Iden i ica ion o subs a e p o eins o F sH
du ing spo ula ion o Bacillus sub ilis
Disse a ion
zu E langung des G ades eines
-Dok o s de Na u wissenscha en-
de Fakul ä ü Biologie, Chemie und Geowissenscha en
de Uni e si ä Bay eu h
o geleg on
Hue Bach Thi Nguyen
Bay eu h 2012
Die o liegende A bei wu de in de Zei on Dezembe 2007 bis Janua 2012 an de
Uni e si ä Bay eu h am Leh s uhl ü Gene ik un e de Be euung on P o . D .
Wol gang Schumann ange e ig .
Volls ändige Abd uck de on de Fakul ä ü Biologie, Chemie und
Geowissenscha en de Uni e si ä Bay eu h genehmig en Disse a ion zu E langung
des akademischen G ades eines Dok o s de Na u wissenscha en (D . e . na .)
P omo ionsgesuch einge eich am: 18.01.2012
Tag des wissenscha lichen Kolloquiums: 19.04.2012
E s gu ach e : P o . D . Wol gang Schumann
Zei gu ach e : P o . D . F anz-Xa e Schmid
D i gu ach e : PD. D . S e an Heidmann
Vo si zende : P o . D . Heike Feldhaa
ACKNOWLEDGEMENTS
I would like o hank o all people who ha e inspi ed and encou aged me du ing
my doc o al s udy.
Fi s o all, I would like o exp ess my deepes g a i ude o my supe iso P o . D .
Wol gang Schumann who augh me how o ques ion hough s and encou aged me o
exp ess my ideas. His insigh ul commen s and cons uc i e c i icisms du ing my g adua e
s udies helped me o o e come many di icul ies and inish his disse a ion. I am indeb ed
o him o his un lagging encou agemen and guidance.
I would like o hank o P o . D . Thomas Wiege o his scien i ic ad ice and
many conside able sugges ions and discussions.
I would also hank o P o . D . Ola S emmann, PD. D . S e an Heidmann and he
membe s o hei g oups o hei help and suppo . My special hanks go o Ma kus
He mann o helping me wi h using he machines in hei lab.
I would like o g a e ully and since ely hank PD. D . Bi gi Voig and P o . D .
Michael Hecke , Uni e si y o G ei swald, P o . D . Be nd Bukau and membe o his
g oup in Uni e si y o Heidelbe g o helping me wi h expe imen s. Especial hanks go o
PD. D . Axel Mogk wi h nume ous insigh ul commen s and consis en discussions.
I am also g a e ul o people in he Depa men o Gene ics, Uni e si y o Bay eu h,
o hei help since I a i ed a Bay eu h. In pa icula , I would like o hank Ka in
Ange mann, Ma gi Ba e a and Pe a Helies o hei assis ance and kindness. My since e
hanks go o Quynh Anh, Kelly, Ka ha ina o being my wonde ul colleagues and eal
iends. Special hanks o Anja Maie , an unde g adua e s uden , o he cons uc ion o
some plasmids used in las pa o my disse a ion.
I would like o acknowledge and hank P o . D . Gab iele Obe maie , D . A nim
Heinemann, M s. Daniela Kasel and M s. Helga Simpe o helping me wi h he inancial
suppo om Bay eu h Uni e si y women's ep esen a i e and Bay eu h In e na ional
O ice. My special hank o D . Nicodemus in Bay eu h Welcome Cen e o he suppo
and encou agemen in he las s age o my s udy.
I would like o be hank ul o all o my iends who ha e helped and encou aged
me o o e come se backs and s ay ocused on my s udy. My hea - el g a i ude goes o bé
Minh, Quỳnh Dung, Ngọc Anh, Phượng, Hồng Ánh, Lê Na, Loan, Hà, Hường, Sơn,
Quỳnh, anh Bình L.V, anh Hiếu C. X, chị Ái, chị T inh, anh Định, chị Hường, chị Tuyế ,
Cô Vẽ, chú Thanh, Cô Nhị, Chú Viễn, Saeedeh, Nebojsa, Johannes, Milene and Li ia, my
since e hanks o hem o gi ing me hei iendship, as deep and as ich as iendship can
be.
Las bu no leas , my deepes g a i ude goes o my amily: my b o he , my sis e s,
my nephews and nieces o hei un lagging lo e and encou agemen h oughou my li e.
I am o e e indeb ed o my pa en s who ha e sac i iced hei li es o me. This
disse a ion is dedica ed o hem o hei uncondi ional lo e and p o iding me wi h
unending encou agemen and ca e. I lo e hem all dea ly.
Bay eu h, 18.01.2012
Table o con en s
Table o con en s
Zusammen assung....................................................................................................... 1
Summa y...................................................................................................................... 3
1. INTRODUCTION............................................................................................... 4
1.1. Bacillus sub ilis - he mos impo an gene ic model o ganism.................
o he G am-posi i e bac e ia .................................................................... 4
1.1.1. O e iew o egula o y ne wo k in spo ula ion o B. sub ilis................. 4
1.1.1.1. Mo phology o B. sub ilis spo ula ion and o ma ion o p o ec i e .........
s uc u es ..................................................................................................... 4
1.1.1.2. Key ansc ip ional egula o s du ing B. sub ilis spo ula ion................ 7
1.1.2. Gene ic ne wo ks and key egula o s con olling ini ia ion .....................
o spo ula ion............................................................................................... 8
1.1.2.1. Ac i a ion o Spo0A, he mas e egula o o phase 0, occu s..................
h ough a phospho elay.............................................................................. 9
1.1.2.2. Posi i e and nega i e au o egula o y loops con ol p oduc ion...............
o Spo0A~P ................................................................................................ 10
1.1.2.3. Role o phospho yla ed Spo0A du ing ini ia ion o spo ula ion .......... 12
1.1.2.4. Sigma H, a posi i e egula o o spo ula ion.......................................... 13
1.1.2.5. Ab B, an impo an ansc ip ion ac o du ing ini ia ion.......................
o spo ula ion............................................................................................. 15
1.2. The me allop o ease F sH ........................................................................ 16
1.2.1. In oduc ion o F sH................................................................................. 16
1.2.2. Disco e y o F sH...................................................................................... 17
1.2.3. The s uc u e o F sH ............................................................................... 17
1.2.4. Subs a e binding...................................................................................... 19
1.2.5. Mechanism o subs a e ecogni ion and deg ada ion by F sH............ 21
1.2.5.1. Recogni ion o N- o C- e minal mo i s o F sH deg ada ion............. 21
1.2.5.2. Complex subs a e ecogni ion mechanisms .......................................... 22
i
Table o con en s
1.2.6. Biological unc ions o he F sH p o ease ............................................... 23
1.2.6.1. Memb ane p o eins as subs a es o F sH.............................................. 23
1.2.6.2. Cy oplasmic subs a es o F sH ............................................................... 24
1.3. The objec i e o he hesis ........................................................................ 27
2. MATERIALS AND METHODS ..................................................................... 29
2.1. Ma e ials .................................................................................................... 29
2.1.1. Bac e ial s ains ........................................................................................ 29
2.1.2. Plasmids ..................................................................................................... 30
2.1.3. Oligonucleo ides ........................................................................................ 31
2.1.4. Media.......................................................................................................... 31
2.1.5. An ibio ics.................................................................................................. 32
2.1.6. Chemicals and enzymes............................................................................ 32
2.1.7. An ibodies .................................................................................................. 33
2.2. Me hods...................................................................................................... 33
2.2.1. Iden i ica ion o F sH subs a es by p o eomics .................................... 33
2.2.1.1. G ow h condi ions..................................................................................... 33
2.2.1.2. Sample p epa a ion .................................................................................. 33
2.2.1.3. Two-dimensional polyac ylamide gel elec opho esis (2D-PAGE)...... 33
2.2.1.4. P o eome analysis and mass spec ome y o p o ein iden i ica ion.. 34
2.2.1.5. Cons uc ion o plasmids and ecombinan s ains............................... 35
2.2.1.5.1. Cons uc ion o pBH1 o he spo0M ansc ip ion analysis......... 35
2.2.1.5.2. Cons uc ion o pBH2 o spo0M exp ession................................. 36
2.2.1.6. Exp ession and pu i ica ion o GST- agged p o eins............................ 37
2.2.1.7. β-Galac osidase assays.............................................................................. 37
2.2.1.8. P o eolysis expe imen s............................................................................ 37
2.2.2. Iden i ica ion o F sH subs a es by ap-mu an app oach................. 38
2.2.2.1. Cons uc ion o F sH ap ........................................................................... 38
ii
Table o con en s
2.2.2.2. Cons uc ion o plasmids and s ains in B. sub ilis o p o ein ................
apping by F sH ap in i o...................................................................... 38
2.2.2.3. Complemen a ion o he sH alleles in an sH knockou s ain .......... 40
2.2.2.3.1. Mo phology complemen a ion in he wild- ype and sH ap .......... 40
2.2.2.3.2. Spo ula ion complemen a ion......................................................... 40
2.2.2.4. Iden i ica ion o F sH subs a es by he pull-down assay ..................... 40
2.2.2.4.1. Sample p epa a ion o p o ein apping in i o............................ 40
2.2.2.4.2. Ex i o c oss - linking wi h DSP .................................................... 41
2.2.2.4.3. Pull-down assay o F sH subs a e apping in i o..................... 41
2.2.2.5. SDS-PAGE and Wes e n blo ing............................................................ 41
2.2.2.6. Sil e S aining ........................................................................................... 42
3. RESULTS .......................................................................................................... 43
3.1. Iden i ica ion o F sH subs a e p o eins by p o eomics.............................. 43
3.1.1. Iden i ica ion o he Spo0M p o ein as a pu a i e subs a e.....................
o F sH by 2D-gel elec opho esis............................................................ 43
3.1.2. F sH does no in luence exp ession o spo0M......................................... 48
3.1.3. Spo0M is con i med as a subs a e p o ein o F sH by an in i o...........
deg ada ion expe imen ............................................................................ 49
3.2. Iden i ica ion o F sH subs a e p o eins by he sH ap mu an .................. 50
3.2.1. Cons uc ion and cha ac e iza ion o F sH ap ....................................... 51
3.2.1.1. De e mina ion o exp ession o F sH ap and i s con ols by IPTG ..........
induc ion .................................................................................................... 51
3.2.1.2. Physiological cha ac e iza ion o he sH ap mu an in i o ................ 52
3.2.1.2.1. Exp ession o F sH+ es o es he wild ype pheno ype, while ......................
F sH ap is de ec i e in pheno ypic complemen a ion................................ 52
3.2.1.2.2. Exp ession o sH+ in a deple ion s ain shows eco e y o he..................
spo ula ion equency while sH ap does no ........................................... 53
3.2.1.3. Cons uc ion and cha ac e iza ion o F sH ap in i o.......................... 54
iii
Table o con en s
3.2.2. Iden i ica ion o F sH subs a es in i o using ...........................................
he GST-F sH ap a ian .......................................................................... 55
3.2.3. Mos F sH ap and i s co-pu i ied p o eins we e de ec ed in he ...............
memb ane ac ion and DSP c oss-linking caused p o ein.......................
agg ega ion ................................................................................................ 55
3.2.4. Iden i ica ion o po en ial F sH subs a e by SDS-PAGE and .................
sil e s aining............................................................................................. 57
3.2.5. YwnF was iden i ied as a po en ial subs a e o F sH ........................... 59
3.3. Is he Eag p o ein in ol ed in he egula ion o he ac i i y o Spo0E?....... 60
3.3.1. Cons uc ion o an eag null mu an by inse ion o he pMUTIN4..........
in eg a ion ec o ...................................................................................... 60
3.3.2. Does he eag gene a ec he spo ula ion equency?............................. 62
3.3.3. Does he eag gene in luence he amoun o Spo0A p o ein? ................. 62
4. DISCUSSION .................................................................................................... 65
4.1. Iden i ica ion o he Spo0M p o ein as a no el subs a e..................... 65
4.1.1. Spo0M, a a ge o F sH and i s unc ion in spo ula ion....................... 65
4.1.2. The unc ion o F sH du ing in he egula ion o Spo0M...................... 66
4.1.3. The mechanism o subs a e ecogni ion by he F sH p o ease............ 67
4.2. Cons uc ion o an F sH ap mu an allowing iden i ica ion......................
o no el subs a e p o eins ....................................................................... 68
4.3. Pu a i e ole o he Eag p o ein in modula ing he ac i i y......................
o he Spo0E phospha ase......................................................................... 71
Re e ence Lis ............................................................................................................ 74
Lis o abb e ia ions and symbols........................................................................... 88
Publica ion................................................................................................................. 90
Publica ion submi ed............................................................................................... 90
Publica ion in p epa a ion ....................................................................................... 90
E klä ung .................................................................................................. 91
i
Zusammen assung
Zusammen assung
F sH is eine ATP- und Zn -abhängige Me allop o ease, welche mi els zweie
2+
T ansmemb an-Segmen e in de cy oplasma ischen Memb an e anke is . Sie is die
einzige besch iebene Memb an- e anke e AAA-P o ease bei Bak e ien mi
e schiedenen egula o ische Funk ionen. Eine sH-Knockou Mu an e zeig einen
pleio open Phäno yp. Dazu gehö en ilamen öses Wachs um de Zellen, Sensi i i ä
gegenübe einem Hi zeschock und osmo ischen Schock, und die Zellen können nich meh
spo ulie en. Kü zlich konn en wi zeigen, dass sH-Knockou Zellen nich das
Spo ula ions-S adium II e eichen au g und eine zu ge ingen Menge an Spo0A~P.
Auße dem haben wi Spo0E, eine Spo0A~P-spezi ische Phospha ase, als e s es Subs a
on F sH iden i izie . Da die Spo ula ions equenz in eine spo0E sH Doppelmu an e
nu eilweise wiede he ges ell wi d, e mu en wi , dass F sH wei e e Subs a p o eine
abbau , die die Spo ula ion nega i beein lussen. Um wei e e P o eine zu iden i izie en,
wu den zwei e schiedene S a egien angewende . Mi els de 2D-Gel Technik wu den
die P o eome eine sH Wild yp- und eine sH-Knockou -Mu an e mi einande
e glichen. Es konn en eine Reihe on P o einen iden i izie we den, die in Abwesenhei
on F sH en wede e meh ode eduzie p oduzie wu den. Eines de mengenmäßig
e wa 4- ach e höh en P o eine wu de als Spo0M iden i izie . Da sH nich mi de
T ansk ip ion on spo0M in e e ie , wu de ein in- i o-P o eolyse es mi ge einig en
Komponen en e ablie . Es konn e gezeig we den, dass Spo0M ATP- und Zei -abhängig
on F sH abgebau wi d. In de zwei en S a egie wu de zunächs eine sH ap Mu an e
kons uie und au Ve lus de P o eolyse-Ak i i ä ge es e . P o ease T ap-Mu an en sind
noch in de Lage ih e Subs a e zu binden, können diese abe nich meh abbauen. Mi
Hil e eine GST- sH ap Mu an e konn e das Memb an-P o ein YwnF gebunden und dann
mi els Massen-Spek ome ie iden i izie we den. Wei e e Expe imen e sind no wendig,
um YwnF als Subs a -P o ein zu e i izie en. De le z e Teil de Disse a ion gal dem
eag-Gen, welches mi spo0E ein bicis onisches Ope on bilde . Die Kons uk ion und
Analyse eine eag Inse ions-Mu an e e gab einen leich en Ans ieg in de
Spo ula ions equenz und in de Menge an Spo0A. Eine T ansk ip ions usion zwischen
dem P omo o des spo0E-eag Ope ons und dem lacZ Repo e gen zeig e einen Ans ieg in
de β-Galac osidase Ak i i ä ab 0 bei Wachs um de Zellen in Spo ula ionsmedium. Da
es sich bei Eag e mu lich um ein in eg ales Memb anp o ein handel , kann es
1
In oduc ion
Table 1.1. Key ansc ip ional egula o s du ing B. sub ilis spo ula ion. This
able was aken om K oos, 2007
P o ein Aliases Func ion
σARpoD, SigA Majo σ ac o in g owing cells; en y in o
spo ula ion
σHSpo0H En y in o spo ula ion
Spo0A En y in o spo ula ion; ac i i y pe sis s in
he mo he cell
σFSpoIIAC, SigF Ea ly o espo e gene exp ession
Rs A Yw N Regula o o σF-dependen gene
exp ession
σESpoIIGB, SigE Ea ly mo he cell gene exp ession
SpoIIID Regula o o σE-dependen gene
exp ession, p ima ilya
Ge RbYlbO Regula o o σE-dependen gene
exp ession
σGSpoIIIG, SigG La e o espo e gene exp ession
SpoVT YabL Regula o o σG-dependen gene
exp ession
σKSpoIVCB/SpoIIICc, SigK La e mo he cell gene exp ession
Ge E Regula o o σK-dependen gene
exp ession
(a): SpoIIID also ep esses some σK-dependen genes (Halbe g and K oos, 1994; Ichikawa
and K oos, 2000).
(b): Ge , ge mina ion; a mu a ion in a ge gene in e e es wi h his p ocess, which in ol es
ehyd a ion o he spo e and ou g ow h o a od-shaped cell in esponse o nu ien s.
(c): σK is encoded in wo genes, spoIVCB and spoIIIC, which a e sepa a ed by 48 kb un il
joined by si e-speci ic ecombina ion in he mo he cell o o m he sigK gene (S agie e
al., 1989).
1.1.2. Gene ic ne wo ks and key egula o s con olling ini ia ion o spo ula ion
Ini ia ion o spo ula ion in B. sub ilis is induced by nu i ional, cell densi y, and
cell cycle signals ha esul in an ele a ed concen a ion o Spo0A~P (K oos, 2007). Due
o nu ien dep i a ion, B. sub ilis cells lea e ege a i e g ow h and en e he s a iona y
8
In oduc ion
phase ( e med ansi ion s a e). In o de o su i e, he cells edi ec hei me abolism and
physiology in di e en ways o deal wi h s a a ion (Phillips and S auch, 2002). The
cell’s i s p io i ies a e o egula e he al e a ions in gene exp ession o u ilize al e na i e
nu ien s and o success ully compe e wi h o he species o sca ce esou ces. Va ious
ex acellula p o eases and o he deg ada i e enzymes a e p oduced and he al e na e
pa hways a e applied o maximize he u iliza ion o nu ien esou ces (S auch, 1993). A
a ie y o an ibio ics and an imic obial compounds a e sec e ed du ing his s age o ou -
compe e wi h o he mic obial species. Cells also es ablish a gene ically compe en s a e o
up ake exogenous DNA and spo ula ing cells a e able o cannibalize non-spo ula ing cells
(Gonzalez-Pas o e al., 2003). Spo ula ion is only commi ed as a las eso when all
o he a emp s o g ow, o compe e and o su i e ha e been exhaus ed. Once ini ia ion o
spo ula ion has occu ed, he e is no u ning back (Phillips and S auch, 2002). Two key
egula o y p o eins in ol ed in he ini i a ion o spo ula ion a e σH and Spo0A and ano he
impo an ac o is Ab B, a nega i e egula o ha egula es a ious s a iona y phase
esponses du ing ini ia ion (E ing on, 1993).
1.1.2.1. Ac i a ion o Spo0A, he mas e egula o o phase 0, occu s h ough a
phospho elay
Spo0A, he mas e egula o o s age 0, is ac i a ed by phospho yla ion ia a
phospho elay, an expanded e sion o a wo-componen sys em including p o ein kinases
and phospha ases (Molle e al., 2003; Mucho a e al., 2004). When cells en e he
ansi ion phase, unknown s a a ion signals igge au ophospho yla ion a an in a ian
his idine esidue o one o i e senso kinases (KinA h ough KinE) (I e on e al., 1993;
Jiang e al., 2000). The phospho yl g oup is hen ans e ed sequen ially om he
kinase(s) o Spo0F, hen o Spo0B and inally o he esponse egula o Spo0A (Bu bulys
e al., 1991). Dephospho yla ion o Spo0F~P may be caused by a leas ou Rap p o eins,
RapA, RapB, RapE and RapH (Pe ego and Hoch, 1996; Bake and Neidi ch, 2011). I was
hough ha hese Rap p o eins unc ion di ec ly as phospha ases. Indeed,
dephospho yla ion o Spo0F~P is caused by he binding o Rap phospha ases o Spo0F~P
s imula ing i s au ophospha ase ac i i y (Piggo and Hilbe , 2004; Co e and Pe ego,
2003). The Rap p o eins a e inhibi ed speci ically by hei co esponding pen apep ides
Ph A, Ph B, Ph E and Ph H. Thei speci ic ac i i y on he a ge Rap phospha ase is
de e mined by he amino acid sequence o each pen apep ide (Co e e al., 2001). Spo0A~P
9
In oduc ion
i sel is also dephospho yla ed by he ac ion o h ee phospha ases: Spo0E is p oduced
du ing he ansi ion s a e and wo homologues, YisI and YnzD, a e p esen du ing he
ege a i e phase o g ow h (Pe ego and Hoch, 1987). Spo0E ac s as a nega i e egula o
o spo ula ion by speci ically dephospho yla ing Spo0A~P and con e ing i in o an
inac i e o m. O e p oduc ion o Spo0E ep esses spo ula ion and dele ion o spo0E
esul s in inapp op ia e iming o spo ula ion (Fig. 1.2) (Pe ego and Hoch, 1991).
KinA
KinB
KinC
KinD
KinE
S
p
o0F~P S
p
o0A~P
S
p
o0B~P
Ra
p
A
,
Ra
p
B
,
Ra
p
E
,
Ra
p
HSpo0E
YisI
YnzD
Ph A Ph B Ph E Ph H
Fig. 1. 2: Schema ic ep esen a ion o he phospho yla ion o Spo0A. Spo0A is indi ec ly
phospho yla ed by a mul icomponen phospho elay in ol ing he kinases KinA, KinB,
KinC, KinD, KinE and wo in e media e p o eins. The kinases phospho yla e Spo0F
esul ing in Spo0F~P. Then, he phospho yl g oup will be ans e ed o Spo0B and
inally o Spo0A o ac i a e i . Ph pep ides sense cell densi y and inhibi se e al Rap
phospha ases ha can dephospho yla e Spo0F~P; Spo0E, YisI and YnzD can
dephospho yla e Spo0A~P.
1.1.2.2. Posi i e and nega i e au o egula o y loops con ol p oduc ion o Spo0A~P
P oduc ion o Spo0A~P is con olled by bo h posi i e and nega i e egula o y
loops du ing ini ia ion o spo ula ion (G ossman, 1995). Spo0A~P can di ec ly s imula e
i s own exp ession and con ibu e o he ansc ip ion o genes ha egula e u he
accumula ion o Spo0A~P ia a posi i e eedback loop in ol ing in Ab B and σH (Fig.
1.3). T ansc ip ion o he spo0A gene is con olled by a mechanism called “p omo e
swi ching mechanism”, in ol ing wo Spo0A~P - dependen p omo e s: a ege a i e σA-
ecognized p omo e , P , and a spo ula ion σH- ecognized p omo e , Ps, con olled by he
amoun o phospho yla ed Spo0A (Chas ane and Losick, 2011). I has been p oposed ha
10
In oduc ion
a low le el o spo0A is ansc ibed om P du ing he exponen ial phase o g ow h while
Ps is silen because o he absence o Spo0A~P and σH. When Spo0A~P is o med ia he
phospho elay, ansc ip ion o he spo0A gene is swi ched om P o Ps (Chas ane e al.,
2010). Once ac i a ed, Spo0A~P ep esses ansc ip ion o ab B causing de ep ession o
ansc ip ion o he spo0H gene coding o he sigma-H p o ein, he eby s imula ing
ansc ip ion o spo0A om a sigma-H- ecognized p omo e . σH also di ec s ansc ip ion
o wo esponse egula o s, kinA and spo0F. As a esul , a posi i e eedback loop is se up
o con ol p oduc ion o Spo0A~P (Fig. 1.3) (B i on e al., 2002).
A nega i e eedback loop is also con olled by Spo0A~P ia Spo0E and i s
ep esso , Ab B. T ansc ip ion o spo0E is ep essed by Ab B and is de ep essed du ing
ea ly spo ula ion due o Spo0A~P ep ession o ab B (Pe ego and Hoch, 1991). An
inc ease in he amoun o he Spo0E phospha ase causes he emo al o phospha e om
Spo0A~P ha con e s i in o he inac i e o m and p e en s cells om en y in o
spo ula ion. This nega i e eedback loop p esumably unc ions in he main enance o a
subpopula ion o cells ha do no spo ula e unde hese condi ions o delays as Spo0A~P
induc ion (G ossman, 1995; Chas ane e al., 2010).
11
In oduc ion
P = σASpo0A box Spo0A box Ps = σ
H
σ
H
Spo0A~P
σ
A
s
p
o0H
σ
A
spo0E
ab B
-
+
σ
H
s
p
o0F
s
p
o0A
σ
H
kinA
+phospho elay
Fig. 1.3. Schema ic ep esen a ion o posi i e and nega i e egula o y loops con olling
he p oduc ion o Spo0A~P. Spo0A is ac i a ed h ough he phospho elay. Spo0A~P
ep esses ansc ip ion o ab B. A dec ease in Ab B p o ein causes de ep ession o
ansc ip ion o spo0H, leading o inc eased ansc ip ion o spo0A and wo esponse
egula o s o he phospho elay, kinA and spo0F [a posi i e eedback loop (+)]. The
dec ease o Ab B le el also causes de ep ession o spo0E, leading o inc eased
accumula ion o he phospha ase ha emo es phospha e om Spo0A~P he eby se ing
upon a nega i e eedback loop (-).
1.1.2.3. Role o phospho yla ed Spo0A du ing ini ia ion o spo ula ion
The mas e egula o o spo ula ion, Spo0A~P, is a DNA-binding p o ein
ac i a ed h ough a phospho elay (Molle e al., 2003). I is a membe o he esponse
egula o amily o wo-componen egula o y sys ems consis ing o wo dis inc domains.
The highly conse ed N- e minal domain called phosphoaccep o (o ecei e ) domain
con aining an in a ian aspa ic acid esidue (Asp-56) is he a ge o phospho yla ion by
he phospho elay and media es dime iza ion o Spo0A. The C- e minal DNA-binding (o
e ec o ) domain which is esponsible o binding o speci ic DNA sequences, called 0A
boxes, egula es ansc ip ion o a ge genes (Pe ego e al., 1991; Mucho a e al., 2004).
Dime iza ion o Spo0A a e phospho yla ion is equi ed o a ge 0A boxes
(Asayama e al., 1995). Spo0A~P ac s as a ep esso and ac i a o p o ein egula ing a
12
In oduc ion
o al o 121 genes including genes wi h ege a i e σA- ecognized p omo e s as well as
spo ula ion σH- ecognized p omo e s (Se edick and Spiegelman, 2001; Molle e al., 2003).
I plays wo majo oles in he cell’s adap i e esponses o s a a ion. Fi s , a low amoun
o Spo0A~P ini ially ep esses ansc ip ion o ab B ha causes an inc ease in Ab B-
dependen gene exp ession du ing he ansi ion s a e. Second, when he Spo0A~P
concen a ion eaches a c i ical le el, i will egula e exp ession o genes equi ed o
en y in o spo ula ion (Phillips and S auch, 2002). The basal le el o Spo0A~P is no
cons an om cell o cell. These egula o y loops and he in e connec edness o he
phospho elay in luences p oduc ion o Spo0A~P and esul s in a bi-s able swi ch - a s a e
whe e some cells in he popula ion accumula e a highe le el o Spo0A~P han o he s
(K oos, 2007; Dubnau and Losick, 2006). Cells wi h a high le el o Spo0A~P p oduce
killing ac o s o lyse hose cells wi h a low Spo0A~P le el o ge mo e nu ien s esul ing
in a delay in ini ia ion o spo ula ion. They also esis hei killing ac o by syn hesizing
an expo pump and an immuni y p o ein o p o ec hem om he oxin (G ossman, 1995;
Dubnau and Losick, 2006). Abou 60% o he cells wi h a su icien amoun o Spo0A~P,
called Spo0A-ON s age, a e able o spo ula e while he emaining 40% a e in he Spo0A-
OFF s age and ail o en e in o spo ula ion. This mechanism is called “bis abili y” which
means he simul aneous exis ence o wo subpopula ions in one popula ion o gene ically
iden ical cells. The explana ion o his mechanism is s ill unknown.
1.1.2.4. Sigma H, a posi i e egula o o spo ula ion
Sigma-H (σH) is an al e na i e RNA polyme ase sigma ac o ac i a ing he
ansc ip ion o many genes equi ed o o ma ion o he pola sep um, he ini ia ion o
cell- ype-speci ic exp ession and ac i a ion o Spo0A (Bu kholde and G ossman, 2000).
Many spo ula ion genes a e di ec ly ac i a ed by sigma-H including spo0A, spo0F, kinA,
spo0M, spoVG, and spoVS and he spoIIA ope on (Bai e al., 1990; Johnson e al., 1983;
P edich e al., 1992; Han e al., 1998; Resneko e al., 1995; Wu e al., 1991).
Sigma-H also egula es ansc ip ion o some membe s o he ph amily, coding
o sec e ed pep ide phe omones ha inhibi speci ically he co esponding Rap
phospha ases, modula ing cell en y in o gene ic compe ence, spo ula ion, and o he
p ocesses (Pe ego and B annigan, 2001; Lazazze a e al., 1999; McQuade e al., 2001).
Se e al o he genes ansc ibed by sigma-H a e also unde con ol o σA-dependen
p omo e s including spo0A, sA (cell di ision), dnaG (DNA eplica ion), sigA (encoding
sigma-A, he majo sigma ac o ), and ci G ( ica boxylic acid cycle) (B i on e al., 2002).
13
In oduc ion
Sigma-H also con ibu es indi ec ly o he exp ession o Spo0A and KinB by ac i a ing
exp ession o sinI and ep essing sinR - a spo0A syn hesis ep esso , he eby ac i a ing
indi ec ly he spo0A syn hesis (Bai e al., 1993). In addi ion, sigma-H s imula es
exp ession o CSF (compe ence s imula ing ac o ), which inhibi s he RapB phospha ase
ha dephospho yla es Spo0F~P and he eby con ibu es o he inc ease in spo0A
ansc ip ion du ing he ea ly s age o spo ula ion (Fig. 1.4). In u n, Spo0A~P con ibu es
o he induc ion o sigma-H by ep essing i s ansc ip ional ep esso , Ab B (Bu kholde
and G ossman, 2000).
Regula ion o sigma-H i sel is qui e complica ed. spo0H, coding o sigma-H, is
ansc ibed om a σA-dependen p omo e and di ec ly unde nega i e con ol o Ab B
which is in u n ep essed by Spo0A~P (Bu kholde and G ossman, 2000; S auch, 1995;
Wei e al., 1991). Unde app op ia e condi ions, inc eased le els o Spo0A~P esul in
ep ession o Ab B esul ing in enhanced le els o spo0H ansc ip ion. The e o e, a high
le el o Spo0A~P is p oduced esul ing in mo e ep ession o Ab B and inc easing le els
o sigH ansc ip ion, he eby es ablishing a sel - ein o cing cycle o egula e bo h sigma-
H and Spo0A.
Sigma-H plays impo an oles in esponse o a di e si y o ex e nal condi ions
including pH, ca bon sou ce, and exis ence o amino acids. I con ols many genes
in ol ed in se e al cellula p ocesses including p o eolysis, cell wall me abolism,
anspo , and cy och ome biogenesis ha helps cells o adap o condi ions o s a a ion
and impac s physiological decisions du ing en y in o s a iona y phase (B i on e al.,
2002).
Schema ic ep esen a ion o egula ion o sigma-H ansc ip ion and i s egula ion
o exp ession and ac i a ion o Spo0A is illus a ed and sho ly explained in Fig. 1.4.
14
In oduc ion
Fig. 1.4. Regula ion o sigma-H ansc ip ion and i s egula ion o exp ession and
ac i a ion o Spo0A. Sigma-H egula es ansc ip ion o kinA, spo0F, and spo0A,
con ibu ing o he high le el accumula ion o Spo0A~P. Sigma-H also s imula es he
ac i a ion o Spo0A by egula ing exp ession o he sec e ed pep ide phe omone, CSF,
which inhibi s he phospha ase, RapB, ha dephospho yla es Spo0F~P. Simila ly, sigma-
H egula es exp ession o sinI, which inhibi s sinR, esul ing in u he de ep ession o
spo0A ansc ip ion. This igu e was aken om Bu kholde and G ossman, 2000.
1.1.2.5. Ab B, an impo an ansc ip ion ac o du ing ini ia ion o spo ula ion
Ab B is a ansc ip ional ep esso ha plays an impo an ole du ing ini ia ion
o spo ula ion (K oos, 2007). This DNA-binding p o ein plays a ole as a ep esso o
se e al compe ence genes as well as genes exp essed du ing he ansi ion s a e (S auch
and Hoch, 1993; S auch e al., 1989b).
A leas h ee spo ula ion genes con olled by Ab B a e spo0E (Pe ego and Hoch,
1991), spo0H (Wei e al., 1991) and spoVG (Zube and Losick, 1987). Ab B also
egula es an an ibio ic-syn he ic gene, ycA (Fü bass e al., 1991; Robe son e al., 1989),
and ab B i sel (S auch e al., 1989a). O e 40 di e en genes a e di ec ly egula ed by
Ab B and many o he genes indi ec ly due o i s in luence on he ansc ip ion o o he
egula o y p o eins. Fo example, he egula o y p o eins ScoC, Abh, SinR and SigH a e
con olled by Ab B. These p o eins also egula e nume ous genes in di e en egula o y
ne wo ks leading o a wide a ie y o genes con olled indi ec ly by Ab B (Phillips and
S auch, 2002).
Ab B ac s as a DNA-binding ac o and con ols gene exp ession in a leas h ee
di e en ways (Dixon e al., 2001; E ing on, 1996; Johnson e al., 1983). Fi s , Ab B ac s
15
In oduc ion
as a unique ep esso o some genes ha a e cons i u i ely exp essed du ing all phases o
g ow h in an ab B mu an s ain. In mos o he cases, Ab B plays a ole as a p e en e o
become a ac o in se ies o edundan egula o y ne wo ks o ensu ing ha no egula o
has comple e con ol o e genes ha mus emain silen du ing ac i e g ow h. Ab B also
plays a ole as an ac i a o o some genes when i ep esses ac i a ion o o he ep esso s
( wo nega i es = a posi i e) (Phillips and S auch, 2002).
The ansc ip ion o he ab B gene is au o egula ed. In an ac i e g ow h s a e, he
Ab B concen a ion is main ained a a h eshold ha is su icien o i s egula o y ac i i y
(S auch e al., 1989a). Du ing s a a ion, Spo0A, a ep esso o ab B ansc ip ion, is
ac i a ed by phospho yla ion h ough he phospho elay, esul ing in a dec ease o he
Ab B le el below he h eshold o i s nega i e egula o y ac i i y he eby inc easing he
exp ession o Ab B- ep essed genes. The genes unde con ol o Ab B may unc ion in
many me abolic and physiological p ocesses, including p oduc ion o ex acellula
deg ada i e enzymes, an ibio ics, mo ili y, de elopmen o compe ence, anspo sys ems,
oxida i e s ess esponse, phospha e, ni ogen and amino acid me abolism, cell su ace
componen s and spo ula ion (Phillips and S auch, 2002).
1.2. The me allop o ease F sH
1.2.1. In oduc ion o F sH
F sH is membe o he AAA amily (ATPases associa ed wi h a a ie y o cellula
ac i i ies) inse ed in o he cy oplasmic memb ane by wo ansmemb ane segmen s
(Schumann, 1999). I is comp ised o an N- e minal egion wi h wo ansmemb ane
segmen s and a C- e minal cy oplasmic egion consis ing o AAA-ATPase and Zn2+-
me allop o ease domains. While o he AAA p o eases a e loca ed in he cy oplasm, F sH
is a unique memb ane-bound AAA p o ease able o deg ade in eg al memb ane p o eins.
I plays c ucial oles in con olling he quali y o memb ane p o eins by apidly deg ading
abno mal memb ane p o eins and some sho -li ed p o eins p esen in he cy osol (I o and
Akiyama, 2005).
Bac e ial cells wi h F sH mal unc ion in bac e ia esul in cell di ision de ec s and
g ow h a es (Bieniossek e al., 2006). In E. coli, he F sH p o ease is essen ial o g ow h
whe eas i is dispensable in B. sub ilis. Howe e , sH mu an cells in B. sub ilis appea
mo e sensi i e o hea , sal , and de ec i e o cell di ision and spo ula ion (Ki an e al.,
16
In oduc ion
2009). O hologs o F sH also exis in chlo oplas s and mi ochond ia o euka yo es
(Bieniossek e al., 2006). The F sH p o ease o A abidopsis haliana con ibu es o he
ole ance o he plan o upli ed empe a u es. I may alle ia e ligh s ess by deg ading
pho odamaged pho osys em II D1 p o ein and unassembled hylakoid memb ane p o eins
(Chen e al., 2006). The loss o a close F sH-o hologs in humans esul s in he edi a y
spas ic pa aplegia (Bieniossek e al., 2006).
1.2.2. Disco e y o F sH
The E. coli sH gene was disco e ed and desc ibed independen ly by ou g oups
h ough de ec ion o di e en pheno ypes, he eby ecei ed ou di e en designa ions:
sH, s ands o ilamen ous empe a u e-sensi i e; olZ, exhibi s ole ance agains colicins
and h lB, causes high equency o lysogeniza ion by phage lambda and m sC, s ands o
mRNA s abili y (Schumann, 1999).
In B. sub ilis, he sH gene has been disco e ed sepa a ely by h ee di e en
g oups. Fi s , he g oup o Schumann de ec ed F sH as an inse ion mu an causing a
g ow h de ec unde hype osmo ic condi ions (Geisle and Schumann, 1993). La e , sH
was de ec ed by he g oup o S. Cu ing as a egula o y ac o o SpoVM, a p o ein
equi ing o spo e co ex and coa o ma ion (Cu ing e al., 1997) and he g oup o P.
Zube iden i ied sH as an essen ial gene o e men a ion and ni a e espi a ion (Nakano
e al., 1997).
In gene al, he sH gene is p esen in one single copy in he examined p oka yo ic
genomes excep o cyanobac e ia such as Synechocys is (J05708), which has ou sH
genes in i s genome (Nixon e al., 2005). Yeas genomes con ain h ee copies o he gene
(Schnall e al., 1994), whe eas plan genomes possess a la ge sH gene amily. Fo
example, he A abidopsis genome has 12 sH genes and mu a ions in hese genes esul in
lea colo a iega ion (Chen e al., 2006).
1.2.3. The s uc u e o F sH
The memb ane-bound me allop o ease F sH is a ing-like homo-hexame complex
ha ca ies he AAA and p o eoly ic domain on he same polypep ide chain (I o and
Akiyama, 2005). The F sH monome o E. coli consis s o 647 amino acid esidues wi h a
calcula ed molecula mass o 71.0 kDa. F sH is an in eg al cy oplasmic memb ane p o ein
17
In oduc ion
One example is YccA, a sho -li ed memb ane p o ein o unknown unc ion. I has been
sugges ed o be na u ally deg aded by F sH, and i s unc ion seems o be linked o bio ilm
o ma ion (Beloin e al., 2004).
F sH also deg ades unassembled memb ane p o eins such as he subuni SecY o
he SecYEG anslocase and F0α o he H+-ATPase. Deg ada ion o hese p o eins only
occu s when hey ail o assemble wi h hei pa ne p o eins (Akiyama e al., 1996a;
Akiyama e al., 1996b). SecY o ms a s able anslocon complex wi h SecE and SecG
allowing ansloca ion o p esec e o y p o eins h ough he cy oplasmic memb ane o
in eg a ion in o he lipid bilaye o newly syn hesized memb ane p o eins. The e o e,
incomple e assemblies o he anslocon could be ha m ul o he cell (Akiyama e al.,
1996b). The F0α is a subuni o a p o on channel ac oss he memb ane and i s edundance
migh be also ha m ul o he cells (Akiyama e al., 1996a). The e o e, hese examples
show ha F sH p o ec s cells om he ha m ul condi ions by deg ading abundan
memb ane p o ein subuni s when hey ailed o o m unc ional complexes (I o and
Akiyama, 2005).
1.2.6.2. Cy oplasmic subs a es o F sH
F sH deg ades a majo i y o cy oplasmic subs a es o F sH (Fig. 1.8 and Table
1.2) and many o hem a e sho -li ed soluble subs a es. A leas h ee subs a es o F sH
a e bac e iophage encoded p o eins and hey belong o he g oup o sho -li e p o eins.
The cII gene p oduc is a ansc ip ion ac o equi ed o se ing up he lysogenic cycle
(Kiha a e al., 1997; Sho land e al., 1997; Sho land e al., 2000a). The Xis p o ein is
esponsible o excision o p ophage DNA om he bac e ial genome (Le e s and
Go esman, 1998). The cIII gene p oduc is a compe i i e inhibi o o F sH (He man e al.,
1997). By deg ading hese subs a es, F sH exhibi s i s egula o y impac on he
de elopmen and li e cycle o in ec ing by deg ading hei key egula o y molecules (I o
and Akiyama, 2005).
F sH also deg ades Ss A- agged p o eins whe e he Ss A- ag consis s o 11
esidues added o s alled nascen chains du ing ansla ion o enable ibosome ecycling
and emo e o abno mal p o eins om he cell (Lies and Mau izi, 2008; He man e al.,
1998). In ano he case, F sH can deg ade E. coli apo- la odoxin in in i o p o eoly ic
24
In oduc ion
es s bu he e ec o F sH on la odoxin le els in i o is s ill unknown (Okuno e al.,
2006a; Okuno e al., 2006b).
F sH is conside ed as he only essen ial AAA p o ein in E. coli due o i s
egula ion on he le el o LpxC, he key enzyme in lipid A biosyn hesis. Bo h oo much
and oo li le lipid A is le hal o E. coli. Thus, F sH main ains a su icien amoun o lipid
A wi hin he cells. F sH also plays a dual ole in LPS biosyn hesis by deg ading Kd A, a
KDO ans e ase, ca alyzes he KDO a achmen o lipid A (Ka z and Ron, 2008).
The e o e, F sH ac s as he c ucial p o ease equi ed o p o ein and memb ane lipid
homeos asis (Na be haus e al., 2009).
Ano he impo an unc ion o F sH is o egula e exp ession o σ32, he hea shock
sigma ac o equi ed o hea shock o o he s ess esponses in E. coli. Regula ion o σ32
by F sH is assumed o in ol e i s associa ion wi h he DnaKJ chape one sys em in which
he DnaK chape one is assumed o ha e a posi i e ole in he deg ada ion by p esen ing
σ32 o F sH (Ta su a e al., 2000; Ta su a e al., 1998; Tomoyasu e al., 1998).
F sH also a ec s he p o eoly ic deg ada ion o he al e na i e sigma ac o s SigF
(σF) in C. c escen us ha indi ec ly egula es he oxida i e s ess esponse in s a iona y
phase (Va ez-Ma inez e al., 2006). The σW o B. sub ilis migh be ano he subs a e o
F sH (Zellmeie e al., 2003). The Spo0E phospha ase in ol ed in dephospho yla ion o
Spo0A~P has been shown o be a subs a e o F sH, and he ecogni ion sequence is
loca ed in he C- e minal end (Le and Schumann, 2009). SpoVM has been shown o be a
a ge and an inhibi o o he F sH p o ease (Cu ing e al., 1997). I sha es s uc u al
simila i ies wi h λ CIII, ano he a ge and inhibi o o F sH in E. coli, implying ha bo h
p o eins sha e compa able inhibi ion and deg ada ion mechanisms owa d o F sH
(Kobile e al., 2007).
F sH is in ol ed in ni ogen me abolism in Co ynebac e ium glu amicum due o
i s deg ada ion o he GlnK p o ein, a esponse p o ein o ni ogen s a a ion. Unde
ni ogen s a a ion condi ions, GlnK in e ac s wi h Am R o induce exp ession o ni ogen
s a a ion genes. In he medium wi h high ni ogen concen a ions, GlnK is seques e ed o
he cy osolic memb ane o in e ac wi h he anspo e Am B, which esul s in blocking
ammonium up ake (S osse e al., 2004).
In Synechocys is sp. PCC 6803, a pho o opic model o ganism ha possesses ou
copies o he sH gene in i s genome, F sH2 is hough o be in ol ed in osmo egula ion
25
In oduc ion
by deg ada ion o he cy oplasmic glycosyl glyce ol (GG) syn hase GgpS (S i nbe g e al.,
2007). This uncomplexed GgpS is deg aded by F sH2 when i ails o o m a complex
wi h he GG phospha e phospha ase GgpP o ca alyze GG syn hesis.
In summa y, F sH is a p o ease wi h many alen s ha deg ades a wide a ie y o
s uc u ally and unc ionally di e se subs a es p esen ei he in he cy oplasm o in he
cy oplasmic memb ane. Nume ous F sH subs a es ha e been iden i ied in a ious
bac e ia and shown in Table 1.2 (Na be haus e al., 2009). Howe e , a g ea deal o F sH
subs a es emain o be disco e ed o cla i y he physiological impo ance o F sH in
p oka yo ic o ganisms as well as in euka yo ic cells (Na be haus e al., 2009).
Fig. 1.8. Schema ic iew o F sH unc ions in E. coli. The hexame ic F sH
p o ease con ols quali y o memb ane p o eins by ei he e olding mis olded p o eins o
deg ading unassembled memb ane p o eins. F sH deg ades λ-encoded subs a es, and is
in ol ed in he supe oxide s ess esponse, hea shock gene exp ession and con ols he
syn hesis o memb ane componen s. IM: inne memb ane; OM: ou e memb ane; LPS:
lipopolysaccha ides. This igu e was aken om Na be haus e al., 2009.
26
In oduc ion
Table 1.2. Iden i ied cy oplasmic subs a es o he F sH p o ease in bac e ia.
Adap o o modula o p o eins and localiza ion o deg ada ion signal a e gi en i
analyzed; ND: no de e mined. This able was aken om he Na be haus e al., 2009.
P o ein O ganism
Adap o /modula o p o eins;
Localiza ion o deg ada ion
signal
Ss A- ag E. coli The ag i sel
λ CII Phage λ/E. coli H lD, H lK/C; C- e minus
Λ CIII Phage λ/E. coli In e nal
Λ Xis Phage λ/E. coli ND
SoxS E. coli N- e minus (Lon)
Fla odoxin E. coli In e nal
LpxC E. coli C- e minus
Kd A E. coli ND
RpoH (σ32) E. coli DnaK/J, G oEL/ES; in e nal
RpoH (σ32) C. c escen us ND
σF C. c escen us ND
σW B. sub ilis ND
SpoVM B. sub ilis In e nal
Spo0E B. sub ilis C- e minus
GgpS Synechocys is sp. PCC 6803 ND
GlnK C. glu amicum ND
1.3. The objec i e o he hesis
As al eady men ioned, a B. sub ilis sH null mu an is iable, bu exhibi s a
pleio opic pheno ype including a d as ically educed spo ula ion e iciency (Deue ling e
al., 1997; Le and Schumann, 2009). Fu he analysis has shown ha he amoun o Spo0A
is signi ican ly educed in such a knockou mu an (Le and Schumann, 2009). I
hypo hesized ha F sH may deg ade one o mo e p o eins in ol ed in educing he le el
o phospho yla ed Spo0A. One spo ula ion-speci ic p o ein has been ecen ly iden i ied,
he phospha ase Spo0E, which speci ically dephospho yla es Spo0A~P (Le and
Schumann, 2009). Since a spo0E sH double knockou es o ed he spo ula ion equency
o only 0.85% (wild ype: ~ 60%), addi ional p o ein(s) ha e o be iden i ied as
subs a e(s) o F sH. The e o e, he objec i e o his doc o al hesis was i s o iden i y
addi ional subs a e p o eins by using wo di e en echniques and second, o unde s and
hei unc ion. Two expe imen al app oaches we e applied. The i s is 2D-gel p o eomics.
27
In oduc ion
The hypo hesis o his app oach is he subs a es migh be o e p oduced in an sH null
mu an when compa ed wi h an sH wild- ype s ain. By he 2D gel elec opho esis
echnique, hese p o eins can be de ec ed and iden i ied by mass spec ome y. Ano he
app oach is called “F sH ap-mu an ”. The aim o his app oach was o cons uc an F sH
mu an which binds subs a es wi hou clea ing hem. The e o e, he subs a es can be
apped in he p o eoly ic chambe o F sH in i o and co-pu i ied wi h F sH by a pull-
down assay. Finally, he ole o he eag gene loca ed downs eam o spo0E was analyzed.
28
Ma e ials and Me hods
2. MATERIALS AND METHODS
2.1. Ma e ials
2.1.1. Bac e ial s ains
The bac e ial s ains used in his s udy a e lis ed in Table 2.1
Table 2.1. Bac e ial s ains used in his s udy
S ains Desc ip ion Sou ce
Esche ichia coli
DH10B mc A Δ(m hsdRMS mc BC) φ80d lacZM15
ΔlacX74 deoR ecA1 a aD139 Δ(a a leu)7697
Be hesda Resea ch
Labo a o ies (BRL)
BL21 E. coli B F– dcm ompT hsdS( B– mB–) gal BRL
A8926 s hC zad-220::Tn10 Δ sH3::kan Ta su a e al., 1998
BHEQ A8926 PIPTG – sHE424Q (AmpR) This s udy
AL60 A8926 PIPTG –GST-F sH (AmpR) Le and Schumann,
2009
Bacillus sub ilis
1012 leuA8 me B5 pC2 hs M1 Sai o e al., 1979
WW01 1012 sH::e m (E mR) Weh l e al., 2000
BH1 1012 Pspo0M - bgaB (NeoR) This s udy
BH2 1012 Pspo0M - bgaB sH::e m (NeoR) (E mR) This s udy
BH3 1012, pbgaB (NeoR) This s udy
BH4 1012 PIPTG-GST- s H ap (CmR) This s udy
BH5 1012 PIPTG-GST- sH+ (CmR) This s udy
BH6 1012 PIPTG-GST (CmR) This s udy
BH7 1012 PIPTG-GST- sH ap ∆ sH::e m (CmR)
(E mR) This s udy
BH8 1012 PIPTG-GST- sH+ ∆ sH::e m (CmR) (E mR) This s udy
29
Ma e ials and Me hods
BH9 1012 PIPTG -GST ∆ sH::e m (CmR) (E mR) This s udy
AB07 1012 ∆spo0E::bleo (BleoR) Le and Schumann,
2009
AM01 1012 ∆eag::pMUTIN4 (E mR) A. Maie
AM02 1012, Psk -lacZ, eag::Pmu in4 (SpcR) (E mR) A. Maie
AM03 1012, amyE::Psk -lacZ, (SpcR) A. Maie
2.1.2. Plasmids
The plasmids used in his s udy a e lis ed in Table 2.2
Table 2.2. Plasmids used in his s udy
Name Desc ip ion Re e ence
pBgaB In eg a ion plasmid ca ying he p omo e -less
bgaB gene, NeoRMogk e al., 1996
pBH1 spo0M p omo e inse ed in o pBgaB, NeoR This s udy
pGEX-2T Exp ession ec o wi h GST- ag, AmpR Ame sham
pBH2 pGEX-2T wi h GST – spo0M usion, AmpRLe and Schumann,
2009
pGST- sH sH+ gene om B. sub ilis inse ed in o pGEX-
2T, AmpRThis s udy
pBH3 pGEX2T ca ying sHE424Q mu an , AmpR This s udy
pHT08
A plasmid-based exp ession ec o o B.
sub ilis wi h he IPTG-inducible Pg ac p omo e ,
CmRNguyen e al., 2007
pBH4 Fusion GST - sHE424Q mu an inse ed in o
pHT08, CmR This s udy
pBH5 Fusion GST- sH+ inse ed in o pHT08, CmRThis s udy
pBH6 GST inse ed in o pHT08, CmRThis s udy
pMUTIN4 In eg a ion plasmid o c ea e a gene usion wi h
he lacZ epo e gene, E mR Vagne e al., 1998
pMUTIN4-
eag eag gene inse ed in o pMUTIN4, E mRA. Maie
30
Ma e ials and Me hods
2.1.3. Oligonucleo ides
The oligonucleo ides used in his s udy a e lis ed in Table 2.3
Table 2.3. Oligonucleo ides used in his s udy
Name Sequence (5’ o 3’) Desc ip ion
ON01 CACCAGGAATTCATCGGTCTAAACTGA
AATCG
5’ end o spo0M
p omo e
ON02 CACCAGGAATTCTCCGGCACTTGCCGC
AAGCTT
3’ end o spo0M
p omo e
ON03 TCTGTTGGATCCATGTCATTTTTTAAGA
AGCTTGCGGCA
5’ end o spo0M
gene
ON04 TCCCGGGGATCCCTATTACTCAACGTA
TTGGTCTAGGATCT
3’ end o spo0M
gene
ON05 CTTATCACCAAGGCGGACACACCGT
mu agenic p ime
wi h subs i u ion o
F sHE424Q
ON06 CAATTCAAGCTTGTCACGATTTTCAGTC
AGGA
lanking a 3’ end
o sH gene
ON07 CACCATGGATCCATGAATCGGGTCTTC
CGTAATACCA 5’ end o sH gene
ON08 CACCATGACGTCATGTCCCCTATACTA
GGTTATTGGA 5’ end o sH gene
ON09 CACCATGACGTCATTACTCTTTCGTATC
GTCTTTCT 3’ end o sH gene
ON10 CACCATGGATCCATGTCCCCTATACTA
GGTTATTGGA 5’ end o GST gene
ON11 CTGGTGGGATCCTTATCAAACAGATGC
ACGACGAGATCCA 3’ end o GST gene
2.1.4. Media
Lu ia-Be ani b o h (LB medium): 1 % (w/ ) yp one, 0.5 % (w/ ) yeas ex ac , 1
% (w/ ) NaCl.
Di co Spo ula ion Medium (DSM): 0.8 % (w/ ) Nu ien B o h, 0.1 % (w/ ) KCl
and 1 mM MgSO4.7H2O. Adjus he pH o 7.4 wi h KOH. A e au ocla ing, he medium
was supplied wi h 0.5 mM CaCl2, 0.01 mM MnCl2 and 0.001 mM FeCl2
Aga was added o 1.5 % (w/ ) o p epa e pla es.
31
Ma e ials and Me hods
2.1.5. An ibio ics
Concen a ions o he an ibio ics used in his s udy a e gi en in Table 2.4.
Table 2.4. An ibio ic solu ions used in his s udy
An ibio ic Concen a ion o s ock
solu ion (mg/ml) Dissol ed in
Final
concen a ion
(μg/ml)
Ampicillin 50 - 100 70% e hanol 100
Chlo amphenicol 20 E hanol 10
E y h omycin 1 o 100 E hanol 1 o 100
Neomycin 10 Wa e 10
Spec inomycin 100 Wa e 100
Bleomycin 20 Wa e 1 o 5
2.1.6. Chemicals and enzymes
All s anda d enzymes and chemicals used o common bu e s and solu ions we e
pu chased om Sigma-Ald ich, Me ck o Ro h, Ka ls uhe, Ge many. O he chemicals,
solu ions, bu e s and ki s we e pu chased om he supplie s lis ed below:
− New England Biolabs: Taq DNA polyme ase, T4 DNA-Ligase
− Fe men as: Res ic ion enzymes, DNA ladde and P o ein Molecula Weigh
Ma ke
− Ame sham: ECL™ Reagen , an ibody
− Pie ce: Di hiobis[succinimidyl p opiona e] (DSP) c oss linke
− Qiagen: PCR pu i ica ion ki , gel-ex ac ion ki , midi pu i ica ion ki
− Roche: Comple e P o ease inhibi o cock ail, Alkaline phospha ase, Lysozyme,
P o einase K, RNase A
32
Ma e ials and Me hods
2.1.7. An ibodies
Table 2.5. An ibodies used in his s udy
Name Dilu ion o
Immunoblo ing Re e ence
Spo0A 1 : 5000 Fuji a e al., 2005
GST 1 : 5000 Ame shamTM
An i-Rabbi IgG 1: 10000 Ame shamTM
2.2. Me hods
2.2.1. Iden i ica ion o F sH subs a es by p o eomics
2.2.1.1. G ow h condi ions
B. sub ilis s ains 1012 and i s isogenic sH mu an (WW01) we e cul i a ed a
37oC unde igo ous agi a ion in Di co Spo ula ion Medium (DSM), e y h omycin was
added o a inal concen a ion o 50 μg/ml du ing cul i a ion o WW01 s ain
(∆ sH::e m). Samples we e aken a s age 0 ( o) and expe imen s we e epea ed wice.
2.2.1.2. Sample p epa a ion
Cells we e ha es ed a s age 0 ( o) by cen i uga ion (6.000 x g, 4oC, 10 min),
washed in TE bu e (10 mM T is, pH 7.5, 1 mM EDTA), esuspended in TE u ea bu e
(8 M u ea, 2 M hio-u ea) and dis up ed by ul asonica ion. A e cen i uga ion (20,000 x
g, 4°C, 30 min), he p o ein concen a ion o he ex ac was de e mined wi h he
Ro iNanoquan Ki (Ro h, Ka ls uhe, Ge many).
2.2.1.3. Two-dimensional polyac ylamide gel elec opho esis (2D-PAGE)
To sepa a e by 2D-PAGE, p o ein ex ac s (500 mg p o ein/sample) we e loaded
on o duplica e immobilized pH g adien (IPG) s ips, pH 4-7 by ehyd a ion o 18-24 h in
33
Ma e ials and Me hods
2.2.2.3. Complemen a ion o he sH alleles in an sH knockou s ain
2.2.2.3.1. Mo phology complemen a ion in he wild- ype and sH ap
Cells o sH knockou s ains BH7 and BH8 allowing sH ap and sH+
exp ession unde con ol o he IPTG-inducible Pg ac p omo e we e g own in DSM
medium, induced wi h IPTG a an OD578 o 0.5, collec ed samples a s a iona y phase,
washed and esuspended in ddH2O. Mix u es o 5 μl o suspensions wi h 10 μl o 1%
aga ose we e sp ead on o a glass slide and he cell’s mo phology was obse ed unde he
mic oscope.
2.2.2.3.2. Spo ula ion complemen a ion
B. sub ilis s ains we e inocula ed in o DS medium and incuba ed wi h shaking
o 24 h a 37oC. The expe imen s we e epea ed wice. Cells we e ha es ed om 10 ml
cul u es, esuspended in 1 ml po assium phospha e bu e (10 mM K2HPO4, 50 mM KCl,
1 mM MgSO4) and hea ed o 30 min a 80oC. Samples o he hea ed cul u es as well as o
he un ea ed pa en al cul u e we e dilu ed and pla ed on DS medium o iable cell
coun ing.
2.2.2.4. Iden i ica ion o F sH subs a es by he pull-down assay
2.2.2.4.1. Sample p epa a ion o p o ein apping in i o
S ains BH7, BH8, BH9 o exp ession o GST-F sH ap, GST-F sH+ and GST,
espec i ely, we e ou inely g own in 1 li e o DSM wi h chlo amphenicol 5 μg/ml and
e y h omycin 1 μg/ml a 37oC o an OD578 o 0.5, induced wi h 0.1 mM IPTG and u he
g own un il cells eached he ansi ion s a e (s age 0 o spo ula ion). The expe imen s
we e epea ed h ee imes.
Then, he cul u es we e aken and chilled. Cells we e ha es ed by
cen i uga ion a 4oC, 8.000 x g, washed and esuspended in 7 ml o lysis bu e (140 mM
NaCl, 1,8 mM KH2PO4, 27 mM KCl, 10 mM Na2HPO4, 5% glyce ol, pH 7.3) con aining
20 mM DTT, 10 μl Comple e P o ease Inhibi o Cock ail (Roche Diagnos ics). Cells we e
dis up ed by using a Mixe Mill a 15 Hz, 5 x 30s.
40
Ma e ials and Me hods
2.2.2.4.2. Ex i o c oss - linking wi h DSP
A e dis up ion o he cells by he Mixe Mill, eshly DSP (Di hiobis-
[succinimidylp opiona e]) s ock a 100 mg/ml was p epa ed in DMSO, 150 μl DSP s ock
was added in o 7 ml cell lysa e and allowed c oss-linking eac ion p oceeding o 5 min a
oom empe a u e. Then, he un eac ed DSP was quenched by adding 100 mM T is pH
8.5, and s i ed o 5-10 min a oom empe a u e.
A e c ossed linking wi h DSP, he lysa es we e cen i uged o 30 min a
21.000 x g o sepa a e he cy oplasmic ac ion (supe na an ) om he memb ane ac ion
(pelle ). The memb ane p o eins in he pelle we e solubilized wi h he non-ionic de e gen
NP-40 ( inal concen a ion 0.5%), he cell deb is we e emo ed by cen i uga ion (25.000
x g, 4oC, 30 min) and collec ed as he supe na an con aining memb ane ac ion.
2.2.2.4.3. Pull-down assay o F sH subs a e apping in i o
The memb ane ac ion and he supe na an we e added o 1 ml glu a hione
aga ose beads, gen ly agi a ed a 4oC o 4 h, washed wi h 5 olumes o PBS bu e (140
mM NaCl, 1.8 mM KH2PO4, 10 mM Na2HPO4, 2.7 mM KCl, pH 7.3), elu ed in 0.5 ml
elu ion bu e (10 mM GSH educed glu a hione in 50 mM T is-HCl, pH 8.0), and he
elu ion ac ion was aken o analyses by SDS-PAGE. The p o ein bands we e de ec ed
by sil e s aining and indi idual p o eins we e iden i ied by Mass spec ome y.
2.2.2.5. SDS-PAGE and Wes e n blo ing
Sodium dodecyl sul a e polyac ylamide gel elec opho esis (SDS-PAGE) was
pe o med acco ding o he me hod o Laemmli (1970) using 10, 12 o 15% SDS-
polyac ylamide gels.
Wes e n blo ing was pe o med as desc ibed by Towbin e al., (1979) wi h he
de ec ion s ep using an ECL Wes e n blo ing de ec ion ki (Ame sham). The signals we e
eco ded by he LAS4000 machine (Fuji ilm) and analyzed by Mul i Gauge Ve 3.1
So wa e (Fuji ilm).
41
Ma e ials and Me hods
2.2.2.6. Sil e S aining
Gels we e ixed by Fixing Solu ion (50% E hanol, 10% glacial ace ic acid, 0.05%
o malin [35% o maldehyde]) and hen shaken o 1 h. Gels we e insed wi h Rinse
Solu ion (50% E hanol) and shaken o 5 min (2X). The Rinse Solu ion was eplaced wi h
Sensi ize (0.02% sodium hiosulpha e), shaken o 2 min and hen washed wi h milli-Q
wa e and shaken o ano he 2 min. Gels we e s ained wi h S aining solu ion (0.2% sil e
ni a e, 0.075% o maldehyde 37% / ) and shaken o 20 min. Then, he gel was washed
wi h wa e o 1 min (5 - 6X) and de eloped wi h De elope Solu ion (5% sodium
ca bona e, 0.05% o maldehyde 37% / , 0.0004% sodium hiosulpha e), shaken o 5 -
10 min as equi ed. A S op Solu ion was added o s op he eac ion. Gels we e washed
wi h milli-Q wa e (3X) and kep a 4ºC in 1% glacial ace ic acid o analyses and F sH
subs a e iden i ica ion by mass spec ome y.
42
Resul s
3. RESULTS
3.1. Iden i ica ion o F sH subs a e p o eins by p o eomics
3.1.1. Iden i ica ion o he Spo0M p o ein as a pu a i e subs a e o F sH by 2D-gel
elec opho esis
To iden i y pu a i e subs a es o F sH, he p o eomes o a wild ype sH and i s
isogenic sH::e m knockou s ain aken a s age 0 we e analyzed by 2D-gel
elec opho esis and indi idual p o ein spo s we e iden i ied by mass spec ome y. The
p o ein quan i y o each spo in bo h s ains was compa ed and analyzed by he Del a 2D
so wa e. App oxima ely 50 p o eins we e s ongly inc eased o dec eased in he sH
knockou s ain as compa ed o he wild ype s ain (Table 3.1 and Table 3.2). Acco ding
o he Sub iLis unc ional ca ego ies, he iden i ied p o eins we e classi ied in o
unc ional g oups and mos o hem pe o m basic me abolic unc ions in he cell such as
ansla ion, amino acid me abolism, glycolysis and being pa o he ica boxylic acid
(TCA) cycle (Table 3.3 and Table 3.4).
43
Resul s
Table 3.1. Lis o p o eins inc easing in an sH knockou s ain
No. Ra io Accession
numbe P o ein name
1 4.54962 Spo0M Spo ula ion-con ol gene
2 3.73728 YjoA Unknown simila o unknown p o eins
3 3.13626 Tk T anske olase
4 3.04021 Tu A Elonga ion ac o Tu
5 2.84877 GlnA Glu amine syn he ase
6 2.59722 YoxD Unknown simila o 3-oxoacyl- acyl-ca ie p o ein
educ ase
7 2.38021 SodA Supe oxide dismu ase
8 2.36637 YjbG Unknown simila o oligoendopep idase
9 2.3513 Icd Isoci a e dehyd ogenase
10 2.34449 Da P obable D-alanine amino ans e ase
11 2.31573 FabI Enoyl-acyl ca ie p o ein educ ase
12 2.31573 Y qH Unknown simila o unknown p o eins om B.
sub ilis
13 2.31118 Ddl D-Alanyl-D-alanine ligase A
14 2.31118 Pgk Phosphoglyce a e kinase
15 2.28535 Y gN Unknown simila o dehyd ogenase
16 2.27029 BkdB Lipoamide acyl ans e ase
17 2.19324 YceC Unknown simila o ellu ium esis ance p o ein
18 2.19095 Hag Flagellin p o ein
19 2.15821 Pyk Py u a e kinase
20 2.12796 Tpx P obable hiol pe oxidase
21 2.0957 Eno Enolase
22 2.0957 SucC Succinyl-CoA syn he ase (be a subuni )
23 2.08144 Y aB Unknown simila o NAD(P)H dehyd ogenase
(quinine)
24 2.05179 Gc PB P obable glycine deca boxylase (subuni 2)
25 2.05179 YumC Unknown simila o hio edoxin educ ase
26 2.00393 AsnS Aspa aginyl- RNA syn he ase
27 2.00393 CysS Cys einyl- RNA syn he ase
28 2.00393 DhaS Aldehyde dehyd ogenase
44
Resul s
Table 3.2. Lis o p o eins dec easing in an sH knockou s ain
No. Ra io Accession
numbe P o ein name
1 0.49203 D m Phosphopen omu ase
2 0.49203 RocD O ni hine amino ans e ase
3 0.48638 GapB Glyce aldehyde-3-phospha e dehyd ogenase
4 0.48287 Py AB Ca bamoyl-phospha e syn he ase (ca aly ic
subuni )
5 0.48002 CysC Pu a i e adenylylsul a e kinase
6 0.48002 Py H U idyla e kinase
7 0.47701 NusG T ansc ip ion an i e mina ion ac o
8 0.46497 PnpA Polynucleo ide phospho ylase (PNPase)
9 0.46428 Fm Me hionyl- RNA o myl ans e ase
10 0.44283 ResD Two-componen esponse egula o in ol ed in
ae obic and anae obic espi a ion
11 0.44283 SucD Succinyl-CoA syn he ase (alpha subuni )
12 0.44091 PdhC Py u a e dehyd ogenase (dihyd olipoamide
ace yl ans e ase E2 subuni )
13 0.43359 Upp U acil phospho ibosyl ans e ase
14 0.42343 OppD
Oligopep ide ABC anspo e (ATP-binding
p o ein) (ini ia ion o spo ula ion, compe ence
de elopme
15 0.41514 RocG Glu ama e dehyd ogenase (majo )
16 0.39438 OdhA 2-Oxoglu a a e dehyd ogenase (E1 subuni )
17 0.38879 IolD Myo-inosi ol ca abolism
45
Resul s
Table 3.3. Func ional g oups o p o eins inc easing in he absence o F sH
acco ding o he Sub iLis da abase
COGs P o ein
Name Func ional g oups
In o ma ion s o age and p ocessing
COG0050J Tu A Elonga ion ac o Tu
COG0017J AsnS Aspa aginyl- RNA syn he ase
COG0215J CysS Cys einyl- RNA syn he ase
Cellula p ocesses and signaling
COG2310T YceC Unknown simila o ellu ium esis ance p o ein
COG1181M Ddl D-alanyl-D-alanine ligase A
COG1344N Hag Flagellin p o ein
COG2077O Tpx P obable hiol pe oxidase
COG0492O YumC Unknown simila o hio edoxin educ ase
Me abolism
COG0538C Icd Isoci a e dehyd ogenase
COG0508C BkdB Lipoamide acyl ans e ase
COG0045C SucC Succinyl-CoA syn he ase (be a subuni )
COG1012C DhaS Aldehyde dehyd ogenase
COG0021G Tk T anske olase
COG0126G Pgk Phosphoglyce a e kinase
COG0469G Pyk Py u a e kinase
COG0148G Eno Enolase
COG0174E GlnA Glu amine syn he ase
COG1003E Gc PB P obable glycine deca boxylase (subuni 2)
COG0115EH Da P obable D-alanine amino ans e ase
COG0623I FabI Enoyl-acyl ca ie p o ein educ ase
COG1182I Y aB Unknown simila o NAD(P)H dehyd ogenase (quinone)
COG0605P SodA Supe oxide dismu ase
Gene al unc ion p edic ion only - unc ion unknown
COG4326R Spo0M Spo ula ion-con ol gene
COG0300R YoxD Unknown simila o 3-oxoacyl- acyl-ca ie p o ein
educ ase
- NA - YjbG Unknown simila o oligoendopep idase
- NA - Y qH Unknown simila o unknown p o eins om B. sub ilis
COG0656R Y gN Unknown simila o dehyd ogenase
COG2318S YjoA Unknown simila o unknown p o eins
COG: Clus e s o O hologous G oups; NA: No A ailable
46
Resul s
Table 3.4. Func ional g oups o p o eins dec easing in he absence o F sH
acco ding o Sub iLis da abase
COGs P o ein
Name Func ional g oups
In o ma ion s o age and p ocessing
COG1185J PnpA Polynucleo ide phospho ylase (PNPase)
COG0223J Fm Me hionyl- RNA o myl ans e ase
COG0250K NusG T ansc ip ion an i e mina ion ac o
Cellula p ocesses and signaling
COG0745TK ResD Two-componen esponse egula o in ol ed in ae obic
and anae obic espi a ion
Me abolism
COG0074C SucD Succinyl-CoA syn he ase (alpha subuni )
COG0508C PdhC Py u a e dehyd ogenase (dihyd olipoamide
ace yl ans e ase E2 subuni )
COG0567C OdhA 2-Oxoglu a a e dehyd ogenase (E1 subuni )
COG1015G D m Phosphopen omu ase
COG0057G GapB Glyce aldehyde-3-phospha e dehyd ogenase
COG4992E RocD O ni hine amino ans e ase
COG0444EP OppD Oligopep ide ABC anspo e (ATP-binding p o ein)
(ini ia ion o spo ula ion, compe ence de elopme
COG0334E RocG Glu ama e dehyd ogenase (majo )
COG3962E IolD Myo-inosi ol ca abolism
COG0458EF Py AB Ca bamoyl-phospha e syn he ase (ca aly ic subuni )
COG0528F Py H U idyla e kinase
COG0035F Upp U acil phospho ibosyl ans e ase
COG0529P CysC P obable adenylylsul a e kinase
The p o eomic app oach was used o iden i y F sH subs a es o unde s and he
unc ion o F sH du ing spo ula ion. I hypo hesize ha hese p o ein subs a es a e
supposed o be o e p oduced in an sH knockou and unc ion du ing spo ula ion. As a
esul , among 28 p o eins signi ican ly inc eased in he absence o F sH, he mos
abundan p o ein was iden i ied as Spo0M wi h i s p edic ed unc ion as a spo ula ion
con ol gene. The Spo0M le el inc eased abou 4.5- old in he sH null mu an (Fig. 3.1).
The spo0M gene has been shown o con ol spo ula ion du ing he p ocess om
s age 0 o s age II (Han e al., 1998). An σH-like p omo e has been de ec ed in he
ups eam egion o spo0M, and i has also been shown o be down- egula ed by benzoa e
a pH 7.0 o by a low ex e nal pH (Ki ko e al., 2009). A spo0M null mu an is iable,
47
Resul s
blocked a s age 0, and i s spo ula ion equency is educed by 20- o 100- old. I he
spo0M gene is inse ed in o a high-copy numbe plasmid, he spo ula ion equency is
educed, indica ing ha o e p oduc ion o he Spo0M p o ein esul s in a nega i e e ec
on spo ula ion (Han e al., 1998).
Since Spo0M is o e p oduced a he beginning o s age 0 in he absence o F sH,
we i s asked whe he F sH egula es exp ession o Spo0M di ec ly o indi ec ly.
Figu e 3.1. Compa a i e p o eomics o a wild ype sH and null mu an s ain. (A)
S ains 1012 ( sH+) and (B) WW01 ( sH::e m) we e g own in DSM o s age 0 a 37°C.
Then, in acellula p o eins we e sepa a ed by 2D elec opho esis. P o eins we e
sepa a ed by a pH g adien o 4 o 7 in he i s dimension ollowed by he second
dimension sepa a ion o SDS-PAGE. Gels we e s ained by Coomassie b illian blue, and
he p o ein spo o Spo0M is indica ed.
3.1.2. F sH does no in luence exp ession o spo0M
In p inciple, F sH could egula e he amoun o Spo0M indi ec ly h ough
modula ion o a nega i e egula o o di ec ly h ough i s deg ada ion. To analyze o an
indi ec in luence, he p omo e egion o spo0M was ansc ip ionally used o he bgaB
epo e gene and cells ca ying he bgaB epo e gene we e allowed o spo ula e in DS
medium (DSM). A he beginning o he s a iona y phase, samples we e emo ed a
in e als and assayed o β-galac osidase ac i i y in he wild ype sH and he isogenic
knockou s ain. The esul s a e shown in Fig. 3.2.
Du ing ansi ion om he exponen ial g ow h phase o he s a iona y phase,
exp ession o bgaB used o he spo0M p omo e clea ly inc eased, while he bgaB
48
Resul s
ac i i y was no exp essed om he ec o con ol (bgaB gene wi hou spo0M p omo e
usion) (Fig. 3.2, s ain BH3). No di e ence in he BgaB ac i i y was ound be ween he
wild- ype sH and i s isogenic inse ion mu an (Fig. 3.2, s ain BH1 and BH2). This
esul clea ly demons a es ha F sH is no in ol ed in egula ion o ansc ip ion o
spo0M.
Figu e 3.2. F sH does no in luence ansc ip ion o spo0M. B. sub ilis s ains BH1,
BH2 and BH3 con aining plasmid pBH1 (Pspo0M-bgaB), pBH1 wi h an sH::e m knockou
and a p omo e - es ec o pBgaB, espec i ely, we e g own in DSM a 37°C, and
aliquo s we e wi hd awn a he indica ed ime poin s o measu emen o
β
-galac osidase
ac i i ies whe e 0 indica es en y in o he ansi ion phase.
3.1.3. Spo0M is con i med as a subs a e p o ein o F sH by an in i o deg ada ion
expe imen
Since F sH is no in ol ed in he egula ion o ansc ip ion o spo0M, I assumed
ha i di ec ly modula es Spo0M ac i i y by deg ada ion. The e o e, he in i o
deg ada ion o Spo0M by F sH was es ed. Fi s , he Spo0M used ansla ionally o a
GST- ag, was o e p oduced and pu i ied. The pu i ied GST-Spo0M usion was incuba ed
wi h pu i ied GST-F sH in he p esence and absence o ATP. Reac ions we e ca ied ou
unde s anda d condi ions as desc ibed (Tomoyasu e al., 1995).
49
Resul s
con i m his assump ion, isola ion o GST-F sH ap was ca ied ou using bo h he
cy oplasmic and he memb ane ac ion. The e ec o DSP c oss-linking on apping
subs a e p o eins in i o was also examined by compa ison o he amoun o pu i ied
p o eins in bo h he p esence and absence o DSP. The pu i ied and co-pu i ied p o eins
we e esol ed by SDS-PAGE and isualized by sil e -s aining. The esul s a e shown in
Fig. 3.7.
As expec ed, mos o he GST-F sH ap p o ein was de ec ed in he memb ane
ac ion, while he majo o soluble GST exp essed in s ain BH9 was p esen in he
cy oplasmic ac ion. Unexpec edly, he c oss-linking expe imen was no e ec i e
enough o apping o subs a e p o eins. As shown in Fig 3.7, he amoun o pu i ied and
co-pu i ied p o eins de ec ed a e c oss-linking is e y low in compa ison wi h hose
p epa ed in he absence o c oss-linke . I is known ha c oss-linking can c ea e p o ein
agg ega es, which can no be esol ed by SDS-PAGE (The mo Scien i ic, Pie ce
C osslinking Technical Handbook). Indeed, c oss-linking expe imen s a e di icul o be
ca ied ou because hey equi e an op imal amoun o c oss-linke o each speci ic
expe imen . Ano he disad an age o c oss-linking is ha hey make da a analysis become
di icul and un eliable due o non-speci ic in e ac ions (The mo Scien i ic, Pie ce
C osslinking Technical Handbook). The e o e, we decided o con inue he F sH ap
expe imen in i o wi hou c oss-linking.
56
Resul s
DSP - + - + - + - + - + - +
F sH+F sH ap GST F sH+F sH ap GST
cy oplasmic ac ion memb ane ac ion
14.4
18.4
25.0
35.0
45.0
66.2.
116.0
GST
GST-F sH
Figu e 3.7. Analysis o pu i ied F sH and co-pu i ied p o eins in he absence o
p esence o he DSP c oss-linke in he cy oplasmic and he memb ane ac ion. DSP
c oss-linke was ei he added (+) o omi ed (-), as indica ed, cy oplasmic and memb ane
ac ions o s ains BH7 (GST-F sH ap), BH8 (GST-F sH+), BH9 (GST) we e pu i ied,
sepa a ed by 15% SDS-PAGE and isualized by sil e s aining.
3.2.4. Iden i ica ion o po en ial F sH subs a e by SDS-PAGE and sil e s aining
The expe imen s o p o ein apping in i o in s ains BH7, BH8 and BH9 we e
epea ed a leas h ee imes, and samples we e aken o pu i ica ion and SDS - PAGE
analysis. P o eins we e esol ed in a 10% SDS-PAGE o iden i y he po en ial F sH
subs a es wi h a molecula weigh highe han 25 kDa and in a 15% SDS-PAGE o de ec
he F sH subs a es wi h a molecula weigh lowe han 25 kDa. The e we e se en p o ein
bands apped in he F sH ap s ain and no p esen in he F sH+ s ain numbe ing om 1 o
7 in he gels (Fig. 3.8 & 3.9). All hese bands and he egions (si es) co esponding o
hese bands in he GST-F sH+ s ain we e excised and sen o mass spec ome y analysis.
57
Resul s
F sH ap GST
F sH+
Figu e 3.8. Analysis o p o eins by 10% SDS-PAGE a e copu i ica ion wi h GST-
F sH+ and GST-F sH ap. P o ein bands copu i ying wi h GST-F sH ap bu no wi h F sH+
and GST we e numbe ed om 1 o 6 and excised o mass spec ome y iden i ica ion.
Figu e 3.9. Analysis o p o eins by 15% SDS-PAGE a e copu i ica ion wi h GST-
F sH+ and GST-F sH ap. Only one band numbe ed “7a” was de ec ed in GST-F sH ap
bu no in GST-F sH+ and GST samples. A band numbe ed “7b” in lane 2 supposed o be
a con amina ed p o ein om lane 1 and band “7a” we e excised and iden i ied by mass
spec ome y.
25.0
.0
.0
66.2.
6.
35
45
11
8
9
1
2
3
4
5
6
7
GST-F sH
4
56
3
1
2
GST
116.0
62.2
45.0
35.0
1 2 3 4 5 6 7 8 9 10
F sH+F sH ap GST
25.0
18.4
14.4 7b 7a
58
Resul s
3.2.5. YwnF was iden i ied as a po en ial subs a e o F sH
The names o he apped p o ein bands iden i ied by mass spec ome y a e
p esen ed in Table 3.6.
Table 3.6: Iden i ica ion o p o ein bands apped by GST-F sH ap
Numbe o he
p o ein band P o ein name
1 F sH
2 F sH
3 F sH
4 F sH
5 GST
6 GST
7a YwnF
7b Unknown
Mos o he p o ein bands iden i ied co esponded o F sH (bands 1 o 4)
sugges ing ha GST-F sH ap was pa ially deg aded in i o. P o ein bands 5 and 6
e ealed as GST al hough hei size as de e mined by SDS-PAGE u ned ou o be highe
han he calcula ed molecula mass. Rema kably, a s ong p o ein band o abou 17 kDa
pulled-down clea ly by GST-F sH , bu no by GST-F sH was iden i ied as YwnF
ap +
p o ein. I is a small p o ein wi h 144 amino acids and p edic ed as a memb ane p o ein
wi h wo ansmemb ane domains in ol ing amino acids 31-53 and 63-80, he unc ion o
which is s ill unknown (www.Unip o .o g).
The band “7b” a lane 2 (Fig 3.9) wi h he same size o YwnF is o unknown
o igin and could be a con amina ing p o ein p esen in B. sub ilis. Possibly, i ep esen s
he β-lac oglobulin o milk om sheep because he 18.4 kDa band o molecula weigh he
ladde in lane 1 consis o he β-lac oglobulin p esence sheep’s milk so ha he mass
spec ome y could no iden i y i s name om he p o ein da abank o B. sub ilis.
In summa y, by using he GST-F sH app oach, one apped p o ein, YwnF, was
ap
iden i ied as a pu a i e p o ein subs a e o F sH. Howe e , u he expe imen s in i o
and in i o showing deg ada ion o his apped p o ein by F sH a e equi ed o cla i y and
con i m his conclusion.
59
Resul s
3.3. Is he Eag p o ein in ol ed in he egula ion o he ac i i y o Spo0E?
The eag gene has been iden i ied as an open eading ame downs eam o he
spo0E gene coding o a phospha ase (Pe ego and Hoch, 1987), whe e eag s ands o
spo0E-associa ed gene. I codes o a p o ein o 143 amino acids wi h a molecula weigh
o 16.4 kDa. Eag p o ein is p edic ed o be an in eg al inne memb ane p o ein wi h wo
po en ial ansmemb ane segmen s. Since no p omo e has been iden i ied ups eam o
eag, i is assumed ha i o ms a po en ial bicis onic ope on wi h spo0E (Pe ego and
Hoch, 1987). Is eag in ol ed in spo ula ion as desc ibed o he ups eam gene, spo0E?
Since Spo0E has been iden i ied as a subs a e o F sH (Le and Schumann, 2009), we
specula e ha he Eag p o ein o s ill unknown unc ion migh be in ol ed in egula ion o
he syn hesis o ac i i y o he Spo0E phospha ase. To es his hypo hesis, we i s
isola ed an eag dis up an mu a ion by in eg a ion o a comple e plasmid he eby
des oying he eading ame o eag.
3.3.1. Cons uc ion o an eag null mu an by inse ion o he pMUTIN4 in eg a ion
ec o
The in eg a ion ec o pMUTIN4 has been widely used o cons uc inse ion
mu an s in ch omosomal genes o B. sub ilis (Vagne e al., 1998). This ec o plasmid is
unable o eplica e in B. sub ilis and allows usion o he p omo e -less lacZ-gene o he
p omo e o he gene o become inac i a ed (Vagne e al., 1998). In a i s s ep, abou 300
bp o he gene o be inac i a ed a e ampli ied by PCR and inse ed in on o he lacZ
epo e gene. Nex , his ecombinan plasmid is ans o med in o he app op ia e B.
sub ilis s ain, and inse ion mu an s a e selec ed on e y h omycin-con aining pla es.
Inse ion a he co ec si e is con i med by Sou he n-blo ing. By using his echnology,
s ain AM01 was ob ained.
Is he eag gene exp essed du ing spo ula ion? To answe his ques ion, s ain
AM01 was g own in DSM and aliquo s we e wi hd awn be o e and a di e en ime
poin s a e 0. S ain y dB::pMUTIN4 was analysed as a con ol. The gene y dB does no
play a ole du ing spo ula ion. Measu emen o he β-galac osidase ac i i ies o bo h
s ains a e p esen ed in Fig. 3.11. While he β-galac osidase ac i i ies o he y dB inse ion
mu an d opped om 8 o abou 2 uni s when cells en e ed he ansi ion phase, ha o he
60
Resul s
eag::pMUTIN4 s ain inc eased om 1 o 5.5 uni s (Fig. 3.11). This esul indica es ha
eag is induced du ing phase 0 o spo ula ion.
1 2 3
W
T
∆
eag::pMUTIN4
-1 0 1
∆spo0E::bleo
Fig. 3.10. Wes e n blo analysis o de ec he amoun o Spo0A in wild ype B. sub ilis
and wo knockou s ains. Cells we e g own in DSM a 37oC and aliquo s we e aken a
he ime poin indica ed ( -1, 0, ) and analysed by Wes e n blo using Spo0A an ibodies.
Fig. 3.11.
β
-Galac osidase ac i i ies o s ains y dB::pMUTIN4 and eag::pMUTIN4.
Cells we e g own in DSM a 37oC and aliquo s we e aken a he ime poin indica ed ( 0,
1, 2, 3) and analysed o
β
-galac osidase ac i i ies.
61
Resul s
3.3.2. Does he eag gene a ec he spo ula ion equency?
S ain AM01 (eag::pMUTIN4), 1012 (posi i e con ol) and AB07 (spo0E::bleo)
we e g own in DSM, and spo es we e p epa ed and analyzed as desc ibed unde Ma e ials
and Me hods. The esul s in Table 3.7 show ha he wild ype s ain 1012 exhibi ed a
spo ula ion equency o abou 52%, while ha o i s isogenic spo0E::bleo de i a i e was
82% ha he spo ula ion equency is inc eased in he absence o he Spo0E phospha ase
has al eady published (Pe ego and Hoch, 1991) and con i med by ou g oup (Le and
Schumann, 2009). Inac i a ion o he eag gene esul ed in a sligh ly inc eased spo ula ion
equency as compa ed o he wild ype s ain (58 e sus 52%, see Table 3.7). This esul
sugges s a nega i e in luence o eag on he spo ula ion p ocess.
Table 3.7. The spo ula ion equencies o he B. sub ilis s ains 1012,
eag::pMUTIN4 and spo0E::bleo.
S ains Viable cells/ml Spo es/ml Spo ula ion
equency
1012 4.8 x 1082.5 x 1080.52
1012, eag::pMUTIN4 6.8 x 1083.9 x 1080.58
1012, spo0E::bleo 6.2 x 1085.1 x1080.82
3.3.3. Does he eag gene in luence he amoun o Spo0A p o ein?
Spo0A is he mas e egula o o he spo ula ion phase 0. This p o ein becomes
phospho yla ed h ough he phospho elay (Bu bulys e al., 1991), and Spo0A~P is a
DNA-binding p o ein which ac s ei he as an ac i a o o a ep esso depending on he
loca ion o he binding si e e med OA-box (Pe ego e al., 1988). Spo0A~P egula es a
o al o 121 genes di ec ly (Fuji a e al., 2005).
Spo0A~P is subjec o di ec egula ion o i s ac i i y o he phospha ase Spo0E
(S ephenson and Pe ego, 2002). This phospha ase speci ically dephospho yla es
Spo0A~P. Nex , we asked whe he eag can in luence he amoun o Spo0A p oduced.
Two di e en expe imen s we e ca ied ou o answe his ques ion. Fi s , we di ec ly
isualized o Spo0A by immunoblo ing and second, we measu ed he enzyma ic ac i i y
o a ansc ip ional usion dependen on he amoun o ac i e Spo0A. Th ee di e en
s ains, wild ype 1012 and i s isogenic inse ion mu an s spo0E::bleo and eag::pMUTIN4
62
Resul s
we e g own in DSM and aliquo s we e wi hd awn a di e en ime poin s be o e and a e
en y in o he ansi ion phase. The Spo0A p o ein p esen in hese aliquo s was isualized
by an immunoblo using an ibodies aised agains Spo0A. As al eady published, he
amoun o Spo0A in wild ype cells was below he de ec ion le el a -1, s a ed o appea
a 0 and u he inc eased a 1 (Fig. 3.10). When he spo0E::bleo s ain was analysed, in
con as o he wild ype ex ac s, Spo0A was al eady p esen a -1 and accumula ed o a
highe amoun a 1 as compa ed o he wild ype s ain (Fig. 3.10). In he absence o a
unc ional eag gene, small amoun s o Spo0A can be de ec ed a -1 and he amoun
p esen a 1 is compa able o he amoun p esen a he same ime poin in he wild ype
s ain. The e o e, we conclude ha he eag gene does no in luence he amoun o Spo0A
signi ican ly. As al eady men ioned, Spo0A~P ac s ei he as a ansc ip ional ac i a o o
ep esso . As o i s ole as an ac i a o , i has been shown ha he e a e wo classes o
p omo e s. While some need only a small amoun o Spo0A~P o become ac i a ed, o he s
need highe amoun s (Fuji a e al., 2005). The p omo e p eceeding he sk ope on needs
only a small amoun o ac i e Spo0A. The ansc ip ional Psk - lacZ usion was in oduced
by ans o ma ion in o wo di e en s ains, he wild ype 1012 used as a con ol and he
eag::pMUTIN4 s ain AM01. Bo h s ains we e g own in DSM, and aliquo s we e aken
a -1, 0, 1 and 2. The β-Galac osidase ac i i ies inc eased om abou 2 uni s o 80 uni s
in he wild ype s ain, while i inc eased up o 120 uni s a 2 in he eag dis up ion mu an
(Fig. 3.12). This esul indica es ha eag exe s a mino e ec on he amoun o ac i e
Spo0A, ei he by dec easing i s amoun o a ou ing i s dephospho yla ion o bo h.
63
Resul s
Fig. 3.12.
β
-Galac osidase ac i i y o an eag knockou and wild ype s ain. Cells
con aining he Psk -lacZ usion in eg a ed a he amyE locus we e g own in DSM a 37oC.
Samples we e aken a he indica ed ime poin s o measu emen o
β
-galac osidase
ac i i y.
64
Discussion
4. DISCUSSION
The p esen doc o al hesis deals wi h di e en aspec s which will be discussed
sepa a ely: (1) Iden i ica ion o he Spo0M p o ein as a no el subs a e, (2) cons uc ion o
an sH ap mu an allowing iden i ica ion o no el subs a e p o ein, and (3) pu a i e ole
o he Eag p o ein in modula ing he ac i i y o he Spo0E phospha ase.
4.1. Iden i ica ion o he Spo0M p o ein as a no el subs a e
F sH is he unique ATP-dependen and memb ane-bound p o ease uni e sally
conse ed in bo h p oka yo es and euka yo es (Okuno e al., 2006b). In B. sub ilis, cells o
an sH knockou s ain ail o spo ula e p esumably due o he absence o a su icien
amoun o Spo0A o /and phospho yla ed Spo0A (Spo0A~P) o en y in o he spo ula ion
p og amme (Deue ling e al., 1997; Le and Schumann, 2009).
The i s a ge o F sH in B. sub ilis iden i ied by ou g oup was he Spo0E
phospha ase, in ol ed in dephospho yla ion o Spo0A. Since a spo0E sH double
knockou es o ed he spo ula ion equency o only 0.85% while he spo ula ion in wild
ype s ains is app oxima e 60%, we easoned ha addi ional s age 0-dependen p o ein(s)
a e subs a es o F sH (Le and Schumann, 2009). By using he p o eomic app oach and
u he analysis in e ms o ansc ip ion and pos - ansla ional modi ica ions, Spo0M was
con i med as a a ge o F sH, he second subs a e o F sH which was iden i ied in B.
sub ilis.
4.1.1. Spo0M, a a ge o F sH and i s unc ion in spo ula ion
In an a emp o iden i y p o ein subs a es o he F sH me allop o ease in ol ed in
s age 0 o spo ula ion in B. sub ilis, he p o eomics app oach using he 2D gel
echniquewas applied o compa e he p o eome o an sH wild- ype s ain o an sH null
mu an . One o he mos abundan p o eins iden i ied in he sH knockou s ain was
Spo0M, a spo ula ion con ol p o ein o s age 0. Using a bgaB epo e sys em, he spo0M
p omo e was used ansc ip ionally wi h he bgaB epo e gene (Pspo0M-bgaB) and
exp ession analysis did no show any in luence o F sH on ansc ip ion o spo0M gene. I
implied ha F sH migh ha e a nega i e egula ion on he s abili y o Spo0M h ough i s
65
Discussion
σA
eag
spo0E
RBS1RBS2
Fig. 4.2. Genomic o ganisa ion o he spo0E-eag egion in B. sub ilis. spo0E gene o ms
a bicis onic ope on wi h eag. Bo h o genes ha e hei own ibosome binding si e (RBS)
and a e sepa a ed by a e mina o sequence.
Due o he genomic o ganiza ion o he eag gene, we asked whe he i is in ol ed
in egula ion o spo0E. By using a ansc ip ional lacZ epo e gene sys em, i could be
shown ha he eag gene is induced du ing phase 0 o spo ula ion (Fig. 3.11). The analysis
o spo ula ion also e ealed ha eag has a nega i e in luence on he spo ula ion
equency. F om hese esul s, i can be hypo hesized ha eag exe s a mino e ec on he
amoun o ac i e Spo0A, ei he by educing i s amoun o a ou ing i s dephospho yla ion
o bo h.
By which mechanism, ansc ip ion o he eag gene occu s when p eceded by a
ansc ip ional e mina o and no ob ious p omo e ? The ecA- ecX ope on o E. coli may
se e as an example (Pages e al., 2003). This ope on exhibi s an o ganiza ion compa able
o ha o spo0E-eag. I con ains jus one p omo e ups eam o ecA and a pu a i e
e mina o be ween ecA and ecX. Two di e en ansc ip s ha e desc ibed, one
co esponding o ecA and he o he o bo h ecA- ecX genes in which he ull-leng h
ansc ip ep esen s only abou 5-10% o he o al amoun o ansc ip s. The ecX
exp ession is shown o be down- egula ed a he ansla ional le el abou 500- old as
compa ed o ecA (Pages e al., 2003). Simila ly, he eag gene o B. sub ilis may in luence
he ac i i y o he Spo0E phospha ase in he same way wi h ecA and ecX ansc ip ion.
We assume ha only small amoun s o Eag a e p oduced which modula e ei he
he syn hesis o he ac i i y o Spo0E. Eag may in e e e wi h ei he ansc ip ion o
ansla ion o spo0E o i may di ec ly in e ac wi h he Spo0E p o ein as desc ibed o
ecX, a new SOS gene loca ed 220 bp downs eam o ecA, and wo genes a e co-
ansc ibed in E. coli. RecX p o ein ac s as a nega i e egula o o RecA ac i i ies by
inhibi ing he RecA-dependen s and exchange eac ion and co-p o ease ac i i y by slow
depolyme iza ion o RecA-DNA ilamen s (Galkin e al., 2011). We p e e he second
possibili y and sugges he ollowing model shown in Fig. 4.3.
72
Discussion
Eag
Spo0E
F sH
Deg ada ion
Fig. 4.3. Hypo he ical model how Eag may modula e he ac i i y o he Spo0E
phospha ase. Eag may bind Spo0E o p e en i om dephospho yla ing Spo0A~P and
e en ans e i o F sH o deg ada ion.
The Eag p o ein has been assumed o be in eg a ed in o he cy oplasmic
memb ane. I may bind Spo0E, he eby p e en ing Spo0E om in e ac ing wi h Spo0A~P
ollowed by dephospho yla ion. This model could be es ed by a i icial o e p oduc ion o
he Eag p o ein. I he model is co ec , his should esul in an inc ease in he spo ula ion
equency and also in he amoun o Spo0A. In addi ion, Eag may ans e Spo0E o he
F sH p o ease ollowed by deg ada ion. This hypo hesis is sugges ed since bo h Eag and
F sH a e in e g al memb ane p o eins and may s ay close oge he in he memb ane. I
Eag eally ans e s Spo0E o F sH, i may ac as an adap e p o ein - a p o ein ha
ecognizes subs a e p o eins o ATP-dependen p o eases and ans e s hem o he
app op ia e p o ease. Examples a e ClpS which coope a es wi h ClpAP o E. coli
(Schmid e al., 2009) and MecA o B. sub ilis ans e ing subs a e p o eins o ClpCP
p o ease (Ki s ein e al., 2006; Mei e al., 2009).
73
Re e ence lis
Re e ence Lis
Akiyama,Y. (2009). Quali y con ol o cy oplasmic memb ane p o eins in Esche ichia
coli. J. Biochem. 146, 449-454.
Akiyama,Y. and I o,K. (2003). Recons i u ion o memb ane p o eolysis by F sH. J. Biol.
Chem. 278, 18146-18153.
Akiyama,Y., Kiha a,A., and I o,K. (1996a). Subuni a o p o on ATPase F0 sec o is a
subs a e o he F sH p o ease in Esche ichia coli. FEBS Le . 399, 26-28.
Akiyama,Y., Kiha a,A., Tokuda,H., and I o,K. (1996b). F sH (H lB) is an ATP-dependen
p o ease selec i ely ac ing on SecY and some o he memb ane p o eins. J. Biol.
Chem. 271, 31196-31201.
Akiyama,Y., Kiha a,A., Mo i,H., Ogu a,T., and I o,K. (1998). Roles o he pe iplasmic
domain o Esche ichia coli F sH (H lB) in p o ein in e ac ions and ac i i y
modula ion. J. Biol. Chem. 273, 22326-22333.
Asayama,M., Yamamo o,A., and Kobayashi,Y. (1995). Dime o m o phospho yla ed
Spo0A, a ansc ip ional egula o , s imula es he spo0F ansc ip ion a he
ini ia ion o spo ula ion in Bacillus sub ilis. J. Mol. Biol. 250, 11-23.
Bai,U., Lewandoski,M., Dubnau,E., and Smi h,I. (1990). Tempo al egula ion o he
Bacillus sub ilis ea ly spo ula ion gene spo0F. J. Bac e iol. 172, 5432-5439.
Bai,U., Mandic-Mulec,I., and Smi h,I. (1993). SinI modula es he ac i i y o SinR, a
de elopmen al swi ch p o ein o Bacillus sub ilis, by p o ein-p o ein in e ac ion.
Genes De . 7, 139-148.
Bake ,M.D. and Neidi ch,M.B. (2011). S uc u al basis o esponse egula o inhibi ion by
a bac e ial an i-ac i a o p o ein. PLoS. Biol. 9, e1001226.
Banse,A.V., Chas ane ,A., Rahn-Lee,L., Hobbs,E.C., and Losick,R. (2008). Pa allel
pa hways o ep ession and an i ep ession go e ning he ansi ion o s a iona y
phase in Bacillus sub ilis. P oc. Na l. Acad. Sci. U. S. A 105, 15547-15552.
Beloin,C., Valle,J., La ou -Lambe ,P., Fau e,P., Kz eminski,M., Bales ino,D.,
Haagensen,J.A., Molin,S., P ensie ,G., A beille,B., and Ghigo,J.M. (2004). Global
impac o ma u e bio ilm li es yle on Esche ichia coli K-12 gene exp ession. Mol.
Mic obiol. 51, 659-674.
74
Re e ence lis
Be nha d ,J., Bu ne ,K., Scha ,C., and Hecke ,M. (1999). Dual channel imaging o wo-
dimensional elec ophe og ams in Bacillus sub ilis. Elec opho esis 20, 2225-2240.
Be ani,D., Oppenheim,A.B., and Na be haus,F. (2001). An in e nal egion o he RpoH
hea shock ansc ip ion ac o is c i ical o apid deg ada ion by he F sH p o ease.
FEBS Le . 493, 17-20.
Bieniossek,C., Niede hause ,B., and Baumann,U.M. (2009). The c ys al s uc u e o apo-
F sH e eals domain mo emen s necessa y o subs a e un olding and
ansloca ion. P oc. Na l. Acad. Sci. U. S. A 106, 21579-21584.
Bieniossek,C., Schalch,T., Bumann,M., Meis e ,M., Meie ,R., and Baumann,U. (2006).
The molecula a chi ec u e o he me allop o ease F sH. P oc. Na l. Acad. Sci. U. S.
A 103, 3066-3071.
B i on,R.A., Eichenbe ge ,P., Gonzalez-Pas o ,J.E., Fawce ,P., Monson,R., Losick,R.,
and G ossman,A.D. (2002). Genome-wide analysis o he s a iona y-phase sigma
ac o (sigma-H) egulon o Bacillus sub ilis. J. Bac e iol. 184, 4881-4890.
Bu bulys,D., T ach,K.A., and Hoch,J.A. (1991). Ini ia ion o spo ula ion in B. sub ilis is
con olled by a mul icomponen phospho elay. Cell 64, 545-552.
Bu kholde ,W.F. and A.D.G ossman (2000). Regula ion o he ini ia ion o endospo e
o ma ion in Bacillus sub ilis. In P oka yo ic de elopmen , Y.V.B un and
L.J.Shimke s, eds. ASM P ess, Washing on, D.C., pp. 151-166.
Bü ne ,K., Be nha d ,J., Scha ,C., Schmid,R., Made ,U., Eymann,C., An elmann,H.,
Völke ,A., Völke ,U., and Hecke ,M. (2001). A comp ehensi e wo-dimensional
map o cy osolic p o eins o Bacillus sub ilis. Elec opho esis 22, 2908-2935.
Chas ane ,A. and Losick,R. (2011). Jus -in- ime con ol o Spo0A syn hesis in Bacillus
sub ilis by mul iple egula o y mechanisms. J. Bac e iol. 193, 6366-6374.
Chas ane ,A., Vi kup,D., Yuan,G.C., No man,T.M., Liu,J.S., and Losick,R.M. (2010).
B oadly he e ogeneous ac i a ion o he mas e egula o o spo ula ion in Bacillus
sub ilis. P oc. Na l. Acad. Sci. U. S. A 107, 8486-8491.
Chen,J., Bu ke,J.J., Vel en,J., and Xin,Z. (2006). F sH11 p o ease plays a c i ical ole in
A abidopsis he mo ole ance. Plan J. 48, 73-84.
75
Re e ence lis
Chiba,S., Akiyama,Y., and I o,K. (2002). Memb ane p o ein deg ada ion by F sH can be
ini ia ed om ei he end. J. Bac e iol. 184, 4775-4782.
Chiba,S., Akiyama,Y., Mo i,H., Ma suo,E., and I o,K. (2000). Leng h ecogni ion a he
N- e minal ail o he ini ia ion o F sH-media ed p o eolysis. EMBO epo s 1, 47-
52.
Co e,L. and Pe ego,M. (2003). TPR-media ed in e ac ion o RapC wi h ComA inhibi s
esponse egula o -DNA binding o compe ence de elopmen in Bacillus sub ilis.
Mol. Mic obiol. 49, 1509-1522.
Co e,L.J., Ishikawa,S., and Pe ego,M. (2001). A ee e minal ca boxyla e g oup is
equi ed o Ph A pen apep ide inhibi ion o RapA phospha ase. Pep ides 22, 1549-
1553.
Cu ing,S., Ande son,M., Lysenko,E., Page,A., Tomoyasu,T., Ta ema su,K., Ta su a,T.,
K oos,L., and Ogu a,T. (1997). SpoVM, a small p o ein essen ial o de elopmen in
Bacillus sub ilis, in e ac s wi h he ATP-dependen p o ease F sH. J. Bac e iol. 179,
5534-5542.
de Hoon,M.J., Eichenbe ge ,P., and Vi kup,D. (2010). Hie a chical e olu ion o he
bac e ial spo ula ion ne wo k. Cu . Biol. 20, R735-R745.
Deue ling,E., Mogk,A., Rich e ,C., Pu ucke ,M., and Schumann,W. (1997). The sH gene
o Bacillus sub ilis is in ol ed in majo cellula p ocesses such as spo ula ion, s ess
adap a ion and sec e ion. Mol. Mic obiol. 23, 921-933.
Deue ling,E., Paeslack,B., and Schumann,W. (1995). The sH gene o Bacillus sub ilis is
ansien ly induced a e osmo ic and empe a u e upshock. J. Bac e iol. 177, 4105-
4112.
Dixon,L.G., Se edick,S., Riche ,M., and Spiegelman,G.B. (2001). De elopmen al gene
exp ession in Bacillus sub ilis c sA47 mu an s e eals glucose-ac i a ed con ol o
he gene o he mino sigma ac o sigma-H. J. Bac e iol. 183, 4814-4822.
Dubnau,D. and Losick,R. (2006). Bis abili y in bac e ia. Mol. Mic obiol. 61, 564-572.
Eichenbe ge ,P., Fuji a,M., Jensen,S.T., Conlon,E.M., Rudne ,D.Z., Wang,S.T.,
Fe guson,C., Haga,K., Sa o,T., Liu,J.S., and Losick,R. (2004). The p og am o gene
ansc ip ion o a single di e en ia ing cell ype du ing spo ula ion in Bacillus
sub ilis. PLoS. Biol. 2, e328.
76
Re e ence lis
E ing on,J. (1993). Bacillus sub ilis spo ula ion: Regula ion o gene exp ession and
con ol o mo phogenesis. Mic obiol. Re . 57, 1-33.
E ing on,J. (1996). De e mina ion o cell a e in Bacillus sub ilis. T ends Gene . 12, 31-
34.
E ing on,J. (2003). Regula ion o endospo e o ma ion in Bacillus sub ilis. Na . Re .
Mic obiol. 1, 117-126.
Fische ,B., Rummel,G., Ald idge,P., and Jenal,U. (2002). The F sH p o ease is in ol ed
in de elopmen , s ess esponse and hea shock con ol in Caulobac e c escen us.
Mol. Mic obiol. 44, 461-478.
Flynn,J.M., Nehe ,S.B., Kim,Y.I., Saue ,R.T., and Bake ,T.A. (2003). P o eomic
disco e y o cellula subs a es o he ClpXP p o ease e eals i e classes o ClpX-
ecogni ion signals. Mol. Cell 11, 671-683.
Füh e ,F., Langklo z,S., and Na be haus,F. (2006). The C- e minal end o LpxC is
equi ed o deg ada ion by he F sH p o ease. Mol. Mic obiol. 59, 1025-1036.
Füh e ,F., Mulle ,A., Baumann,H., Langklo z,S., Ku sche ,B., and Na be haus,F. (2007).
Sequence and leng h ecogni ion o he C- e minal u no e elemen o LpxC, a
soluble subs a e o he memb ane-bound F sH p o ease. J. Mol. Biol. 372, 485-496.
Fuji a,M., Gonzalez-Pas o ,J.E., and Losick,R. (2005). High- and low- h eshold genes in
he Spo0A egulon o Bacillus sub ilis. J. Bac e iol. 187, 1357-1368.
Fü bass,R., Goch ,M., Zube ,P., and Ma ahiel,M.A. (1991). In e ac ion o Ab B, a
ansc ip ional egula o om Bacillus sub ilis wi h he p omo e s o he ansi ion
s a e-ac i a ed genes ycA and spoVG. Mol. Gen. Gene . 225, 347-354.
Galkin,V.E., B i ,R.L., Bane,L.B., Yu,X., Cox,M.M., and Egelman,E.H. (2011). Two
modes o binding o DinI o RecA ilamen p o ide a new insigh in o he egula ion
o SOS esponse by DinI p o ein. J. Mol. Biol. 408, 815-824.
Geisle ,U. and Schumann,W. (1993). Isola ion o s ess mu an s o Bacillus sub ilis by a
no el gene ic me hod. FEMS Mic obiol. Le . 108, 251-254.
Gonzalez-Pas o ,J.E., Hobbs,E.C., and Losick,R. (2003). Cannibalism by spo ula ing
bac e ia. Science 301, 510-513.
77
Re e ence lis
Gö g,A., Bogu h,G., Obe maie ,C., Posch,A., and Weiss,W. (1995). Two-dimensional
polyac ylamide gel elec opho esis wi h immobilized pH g adien s in he i s
dimension (IPG-Dal ): he s a e o he a and he con o e sy o e ical e sus
ho izon al sys ems. Elec opho esis 16, 1079-1086.
G ossman,A.D. (1995). Gene ic ne wo ks con olling he ini ia ion o spo ula ion and he
de elopmen o gene ic compe ence in Bacillus sub ilis. Annu. Re . Gene . 29, 477-
508.
Halbe g,R. and K oos,L. (1994). Spo ula ion egula o y p o ein SpoIIID om Bacillus
sub ilis ac i a es and ep esses ansc ip ion by bo h mo he -cell-speci ic o ms o
RNA polyme ase. J. Mol. Biol. 243, 425-436.
Han,W.D., Kawamo o,S., Hosoya,Y., Fuji a,M., Sadaie,Y., Suzuki,K., Ohashi,Y.,
Kawamu a,F., and Ochi,K. (1998). A no el spo ula ion-con ol gene (spo0M) o
Bacillus sub ilis wi h a sigmaH- egula ed p omo e . Gene 217, 31-40.
He man,C., P akash,S., Lu,C.Z., Ma ouschek,A., and G oss,C.A. (2003). Lack o a obus
un oldase ac i i y con e s a unique le el o subs a e speci ici y o he uni e sal
AAA p o ease F sH. Mol. Cell 11, 659-669.
He man,C., Thé ene ,D., Bouloc,P., Walke ,G.C., and D'A i,R. (1998). Deg ada ion o
ca boxy- e minal- agged cy oplasmic p o eins by he Esche ichia coli p o ease H lB
(F sH). Genes De . 12, 1348-1355.
He man,C., Thé ene ,D., D'A i,R., and Bouloc,P. (1997). The H lB p o ease o
Esche ichia coli deg ades i s inhibi o λCIII. J. Bac e iol. 179, 358-363.
Ho ikoshi,M., Yu a,T., Tsuchimo o,S., Fukumo i,Y., and Kanemo i,M. (2004). Conse ed
egion 2.1 o Esche ichia coli hea shock ansc ip ion ac o σ32 is equi ed o
modula ing bo h me abolic s abili y and ansc ip ional ac i i y. J. Bac e iol. 186,
7474-7480.
Ichikawa,H. and K oos,L. (2000). Combined ac ion o wo ansc ip ion ac o s egula es
genes encoding spo e coa p o eins o Bacillus sub ilis. J. Biol. Chem. 275, 13849-
13855.
I e on,K., Rudne ,D.Z., Si anosian,K.J., and G ossman,A.D. (1993). In eg a ion o
mul iple de elopmen al signals in Bacillus sub ilis h ough he Spo0A ansc ip ion
ac o . Genes De . 7, 283-294.
78
Re e ence lis
I o,K. and Akiyama,Y. (2005). Cellula unc ions, mechanism o ac ion, and egula ion o
F sH p o ease. Annu. Re . Mic obiol. 59, 211-231.
Jayaseke a,M.M.K., Fol in,S.K., Olson,E.R., and Holle ,T.P. (2000). Esche ichia coli
equi es he p o ease ac i i y o F sH o g ow h. A ch. Biochem. Biophys. 380,
103-107.
Jiang,M., Shao,W., Pe ego,M., and Hoch,J.A. (2000). Mul iple his idine kinases egula e
en y in o s a iona y phase and spo ula ion in Bacillus sub ilis. Mol. Mic obiol. 38,
535-542.
Johnson,W.C., Mo an,C.P., J ., and Losick,R. (1983). Two RNA polyme ase sigma
ac o s om Bacillus sub ilis disc imina e be ween o e lapping p omo e s o a
de elopmen ally egula ed gene. Na u e 302, 800-804.
Ka z,C. and Ron,E.Z. (2008). Dual ole o F sH in egula ing lipopolysaccha ide
biosyn hesis in Esche ichia coli. J. Bac e iol. 190, 7117-7122.
Kiha a,A. and I o,K. (1998). T ansloca ion, olding, and s abili y o he H lKC complex
wi h signal ancho opogenic sequences. J. Biol. Chem. 273, 29770-29775.
Kiha a,A., Akiyama,Y., and I o,K. (1995). F sH is equi ed o p o eoly ic elimina ion o
uncomplexed o ms o SecY, an essen ial p o ein anslocase subuni . P oc. Na l.
Acad. Sci. USA 92, 4532-4536.
Kiha a,A., Akiyama,Y., and I o,K. (1996). A p o ease complex in he Esche ichia coli
plasma memb ane: H lKC (H lA) o ms a complex wi h F sH (H lB), egula ing i s
p o eoly ic ac i i y agains SecY. EMBO J. 15, 6122-6131.
Kiha a,A., Akiyama,Y., and I o,K. (1997). Hos egula ion o lysogenic decision in
bac e iophage lambda: T ansmemb ane modula ion o F sH (H lB), he CII
deg ading p o ease, by H lKC (H lA). P oc. Na l. Acad. Sci. USA 94, 5544-5549.
Kiha a,A., Akiyama,Y., and I o,K. (1998). Di e en pa hways o p o ein deg ada ion by
he F sH/H lKC memb ane-embedded p o ease complex: An implica ion om he
in e e ence by a mu an o m o a new subs a e p o ein, YccA. J. Mol. Biol. 279,
175-188.
Kiha a,A., Akiyama,Y., and I o,K. (1999). Disloca ion o memb ane p o eins in F sH-
media ed p o eolysis. EMBO J. 18, 2970-2981.
79
Re e ence lis
Ki an,M., Chauhan,A., Dziedzic,R., Maloney,E., Mukhe ji,S.K., Madi aju,M., and
Rajagopalan,M. (2009). Mycobac e ium ube culosis sH exp ession in esponse o
s ess and iabili y. Tube culosis. (Edinb. ) 89 Suppl 1, S70-S73.
Ki s ein,J., Schlo haue ,T., Dougan,D.A., Lilie,H., Tischendo ,G., Mogk,A., Bukau,B.,
and Tu gay,K. (2006). Adap o p o ein con olled oligome iza ion ac i a es he
AAA+ p o ein ClpC. EMBO J. 25, 1481-1491.
Ki ko,R.D., Clee on,R.L., A men ou ,E.I., Lee,G.E., Noguchi,K., Be kmen,M.B.,
Jones,B.D., and Slonczewski,J.L. (2009). Cy oplasmic acidi ica ion and he
benzoa e ansc ip ome in Bacillus sub ilis. PLoS. One. 4, e8255.
Klobu che ,L.A., Ragkousi,K., and Se low,P. (2006). The Bacillus sub ilis spo e coa
p o ides "ea esis ance" du ing phagocy ic p eda ion by he p o ozoan
Te ahymena he mophila. P oc. Na l. Acad. Sci. U. S. A 103, 165-170.
Kobile ,O., Rokney,A., and Oppenheim,A.B. (2007). Phage lambda CIII: a p o ease
inhibi o egula ing he lysis-lysogeny decision. PLoS. One. 2, e363.
K oos,L. (2007). The Bacillus and Myxococcus de elopmen al ne wo ks and hei
ansc ip ional egula o s. Annu. Re . Gene . 41, 13-39.
Laabe ki,M.H. and Dwo kin,J. (2008). Role o spo e coa p o eins in he esis ance o
Bacillus sub ilis spo es o Caeno habdi is elegans p eda ion. J. Bac e iol. 190,
6197-6203.
Laemmli,U.K. (1970). Clea age o s uc u al p o eins du ing he assembly o he head o
bac e iophage T4. Na u e 277, 680-685.
Langklo z,S., Schake mann,M., and Na be haus,F. (2011). Con ol o lipopolysaccha ide
biosyn hesis by F sH-media ed p o eolysis o LpxC is conse ed in en e obac e ia
bu no in all g am-nega i e bac e ia. J. Bac e iol. 193, 1090-1097.
Lazazze a,B.A., Ku se ,I.G., McQuade,R.S., and G ossman,A.D. (1999). An
au o egula o y ci cui a ec ing pep ide signaling in Bacillus sub ilis. J. Bac e iol.
181, 5193-5200.
Le,A.T. and Schumann,W. (2009). The Spo0E phospha ase o Bacillus sub ilis is a
subs a e o he F sH me allop o ease. Mic obiology 155, 1122-1132.
80
Re e ence lis
Le e s,G.G. and Go esman,S. (1998). Lambda Xis deg ada ion in i o by Lon and F sH.
J. Bac e iol. 180, 1573-1577.
Lies,M. and Mau izi,M.R. (2008). Tu no e o endogenous Ss A- agged p o eins
media ed by ATP-dependen p o eases in Esche ichia coli. J. Biol. Chem. 283,
22918-22929.
Losick,R. and S agie ,P. (1992). C issc oss egula ion o cell- ype-speci ic gene
exp ession du ing de elopmen in B. sub ilis. Na u e 355, 601-604.
McQuade,R.S., Comella,N., and G ossman,A.D. (2001). Con ol o a amily o
phospha ase egula o y genes (ph ) by he al e na e sigma ac o sigma-H o
Bacillus sub ilis. J. Bac e iol. 183, 4905-4909.
Mei,Z., Wang,F., Qi,Y., Zhou,Z., Hu,Q., Li,H., Wu,J., and Shi,Y. (2009). Molecula
de e minan s o MecA as a deg ada ion ag o he ClpCP p o ease. J. Biol. Chem.
284, 34366-34375.
Mille ,J.H. (1972). Expe imen s in Molecula Gene ics. (Cold Sp ing Ha bo , NY: Cold
Sp ing Ha bo Labo a o y).
Mogk,A., Haywa d,R., and Schumann,W. (1996). In eg a i e ec o s o cons uc ing
single-copy ansc ip ional usions be ween Bacillus sub ilis p omo e s and a ious
epo e genes encoding hea -s able enzymes. Gene 182, 33-36.
Molle,V., Fuji a,M., Jensen,S.T., Eichenbe ge ,P., Gonzalez-Pas o ,J.E., Liu,J.S., and
Losick,R. (2003). The Spo0A egulon o Bacillus sub ilis. Mol. Mic obiol. 50,
1683-1701.
Mo lo ,C., Ueha a,T., Ma quis,K.A., Be nha d ,T.G., and Rudne ,D.Z. (2010). A highly
coo dina ed cell wall deg ada ion machine go e ns spo e mo phogenesis in Bacillus
sub ilis. Genes De . 24, 411-422.
Mucho a,K., Lewis,R.J., Pe ecko,D., B annigan,J.A., Ladds,J.C., Leech,A.,
Wilkinson,A.J., and Ba ak,I. (2004). Dime -induced signal p opaga ion in Spo0A.
Mol. Mic obiol. 53, 829-842.
Nakano,M.M., Dailly,Y.P., Zube ,P., and Cla k,D.P. (1997). Cha ac e iza ion o
anae obic e men a i e g ow h o Bacillus sub ilis: Iden i ica ion o e men a ion
end p oduc s and genes equi ed o g ow h. J. Bac e iol. 179, 6749-6755.
81
Abb e ia ion
Lis o abb e ia ions and symbols
Abb e ia ion Deno a ion
σ Sigma Fac o
2D-Gel Two-Dimensional Gel
2D-PAGE Two-Dimensional Polyac ylamide Gel Elec opho esis
AAA ATPases Associa ed wi h a Va ie y o Cellula Ac i i ies
ATP Adenosine-5'-T iphospha e
AmpRResis an o Ampicillin
BSA Bo ine Se um Albumin
Ca Gene Coding o Chlo amphenicol-Ace y ans e ase
CHAPS 3-[(3-Cholamidop opyl)Dime hylammonio]-1-P opanesul ona e
CmRResis an o Chlo amphenicol
COG Clus e s o O hologous G oups
CSF Compe ence S imula ing Fac o
ddH2O Double Dis illed Wa e
DHFR Dihyd o ola e Reduc ase
DMSO Dime hyl Sul oxide
DSM Di co Spo ula ion Medium
DSP Di hiobis[Succinimidyl P opiona e]
DTT Di hio h ei ol
EDTA E hylene Diamine Te aace ic Acid
E m Gene Coding o E y h omycin Resis ance
E mRResis an o E y h omycin
GFP G een Fluo escen P o ein
GSH Reduced Glu a hione
GST Glu a hione-S-T ans e ase
IEF Isoelec ic Focusing
IPG Immobilized pH G adien
IPTG Isop opyl-ß-D-Thiogalac oside
88
Abb e ia ion
KDO 3-Deoxy-D-Manno-Oc -2-Ulosonic Acid
LB Lu ia-Be ani
LPS Lipopolysaccha ide
MS Mass Spec ome y
Neo Gene Coding o Neomycin Resis ance
NeoRResis an o Neomycin
OD Op ical Densi y
OD578 (600) Op ical Densi y a a Wa eleng h o 578 (o 600) nm
PBS Phospha e Bu e ed Saline
PCR Polyme ase Chain Reac ion
PMSF Phenylme hylsul onyl Fluo ide
Pg ac An IPTG inducible p omo e , which consis s p omo e o Pg oES
and lac ope a o
RBS Ribosome Binding Si e
Rpm Re olu ion o Round pe Minu e
SDS Sodium Dodecyl Sulpha e
SDS-PAGE Sodium Dodecyl Sul a e Polyac ylamide Gel Elec opho esis
Spc Gene Coding o Spec imomycin Resis ance
SpcRResis an o Spec inomycin
SRH The Second Region o Homology
TE T is – EDTA
TCA T ica boxylic Acid
T is T is-(Hyd oxyme hyl)-Aminome hane
xS age x o Spo ula ion P og am
WT Wild-Type
89
Publica ion
Publica ion
Resea ch in Mic obiology
The spo ula ion con ol gene spo0M o Bacillus sub ilis is a a ge o he F sH
me allop o ease
Hue Bach Thi Nguyen and Wol gang Schumann
Ins i u e o Gene ics, Uni e si y o Bay eu h, D-95440 Bay eu h, Ge many
Recei ed 4 Augus 2011, Accep ed 10 Oc obe 2011. A ailable online 19 No embe 2011
**********
Publica ion submi ed
The eag gene o Bacillus sub ilis in luences he ac i i y o he Spo0E phospha ase
Hue Bach Thi Nguyen, Anja Maie and Wol gang Schumann
Ins i u e o Gene ics, Uni e si y o Bay eu h, D-95440 Bay eu h, Ge many
Submi ed o Cu en Mic obiology
**********
Publica ion in p epa a ion
Cons uc ion o sH ap mu an o isola e F sH p o ein subs a e in Bacillus sub ilis,
Hue Bach Thi Nguyen and Wol gang Schumann.
in p epa a ion.
90
E klä ung
Hie mi e klä e ich, die o liegende A bei selbs s ändig e ass zu haben
und keine ande en als die on mi angegebenen Quellen ode Hil smi el e wende
zu haben.
Fe ne habe ich wede an de Uni e si ä Bay eu h, noch an eine ande en
Hochschule e such eine Disse a ion einzu eichen, ode mich eine
P omo ionsp ü ung zu un e ziehen.
Hue Bach Thi Nguyen
Bay eu h, Janua 2012
91