scieee Science in your language
[en] (orig)

Biomimetic Collagen Membranes as Drug Carriers of Geranylgeraniol to Counteract the Effect of Zoledronate

Author: Manzano-Moreno, Francisco Javier,Luna Bertos, María Elvira De,Toledano Osorio, Manuel,Urbano Arroyo, Paula,Ruiz Rodríguez, Concepción,Toledano Pérez, Manuel,Osorio Ruiz, Raquel
Publisher: MDPI
Year: 2023
DOI: 10.3390/biomimetics9010004
Source: https://digibug.ugr.es/bitstream/10481/90833/1/biomimetics-09-00004.pdf
Ci a ion: Manzano-Mo eno, F.J.; de
Luna-Be os, E.; Toledano-Oso io, M.;
U bano-A oyo, P.; Ruiz, C.; Toledano,
M.; Oso io, R. Biomime ic Collagen
Memb anes as D ug Ca ie s o
Ge anylge aniol o Coun e ac he
E ec o Zoled ona e. Biomime ics
2024,9, 4. h ps://doi.o g/10.3390/
biomime ics9010004
Academic Edi o : Ma ia G azia
Cascone
Recei ed: 14 No embe 2023
Re ised: 4 Decembe 2023
Accep ed: 20 Decembe 2023
Published: 22 Decembe 2023
Copy igh : © 2023 by he au ho s.
Licensee MDPI, Basel, Swi ze land.
This a icle is an open access a icle
dis ibu ed unde he e ms and
condi ions o he C ea i e Commons
A ibu ion (CC BY) license (h ps://
c ea i ecommons.o g/licenses/by/
4.0/).
biomime ics
A icle
Biomime ic Collagen Memb anes as D ug Ca ie s o
Ge anylge aniol o Coun e ac he E ec o Zoled ona e
F ancisco Ja ie Manzano-Mo eno 1,2 , El i a de Luna-Be os 2,3,* , Manuel Toledano-Oso io 4,†,
Paula U bano-A oyo 4, Concepción Ruiz 2,3,5 , Manuel Toledano 2,4 and Raquel Oso io 2,4
1Biomedical G oup (BIO277), Depa men o S oma ology, School o Den is y, Uni e si y o G anada,
18071 G anada, Spain; jmanza@ug .es
2Ins i u o In es igación Biosani a ia, ibs. G anada, 18012 G anada, Spain; c @ug .es (C.R.);
oledano@ug .es (M.T.); oso io@ug .es (R.O.)
3Biomedical G oup (BIO277), Depa men o Nu sing, Facul y o Heal h Sciences, Uni e si y o G anada,
18016 G anada, Spain
4Facul y o Den is y, Uni e si y o G anada, Colegio Máximo de Ca uja s/n, 18071 G anada, Spain;
[email p o ec ed] (M.T.-O.); [email p o ec ed] (P.U.-A.)
5Ins i u e o Neu oscience, Uni e si y o G anada, Cen o de In es igación Biomédica (CIBM),
Pa que de Tecnológico de la Salud (PTS), 18071 G anada, Spain
*Co espondence: el i adlb@ug .es
†Cu en add ess: Pos g adua e P og am o Specializa ion in Pe iodon ology, Facul y o Den is y,
Uni e si y Complu ense o Mad id, 28040 Mad id, Spain.
Abs ac : To coun e ac he e ec o zoled ona e and dec ease he isk o os eonec osis o he jaw
(BRONJ) de elopmen in pa ien s unde going guided bone egene a ion su ge y, he use o ge anyl-
ge aniol (GGOH) has been p oposed. Collagen memb anes may ac as biomime ical d ug ca ie s.
The objec i e o his s udy was o de e mine he capaci y o collagen-based memb anes doped wi h
GGOH o e e he nega i e impac o zoled ona e on he g ow h and di e en ia ion o human
os eoblas s. MG-63 cells we e cul u ed on collagen memb anes. Two g oups we e es ablished:
(1) undoped memb anes and (2) memb anes doped wi h ge anylge aniol. Os eoblas s we e cul u ed
wi h o wi hou zoled ona e (50
µ
M). Cell p oli e a ion was e alua ed a 48 h using he MTT colo i-
me ic me hod. Di e en ia ion was es ed by s aining mine aliza ion nodules wi h aliza in ed and
by gene exp ession analysis o bone mo phogene ic p o eins 2 and 7, alkaline phospha ase (ALP),
bone mo phogene ic p o eins 2 and 7 (BMP-2 and BMP-7), ype I collagen (Col-I), os e ix (OSX),
os eocalcin (OSC), os eop o ege in (OPG), ecep o o RANK (RANKL), un - ela ed ansc ip ion
ac o 2 (Runx-2), TGF-
β
1 and TGF-
β
ecep o s (TGF-
β
R1, TGF-
β
R2, and TGF-
β
R3), and ascula
endo helial g ow h ac o (VEGF) wi h eal- ime PCR. One-way ANOVA o K uskal–Wallis and pos
hoc Bon e oni es s we e applied (p< 0.05). Scanning elec on mic oscopy (SEM) obse a ions we e
also pe o med. T ea men o os eoblas s wi h 50
µ
M zoled ona e p oduced a signi ican dec ease in
cell p oli e a ion, mine aliza ion capaci y, and gene exp ession o se e al di e en ia ion ma ke s i
compa ed o he con ol (p< 0.001). When os eoblas s we e ea ed wi h zoled ona e and cul u ed on
GGOH-doped memb anes, hese a iables we e, in gene al, simila o he con ol g oup (p> 0.05).
GGOH applied on collagen memb anes is able o e e se he nega i e impac o zoled ona e on he
p oli e a ion, di e en ia ion, and gene exp ession o di e en os eoblas s’ ma ke s.
Keywo ds: zoled ona e; collagen memb anes; os eoblas ; ge anylge aniol
1. In oduc ion
In ecen yea s, he use o polyme ic memb anes in di e en medical applica ions
has been e ol ed [
1
,
2
]. Biomime ic collagen memb anes and sca olding ab ica ion ech-
nologies ha may imi a e he mic oen i onmen o na u al ex acellula ma ices (ECM)
ha e been de eloped o guided bone egene a ion (GBR) and guided issue egene a ion
Biomime ics 2024,9, 4. h ps://doi.o g/10.3390/biomime ics9010004 h ps://www.mdpi.com/jou nal/biomime ics
Biomime ics 2024,9, 4 2 o 18
(GTR) [
3
]. Thei abili y o mimic na u al ECM p o iding a suppo i e en i onmen o
cell g ow h and issue egene a ion, and he ac ha hey a e sel -healing ma e ials makes
hem a aluable esou ce o medical and den al p o essionals seeking o imp o e pa ien
ou comes in a a ie y o applica ions [4].
One o he applica ions o biomime ic polyme ic memb anes in he biomedical ield is
ep esen ed by he de elopmen o d ug deli e y sys ems such as an ibio ics o p o eins [
5
].
D ug elease can be achie ed h ough di usion o ac i e subs ances loaded on he polyme ic
memb ane, esul ing in a sus ained d ug elease [
6
]. Collagen-based memb anes, a e he
mos widely used in GBR/GTR p ocedu es, mainly due o hei biomime ic p ope ies,
biocompa ibili y, good handling and biological abili y o a ac and ac i a e gingi al
ib oblas s, pe iodon al ligamen cells, and os eoblas s [
7
]. Di e en subs ances ha e been
used o unc ionalize hese memb anes, such as co icos e oids o an ibio ics wi h he aim
o imp o ing hei biological p ope ies [8,9].
Bisphosphona es (BPs) a e syn he ic compounds analogous o py ophospha es whe e
he oxygen a om esponsible o binding he phospha e g oups is eplaced by a ca bon a om.
These d ugs a e used o ea ce ain bone pa hologies such as malignan hype calcaemia,
p os a e, and b eas cance bone me as ases, Page ’s disease and os eopo osis [
10
–
12
]. These
d ugs a e classi ied in o ni ogenous and non-ni ogenous BPs. Ni ogenous BPs, such
as zoled ona e, pamid ona e, alend ona e o iband ona e, inhibi he enzyme a nesyl
diphospha e syn hase and dis up he me alona e pa hway. Consequen ly, ge anylge -
anylpy ophospha e (GGPP) p oduc ion in he me alona e pa hway is educed [
13
], leading
o impai ed os eoclas ic unc ion [10,14].
These d ugs a e widely used, and hei abili y o inhibi os eoclas o ma ion and
ac i i y has been ex ensi ely es ed [
15
,
16
]. Howe e , he exac e ec ha hey p oduce
on os eoblas s and bone is no ully unde s ood. P e ious s udies s a ed ha high doses
o bisphosphona es educe os eoblas -like cell p oli e a ion h ough cell cycle a es and
induce cell apop osis/nec osis [
17
]. Howe e , a low doses, BPs inc ease cell p oli e a ion
while inhibi ing di e en ia ion o his cell lineage [18,19].
BPs ha e been associa ed wi h he de elopmen o some BRONJ [
20
,
21
]. E en when
he apeu ic doses o BPs a e low, a e p olonged ea men , a high concen a ion o BPs
may be ound in bone. I is due o he s ong binding o hese d ugs o hyd oxyapa i e [
18
].
Pa ien s ea ed wi h BPs may need o unde go o al ca i y ehabili a ion p ocedu es
in ol ing he use o osseoin eg a ed implan s and guided bone egene a ion (GBR). I
equi es he use o a memb ane in o de o compa men alize he bone de ec and p e en
i s coloniza ion by non-bone o ming cells, allowing he egene a ion o ha d issues
ha ha e been damaged o los [
22
]. The biological mechanisms esponsible o wound
egene a ion and healing ha e been s udied, which has allowed polyme ic memb anes o
mo e om being a ba ie o playing a mo e ac i e ole by combining biological ac i i y
wi h a ba ie e ec o p omo e issue egene a ion [23].
Ge anylge aniol (GGOH) is a di e penoid ha is hexadeca-2,6,10,14- e aene subs i-
u ed by me hyl g oups a posi ions 3, 7, 11, and 15 and a hyd oxy g oup a posi ion 1. I
has been p oposed as a po en ial he apeu ic weapon o he ea men and p e en ion o
BRONJ. GGOH is con e ed in o GGPP, which se es as a subs a e o he ge anylge -
anyla ion o p o eins [
24
–
26
]. I is a poo wa e -soluble d ug [
27
]. The enhanced loading
capaci y o poo wa e -soluble d ugs in o amine-con aining ma e ials has been p e iously
epo ed. I is supposed o be ia a eac ion wi h he amine o collagen chains, o ming
amide bonds [28].
So a , he e a e no s udies analysing he e ec o doping collagen memb anes wi h
GGOH on bisphosphona e- ea ed os eoblas s. This ac can be conside ed e y ele an
because he e a e many pa ien s ea ed wi h bisphosphona es who will need o unde go
GBR/GTR p ocedu es o o al ehabili a ion.
The objec i e o his s udy was o de e mine he capaci y o collagen-based mem-
b anes doped wi h GGOH o e e he nega i e impac o zoled ona e on he g ow h and
di e en ia ion o human os eoblas s.
Biomime ics 2024,9, 4 3 o 18
2. Me hods
2.1. Collagen Memb anes Func ionaliza ion
Collagen memb anes ob ained om po cine pe ica dium (Jason
®
; Bo iss Bioma e ials
GmbH, Be lin, Ge many) we e adap ed o 7 mm diame e discs and doped wi h GGOH.
Fo his p ocess, an e hanol (Sigma, S . Louis, MO, USA), solu ion o GGOH 10
µ
M was
p epa ed. An amoun o 15
µ
L o his solu ion was added o each memb ane disc. Hence,
wo g oups o memb anes we e ob ained: (1) undoped collagen memb anes (Col-M), and
(2) GGOH-doped collagen memb anes (GG-M).
2.2. Cell Cul u e
Human os eoblas ic os eosa coma MG-63 cells (ATCC, Manassas, VA, USA) we e
cul u ed in Dulbecco’s modi ied Eagle’s medium (DMEM; In i ogen Gibco Cell Cul-
u e P oduc s, Ca lsbad, CA, USA). DMEM medium was supplemen ed wi h gen amicin
50 mg/mL (B aum Medical SA, Jaén, Spain), ampho e icin B 2.5 mg/mL (Sigma, S . Louis,
MO, USA), ampho e icin B 2.5 mg/mL (Sigma, S . Louis, MO, USA), glu amine 1% (Sigma,
S . Louis, MO, USA) and HEPES 2% (Sigma, S . Louis, MO, USA), penicillin 100 IU/mL
(Lab Roge SA, Ba celona, Spain), 2% HEPES (Sigma, S . Louis, MO, USA), and 1% glu-
amine (Sigma, S . Louis, MO, USA), and subsequen ly supplemen ed wi h 10% e al
bo ine se um (FBS; Gibco, Paisley, UK). A humidi ied a mosphe e a 37
◦
C wi h 95% ai
and 5% CO
2
was used o main ain he cul u es. A solu ion wi h 0.05% ypsin (Sigma,
S . Louis, MO, USA) and 0.02% e hylenediamine e aace ic acid (EDTA; Sigma, S . Louis,
MO, USA) was used o de ach he cells om he cul u e lask. A e his, he cells we e
esuspended in DMEM medium con aining 10% FBS [
29
]. MG-63 cells we e seeded on o
bo h g oups o collagen memb anes (Col-M and GG-M) and cul u ed wi h o wi hou he
p esence o a ni ogen-con aining BP, zoled ona e (Sigma-Ald ich, S . Louis, MO, USA) a a
dose o 50 µM o 48 h.
2.3. Cell P oli e a ion Assay
Cells we e seeded on o collagen memb anes a a densi y o 1
×
10
4
cells/mL, in a
24-well pla e unde he cul u e condi ions desc ibed abo e. A e 48 h, cell p oli e a ion was
analysed using he 3-(4,5-dime hyl hiazol-2-yl)-2,5-diphenyl e azolium (MTT) assay. In
his assay DMEM medium is eplaced by DMEM wi hou phenol ed wi h MTT 0.5 mg/mL
(Sigma, S . Louis, MO, USA), incuba ed o 4 h, a e which insoluble o mazan c ys als
om he cell educ ion o MTT a e dissol ed by he addi ion o dime hyl sul oxide (Me ck
Biosciences, Da ms ad , Ge many), and a spec opho ome e (Sun ise, Tecan, Männedo ,
Swi ze land) was used o ead he abso bance a 570 nm [
30
]. The expe imen s we e un
in iplica e.
2.4. RNA Ex ac ion and Real-Time Quan i a i e Polyme ase Chain Reac ion (RT-qPCR)
RNA om os eoblas ic cells was ex ac ed a e 48 h o cul u e using he Qiagen
RNeasy ex ac ion ki (Qiagen Inc., Hilden, Ge many), and a UV spec opho ome e a
260 nm (Eppendo AG, Hambu g, Ge many) was used o measu e he amoun o mRNA.
An amoun o 1
µ
g o mRNA was ob ained o each o he examples and b ough o
40
µ
L olume, a e which i was e e se ansc ibed in o cDNA o be ampli ied using he
iSc ip TM ki (Bio-Rad Labo a o ies, He cules, CA, USA) by PCR echnique [
19
]. P ime 3-
design so wa e was hen used o design p ime s o de ec he mRNA o he ollowing genes:
bone mo phogene ic p o eins 2 and 7, alkaline phospha ase (ALP), bone mo phogene ic
p o eins 2 and 7 (BMP-2 and BMP-7), ype I collagen (Col-I), os e ix (OSX), os eocalcin
(OSC), os eop o ege in (OPG), ecep o o RANK (RANKL), un - ela ed ansc ip ion
ac o 2 (Runx-2), TGF-
β
1 and TGF-
β
ecep o s (TGF-
β
R1, TGF-
β
R2, and TGF-
β
R3), and
ascula endo helial g ow h ac o (VEGF). Pep idylp olyl isome ase A (PPIA), ubiqui in C
(UBC) and ibosomal p o ein S13 (RPS13) we e used as housekeeping genes o no malize
he esul s [31,32]. The p ime sequences a e included in Table 1.
Biomime ics 2024,9, 4 4 o 18
Table 1. Sense and an isense p ime sequences o eal- ime qPCR.
Gene Sense P ime (5′–3′) An isense P ime
ALP CCAACGTGGCTAAGAATGTCATC TGGGCATTGGTGTTGTACGTC
BMP-2 TCGAAATTCCCCGTGACCAG CCACTTCCACCACGAATCCA
BMP-7 CTGGTCTTTGTCTGCAGTGG GTACCCCTCAACAAGGCTTC
Col-1 AGAACTGGTACATCAGCAAG GAGTTTACAGGAAGCAGACA
OSX TGCCTAGAAGCCCTGAGAAA TTTAACTTGGGGCCTTGAGA
OPG ATGCAACACAGCACAACATA GTTGCCGTTTTATCCTCTCT
OSC CCATGAGAGCCCTCACACTCC GGTCAGCCAACTCGTCACAGTC
RANKL ATACCCTGATGAAAGGAGGA GGGGCTCAATCTATATCTCG
Runx-2 TGGTTAATCTCCGCAGGTCAC ACTGTGCTGAAGAGGCTGTTTG
TGFβ1 TGAACCGGCCTTTCCTGCTTCTCATG GCGGAAGTCAATGTACAGCTGCCGC
TGFβ-R1 ACTGGCAGCTGTCATTGCTGGACCAG CTGAGCCAGAACCTGACGTTGTCATATCA
TGFβ-R2 GGCTCAACCACCAGGGCATCCAGAT CTCCCCGAGAGCCTGTCCAGATGCT
TGFβ-R3 ACCGTGATGGGCATTGCGTTTGCA GTGCTCTGCGTGCTGCCGA TGCTGT
VEGF CCTTGCTGCTCTACCTCCAC CACACAGGATGGCTTGAAGA
UBC TGGGATGCAAATCTTCGTGAAGACCCTGAC ACCAAGTGCAGAGTGGACTCTTTCTGGATG
PPIA CCATGGCAAATGCTGGACCCAACACAAATG TCCTGAGCTACAGAAGGAATGATCTGGTGG
RPS13 GGTGTTGCACAAGTACGTTTTGTGACAGGC TCATATTTCCAATTGGGAGGGAGGACTCGC
SsoFas
TM
E aG een
®
Supe mix ki (Bio-Rad Labo a o ies, He cules, CA, USA) was
used o RT-qPCR. A o al o 5
µ
L o cDNA was ob ained o each sample and pla ed in
96-well pla es o ampli ica ion using a he mal cycle (IQ5-Cycle , Bio-Rad Labo a o ies,
He cules, CA, USA). Tempe a u es we e se a 60–65
◦
C and 72
◦
C o annealing and
elonga ion, espec i ely, o mo e han 40 cycles. A s anda d cu e o he a ge genes was
ob ained by plo ing C alues agains log cDNA dilu ion. This was ollowed by aga ose
gel elec opho esis o c ea e a mel ing p o ile. The p opo ion o ng o mRNA pe a e age
ng o housekeeping mRNA was calcula ed. The expe imen s we e un in iplica e.
2.5. Nodules Fo ma ion and Ma ix Mine aliza ion
Aliza in Red S echnique was applied o de ec calcium deposi s in he cell ma ix [
33
].
Os eoblas s we e seeded a a densi y o 5
×
10
4
cells/mL pe well on collagen memb anes
and cul u ed in os eogenic medium (DMEM wi hou gen amicin and penicillin supple-
men ed wi h 5 mM
β
-glyce ophospha e and 0.05 mM asco bic acid) wi h 400
µ
g/mL
amoxicillin o 150
µ
g/mL clindamycin. Ma ix mine aliza ion analysis was ca ied ou a
15 and 21 d o cul u e, cap u ing digi al images o he s aining. Ce ylpy idinium chlo ide
10% (w/ ) was used o 15 min o dissol e he ed calcium deposi s. Finally, he abso bance
o he ex ac ed s ain was measu ed wi h a spec opho ome e a 562 nm (Bio ek EL×800)
2.6. Scanning Elec on Mic oscopy (SEM)
A e os eoblas s we e cul u ed on memb ane disks in a 24-well pla e a a densi y
o
1×104cells/mL
o 48 h, hese memb anes we e subjec ed o c i ical poin d ying
a e ixa ion and hen co e ed wi h ca bon o e alua e cell mo phology wi h a ield
emission scanning elec on mic oscope (FESEM) (GEMINI, Ca l Zeiss SMT, Obe kochen,
Ge many) [34].
2.7. S a is ical Analysis
No mali y was es ed using he Kolmogo o –Smi no es , a e which compa isons
be ween expe imen al g oups we e made using he one-way ANOVA es o a iables
Biomime ics 2024,9, 4 5 o 18
ollowing a no mal dis ibu ion o by K uskal–Wallis. The Bon e oni pos hoc es was hen
applied o mul iple compa isons. Da a we e exp essed as mean and s anda d de ia ion,
wi h signi icance se a p< 0.05.
3. Resul s
3.1. Cell P oli e a ion Assay
The a ained mean and s anda d de ia ions o he os eoblas ic cell p oli e a ion in
he MTT assay a e p esen ed in Figu e 1. When he os eoblas s we e ea ed wi h 50
µ
M
zoled ona e (which is epo ed as a he apeu ic dose [
18
,
19
,
24
]) in he undoped (Col-M)
g oup, a signi ican dec ease in cell p oli e a ion o abou 65% (p< 0.001) was obse ed
i compa ed o un ea ed cells. When os eoblas s we e ea ed wi h zoled ona e 50
µ
M
and g own on he GG-M g oup, p oli e a ion was wo- old highe i compa ed o he
undoped memb anes (p< 0.001). In he absence o zoled ona e, no di e ence was ound in
p oli e a ion be ween he con ol (Col-M) and he GG-M g oups (p> 0.05).
Biomime ics 2024, 9, x FOR PEER REVIEW 5 o 18
2.7. S a is ical Analysis
No mali y was es ed using he Kolmogo o –Smi no es , a e which compa isons
be ween expe imen al g oups we e made using he one-way ANOVA es o a iables
ollowing a no mal dis ibu ion o by K uskal–Wallis. The Bon e oni pos hoc es was
hen applied o mul iple compa isons. Da a we e exp essed as mean and s anda d
de ia ion, wi h signi icance se a p < 0.05.
3. Resul s
3.1. Cell P oli e a ion Assay
The a ained mean and s anda d de ia ions o he os eoblas ic cell p oli e a ion in he
MTT assay a e p esen ed in Figu e 1. When he os eoblas s we e ea ed wi h 50 µM
zoled ona e (which is epo ed as a he apeu ic dose [18,19,24]) in he undoped (Col-M)
g oup, a signi ican dec ease in cell p oli e a ion o abou 65% (p < 0.001) was obse ed i
compa ed o un ea ed cells. When os eoblas s we e ea ed wi h zoled ona e 50 µM and
g own on he GG-M g oup, p oli e a ion was wo- old highe i compa ed o he undoped
memb anes (p < 0.001). In he absence o zoled ona e, no diffe ence was ound in
p oli e a ion be ween he con ol (Col-M) and he GG-M g oups (p > 0.05).
Figu e 1. Os eoblas p oli e a ion a e 48 h o cul u e on o he diffe en doped memb anes. Da a
a e exp essed as mean and s anda d de ia ion. Signi ican diffe ences a e indica ed by diffe en
le e s a e mul iple compa isons (p < 0.05).
3.2. Real-Time Quan i a i e Polyme ase Chain Reac ion
3.2.1. Gene exp ession o TGF-β1 and i s ecep o s (TGF-β R1, TGF-β R2, and TGF-β R3)
Figu e 2 displays RT-qPCR esul s o he gene exp ession o TGF-β1 and i s ecep o s
(TGF-β R1, TGF-β R2, and TGF-β R3). A signi ican dec ease (p < 0.001) o abou 70% was
obse ed in he exp ession o TGF-β1, TGF-βR1, TGF-βR2, and TGF-βR3 when os eoblas s
we e ea ed wi h 50 µM zoled ona e in he Col-M g oup i compa ed o un ea ed cells.
Howe e , hese dec eases in gene exp ession we e no ound when os eoblas s we e
ea ed wi h 50 µM zoled ona e and a e being cul u ed on he Ge anyl-ge aniol-doped
memb anes.
Figu e 1. Os eoblas p oli e a ion a e 48 h o cul u e on o he di e en doped memb anes. Da a a e
exp essed as mean and s anda d de ia ion. Signi ican di e ences a e indica ed by di e en le e s
a e mul iple compa isons (p< 0.05).
3.2. Real-Time Quan i a i e Polyme ase Chain Reac ion
3.2.1. Gene Exp ession o TGF-
β
1 and I s Recep o s (TGF-
β
R1, TGF-
β
R2, and TGF-
β
R3)
Figu e 2displays RT-qPCR esul s o he gene exp ession o TGF-
β
1 and i s ecep o s
(TGF-
β
R1, TGF-
β
R2, and TGF-
β
R3). A signi ican dec ease (p< 0.001) o abou 70%
was obse ed in he exp ession o TGF-
β
1, TGF-
β
R1, TGF-
β
R2, and TGF-
β
R3 when os-
eoblas s we e ea ed wi h 50
µ
M zoled ona e in he Col-M g oup i compa ed o un ea ed
cells. Howe e , hese dec eases in gene exp ession we e no ound when os eoblas s we e
ea ed wi h 50
µ
M zoled ona e and a e being cul u ed on he Ge anyl-ge aniol-doped
memb anes.

Biomime ics 2024,9, 4 6 o 18
Biomime ics 2024, 9, x FOR PEER REVIEW 6 o 18
Figu e 2. Gene exp ession analysis o TGF-β1, TGF-βR1, TGF-βR2 and TGF-βR3 by eal- ime PCR
o os eoblas s seeded on o he diffe en expe imen al memb anes a e 48 h o cul u e. Mean and
s anda d de ia ion o ng mRNA/ngHK is p esen ed o each expe imen al g oup. Signi ican
diffe ences a e indica ed by diffe en le e s, a e mul iple compa isons (p < 0.05).
3.2.2. Gene exp ession o OPG-RANKL complex
Figu e 3 depic s he RT-qPCR esul s o he gene exp ession o RANKL, OPG and
he OPG/RANKL a io. Zolend ona e- ea ed os eoblas s in he Col-M showed abou an
eigh - old (p < 0.001) dec ease in he exp ession o RANKL, and a signi ican inc ease (p <
0.05) o abou 30% in he exp ession o OPG compa ed o he un ea ed cells. Howe e ,
his inc ease in OPG gene exp ession did no occu when os eoblas s we e ea ed wi h 50
µM zoled ona e in he Ge anyl-ge aniol (GG-M) g oup. Os eoblas s seeded on o he GG-
M wi hou zoled ona e ea men also showed a signi ican dec ease o abou 75% in
RANKL gene exp ession (p < 0.001). When conside ing he OPG/RANKL a io, he
addi ion o zoled ona e up- egula es he a io abou 30 imes in os eoblas s seeded on Col-
M, i compa ed o he con ol g oup (p < 0.001). When zoled ona e- ea ed os eoblas s
we e cul u ed on he GGOH-doped memb ane, OPG/RANKL alues we e simila o hose
o he con ol g oup (p > 0.05). Non- ea ed cells cul u ed on GGOH-doped memb anes
a ained lowe OPG/RANKL a io alues han he con ol (abou 1.5 lowe ) (p = 0.03).
Figu e 2. Gene exp ession analysis o TGF-
β
1, TGF-
β
R1, TGF-
β
R2 and TGF-
β
R3 by eal- ime
PCR o os eoblas s seeded on o he di e en expe imen al memb anes a e 48 h o cul u e. Mean
and s anda d de ia ion o ng mRNA/ngHK is p esen ed o each expe imen al g oup. Signi ican
di e ences a e indica ed by di e en le e s, a e mul iple compa isons (p< 0.05).
3.2.2. Gene Exp ession o OPG-RANKL Complex
Figu e 3depic s he RT-qPCR esul s o he gene exp ession o RANKL, OPG and
he OPG/RANKL a io. Zolend ona e- ea ed os eoblas s in he Col-M showed abou
an eigh - old (
p< 0.001
) dec ease in he exp ession o RANKL, and a signi ican inc ease
(
p< 0.05
) o abou 30% in he exp ession o OPG compa ed o he un ea ed cells. Howe e ,
his inc ease in OPG gene exp ession did no occu when os eoblas s we e ea ed wi h
50
µ
M zoled ona e in he Ge anyl-ge aniol (GG-M) g oup. Os eoblas s seeded on o he
GG-M wi hou zoled ona e ea men also showed a signi ican dec ease o abou 75%
in RANKL gene exp ession (
p< 0.001
). When conside ing he OPG/RANKL a io, he
addi ion o zoled ona e up- egula es he a io abou 30 imes in os eoblas s seeded on
Col-M, i compa ed o he con ol g oup (p< 0.001). When zoled ona e- ea ed os eoblas s
we e cul u ed on he GGOH-doped memb ane, OPG/RANKL alues we e simila o hose
o he con ol g oup (p> 0.05). Non- ea ed cells cul u ed on GGOH-doped memb anes
a ained lowe OPG/RANKL a io alues han he con ol (abou 1.5 lowe ) (p= 0.03).
Biomime ics 2024,9, 4 7 o 18
Biomime ics 2024, 9, x FOR PEER REVIEW 7 o 18
Figu e 3. Gene exp ession analysis o RANKL, OPG and OPG/RANKL by eal- ime PCR o
os eoblas s seeded on o he diffe en expe imen al memb anes a e 48 h o cul u e. Mean and
s anda d de ia ion o ng mRNA/ngHK is p esen ed o each expe imen al g oup. Signi ican
diffe ences a e indica ed by diffe en le e s, a e mul iple compa isons (p < 0.05).
3.2.3. Effec o BPs on he gene exp ession o Runx2, ALP, Col-I, OSX, and OSC
The RT-qPCR esul s o he exp ession o os eoblas diffe en ia ion ma ke s Runx2,
ALP, Col-I, OSX, and OSC a e displayed in Figu e 4. In gene al, ea men o os eoblas s
wi h 50 µM zoled ona e in he Col-M a ained a signi ican dec ease in he exp ession o
diffe en ia ion ma ke s compa ed o he un ea ed cells. Abou a 2.5- old dec ease in he
exp ession o Runx2, ALP, and OSX, a 1- old dec ease in he exp ession o COL-I, and a
3.5- old dec ease in he exp ession o OSC we e encoun e ed. When zoled ona e- ea ed
os eoblas s we e cul u ed in he GG-M, dec eases in gene exp ession we e no obse ed,
Figu e 3. Gene exp ession analysis o RANKL, OPG and OPG/RANKL by eal- ime PCR o
os eoblas s seeded on o he di e en expe imen al memb anes a e 48 h o cul u e. Mean and
s anda d de ia ion o ng mRNA/ngHK is p esen ed o each expe imen al g oup. Signi ican
di e ences a e indica ed by di e en le e s, a e mul iple compa isons (p< 0.05).
3.2.3. E ec o BPs on he Gene Exp ession o Runx2, ALP, Col-I, OSX, and OSC
The RT-qPCR esul s o he exp ession o os eoblas di e en ia ion ma ke s Runx2,
ALP, Col-I, OSX, and OSC a e displayed in Figu e 4. In gene al, ea men o os eoblas s
Biomime ics 2024,9, 4 8 o 18
wi h 50
µ
M zoled ona e in he Col-M a ained a signi ican dec ease in he exp ession
o di e en ia ion ma ke s compa ed o he un ea ed cells. Abou a 2.5- old dec ease in
he exp ession o Runx2, ALP, and OSX, a 1- old dec ease in he exp ession o COL-I,
and a 3.5- old dec ease in he exp ession o OSC we e encoun e ed. When zoled ona e-
ea ed os eoblas s we e cul u ed in he GG-M, dec eases in gene exp ession we e no
obse ed, i compa ed o he con ol g oup. The exp ession o OSX was signi ican ly up-
egula ed (abou 50%; p< 0.001) when os eoblas s we e seeded on o he GG-M, wi hou
zoled ona e ea men .
Biomime ics 2024, 9, x FOR PEER REVIEW 8 o 18
i compa ed o he con ol g oup. The exp ession o OSX was signi ican ly up- egula ed
(abou 50%; p < 0.001) when os eoblas s we e seeded on o he GG-M, wi hou zoled ona e
ea men .
Figu e 4. Gene exp ession analysis o OSX, COL-I, ALP, RUNX-2, and OSC by eal- ime PCR o
os eoblas s seeded on o he diffe en expe imen al memb anes a e 48 h o cul u e. Mean and
s anda d de ia ion o ng mRNA/ngHK is p esen ed o each expe imen al g oup. Signi ican
diffe ences a e indica ed by diffe en le e s, a e mul iple compa isons (p < 0.05).
3.2.4. Gene exp ession o BMP-2, BMP-7, and VEGF
The RT-qPCR esul s o he gene exp ession o BMP-2, BMP-7, and VEGF a e
epo ed in he Figu e 5. The ea men o os eoblas s wi h zoled ona e in he Col-M
p oduced a signi ican dec ease o abou 60% in he exp ession o BMP-2 (p < 0.05) and
abou 75% in he exp ession o BMP-7 (p < 0.001), i compa ed o he un ea ed cells. When
zoled ona e- ea ed os eoblas s we e seeded on he GG-M, he a ained alues o he gene
exp ession o BMP-2, BMP-7, and VEGF we e simila o hose o he con ol g oup. The
exp ession o VEGF was signi ican ly up- egula ed when os eoblas s we e seeded on o
GG-M memb anes, a aining a 3- old inc ease. When non- ea ed os eoblas s we e
cul u ed on GG-M, a 1- old inc ease was p oduced.
Figu e 4. Gene exp ession analysis o OSX, COL-I, ALP, RUNX-2, and OSC by eal- ime PCR o
os eoblas s seeded on o he di e en expe imen al memb anes a e 48 h o cul u e. Mean and
s anda d de ia ion o ng mRNA/ngHK is p esen ed o each expe imen al g oup. Signi ican
di e ences a e indica ed by di e en le e s, a e mul iple compa isons (p< 0.05).
3.2.4. Gene Exp ession o BMP-2, BMP-7, and VEGF
The RT-qPCR esul s o he gene exp ession o BMP-2, BMP-7, and VEGF a e epo ed
in he Figu e 5. The ea men o os eoblas s wi h zoled ona e in he Col-M p oduced a
signi ican dec ease o abou 60% in he exp ession o BMP-2 (p< 0.05) and abou 75% in
he exp ession o BMP-7 (p< 0.001), i compa ed o he un ea ed cells. When zoled ona e-
Biomime ics 2024,9, 4 9 o 18
ea ed os eoblas s we e seeded on he GG-M, he a ained alues o he gene exp ession
o BMP-2, BMP-7, and VEGF we e simila o hose o he con ol g oup. The exp ession o
VEGF was signi ican ly up- egula ed when os eoblas s we e seeded on o GG-M memb anes,
a aining a 3- old inc ease. When non- ea ed os eoblas s we e cul u ed on GG-M, a 1- old
inc ease was p oduced.
Biomime ics 2024, 9, x FOR PEER REVIEW 9 o 18
Figu e 5. Gene exp ession analysis o BMP-2, BMP-7, and VEGF by eal- ime PCR o os eoblas s
seeded on o he diffe en expe imen al memb anes a e 48 h o cul u e. Mean and s anda d
de ia ion o ng mRNA/ngHK is p esen ed. Signi ican diffe ences a e indica ed by diffe en le e s
a e mul iple compa isons (p < 0.05).
3.3. Nodules Fo ma ion and Ma ix Mine aliza ion
The Aliza in Red s aining esul s a e 15 and 21 d o cul u e in os eogenic medium
a e shown in Figu e 6. A signi ican dec ease o abou 25% in calcium deposi ion was
obse ed when os eoblas s we e ea ed wi h zoled ona e and cul u ed on he undoped
Col-M, i compa ed o un ea ed cells a e 15 d o cul u e (p < 0.001), and a dec ease o
abou 55% a e 21 d (p < 0.001). Jus sligh dec eases in calcium deposi ion we e obse ed
o zoled ona e- ea ed os eoblas s in he ge anylge aniol-doped memb anes a e 15 d,
and a e 21 d, no diffe ences we e ound i compa ed o he con ol g oup.
Figu e 5. Gene exp ession analysis o BMP-2, BMP-7, and VEGF by eal- ime PCR o os eoblas s
seeded on o he di e en expe imen al memb anes a e 48 h o cul u e. Mean and s anda d de ia ion
o ng mRNA/ngHK is p esen ed. Signi ican di e ences a e indica ed by di e en le e s a e
mul iple compa isons (p< 0.05).
3.3. Nodules Fo ma ion and Ma ix Mine aliza ion
The Aliza in Red s aining esul s a e 15 and 21 d o cul u e in os eogenic medium
a e shown in Figu e 6. A signi ican dec ease o abou 25% in calcium deposi ion was
obse ed when os eoblas s we e ea ed wi h zoled ona e and cul u ed on he undoped
Col-M, i compa ed o un ea ed cells a e 15 d o cul u e (p< 0.001), and a dec ease o
abou 55% a e 21 d (p< 0.001). Jus sligh dec eases in calcium deposi ion we e obse ed
o zoled ona e- ea ed os eoblas s in he ge anylge aniol-doped memb anes a e 15 d,
and a e 21 d, no di e ences we e ound i compa ed o he con ol g oup.
Biomime ics 2024,9, 4 16 o 18
8.
Toledano-Oso io, M.; de Luna-Be os, E.; Toledano, M.; Manzano-Mo eno, F.J.; Ga cía-Recio, E.; Ruiz, C.; Oso io, R.; Sanz, M.
Doxycycline-Doped Collagen Memb anes Accele a e in Vi o Os eoblas P oli e a ion and Di e en ia ion. J. Pe iodon al Res. 2023,
58, 296–307. [C ossRe ]
9.
Toledano-Oso io, M.; Vallecillo, C.; Vallecillo-Ri as, M.; Manzano-Mo eno, F.-J.; Oso io, R. An ibio ic-Loaded Polyme ic Ba ie
Memb anes o Guided Bone/Tissue Regene a ion: A Mini-Re iew. Polyme s 2022,14, 840. [C ossRe ]
10.
Lane, J.M.; Khan, S.N.; O’Conno , W.J.; Nydick, M.; Hommen, J.P.; Schneide , R.; Tomin, E.; B and, J.; Cu in, J. Bisphosphona e
The apy in Fib ous Dysplasia. Clin. O hop. Rela . Res. 2001,382, 6–12. [C ossRe ]
11.
Lala, R.; Ma a azzo, P.; Be elloni, S.; Buzi, F.; Rigon, F.; de Sanc is, C. Pamid ona e T ea men o Bone Fib ous Dysplasia in Nine
Child en wi h McCune-Alb igh Synd ome. Ac a Paedia . 2000,89, 188–193. [C ossRe ] [PubMed]
12. Rodan, G.A.; Ma in, T.J. The apeu ic App oaches o Bone Diseases. Science 2000,289, 1508–1514. [C ossRe ] [PubMed]
13.
Pa n i apong, S.; Singha anadgi , W.; Chan uang ani , C.; La an a anakul, K.; Sa a aha, Y. Zoled onic Acid Supp esses
Mine aliza ion h ough Di ec Cy o oxici y and Os eoblas Di e en ia ion Inhibi ion. J. O al. Pa hol. Med. 2012,41, 713–720.
[C ossRe ] [PubMed]
14.
Reszka, A.A.; Rodan, G.A. Ni ogen-Con aining Bisphosphona e Mechanism o Ac ion. Mini Re . Med. Chem. 2004,4, 711–719.
[PubMed]
15.
Russell, R.G.G. Bisphosphona es: Mode o Ac ion and Pha macology. Pedia ics 2007,119 (Suppl. S2), S150–S162. [C ossRe ]
[PubMed]
16.
Sil e man, S.L.; Ma icic, M. Recen De elopmen s in Bisphosphona e The apy. Semin. A h i is Rheum. 2007,37, 1–12. [C ossRe ]
17.
Manzano-Mo eno, F.J.; Ramos-To ecillas, J.; De Luna-Be os, E.; Ruiz, C.; Ga cía-Ma ínez, O. High Doses o Bisphosphona es
Reduce Os eoblas -like Cell P oli e a ion by A es ing he Cell Cycle and Inducing Apop osis. J. C anio-Maxillo ac. Su g. 2015,43,
396–401. [C ossRe ]
18.
Manzano-Mo eno, F.J.; Ramos-To ecillas, J.; De Luna-Be os, E.; Reyes-Bo ella, C.; Ruiz, C.; Ga cía-Ma ínez, O. Ni ogen-
Con aining Bisphosphona es Modula e he An igenic P o ile and Inhibi he Ma u a ion and Biomine aliza ion Po en ial o
Os eoblas -like Cells. Clin. O al. In es ig. 2015,19, 895–902. [C ossRe ]
19.
Manzano-Mo eno, F.J.; Ramos-To ecillas, J.; Melguizo-Rod íguez, L.; Illescas-Mon es, R.; Ruiz, C.; Ga cía-Ma ínez, O. Bisphos-
phona e Modula ion o he Gene Exp ession o Di e en Ma ke s In ol ed in Os eoblas Physiology: Possible Implica ions in
Bisphosphona e-Rela ed Os eonec osis o he Jaw. In . J. Med. Sci. 2018,15, 359–367. [C ossRe ]
20.
Ma x, R.E. Pamid ona e (A edia) and Zoled ona e (Zome a) Induced A ascula Nec osis o he Jaws: A G owing Epidemic.
J. O al. Maxillo ac. Su g. 2003,61, 1115–1117. [C ossRe ]
21.
Ruggie o, S.L.; Meh o a, B.; Rosenbe g, T.J.; Eng o , S.L. Os eonec osis o he Jaws Associa ed wi h he Use o Bisphosphona es:
A Re iew o 63 Cases. J. O al. Maxillo ac. Su g. 2004,62, 527–534. [C ossRe ] [PubMed]
22. Melche , A.H. On he Repai Po en ial o Pe iodon al Tissues. J. Pe iodon ol. 1976,47, 256–260. [C ossRe ] [PubMed]
23.
Sanz, M.; Dahlin, C.; Apa zidou, D.; A zi, Z.; Bozic, D.; Calciola i, E.; De B uyn, H.; Dommisch, H.; Donos, N.; Eickholz, P.; e al.
Bioma e ials and Regene a i e Technologies Used in Bone Regene a ion in he C aniomaxillo acial Region: Consensus Repo o
G oup 2 o he 15 h Eu opean Wo kshop on Pe iodon ology on Bone Regene a ion. J. Clin. Pe iodon ol. 2019,46 (Suppl. S21),
82–91. [C ossRe ] [PubMed]
24.
O o, M.; Lux, C.; Schli enbaue , T.; Halling, F.; Zieba , T. Ge anyl-Ge aniol Addi ion A ec s Po ency o Bisphosphona es-a
Compa ison in Vi o P omising a The apeu ic App oach o Bisphosphona e-Associa ed Os eonec osis o he Jaw and O al
Wound Healing. O al. Maxillo ac. Su g. 2022,26, 321–332. [C ossRe ]
25.
Pa n i apong, S.; Chan uang ani , C.; La an a anakul, K.; Sa a aha, Y. Assessmen o Bisphosphona e T ea ed-Os eoblas
Beha io s by Con en ional Assays and a Simple Digi al Image Analysis. Ac a His ochem. 2021,123, 151659. [C ossRe ]
26.
Tha o nyu ika n, B.; Sungkhaphan, P.; Kaewkong, P.; Po nsuwan, S.; Risangud, N.; Singha anadgi , W.; Jan ikul, W. Biodeg ad-
able Dual-Func ion Nanocomposi e Hyd ogels o P e en ion o Bisphosphona e-Rela ed Os eonec osis o he Jaw. ACS Appl. Bio
Ma e . 2023,6, 1658–1675. [C ossRe ]
27.
PubChem Ge anylge aniol. A ailable online: h ps://pubchem.ncbi.nlm.nih.go /compound/5281365 (accessed on 31 May
2023).
28.
La i i, L.; Soh abnezhad, S.H.; Hada i, M. Mesopo ous Silica as a Suppo o Poo ly Soluble D ug: In luence o pH and Amino
G oup on he D ug Release. Mic opo ous Mesopo ous Ma e . 2017,250, 148–157. [C ossRe ]
29.
Manzano-Mo eno, F.J.; Ramos-To ecillas, J.; De Luna-Be os, E.; Reyes-Bo ella, C.; Ga cía-Ma ínez, O.; Ruiz, C. E ec o
Clod ona e on An igenic P o ile, G ow h, and Di e en ia ion o Os eoblas -Like Cells. J. O al. Maxillo ac. Su g. 2016,74,
1765–1770. [C ossRe ]
30.
Manzano-Mo eno, F.J.; Rod íguez-Ma ínez, J.B.; Ramos-To ecillas, J.; Vallecillo-Capilla, M.F.; Ruiz, C.; Ga cía-Ma ínez, O.;
Reyes-Bo ella, C. P oli e a ion and Os eogenic Di e en ia ion o Os eoblas -like Cells Ob ained om Two Techniques o
Ha es ing In ao al Bone G a s. Clin. O al. In es ig. 2013,17, 1349–1356. [C ossRe ]
31.
Vandesompele, J.; De P e e , K.; Pa yn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accu a e No maliza ion o Real-Time
Quan i a i e RT-PCR Da a by Geome ic A e aging o Mul iple In e nal Con ol Genes. Genome Biol. 2002,3, esea ch0034.1.
[C ossRe ]

Biomime ics 2024,9, 4 17 o 18
32.
Ragni, E.; Viganò, M.; Rebulla, P.; Gio dano, R.; Lazza i, L. Wha Is beyond a qRT-PCR S udy on Mesenchymal S em Cell
Di e en ia ion P ope ies: How o Choose he Mos Reliable Housekeeping Genes. J. Cell. Mol. Med. 2013,17, 168–180. [C ossRe ]
[PubMed]
33.
Sand ini, E.; Mo is, C.; Chiesa, R.; Cigada, A.; San in, M. In Vi o Assessmen o he Os eoin eg a i e Po en ial o a No el
Mul iphase Anodic Spa k Deposi ion Coa ing o O hopaedic and Den al Implan s. J. Biomed. Ma e . Res. Pa B Appl. Bioma e .
2005,73, 392–399. [C ossRe ] [PubMed]
34.
Toledano-Oso io, M.; Manzano-Mo eno, F.J.; Toledano, M.; Oso io, R.; Medina-Cas illo, A.L.; Cos ela-Ruiz, V.J.; Ruiz, C.
Doxycycline-Doped Memb anes Induced Os eogenic Gene Exp ession on Os eoblas ic Cells. J. Den . 2021,109, 103676. [C ossRe ]
[PubMed]
35.
Ro hamel, D.; Schwa z, F.; Fieni z, T.; Smee s, R.; D eiseidle , T.; Ri e , L.; Happe, A.; Zölle , J. Biocompa ibili y and Biodeg ada ion
o a Na i e Po cine Pe ica dium Memb ane: Resul s o in Vi o and in Vi o Examina ions. In . J. O al. Maxillo ac. Implan . 2012,
27, 146–154.
36.
B aga-Vilela, A.S.; Pimen el, E.R.; Ma angoni, S.; Toyama, M.H.; de Campos Vidal, B. Ex acellula Ma ix o Po cine Pe ica dium:
Biochemis y and Collagen A chi ec u e. J. Memb . Biol. 2008,221, 15–25. [C ossRe ]
37.
Ng, H.W.; Zhang, Y.; Na a, R.; P abaka , S. Moni o ing he Deg ada ion o Collagen Hyd ogels by Collagenase Clos idium
His oly icum. Gels 2020,6, 46. [C ossRe ]
38.
Toledano-Oso io, M.; Manzano-Mo eno, F.J.; Ruiz, C.; Toledano, M.; Oso io, R. Tes ing Ac i e Memb anes o Bone Regene a ion:
A Re iew. J. Den . 2021,105, 103580. [C ossRe ]
39.
Czekanska, E.M.; S odda , M.J.; Richa ds, R.G.; Hayes, J.S. In Sea ch o an Os eoblas Cell Model o in Vi o Resea ch. Eu . Cell
Ma e . 2012,24, 1–17. [C ossRe ]
40. Boyce, B.F.; Xing, L. The RANKL/RANK/OPG Pa hway. Cu . Os eopo os. Rep. 2007,5, 98–104. [C ossRe ]
41.
Schmid , C.; Kaspa , D.; Sa ka , M.R.; Claes, L.E.; Igna ius, A.A. A Scanning Elec on Mic oscopy S udy o Human Os eoblas
Mo phology on Fi e O hopedic Me als. J. Biomed. Ma e . Res. 2002,63, 252–261. [C ossRe ]
42.
Za a , S.; Coa es, D.E.; Cullinan, M.P.; D ummond, B.K.; Milne, T.; Seymou , G.J. E ec s o Zoled onic Acid and Ge anylge aniol
on he Cellula Beha iou and Gene Exp ession o P ima y Human Al eola Os eoblas s. Clin. O al. In es ig. 2016,20, 2023–2035.
[C ossRe ] [PubMed]
43.
Chin, K.-Y.; Ekeuku, S.O.; T ias, A. The Role o Ge anylge aniol in Managing Bisphosphona e-Rela ed Os eonec osis o he Jaw.
F on . Pha macol. 2022,13, 878556. [C ossRe ] [PubMed]
44.
Shen, B.; Wei, A.; Whi ake , S.; Williams, L.A.; Tao, H.; Ma, D.D.F.; Diwan, A.D. The Role o BMP-7 in Chond ogenic and
Os eogenic Di e en ia ion o Human Bone Ma ow Mul ipo en Mesenchymal S omal Cells in Vi o. J. Cell. Biochem. 2010,109,
406–416. [C ossRe ] [PubMed]
45.
Xiao, G.; Jiang, D.; Gopalak ishnan, R.; F anceschi, R.T. Fib oblas G ow h Fac o 2 Induc ion o he Os eocalcin Gene Requi es
MAPK Ac i i y and Phospho yla ion o he Os eoblas T ansc ip ion Fac o , Cb a1/Runx2. J. Biol. Chem. 2002,277, 36181–36187.
[C ossRe ]
46. Po al-Núñez, S.; Lozano, D.; Esb i , P. Role o Angiogenesis on Bone Fo ma ion. His ol. His opa hol. 2012,27, 559–566.
47.
S ee , J.; Lenehan, B. Vascula Endo helial G ow h Fac o Regula es Os eoblas Su i al—E idence o an Au oc ine Feedback
Mechanism. J. O hop. Su g. Res. 2009,4, 19. [C ossRe ]
48.
Ho ne , A.; Bo d, S.; Kelsall, A.W.; Coleman, N.; Comps on, J.E. Tie2 Ligands Angiopoie in-1 and Angiopoie in-2 A e Coexp essed
wi h Vascula Endo helial Cell G ow h Fac o in G owing Human Bone. Bone 2001,28, 65–71. [C ossRe ]
49.
Saadeh, P.B.; Meh a a, B.J.; S einb ech, D.S.; Dudziak, M.E.; G eenwald, J.A.; Luchs, J.S.; Spec o , J.A.; Ueno, H.; Gi es,
G.K.; Longake , M.T. T ans o ming G ow h Fac o -Be a1 Modula es he Exp ession o Vascula Endo helial G ow h Fac o by
Os eoblas s. Am. J. Physiol. 1999,277, C628–C637. [C ossRe ]
50.
E ans, K.D.; Obe baue , A.M. Alend ona e Inhibi s VEGF Exp ession in G ow h Pla e Chond ocy es by Ac ing on he Me alona e
Pa hway. Open O hop. J. 2009,3, 83–88. [C ossRe ]
51.
Jia, J.; Yao, W.; Amugongo, S.; Shahnaza i, M.; Dai, W.; Lay, Y.-A.E.; Ol e a, D.; Zimme mann, E.A.; Ri chie, R.O.; Li, C.-S.;
e al. P olonged Alend ona e T ea men P e en s he Decline in Se um TGF-B1 Le els and Reduces Co ical Bone S eng h in
Long-Te m Es ogen De iciency Ra Model. Bone 2013,52, 424–432. [C ossRe ]
52.
Sims, N.A.; V ahnas, C. Regula ion o Co ical and T abecula Bone Mass by Communica ion be ween Os eoblas s, Os eocy es
and Os eoclas s. A ch. Biochem. Biophys. 2014,561C, 22–28. [C ossRe ] [PubMed]
53. Li, X.; Cao, X. BMP Signaling and Skele ogenesis. Ann. N. Y. Acad. Sci. 2006,1068, 26–40. [C ossRe ] [PubMed]
54.
Gu, K.; Zhang, L.; Jin, T.; Ru he o d, R.B. Iden i ica ion o Po en ial Modi ie s o Runx2/Cb a1 Ac i i y in C2C12 Cells in
Response o Bone Mo phogene ic P o ein-7. Cells Tissues O gans (P in ) 2004,176, 28–40. [C ossRe ] [PubMed]
55.
Ho, H.-J.; Shi akawa, H.; Gi iwono, P.E.; I o, A.; Komai, M. A No el Func ion o Ge anylge aniol in Regula ing Tes os e one
P oduc ion. Biosci. Bio echnol. Biochem. 2018,82, 956–962. [C ossRe ] [PubMed]
56.
Hi uma, Y.; Nakahama, K.; Fuji a, H.; Mo i a, I. Vi amin K2 and Ge anylge aniol, I s Side Chain Componen , Inhibi ed Os eoclas
Fo ma ion in a Di e en Manne . Biochem. Biophys. Res. Commun. 2004,314, 24–30. [C ossRe ] [PubMed]
57.
an Beek, E.; Pie e man, E.; Cohen, L.; Löwik, C.; Papapoulos, S. Fa nesyl Py ophospha e Syn hase Is he Molecula Ta ge o
Ni ogen-Con aining Bisphosphona es. Biochem. Biophys. Res. Commun. 1999,264, 108–111. [C ossRe ] [PubMed]
Biomime ics 2024,9, 4 18 o 18
58.
Fishe , J.E.; Roge s, M.J.; Halasy, J.M.; Luckman, S.P.; Hughes, D.E.; Masa achia, P.J.; Wesolowski, G.; Russell, R.G.; Rodan,
G.A.; Reszka, A.A. Alend ona e Mechanism o Ac ion: Ge anylge aniol, an In e media e in he Me alona e Pa hway, P e en s
Inhibi ion o Os eoclas Fo ma ion, Bone Reso p ion, and Kinase Ac i a ion in Vi o. P oc. Na l. Acad. Sci. USA 1999,96, 133–138.
[C ossRe ] [PubMed]
59.
Reszka, A.A.; Halasy-Nagy, J.M.; Masa achia, P.J.; Rodan, G.A. Bisphosphona es Ac Di ec ly on he Os eoclas o Induce Caspase
Clea age o Ms 1 Kinase du ing Apop osis. A Link be ween Inhibi ion o he Me alona e Pa hway and Regula ion o an
Apop osis-P omo ing Kinase. J. Biol. Chem. 1999,274, 34967–34973. [C ossRe ]
60.
Jawad, M.J.; Ib ahim, S.; Kuma , M.; Bu ge , C.; Li, W.-W.; Richa dson, A. Iden i ica ion o Foods Tha A ec he An i-Cance
Ac i i y o Pi a as a in in Cells. Oncol. Le . 2022,23, 73. [C ossRe ]
61.
Re zepi, M.; Donos, N. Guided Bone Regene a ion: Biological P inciple and The apeu ic Applica ions. Clin. O al. Implan . Res.
2010,21, 567–576. [C ossRe ]
62. Xie, Y.; Chu, Z.; Jin, W. Beyond Sepa a ion: Memb anes owa ds Medicine. J. Memb . Sci. Le . 2022,2, 100020. [C ossRe ]
Disclaime /Publishe ’s No e: The s a emen s, opinions and da a con ained in all publica ions a e solely hose o he indi idual
au ho (s) and con ibu o (s) and no o MDPI and/o he edi o (s). MDPI and/o he edi o (s) disclaim esponsibili y o any inju y o
people o p ope y esul ing om any ideas, me hods, ins uc ions o p oduc s e e ed o in he con en .