Mapping of QTL affecting incidence of blood and meat inclusions in egg layers

RESEARCH ARTICLE Open Access Mapping o QTL a ec ing incidence o blood and mea inclusions in egg laye s Me i Honka ukia 1* , Ma ia Tuiskula-Haa is o 1 , Vi pi Ahola 1,2 , Pekka Uima i 1 , Ma hias Schmu z 3 , Rudol P eisinge 3 , Da id Ca e o 3 , Pia Venne s öm 4 , Jesus A ango 5 , Neil O’Sulli an 5 , Jane Ful on 5 and Johanna Vilkki 1 Abs ac Backg ound: Occu ence o blood and mea inclusions is an in e nal egg quali y de ec . Mass candling e eals mos o he spo s, bu because b own eggshell hampe s selec ion in b own chicken lines i has no been possible o elimina e he de ec by selec ion. Es ima ed equency o blood and mea inclusions in b own laye s is abou 18% whe eas i is 0.5% in whi e egg laye s. Se e al ac o s a e known o inc ease he incidence o his aul : gene ic backg ound, low le el o i amin A and/o D, s ess o in ec ions, o ins ance. To s udy he gene ic backg ound o he de ec , a mapping popula ion o 1599 F 2 hens om a c oss o Whi e Rock and Rhode Island Red lines was se up. Resul s: Ou his opa hological analyses show ha blood spo s consis o mainly e y h ocy es and ha mea spo s a e accumula ions o nec o ic ma e ial. Linkage analysis o 27 ch omosomes wi h 162 mic osa elli e ma ke s e ealed one signi ican quan i a i e ai locus (QTL) a ec ing blood spo and mea spo equency. We sequenced a agmen o a candida e gene wi hin he egion, ZO-2, coding o a igh junc ion p o ein. Nine polymo phisms we e de ec ed and wo o hem we e included in ine-mapping and associa ion analysis. Fine-mapping de ined he QTL esul . To u he e i y he QTL, associa ion analyses we e ca ied ou in wo independen comme cial b eeding lines wi h he ma ke MCW241 and su ounding SNPs. Associa ion was ound mainly in a 0.8 Mb-wide ch omosomal a ea on GGAZ. Conclusions: The e was good ag eemen be ween he loca ion o he QTL egion on ch omosome Z and he associa ion esul s in he comme cial b eeds analyzed. Va ia ions ound in igh junc ion p o ein ZO-2 and mic oRNA gga-mi -1556 may p edispose egg laye s o blood and mea spo de ec s. This pape desc ibes he i s esul s o de ailed QTL analyses o he blood and mea spo s ai (s) in chickens. Backg ound Egg quali y has ecei ed mo e a en ion due o inc eased demands o sa e y and high-quali y eggs by consume s. In e nal egg quali y in ol es unc ional, aes he ic and mic obiological p ope ies o he egg yolk and albumen. In e nal inclusions (blood and mea spo s) in he egg ha e been ecognized as quali y de ec s since 1899 [1]. In addi ion o being an aes he ic and e hical p oblem, he e is indica ion ha blood o pieces o issue inside he egg may inc ease he isk o in ec ions such as sal- monella [2] and educe ha chabili y o eggs [3]. Blood spo s a e d ople s o blood ound usually on he su ace o he yolk [4,5]. Mea spo s appea as ed, b own o whi e spo s in he albumen. They a e ei he pieces o issue om ep oduc i e o gans o blood spo s ha ha e changed colou due o dilu ion. The ac o s causing inclusions a e unknown. They eme ge du ing he o ula ion p ocess in he o a y o la e in he o i- duc . Blood on he yolk o igina es om bleeding o he small essels in he o a y o in he o iduc [5]. When blood is ound adhe ing o he yolk, bleeding has occu ed in he o a y a he ime when he yolk was eleased om he ollicle. The ollicle has a dense ne wo k o blood essels, aside om an a ascula a ea o he ollicula wall, called he s igma. The ollicle sac up u es a he s igma du ing o ula ion. I any blood essels c oss he s igma, a small d op o blood may be deposi ed on he yolk as i is eleased om he ollicle. Al e na i ely, bleeding may occu be o e o ula ion on * Co espondence: me i.honka ukia@m . i 1 Bio echnology and Food Resea ch, MTT, Jokioinen, 31600, Finland Full lis o au ho in o ma ion is a ailable a he end o he a icle Honka ukia e al.BMC Gene ics 2011, 12:55 h p://www.biomedcen al.com/1471-2156/12/55 © 2011 Honka ukia e al; licensee BioMed Cen al L d. This is an Open Access a icle dis ibu ed unde he e ms o he C ea i e Commons A ibu ion License (h p://c ea i ecommons.o g/licenses/by/2.0), which pe mi s un es ic ed use, dis ibu ion, and ep oduc ion in any medium, p o ided he o iginal wo k is p ope ly ci ed. he i elline memb ane, he s uc u e di ec ly adjacen o he ou e su ace o he yolk. In ha case, blood spo s a e ound in he space be ween he ollicula wall and he i elline memb ane [4]. Blood in he albumen indica es bleeding sho ly a e he elease o he yolk in o he o iduc , a he ime when he yolk is coa ed wi h albumen. Mea spo s in he albumen can be o med om a bi o ep oduc i e issue while he egg is passing h ough he o iduc . As an egg ages, he yolk akes up wa e om he albumen, which in u n dilu es blood spo s and makes hem look like mea spo s. In gene al he equency o blood and mea inclusions is less han 1% in all eggs laid in p esen comme cial lines [2]. Howe e , he incidence o spo s a ies g ea ly: i is abou 18% in b own laye s, whe eas i is only 0.5% in whi e egg laye s [6]. In some b own laye lines he equency can be as high as 30% [6]. The incidence o spo s seems o inc ease when he hen ages [7]. Inc eased equency also appea s a he s a o laying. Di e en ypes o ac o s, including nu i ional, en i - onmen al and he edi a y ac o s, igge he incidence o spo s. P obably he mos impo an nu i ional ac o is a lack o i amins A and D [3, 8, 9, 10]. The e is a phy- siological h eshold o he amoun o i amin A. When he supply is su icien , he chicken has a low p obabili y o ha ing blood spo s [11]. En i onmen al ac o s, like sudden loud noises, empe a u e changes and in ec ions, induce an inc ease in he incidence o spo s [4,6,12]. Fu he mo e, he p oblem has a gene ic backg ound. The es ima es o he i abili y o inclusion ai s ange om 0.07 up o 0.6 [11,13,14]. In con en ional b eeding p ac ices, selec ion agains inclusions is usually done by elimina ing amilies ha ha e inc eased incidence o inclusions om he b eeding popula ion (Schmu z, M., pe sonal communica ion). In e nal inclusions a e de ec ed ia mass candling. This p ocess e eals mos o he spo s, bu occasionally aul y eggs pass he con ol checks and end up in he consume ’s hands. This has been a p oblem especially in b own laye lines, because b own shells hampe spo de ec ion. Inc eased in e es in sa e y and high-quali y eggs mo i- a ed us o s udy he gene ic backg ound o he inci- dence o blood spo s in chicken eggs. So a , he e ha e been no a emp s o map QTL o in e nal inclusions. The ul ima e objec i e was o ind ma ke s sui able o use in a comme cial selec ion p og amme and o iden- i y genes a ec ing he de ec . Resul s His opa hologic s udy In he analyzed b oile eggs, he spo s ha we e col- lec ed close o he su ace o he yolk, mac oscopically looking like blood s ains, we e accumula ions o e y h ocy es su ounded by a hin eosinophilic acellula memb ane. Spo s ound in he albumen, mac oscopically looking like a g eyish mass, we e accumula ions o nec o ic ma e ial su ounded by a hin acellula mem- b ane. The nec o ic ma e ial consis ed o ine g anula eosinophilic and b own deb is. Gene ic pa ame e s, he i abili ies and gene ic co ela ions The he i abili y es ima es in pu e lines o blood spo sco e and blood spo combina ion (numbe *size) we e 0.05 and 0.04, espec i ely, in Lohmann B own. In Whi e Rock he he i abili y o blood spo sco e was 0.01. The he i abili y o mea spo combina ion (num- be *size) was e alua ed o be 0.01 in Lohmann B own (no da a a ailable o Whi e Rock). The gene ic co ela- ion be ween inclusion ai s a ied g ea ly: i was highly nega i e (-0.90) be ween wo blood spo ai s (sco e and combina ion) and be ween blood spo sco e and mea spo combina ion (-0.70), whe eas i was posi i e (0.83) be ween blood spo combina ion and mea spo combina ion (see addi ional ile 1, Table S1). Genome scan One genome-wide signi ican QTL a ec ing incidence o in e nal inclusions was disco e ed (Table 1). The highes F- a io, 18.59, occu ed a 69 cM, in he a ea lanked by ma ke s MCW258 and MCW241 (21,403,330- 34,264,330 Mb) on ch omosome Z. The addi i e e ec was 3.61 wi h 0.84 SE, co esponding o a di e ence o 0.036 in he a e age sco e om h ee consecu i e eggs ( his ai has an a e age o 1.02, wi h a s anda d de ia- ion o 0.24). I explains 1% o he o al pheno ypic a iance. O he sugges i e (genome-wide 10% signi icance) QTL we e ound on ch omosome 1 a he posi ion o 429 cM be ween ma ke s MCW23 and MCW145 (156,472,062- 162,032,936 Mb), on ch omosome 2 a he beginning o he linkage map a he ma ke MCW82 (5,313,874- 5,313,971 Mb), and on ch omosome 4 a he ma ke ADL331 (63,195,046-63,195,223 Mb). The QTL e ec on ch omosome 1 is dominan while i is addi i e o he o he wo egions. Sequencing o ZO-2 A pu a i e candida e gene, ZO-2 (NP_990249), a key gene con olling adhesion be ween neighbou ing epi he- lial cells, was ound o be loca ed wi hin he QTL egion on ch omosome Z. The ma ke MCW241 showing sig- ni ican associa ion o blood and mea inclusions was loca ed inside his gene. We sequenced a agmen o 549 bp om se e al indi iduals om his candida e gene among Lohmann B own and Hy-Line popula ions (106 and 20, espec i ely). We disco e ed nine poly- mo phic si es (Table 2). Th ee o he a ia ions we e Honka ukia e al.BMC Gene ics 2011, 12:55 h p://www.biomedcen al.com/1471-2156/12/55 Page 2 o 10 loca ed in exon 18. One o he p e iously epo ed SNPs, s10724503 h p://www.ensembl.o g/Gallus_gal- lus/ was con i med and used as a ma ke (ZO-2 snupe) in he ollowing associa ion s udy. The o he epo ed ameshi mu a ion s16767170 h p://www.ensembl. o g/Gallus_gallus/) was no de ec ed among his ma e- ial. Two new in onic a ia ions (SNP6, posi ion 34,315,888 and SNP7, posi ion 34,315, 890 in Table 2) we e ound o be loca ed wi hin a mic oRNA (gga-mi - 1556). These polymo phisms we e loca ed in he p edic ed s em-loop s uc u e o he mic oRNA (Figu e 1). Such a ia ion migh a ec he s abili y o he s em-loop s uc u e and hus also he unc ion o he miRNA in gene egula ion. One o hese a ia ions was used in he associa ion s udy (SNP7, ‘miRNA’). The a ia ions ha e been submi ed o GeneBank (BankI 1438826, JF509397). Fine-mapping o ch omosome Z When a la ge sample o animals was geno yped o a dense map o he QTL egion on ch omosome Z, a gen- ome-wide highly signi ican QTL (F- a io 32.9) was seen a he ma ke posi ion MCW241, a he posi ion 54 cM on he linkage map (genomic loca ion Z: 34.26 Mb) wi h he addi i e e ec o 3.75 uni s (Figu e 2). Com- pa ed o he ini ial QTL scan, mo e ma ke s we e added o he dis al end o he map o lank he QTL. As a esul , he highes peak o F- a io shi ed ou side o he p e iously mapped a ea, bu i was success ully lanked wi h new ma ke s. The e ec o he QTL was now es ima ed o be 2% o he pheno ypic a iance. Associa ion Associa ion was s udied wi h a se o SNP ma ke s (including miRNA a ia ion) and he mos signi ican mic osa elli e ma ke MCW241 (Table 3). The s udied SNP ma ke s we e loca ed be ween bp 31,855,282 and 36,533,455 o ch omosome Z. Associa ions we e ound mainly in a 0.8 Mb-wide ch omosomal a ea loca ed be ween 33,508,907 - 34,315,890 o GGAZ (Table 3). The associa ed loci a ied acco ding o he s udied pheno ype and popula ion. Fo ins ance, in he Hy-Line popula ion only he mea spo ai was ound o be associa ed o SNP ‘ s14761267’,whe easSNP Table 1 Summa y o QTL esul s o blood and mea spo ai (BMS F2 ) om he F 2 genome scan Ch om. pos cM Flanking ma ke s and genomic posi ions F (1) 1% (2) 5% (2) 10% (2) Add. (4) SE (5) Dom. (4) SE R 2(3) 1 429 MCW0023-MCW0145 156,472,062 - 162,032,735 5,86 8,64 7,52 4,33 -2,27 1,48 7,07 2,35 2% 2 0 MCW0082 5,313,874 6,90 10,90 8,60 4,90 -4,32 1,43 4,38 2,19 2% 4 113 MCW0284-ADL331 54,907,139 - 63,195,046 6,25 10,33 8,00 5,18 -3,64 1,30 -3,87 1,90 2% Z 69 MCW258-MCW241 21,403,330 - 34,264,059 18,59 16,24 13,63 12,2 3,61 0,84 na na 1% The e ec was calcula ed as he e ec o he allele o igina ing om he pa en al RIR line. The ma ke map used in he Z-ch omosome was: ADL117-(22cM)- MCW331-(12 cM)-MCW55-(16cM)-MCW258-(38cM)-MCW241. 1 F- a io o he eg ession analysis. 2 Genome wide signi ican le els 3 R 2 is he educ ion (in %) o o al pheno ypic a iance due o he p esence o he QTL. 4 Real e ec is he alue di ided by 100 (Add = addi i e e ec , Dom = dominance e ec ) 5 SE = s anda d e o Table 2 Va ia ion ound in he ZO-2 gene SNP # genomic loca ion exon/in on addi ional in o ma ion lanking sequence 134,315,482 in on17-18 TCTGAATGCA[A/G]TATAACTGTA 234,315,545 in on17-18 ATAAGATGTT[C/T]CACACCCTGC 334,315,708 exon18 s10724503 GTAAGCAGGG[C/T]GTGAAAACGA 434,315,757 exon18 AAAAGCTCGA[A/G]GAAGCTTTAT 534,315,792 exon18 AGCTGAAGAA[A/G]ACTTGTTCCC 634,315,888 in on18-19 gga-mi -1556 TTACTGCTCT[C/G]CGTATTAACT 734,315,890 in on18-19 gga-mi -1556 ACTGCTCTGC[G/A]TATTAACTCA 834,315,932 in on18-19 GTGTGAAAGT[A/G]TGGTCATGAG 934,315,953 in on18-19 CAATCTCTGA[C/T]TTCCTCTCAA Loca ions o polymo phisms a e shown oge he wi h he lanking sequences. Honka ukia e al.BMC Gene ics 2011, 12:55 h p://www.biomedcen al.com/1471-2156/12/55 Page 3 o 10 ‘ s14761196’was linked o bo h he mea and blood spo ai s. Mos o he associa ions we e ela ed o he p e- alence o he spo s (sco e o numbe o he spo s). The allelic e ec s a ied be ween 0.13 and 0.5 SD, depending on bo h ai and popula ion. Discussion and conclusions The e ha e been no epo s so a o QTL o blood and mea inclusions in eggs o laying hens. This pape desc ibes he i s esul s o de ailed analyses o he in e nal inclusion ai s in chickens. QTL we e i s localized h ough linkage analysis in a genome scan. This analysis e ealed one highly signi ican QTL on ch omosome Z and h ee sugges i e QTLs on ch omo- somes 1, 2 and 4. The QTL on ch omosome Z was ine- mapped and alida ed wi h a con i ma ion s udy in wo independen comme cial popula ions. The associa ion o ma ke s wi h he ai in hese independen samples suppo ed he loca ion o he QTL on ch omosome Z. Ma ke s MCW241 and s14761267 showed mos con- g uen associa ion o inclusion ai s in he wo es ed comme cial popula ions. Thus hese ma ke s could be conside ed as ha ing he bes po en ial o selec ing agains in e nal inclusions. The co ec de ini ion o inclusion pheno ype is usually demanding i eggs a e no s udied soon a e lay- ing. Some imes he wo ypes can ha e simila appea - ance (i.e. dilu ion o blood spo s o pale mea spo s). Combining mea and blood spo s o a single a iable is a common p ocedu e in b eeding companies. Howe e , in QTL mapping his may in oduce a bias, especially when one o he componen s is weigh ed mo e han he o he a iable. Acco ding o ou esul s, blood and mea spo s a e sepa a e en i ies. The o igin o blood spo s is ed cells, and mea spo s a e cell masses o epi helium. Dis inc sou ces o he wo spo ypes a e suppo ed by hei sepa a e loca ions wi hin he egg. Simila conclu- sions can be ound om [15] o [16]. Campo e al. [6] sugges ed ha in e nal inclusions a e ela ed o shell pigmen a ion. In ano he s udy, a p o opo phy in mu an ha educed shell colo signi ican ly also showed a educ ion in mea spo s [17]. Howe e , acco ding o ou esul s, he e a e no signs o pigmen ed cells in he inclusions. Ou esul s om he F 2 and LB da a ( ea ing blood and mea spo s as one ai , wi h weigh on blood spo s), migh be pulled owa ds loci a ec ing blood spo s ins ead o mea spo s. Ye , he esul s in Hy-Line, whe e hose wo ai s a e ea ed sepa a ely, a e indica - ing ha he same ch omosomal a ea has an impac on bo h spo ypes. Nume ous iden i ied genes can be ound om he Ensembl genome da abase in he QTL egion. ZO-2 was one o hese genes. I was chosen o u he s udies Figu e 1 Hai pin s uc u e o MI0007281 (mi -gga-1556).The p edic ion o he s uc u e is cons uc ed wi h RNA old web se e . Va ia ions ound by sequencing a e indica ed wi h a ows. Honka ukia e al.BMC Gene ics 2011, 12:55 h p://www.biomedcen al.com/1471-2156/12/55 Page 4 o 10 because o i s known biological unc ion oge he wi h co-loca ion o mic osa elli e ma ke MCW241. ZO-2 belongs o he igh junc ion p o ein amily, which is in ol ed in he o ganiza ion o epi helial and endo helial in e cellula junc ions. I has an impo an ole in ba - ie o ma ion. Blood spo s in he eggs may be due o he agili y o blood essel walls in he o a ies. Symp oms like clo ing and bleeding a e caused by a gene ic de ec called amilial hype cholanemia (FHAC, OMIM ID#607748) in humans [18], which is caused by a mu a ion in he igh junc ion p o ein ZO-2. Compa ed o ou sequencing indings, he mu a ion in humans is loca ed elsewhe e on he ZO-2 gene. The oleo hemic oRNAiden i ied inside he ZO-2 gene in on 18 is also in e es ing. Some epo s ha e demons a ed ha miRNAs a e ansc ip ionally linked o he exp ession o hei hos genes and p ocessed om he same p ima y ansc ip [19]. Thus in addi ion o egula ing i s own a ge genes, gga-mi -1556 migh also a ec he exp ession o ZO-2. Ta ge p edic ion and unc ional anno a ions sea ch ga e 80 p edic ed a ge s o gga-mi -1556 (h p:// mi db.o g/). Among he a ge genes is AGT, angio ensi- nogen (loca ed on GGA3 a 42.30 Mb). Angio ensinogen is a p ecu so o angio ensin, which inc eases blood p essu e. The ac ion o his hypo he ical gene would be compa ible wi h he indings o F y e al. [20] who demons a ed ha blood p essu e is a ac o in suscep - ibili y o blood spo incidence. Acco ding o eQTL s udies, a polymo phism explain- ing gene exp ession a iance may be loca ed ei he nea he gene (cis-eQTL) o u he apa on he genome ( ans-eQTL)[21]. I has been p oposed ha ans-eQTL ha e smalle pheno ypic e ec s han cis-eQTL. In his s udy we ound polymo phism in he miRNA s em-loop ha may a ec i s binding a ini ies o a ge genes. Thus he e ec could be simila o a ans-ac ing eQTL. This is suppo ed by he ac ha al hough he e ec o he QTL was e y signi ican , i was qui e small, app oxima ely 2% o he pheno ypic a iance. 0 5 10 15 20 25 30 35 1 31 61 91 Fine-mapped Genome scan MCW331 LEI171 MCW258 ADL201 MCW241 LEI111 LEI144 LEI121 LEI75 RS14761196 RS16767662 RS16132985 RS1611109 RS16110443 Figu e 2 QTL analysis o he blood and mea spo ai (BMS F2 ) in he F 2 mapping popula ion. The F- a io cu es om he ini ial genome scan (dashed line; 7 amilies, 5 mic osa elli e ma ke s) and he ine-mapping s age (solid line; 17 amilies, 9 mic osa elli e ma ke s, 5 SNPs) a e shown. The genome-wide signi icance le el is ma ked as a do ed line. The mic osa elli e ma ke posi ions ( ine-mapping s age) a e indica ed wi h ed ci cles and he SNP posi ions wi h yellow ci cles in he ollowing o de : MCW331, MCW258, LEI171, ADL201, s14761196, MCW241, s16767662, s16110443, s1611109, s16132985, LEI111, LEI144, LEI121, LEI75. Honka ukia e al.BMC Gene ics 2011, 12:55 h p://www.biomedcen al.com/1471-2156/12/55 Page 5 o 10 The he i abili y o in e nal inclusions is high enough o he ai o be in luenced by con en ional b eeding [11], bu i has no been possible o comple ely elimi- na e i by means o selec ion. We ha e iden i ied one o he genomic a eas in luencing he incidence o blood and mea inclusions. In addi ion, we ha e con i med his associa ion in wo comme cial b eeding popula ions. The ac ual causa i e gene o egula o y mechanism s ill emains unknown. Fu he in es iga ions a e needed be o e decisions can be made on using he esul s in ma ke -assis ed selec ion. The gene ic gain is ela i e o he magni ude o he e ec o he locus, and in his case, he e ec o he QTL is mode a e. Howe e , com- bining he allele in o ma ion wi h con en ional selec ion schemes would yield mo e in o ma ion o use in selec- ion decisions. Me hods Mapping popula ions and geno yping Th ee independen egg laye chicken popula ions we e used o di e en s ages in his s udy. Mapping was done in a wo-s ep app oach; i s a subse o he F 2 popula ion was used o a spa se genome scan and he e- a e he en i e mapping popula ion was used in a Table 3 Associa ion o ma ke s wi h di e en in e nal inclusion ai s in he con i ma ion s udy SNP ID/ma ke Genomic posi ion Ma ke in o ma i e in Associa ion ound in T ai and p- alues s14762832 31,855,282 LB LB Sco e LB (p < 0.001) s16766794 31,955,874 LB s16766752 32,044,210 LB s13795687 32,122,845 LB s16766685 32,276,606 LB s16766334 33,022,548 LB sco e LB (p < 0.05) s16766274 33,092,178 LB s16766257 33,167,074 LB s14761556 33,443,086 LB s14761487 33,508,907 LB LB sco e LB (p < 0.01) g oup LB (p = 0.02) numbe o spo s LB (p < 0.05) s14761341 33,749,060 LB, Hy s14761267 33,832,110 LB, Hy LB, Hy numbe LB (p < 0.02) size LB (p < 0.02) MS Hy (p < 0.05) s14761196 33,996,581 Hy Hy MS Hy (p < 0.01) BL Hy (p < 0.04) MCW241 34,264,059 LB,Hy LB, Hy MS Hy (p < 0.001) BL Hy (p < 0.001) sco e LB (p < 0.01) s10724503 1 34,315,708 LB LB g oup LB (p < 0.001) numbe o spo s LB p < 0.01) size LB (p < 0.001) s14763225 2 34,275,496 LB, Hy miRNA-1556 34,315,890 LB LB g oup LB (p < 0.002) numbe o spo s LB (p < 0.002) size LB (p < 0.002) s16767662 34,996,069 s16110443 36,236,398 s14764985 36,533,455 LB LB g oup LB (p < 0.03) numbe o spo LB (p < 0.02) s16111109 36,959,973 s14766124 38,170,684 LB s16132985 41,098,862 LB Ma ke s ( hei in o ma i i y and ela i e genomic posi ions) in each popula ion can be ound in he 3 d column (LB = Lohmann B own, Hy = Hy-Line). The popula ion and ai showing he associa ion (co esponding p- alues in pa en hesis) a e indica ed in he 4 h and 5 h columns. 1 ZO-2 snupe 2 no mapped in WASHUC2, posi ion based on G oenen e al. 2009 [24]. Honka ukia e al.BMC Gene ics 2011, 12:55 h p://www.biomedcen al.com/1471-2156/12/55 Page 6 o 10 consequen ine-mapping s ep wi h dense ma ke map o he mos signi ican QTL egion. Two independen pu e comme cial lines, Lohmann B own (LB) and Hy- Line (Hy) we e used o con i ming he QTL esul wi h associa ion analysis. The phases o he s udy a e illu- s a ed in Table 4. F 2 c oss Fo he genome scan, an F 2 c oss be ween wo comme - cial b own pu e b eeding lines om Lohmann Tie - zuch , Rhode Island Red and Whi e Rock, desc ibed ea lie in Tuiskula-Haa is o e al. [22] was used. The en i e mapping popula ion consis ed o a o al o 1783 indi iduals, including 30 g andpa en al males, 47 g and- pa en al emales, 16 F 1 males, 90 F 1 emales, and 1599 F 2 hens. Rea ing and managemen p ac ices we e simila o hose in he p e ious QTL s udy, see [23]. Comme cial lines The Lohmann B own popula ion consis ed o 767 pu eb ed hens om pa e nal hal -sib amilies wi h an a e age o 9.7 o sp ing pe amily. Di e en numbe s o indi iduals we e included in analyses depending on he ma ke used (see Table 4). In he LB, 17 SNP ma ke s, a miRNA polymo phism and one mic osa elli e ma ke (MCW241) we e geno yped. The Hy-Line popula ion included a o al o 290 males belonging o pa e nal hal -sib amilies (3,5 males pe amily). Pheno ypes ep esen ed si e-daugh e a e ages. The Hy-Line popula ion was analyzed wi h a mic osa el- li e ma ke (MCW241) and 4 in o ma i e SNP ma ke s wi hin he QTL a ea ( s14761341, s14761267, s14761196 and s14763225). Geno yping DNA p epa a ion and geno yping o mic osa elli e ma ke s ha e been desc ibed in [22]. The numbe o geno yped indi iduals in each popula ion is shown in Table 4. Fo ine-mapping, we selec ed a se o SNP ma ke s [24] om he QTL egion (Table 3). Illumina BeadXp ess (h p://www.illumina.com) eade was used o geno yping mul iplex SNPs (OPA), which we e clus e ed wi h BeadS udio. The miRNA geno ypes we e yped by sequencing, and he SNP in he candi- da e gene by minisequencing (ZO-2 snupe), acco ding o p o ocols in [25]. Pheno ypes Blood and mea spo pheno ypes we e collec ed om h ee consecu i e eggs o each hen be ween he ages o 35 and 41 weeks (Table 5). In con as o o he ypes o blood spo s udies, he hens we e ed wi h adequa e eed; no challenge die was used. Eggs we e b oken on o a glass shee o de ec he spo s. In he F 2 genome scan, blood and mea spo pheno ypes we e ea ed as one ai (BMS F2 ). Eggs we e sco ed based on he p esence and size o inclusions ("0”no inclusions, “1”and “2” small o big mea spo , “3”,“4”and “5”small, middle- sized o la ge blood spo ). The nume ic alue o BMS F2 was elici ed by a ans o ma ion, whe e he a e age o h ee eggs was mul iplied wi h 100; he ea e he ‘BMS F2 uni ’ e e ed o a combina ion o numbe and se e - i y o he inclusions. Pheno ypes we e s udied in mo e de ail in he con i - ma ion s udy o he comme cial lines. Blood and mea spo s we e sco ed a 36, 40 and 42 weeks o age. Fo Table 4 Wo k low S udy Aim Ma e ial Me hod de ails Genome scan Sea ch o QTL Sub da a o F 2 popula ion ( andomly selec ed 7 hal -sib amilies) Linkage analyses o 162 mic osa elli es on 27 ch omosomes 668 F 2 hens Fine- mapping Focusing on he QTL a ea Whole F 2 mapping popula ion (17 hal -sib amilies) 6 new mic osa elli e ma ke s + 5 SNPs 1599 F 2 hens Sequencing SNP de ec ion Lohmann B own, Hy-Line 106 indi uals in LB 20 in idi uals in Hy His o- pa hology Tissue analysis Eggs om a b oile b eeding ha che y Ligh mic oscopy s udy 480 eggs Con i ma ion Associa ion s udies in independen comme cial lines 1) Lohmann B own (767 hens) Mixed models wi h DMU whole pu e line hen popula ion (767 hens): MCW241 -sub da a I: ZO-2 (516 hens) -sub da a II: pheno ypically ex eme 416 hens: panel o 15 SNPs 2) Hy-Line (290 males) Linea model wi h leas squa es, SAS -all geno yped wi h MCW241 -all geno yped wi h a panel o 5 in o ma i e SNPs Di e en phases and aims o he s udy a e shown in he 1 s and 2 nd columns. Popula ions and subse s a e p esen ed in he 3 d column ollowed wi h he me hods and de ails in he 4 h and 5 h columns. Honka ukia e al.BMC Gene ics 2011, 12:55 h p://www.biomedcen al.com/1471-2156/12/55 Page 7 o 10 each hen and measu emen 3 consecu i e eggs we e col- lec ed and he spo s we e subjec i ely sco ed. In he Lohmann B own, he pheno ype was eco ded as i e pheno ypic a iables o blood and mea spo (Table 5). Fi s , SCORING: sco ing scheme was as ollows: 0 = no spo s 1 = low numbe o small mea spo s 2 = highe numbe o small mea spo s o small num- be o medium sized mea spo s 3 = high numbe and/o la ge sized mea spo s 4 = low numbe o small blood spo s 5 = highe numbe o small and/o la ge blood spo s P io o QTL analyses he pheno ypic mean o he 3 eggs om one hen o e e y age we e co ec ed o he e ec o ha ch and posi ion o he hen ( ie o he ba - e y). This en i onmen al in luence was es ima ed om a gene ic model including he addi i e gene ic e ec s o he animals. This analysis was done wi h he So wa e PEST [26]. Model : yij =µ+AHT i+a j+e ij whe e y ij = pheno ypic obse a ion AHT i = ixed e ec o Age-Class, Ha ch and Tie i (combined in a mul icode) a j = addi i e gene ic e ec o animal j e ij = esidual The co ec ed a e ages o e e y hen o he 3 obse - a ions a di e en age we e hen agg ega ed in o one obse a ion by a i hme ic mean. Second, GROUP: based on he sco ing, hens we e di ided in o high (spo s) o low(nospo s).Thi d,NUMBERo spo s.Fou h,SIZE o spo s: diame e o he spo s (in mm). Fi h, COMBI- NATION: he unc ion o numbe and size o spo s. The unc ions used o no malizing he pheno ypic da a a e p esen ed in Table 5. In he Hy-Line popula ion, eggs we e p ocessed wi hin 24 hou s o p oduc ion a a cen alized egg quali y lab acili y. Blood and mea inclusions we e iden i ied and ea ed as wo sepa a e ai s. Bo h ai s we e measu ed in a semi-quan i a i e scale, using a sco e based on he p esence and size o he inclusion (0 o 5: “0”i an inclusion was absen , o “5”i an app oxima ely 5 mm inclusion was p esen ). Pheno ypes o males we e exp essed as si e-daugh e a e ages. Desc ip i e s a is- ics, such as dis ibu ion and gene ic pa ame e s in he pa en al lines o F 2 mapping popula ion is p esen ed in he addi ional ile, Tables S1-S3. His opa hological s udies In o de o examine he sou ce o he inclusions, a his opa hological s udy was conduc ed. Ma e ial o he his opa hological s udy was collec ed om a o al o 480 andomly selec ed eggs om a b oile -b eeding ha che y. F esh, dis inc spo s we e ixed in 10% bu e ed o malin, ou inely p ocessed, embedded in pa a in and se ially sec ioned a 4 μm. The sec ions we e s ained wi h haema oxylin and eosin (H&E) and s udied by ligh mic oscopy. QTL mapping The mapping was done in wo s ages. A i s , a genome scan wi h 162 mic osa elli e ma ke s on 27 ch omosomes was conduc ed in a subse o se en hal -sib amilies wi h 668 F 2 indi iduals. Then he en i e mapping popula ion including 1599 F 2 hens was used in he ine-mapping. A new linkage map o he Z-ch omosome was calcula ed Table 5 The popula ions and pheno ypes used in he s udy Pop. N T ai Scaling Age o e alua ion Co ec ion F 2 1599 Blood and mea spo s (BMS F2 ) Adjus ed om numbe and ype o spo s 35, 40, 50 weeks A e age o h ee sequen ial eggs, mul iplied by 100. LB 416 1 Sco e con inuous scaling om 0 o 5 36, 40, 42 weeks LN co ec ion G oup coun o spo s = > high o low 36, 40, 42 weeks e ec o ha ch and ie o he ba e y Numbe o spo s absolu e numbe o spo s 36, 40, 42 weeks (numbe _co +0,05)*100 Size o spo s con inuous (in mm) 36, 40, 42 weeks (size_co +0,1)*100 Combina ion numbe * size 36, 40, 42 weeks (combina ion_co +0,1)*100 Hy- Line 290 Blood spo s (BL) Semi-quan i a i e ea ly, la e The pheno ypes we e exp essed as si e-daugh e a e ages Mea spo s (MS) Semi-quan i a i e ea ly, la e The pheno ypes we e exp essed as si e-daugh e a e ages The s udied popula ions and he numbe o indi iduals in each o hem a e indica ed in he 1 s and 2 nd columns. The ai s a e desc ibed in he 3 d and 4 h columns. The age a ime o e alua ion is gi en in he 5 h column. The las column p esen s he co ec ion unc ions used o no malizing he pheno ypic da a (LN = na u al loga i hm). 1 The numbe o hens geno yped in he Lohmann B own popula ion a ied acco ding o ma ke : MCW241, 767 hens; ZO-2 SNP,516; 15 o he SNPs on he Z ch omosome, 416; mi RNA-1556 sequencing, 90. Honka ukia e al.BMC Gene ics 2011, 12:55 h p://www.biomedcen al.com/1471-2156/12/55 Page 8 o 10 by CRI-MAP [27], including 9 mic osa elli e ma ke s and 5 SNPs. QTL mapping was based on eg ession analysis using mul iple ma ke in o ma ion. Au osomes we e ana- lyzed wi h G idQTL [28] and he Z-ch omosome by a cus om-made p og am as desc ibed in [22,23]. F om he Z-ch omosome, only he addi i e e ec could be es i- ma ed. The empi ical signi icance le els we e de e mined by a pe mu a ion es , also desc ibed in [22,23]. Candida e gene sequencing A candida e gene was chosen based on i s known unc ion and he gene ic map in o ma ion ob ained om QTL mapping. The igh junc ion p o ein 2 gene, TJP2, also known as ZO-2, was pa ially sequenced o a single genomic agmen , including wo p e iously epo ed SNPs ( s10724503 and s16767170) h p:// www.ensembl.o g/Gallus_gallus/. This a ea o 546 base pai s con ains exon 18 and pa o he ollowing in on (genomic loca ion o 34,315,438 - 34,315,986). The p ime pai o ampli y he agmen was designed wi h P ime 3 h p:// odo.wi.mi .edu/p ime 3/) ( o wa d p i- me : 5’- AAGCTGCTTCGAAAAATGGA and e e se 5’-GTCACTTGGCAACACAAGGA). This p ime pai was also used o sequencing. The sequencing and minisequencing p o ocols we e conduc ed as desc ibed in [25]. Fo he minisequencing, p ime s o agmen ampli ica ion we e o wa d 5’-CTGTACCGGCAGAA- CACTGA and e e se 5’- GAAGACACAGTTAC TTCCCCTGA. The oligo o minisequencing was 5’- AACCCAGACAGTAAGCAGGG. Fine-mapping Basedon he esul om hegenomescan,ninemo e amilies we e included in he QTL analysis. The ull popula ion was geno yped wi h a ma ke panel o nine mic osa elli e ma ke s and i e single nucleo ide poly- mo phisms(SNPs)chosen omG oenene al.[24] o he QTL a ea on ch omosome Z. The ini ial genome scan was conduc ed wi h 5 mic osa elli e ma ke s (ADL117-22cM-MCW331-12 cM-MCW55-16cM- MCW258-38cM-MCW241). Ma ke s used in he ine-- mapping we e: MCW331-15cM-MCW258-28cM- LEI171-4cM-ADL201-3cM- s14761196-2cM-MCW241- 4cM- s16767662-7cM- s16110443-1cM- s1611109- 2cM- s16132985-5cM-LEI111-1cM-LEI144-2cM-LEI 121-17cM-LEI75. Con i ma ion wi h associa ion To con i m he ine-mapping QTL esul o blood and mea spo s, associa ion was es ed in wo independen comme cial pu e lines wi h mo e de ailed pheno ypic ai s. Di e en se s o SNP ma ke s we e used depend- ing on hei in o ma ion con en in he espec i e popu- la ion. In he Lohmann B own (LB) popula ion, hens we e geno yped o he mic osa elli e MCW241 and minisequenced o a candida e gene SNP ( s10724503) (called he ein ZO-2 snupe). Addi ional analyses wi h 15 SNPs we e done wi h a subse o pheno ypically ex eme hens om he LB (Table 3). F om Hy-Line, a Whi e Ply- mou h Rock pu e line, 290 si es we e geno yped wi h one mic osa elli e ma ke (MCW241) and 5 SNP ma - ke s om he QTL a ea. The ma ke associa ions wi h di e en inclusion ai s we e conduc ed sepa a ely o each ma ke (Table 5). The associa ions in he LB popu- la ion we e es ima ed wi h he so wa e package DMU [29], which enabled exploi a ion o a mixed linea model and inclusion o popula ion s uc u e. In he Hy-Line popula ion, he ma ke - ai associa- ion was analysed using a linea model wi h he me hod o leas squa es in SAS [30]. Depending on he ai es ed T- es , Wilcoxon Rank Sum, o Fishe ’s exac es was implemen ed o ind associa ion be ween pheno y- pic ai s and ma ke s. Addi ional ma e ial Addi ional ile 1: Table S1: Es ima es o Gene ic Pa ame e s o Inclusions in pu e lines (g andpa en al lines) o Lohmann B own (He i abili y on he diagonal and gene ic co ela ion o he o - diagonal).Table S2: Dis ibu ion o pheno ypes in he g andpa en al lines o Lohmann B own o he subjec i e combined sco e (3 eggs pe hen). Table S3: Dis ibu ions o pheno ypes in he g andpa en al lines o Lohmann B own o numbe and size o he spo s (only o Rhode Island Red line). Acknowledgemen s The sequences has been submi ed o GenBank (BankI 1438826 JF509397). This p ojec was unded by Lohmann Tie zuch GmbH and by a pe sonal g an om Emil Aal onen Founda ion o MH. We a e g a e ul o Lau a Lau amäki and Sa i Raiskio o p ac icali ies in he poul y house, Jonna Tabell and Anneli Vi a o unning he lab wo k, Johanna Daka om Munakun a o o ganizing ma e ial o his opa hological analysis and Lau i Jauhiainen o helping wi h he associa ion analysis. Au ho de ails 1 Bio echnology and Food Resea ch, MTT, Jokioinen, 31600, Finland. 2 Depa men o Biosciences, Uni e si y o Helsinki, Helsinki, 00014, Finland. 3 Lohmann Tie zuch GmbH, Cuxha en, 27472, Ge many. 4 Resea ch Depa men , Fish and Wildli e Heal h, EVIRA, Mus ialanka u 3, Helsinki, 00790, Finland. 5 Hy-Line In e na ional, P.O. Box 310, Dallas Cen e , IA 50063, USA. Au ho s’con ibu ions MH designed and pe o med he geno yping and sequencing wo k, pa icipa ed in he s a is ical analysis (linkage analyses) and w o e he manusc ip . MT-H con ibu ed o he s udy design and da a collec ion and analyses. VA and PU con ibu ed o he s a is ical analyses (associa ion analyses). PV did he his opa hological s udy. MS, DC, JA, NOS, JF and RP con ibu ed o he s udy design, p o ided pheno ypic da a and animal samples. JV supe ised he s udy and edi ed he manusc ip . All au ho s ead and app o ed he inal manusc ip . Recei ed: 1 Oc obe 2010 Accep ed: 13 June 2011 Published: 13 June 2011 Re e ences 1. Anonymous: Blood Spo s in Hens’Eggs. The Ame ican Na u alis 1899, 33(390):530. Honka ukia e al.BMC Gene ics 2011, 12:55 h p://www.biomedcen al.com/1471-2156/12/55 Page 9 o 10