.
Symp oms like clo ing and bleeding a e caused by a
gene ic de ec called amilial hype cholanemia (FHAC,
OMIM ID#607748) in humans [18], which is caused by
a mu a ion in he igh junc ion p o ein ZO-2. Compa ed
o ou sequencing indings, he mu a ion in humans is
loca ed elsewhe e on he ZO-2 gene.
The oleo hemic oRNAiden i ied inside he ZO-2
gene in on 18 is also in e es ing. Some epo s ha e
demons a ed ha miRNAs a e ansc ip ionally linked
o he exp ession o hei hos genes and p ocessed
om he same p ima y ansc ip [19]. Thus in addi ion
o egula ing i s own a ge genes, gga-mi -1556 migh
also a ec he exp ession o ZO-2.
Ta ge p edic ion and unc ional anno a ions sea ch
ga e 80 p edic ed a ge s o gga-mi -1556 (h p://
mi db.o g/). Among he a ge genes is AGT, angio ensi-
nogen (loca ed on GGA3 a 42.30 Mb). Angio ensinogen
is a p ecu so o angio ensin, which inc eases blood
p essu e. The ac ion o his hypo he ical gene would be
compa ible wi h he indings o F y e al. [20] who
demons a ed ha blood p essu e is a ac o in suscep -
ibili y o blood spo incidence.
Acco ding o eQTL s udies, a polymo phism explain-
ing gene exp ession a iance may be loca ed ei he nea
he gene (cis-eQTL) o u he apa on he genome
( ans-eQTL)[21]. I has been p oposed ha ans-eQTL
ha e smalle pheno ypic e ec s han cis-eQTL. In his
s udy we ound polymo phism in he miRNA s em-loop
ha may a ec i s binding a ini ies o a ge genes.
Thus he e ec could be simila o a ans-ac ing eQTL.
This is suppo ed by he ac ha al hough he e ec o
he QTL was e y signi ican , i was qui e small,
app oxima ely 2% o he pheno ypic a iance.
0
5
10
15
20
25
30
35
1
31
61
91
Fine-mapped
Genome scan
MCW331
LEI171
MCW258
ADL201
MCW241
LEI111
LEI144
LEI121
LEI75
RS14761196
RS16767662
RS16132985
RS1611109
RS16110443
Figu e 2 QTL analysis o he blood and mea spo ai (BMS
F2
) in he F
2
mapping popula ion. The F- a io cu es om he ini ial genome
scan (dashed line; 7 amilies, 5 mic osa elli e ma ke s) and he ine-mapping s age (solid line; 17 amilies, 9 mic osa elli e ma ke s, 5 SNPs) a e
shown. The genome-wide signi icance le el is ma ked as a do ed line. The mic osa elli e ma ke posi ions ( ine-mapping s age) a e indica ed
wi h ed ci cles and he SNP posi ions wi h yellow ci cles in he ollowing o de : MCW331, MCW258, LEI171, ADL201, s14761196, MCW241,
s16767662, s16110443, s1611109, s16132985, LEI111, LEI144, LEI121, LEI75.
Honka ukia e al.BMC Gene ics 2011, 12:55
h p://www.biomedcen al.com/1471-2156/12/55
Page 5 o 10
The he i abili y o in e nal inclusions is high enough
o he ai o be in luenced by con en ional b eeding
[11], bu i has no been possible o comple ely elimi-
na e i by means o selec ion. We ha e iden i ied one o
he genomic a eas in luencing he incidence o blood
and mea inclusions. In addi ion, we ha e con i med
his associa ion in wo comme cial b eeding popula ions.
The ac ual causa i e gene o egula o y mechanism s ill
emains unknown. Fu he in es iga ions a e needed
be o e decisions can be made on using he esul s in
ma ke -assis ed selec ion. The gene ic gain is ela i e o
he magni ude o he e ec o he locus, and in his
case, he e ec o he QTL is mode a e. Howe e , com-
bining he allele in o ma ion wi h con en ional selec ion
schemes would yield mo e in o ma ion o use in selec-
ion decisions.
Me hods
Mapping popula ions and geno yping
Th ee independen egg laye chicken popula ions we e
used o di e en s ages in his s udy. Mapping was
done in a wo-s ep app oach; i s a subse o he F
2
popula ion was used o a spa se genome scan and he e-
a e he en i e mapping popula ion was used in a
Table 3 Associa ion o ma ke s wi h di e en in e nal inclusion ai s in he con i ma ion s udy
SNP ID/ma ke Genomic posi ion Ma ke in o ma i e in Associa ion ound in T ai and p- alues
s14762832 31,855,282 LB LB Sco e
LB
(p < 0.001)
s16766794 31,955,874 LB
s16766752 32,044,210 LB
s13795687 32,122,845 LB
s16766685 32,276,606 LB
s16766334 33,022,548 LB sco e
LB
(p < 0.05)
s16766274 33,092,178 LB
s16766257 33,167,074 LB
s14761556 33,443,086 LB
s14761487 33,508,907 LB LB sco e
LB
(p < 0.01)
g oup
LB
(p = 0.02)
numbe o spo s
LB
(p < 0.05)
s14761341 33,749,060 LB, Hy
s14761267 33,832,110 LB, Hy LB, Hy numbe
LB
(p < 0.02)
size
LB
(p < 0.02)
MS
Hy
(p < 0.05)
s14761196 33,996,581 Hy Hy MS
Hy
(p < 0.01)
BL
Hy
(p < 0.04)
MCW241 34,264,059 LB,Hy LB, Hy MS
Hy
(p < 0.001)
BL
Hy
(p < 0.001)
sco e
LB
(p < 0.01)
s10724503
1
34,315,708 LB LB g oup
LB
(p < 0.001)
numbe o spo s
LB
p < 0.01)
size
LB
(p < 0.001)
s14763225
2
34,275,496 LB, Hy
miRNA-1556 34,315,890 LB LB g oup
LB
(p < 0.002)
numbe o spo s
LB
(p < 0.002)
size
LB
(p < 0.002)
s16767662 34,996,069
s16110443 36,236,398
s14764985 36,533,455 LB LB g oup
LB
(p < 0.03)
numbe o spo
LB
(p < 0.02)
s16111109 36,959,973
s14766124 38,170,684 LB
s16132985 41,098,862 LB
Ma ke s ( hei in o ma i i y and ela i e genomic posi ions) in each popula ion can be ound in he 3 d column (LB = Lohmann B own, Hy = Hy-Line). The
popula ion and ai showing he associa ion (co esponding p- alues in pa en hesis) a e indica ed in he 4
h
and 5
h
columns.
1
ZO-2 snupe
2
no mapped in WASHUC2, posi ion based on G oenen e al. 2009 [24].
Honka ukia e al.BMC Gene ics 2011, 12:55
h p://www.biomedcen al.com/1471-2156/12/55
Page 6 o 10
consequen ine-mapping s ep wi h dense ma ke map
o he mos signi ican QTL egion. Two independen
pu e comme cial lines, Lohmann B own (LB) and Hy-
Line (Hy) we e used o con i ming he QTL esul wi h
associa ion analysis. The phases o he s udy a e illu-
s a ed in Table 4.
F
2
c oss
Fo he genome scan, an F
2
c oss be ween wo comme -
cial b own pu e b eeding lines om Lohmann Tie -
zuch , Rhode Island Red and Whi e Rock, desc ibed
ea lie in Tuiskula-Haa is o e al. [22] was used. The
en i e mapping popula ion consis ed o a o al o 1783
indi iduals, including 30 g andpa en al males, 47 g and-
pa en al emales, 16 F
1
males, 90 F
1
emales, and 1599
F
2
hens. Rea ing and managemen p ac ices we e simila
o hose in he p e ious QTL s udy, see [23].
Comme cial lines
The Lohmann B own popula ion consis ed o 767
pu eb ed hens om pa e nal hal -sib amilies wi h an
a e age o 9.7 o sp ing pe amily. Di e en numbe s o
indi iduals we e included in analyses depending on he
ma ke used (see Table 4). In he LB, 17 SNP ma ke s,
a miRNA polymo phism and one mic osa elli e ma ke
(MCW241) we e geno yped.
The Hy-Line popula ion included a o al o 290 males
belonging o pa e nal hal -sib amilies (3,5 males pe
amily). Pheno ypes ep esen ed si e-daugh e a e ages.
The Hy-Line popula ion was analyzed wi h a mic osa el-
li e ma ke (MCW241) and 4 in o ma i e SNP ma ke s
wi hin he QTL a ea ( s14761341, s14761267,
s14761196 and s14763225).
Geno yping
DNA p epa a ion and geno yping o mic osa elli e
ma ke s ha e been desc ibed in [22]. The numbe o
geno yped indi iduals in each popula ion is shown in
Table 4. Fo ine-mapping, we selec ed a se o SNP
ma ke s [24] om he QTL egion (Table 3). Illumina
BeadXp ess (h p://www.illumina.com) eade was used
o geno yping mul iplex SNPs (OPA), which we e
clus e ed wi h BeadS udio. The miRNA geno ypes
we e yped by sequencing, and he SNP in he candi-
da e gene by minisequencing (ZO-2 snupe), acco ding
o p o ocols in [25].
Pheno ypes
Blood and mea spo pheno ypes we e collec ed om
h ee consecu i e eggs o each hen be ween he ages o
35 and 41 weeks (Table 5). In con as o o he ypes o
blood spo s udies, he hens we e ed wi h adequa e
eed; no challenge die was used. Eggs we e b oken on o
a glass shee o de ec he spo s. In he F
2
genome scan,
blood and mea spo pheno ypes we e ea ed as one
ai (BMS
F2
). Eggs we e sco ed based on he p esence
and size o inclusions ("0”no inclusions, “1”and “2”
small o big mea spo , “3”,“4”and “5”small, middle-
sized o la ge blood spo ). The nume ic alue o BMS
F2
was elici ed by a ans o ma ion, whe e he a e age o
h ee eggs was mul iplied wi h 100; he ea e he ‘BMS
F2
uni ’ e e ed o a combina ion o numbe and se e -
i y o he inclusions.
Pheno ypes we e s udied in mo e de ail in he con i -
ma ion s udy o he comme cial lines. Blood and mea
spo s we e sco ed a 36, 40 and 42 weeks o age. Fo
Table 4 Wo k low
S udy Aim Ma e ial Me hod de ails
Genome
scan
Sea ch o QTL Sub da a o F
2
popula ion
( andomly selec ed 7 hal -sib
amilies)
Linkage analyses o 162
mic osa elli es on 27
ch omosomes
668 F
2
hens
Fine-
mapping
Focusing on he QTL a ea Whole F
2
mapping popula ion (17
hal -sib amilies)
6 new mic osa elli e ma ke s +
5 SNPs
1599 F
2
hens
Sequencing SNP de ec ion Lohmann B own, Hy-Line 106 indi uals in LB
20 in idi uals in Hy
His o-
pa hology
Tissue analysis Eggs om a b oile b eeding
ha che y
Ligh mic oscopy s udy 480 eggs
Con i ma ion Associa ion s udies in
independen comme cial
lines
1) Lohmann B own (767 hens) Mixed models wi h DMU whole pu e line hen popula ion
(767 hens): MCW241
-sub da a I: ZO-2 (516 hens)
-sub da a II: pheno ypically
ex eme 416 hens: panel o 15
SNPs
2) Hy-Line
(290 males)
Linea model wi h leas squa es,
SAS -all geno yped wi h MCW241
-all geno yped wi h a panel o 5
in o ma i e SNPs
Di e en phases and aims o he s udy a e shown in he 1
s
and 2
nd
columns. Popula ions and subse s a e p esen ed in he 3
d
column ollowed wi h he
me hods and de ails in he 4
h
and 5
h
columns.
Honka ukia e al.BMC Gene ics 2011, 12:55
h p://www.biomedcen al.com/1471-2156/12/55
Page 7 o 10
each hen and measu emen 3 consecu i e eggs we e col-
lec ed and he spo s we e subjec i ely sco ed.
In he Lohmann B own, he pheno ype was eco ded
as i e pheno ypic a iables o blood and mea spo
(Table 5). Fi s , SCORING: sco ing scheme was as
ollows:
0 = no spo s
1 = low numbe o small mea spo s
2 = highe numbe o small mea spo s o small num-
be o medium sized mea spo s
3 = high numbe and/o la ge sized mea spo s
4 = low numbe o small blood spo s
5 = highe numbe o small and/o la ge blood spo s
P io o QTL analyses he pheno ypic mean o he 3
eggs om one hen o e e y age we e co ec ed o he
e ec o ha ch and posi ion o he hen ( ie o he ba -
e y). This en i onmen al in luence was es ima ed om
a gene ic model including he addi i e gene ic e ec s o
he animals. This analysis was done wi h he So wa e
PEST [26].
Model : yij =µ+AHT
i+a
j+e
ij
whe e y
ij
= pheno ypic obse a ion
AHT
i
= ixed e ec o Age-Class, Ha ch and Tie i
(combined in a mul icode)
a
j
= addi i e gene ic e ec o animal j
e
ij
= esidual
The co ec ed a e ages o e e y hen o he 3 obse -
a ions a di e en age we e hen agg ega ed in o one
obse a ion by a i hme ic mean. Second, GROUP: based
on he sco ing, hens we e di ided in o high (spo s) o
low(nospo s).Thi d,NUMBERo spo s.Fou h,SIZE
o spo s: diame e o he spo s (in mm). Fi h, COMBI-
NATION: he unc ion o numbe and size o spo s.
The unc ions used o no malizing he pheno ypic da a
a e p esen ed in Table 5.
In he Hy-Line popula ion, eggs we e p ocessed wi hin
24 hou s o p oduc ion a a cen alized egg quali y lab
acili y. Blood and mea inclusions we e iden i ied and
ea ed as wo sepa a e ai s. Bo h ai s we e measu ed
in a semi-quan i a i e scale, using a sco e based on he
p esence and size o he inclusion (0 o 5: “0”i an
inclusion was absen , o “5”i an app oxima ely 5 mm
inclusion was p esen ). Pheno ypes o males we e
exp essed as si e-daugh e a e ages. Desc ip i e s a is-
ics, such as dis ibu ion and gene ic pa ame e s in he
pa en al lines o F
2
mapping popula ion is p esen ed in
he addi ional ile, Tables S1-S3.
His opa hological s udies
In o de o examine he sou ce o he inclusions,
a his opa hological s udy was conduc ed. Ma e ial o
he his opa hological s udy was collec ed om a o al o
480 andomly selec ed eggs om a b oile -b eeding
ha che y. F esh, dis inc spo s we e ixed in 10%
bu e ed o malin, ou inely p ocessed, embedded in
pa a in and se ially sec ioned a 4 μm. The sec ions
we e s ained wi h haema oxylin and eosin (H&E) and
s udied by ligh mic oscopy.
QTL mapping
The mapping was done in wo s ages. A i s , a genome
scan wi h 162 mic osa elli e ma ke s on 27 ch omosomes
was conduc ed in a subse o se en hal -sib amilies wi h
668 F
2
indi iduals. Then he en i e mapping popula ion
including 1599 F
2
hens was used in he ine-mapping. A
new linkage map o he Z-ch omosome was calcula ed
Table 5 The popula ions and pheno ypes used in he s udy
Pop. N T ai Scaling Age o
e alua ion
Co ec ion
F
2
1599 Blood and mea spo s
(BMS
F2
)
Adjus ed om numbe and ype o
spo s
35, 40, 50 weeks A e age o h ee sequen ial eggs, mul iplied by
100.
LB 416
1
Sco e con inuous scaling om 0 o 5 36, 40, 42 weeks LN co ec ion
G oup coun o spo s = > high o low 36, 40, 42 weeks e ec o ha ch and ie o he ba e y
Numbe o spo s absolu e numbe o spo s 36, 40, 42 weeks (numbe _co +0,05)*100
Size o spo s con inuous (in mm) 36, 40, 42 weeks (size_co +0,1)*100
Combina ion numbe * size 36, 40, 42 weeks (combina ion_co +0,1)*100
Hy-
Line
290 Blood spo s (BL) Semi-quan i a i e ea ly, la e The pheno ypes we e exp essed as si e-daugh e
a e ages
Mea spo s (MS) Semi-quan i a i e ea ly, la e The pheno ypes we e exp essed as si e-daugh e
a e ages
The s udied popula ions and he numbe o indi iduals in each o hem a e indica ed in he 1
s
and 2
nd
columns. The ai s a e desc ibed in he 3
d
and 4
h
columns. The age a ime o e alua ion is gi en in he 5
h
column. The las column p esen s he co ec ion unc ions used o no malizing he pheno ypic da a
(LN = na u al loga i hm).
1
The numbe o hens geno yped in he Lohmann B own popula ion a ied acco ding o ma ke : MCW241, 767 hens; ZO-2 SNP,516; 15 o he SNPs on he Z
ch omosome, 416; mi RNA-1556 sequencing, 90.
Honka ukia e al.BMC Gene ics 2011, 12:55
h p://www.biomedcen al.com/1471-2156/12/55
Page 8 o 10
by CRI-MAP [27], including 9 mic osa elli e ma ke s and
5 SNPs. QTL mapping was based on eg ession analysis
using mul iple ma ke in o ma ion. Au osomes we e ana-
lyzed wi h G idQTL [28] and he Z-ch omosome by a
cus om-made p og am as desc ibed in [22,23]. F om he
Z-ch omosome, only he addi i e e ec could be es i-
ma ed. The empi ical signi icance le els we e de e mined
by a pe mu a ion es , also desc ibed in [22,23].
Candida e gene sequencing
A candida e gene was chosen based on i s known
unc ion and he gene ic map in o ma ion ob ained
om QTL mapping. The igh junc ion p o ein 2 gene,
TJP2, also known as ZO-2, was pa ially sequenced o a
single genomic agmen , including wo p e iously
epo ed SNPs ( s10724503 and s16767170) h p://
www.ensembl.o g/Gallus_gallus/. This a ea o 546 base
pai s con ains exon 18 and pa o he ollowing in on
(genomic loca ion o 34,315,438 - 34,315,986). The
p ime pai o ampli y he agmen was designed wi h
P ime 3 h p:// odo.wi.mi .edu/p ime 3/) ( o wa d p i-
me : 5’- AAGCTGCTTCGAAAAATGGA and e e se
5’-GTCACTTGGCAACACAAGGA). This p ime pai
was also used o sequencing. The sequencing and
minisequencing p o ocols we e conduc ed as desc ibed
in [25]. Fo he minisequencing, p ime s o agmen
ampli ica ion we e o wa d 5’-CTGTACCGGCAGAA-
CACTGA and e e se 5’- GAAGACACAGTTAC
TTCCCCTGA. The oligo o minisequencing was 5’-
AACCCAGACAGTAAGCAGGG.
Fine-mapping
Basedon he esul om hegenomescan,ninemo e
amilies we e included in he QTL analysis. The ull
popula ion was geno yped wi h a ma ke panel o nine
mic osa elli e ma ke s and i e single nucleo ide poly-
mo phisms(SNPs)chosen omG oenene al.[24] o
he QTL a ea on ch omosome Z. The ini ial genome
scan was conduc ed wi h 5 mic osa elli e ma ke s
(ADL117-22cM-MCW331-12 cM-MCW55-16cM-
MCW258-38cM-MCW241). Ma ke s used in he ine--
mapping we e: MCW331-15cM-MCW258-28cM-
LEI171-4cM-ADL201-3cM- s14761196-2cM-MCW241-
4cM- s16767662-7cM- s16110443-1cM- s1611109-
2cM- s16132985-5cM-LEI111-1cM-LEI144-2cM-LEI
121-17cM-LEI75.
Con i ma ion wi h associa ion
To con i m he ine-mapping QTL esul o blood and
mea spo s, associa ion was es ed in wo independen
comme cial pu e lines wi h mo e de ailed pheno ypic
ai s. Di e en se s o SNP ma ke s we e used depend-
ing on hei in o ma ion con en in he espec i e popu-
la ion. In he Lohmann B own (LB) popula ion, hens
we e geno yped o he mic osa elli e MCW241 and
minisequenced o a candida e gene SNP ( s10724503)
(called he ein ZO-2 snupe). Addi ional analyses wi h 15
SNPs we e done wi h a subse o pheno ypically ex eme
hens om he LB (Table 3). F om Hy-Line, a Whi e Ply-
mou h Rock pu e line, 290 si es we e geno yped wi h
one mic osa elli e ma ke (MCW241) and 5 SNP ma -
ke s om he QTL a ea. The ma ke associa ions wi h
di e en inclusion ai s we e conduc ed sepa a ely o
each ma ke (Table 5). The associa ions in he LB popu-
la ion we e es ima ed wi h he so wa e package DMU
[29], which enabled exploi a ion o a mixed linea model
and inclusion o popula ion s uc u e.
In he Hy-Line popula ion, he ma ke - ai associa-
ion was analysed using a linea model wi h he me hod
o leas squa es in SAS [30]. Depending on he ai
es ed T- es , Wilcoxon Rank Sum, o Fishe ’s exac es
was implemen ed o ind associa ion be ween pheno y-
pic ai s and ma ke s.
Addi ional ma e ial
Addi ional ile 1: Table S1: Es ima es o Gene ic Pa ame e s o
Inclusions in pu e lines (g andpa en al lines) o Lohmann B own
(He i abili y on he diagonal and gene ic co ela ion o he o -
diagonal).Table S2: Dis ibu ion o pheno ypes in he g andpa en al
lines o Lohmann B own o he subjec i e combined sco e (3 eggs pe
hen). Table S3: Dis ibu ions o pheno ypes in he g andpa en al lines o
Lohmann B own o numbe and size o he spo s (only o Rhode Island
Red line).
Acknowledgemen s
The sequences has been submi ed o GenBank (BankI 1438826 JF509397).
This p ojec was unded by Lohmann Tie zuch GmbH and by a pe sonal
g an om Emil Aal onen Founda ion o MH. We a e g a e ul o Lau a
Lau amäki and Sa i Raiskio o p ac icali ies in he poul y house, Jonna
Tabell and Anneli Vi a o unning he lab wo k, Johanna Daka om
Munakun a o o ganizing ma e ial o his opa hological analysis and Lau i
Jauhiainen o helping wi h he associa ion analysis.
Au ho de ails
1
Bio echnology and Food Resea ch, MTT, Jokioinen, 31600, Finland.
2
Depa men o Biosciences, Uni e si y o Helsinki, Helsinki, 00014, Finland.
3
Lohmann Tie zuch GmbH, Cuxha en, 27472, Ge many.
4
Resea ch
Depa men , Fish and Wildli e Heal h, EVIRA, Mus ialanka u 3, Helsinki, 00790,
Finland.
5
Hy-Line In e na ional, P.O. Box 310, Dallas Cen e , IA 50063, USA.
Au ho s’con ibu ions
MH designed and pe o med he geno yping and sequencing wo k,
pa icipa ed in he s a is ical analysis (linkage analyses) and w o e he
manusc ip . MT-H con ibu ed o he s udy design and da a collec ion and
analyses. VA and PU con ibu ed o he s a is ical analyses (associa ion
analyses). PV did he his opa hological s udy. MS, DC, JA, NOS, JF and RP
con ibu ed o he s udy design, p o ided pheno ypic da a and animal
samples. JV supe ised he s udy and edi ed he manusc ip . All au ho s ead
and app o ed he inal manusc ip .
Recei ed: 1 Oc obe 2010 Accep ed: 13 June 2011
Published: 13 June 2011
Re e ences
1. Anonymous: Blood Spo s in Hens’Eggs. The Ame ican Na u alis 1899,
33(390):530.
Honka ukia e al.BMC Gene ics 2011, 12:55
h p://www.biomedcen al.com/1471-2156/12/55
Page 9 o 10