scieee Open visual document viewer

Identification of substrate proteins of FtsH during sporulation of Bacillus subtilis

Nguyen, Hue Bach Thi

Full text

Iden i ica ion o subs a e p o eins o F sH du ing spo ula ion o Bacillus sub ilis Disse a ion zu E langung des G ades eines -Dok o s de Na u wissenscha en- de Fakul ä ü Biologie, Chemie und Geowissenscha en de Uni e si ä Bay eu h o geleg on Hue Bach Thi Nguyen Bay eu h 2012     Die o liegende A bei wu de in de Zei on Dezembe 2007 bis Janua 2012 an de Uni e si ä Bay eu h am Leh s uhl ü Gene ik un e de Be euung on P o . D . Wol gang Schumann ange e ig . Volls ändige Abd uck de on de Fakul ä ü Biologie, Chemie und Geowissenscha en de Uni e si ä Bay eu h genehmig en Disse a ion zu E langung des akademischen G ades eines Dok o s de Na u wissenscha en (D . e . na .) P omo ionsgesuch einge eich am: 18.01.2012 Tag des wissenscha lichen Kolloquiums: 19.04.2012 E s gu ach e : P o . D . Wol gang Schumann Zei gu ach e : P o . D . F anz-Xa e Schmid D i gu ach e : PD. D . S e an Heidmann Vo si zende : P o . D . Heike Feldhaa     ACKNOWLEDGEMENTS I would like o hank o all people who ha e inspi ed and encou aged me du ing my doc o al s udy. Fi s o all, I would like o exp ess my deepes g a i ude o my supe iso P o . D . Wol gang Schumann who augh me how o ques ion hough s and encou aged me o exp ess my ideas. His insigh ul commen s and cons uc i e c i icisms du ing my g adua e s udies helped me o o e come many di icul ies and inish his disse a ion. I am indeb ed o him o his un lagging encou agemen and guidance. I would like o hank o P o . D . Thomas Wiege o his scien i ic ad ice and many conside able sugges ions and discussions. I would also hank o P o . D . Ola S emmann, PD. D . S e an Heidmann and he membe s o hei g oups o hei help and suppo . My special hanks go o Ma kus He mann o helping me wi h using he machines in hei lab. I would like o g a e ully and since ely hank PD. D . Bi gi Voig and P o . D . Michael Hecke , Uni e si y o G ei swald, P o . D . Be nd Bukau and membe o his g oup in Uni e si y o Heidelbe g o helping me wi h expe imen s. Especial hanks go o PD. D . Axel Mogk wi h nume ous insigh ul commen s and consis en discussions. I am also g a e ul o people in he Depa men o Gene ics, Uni e si y o Bay eu h, o hei help since I a i ed a Bay eu h. In pa icula , I would like o hank Ka in Ange mann, Ma gi Ba e a and Pe a Helies o hei assis ance and kindness. My since e hanks go o Quynh Anh, Kelly, Ka ha ina o being my wonde ul colleagues and eal iends. Special hanks o Anja Maie , an unde g adua e s uden , o he cons uc ion o some plasmids used in las pa o my disse a ion. I would like o acknowledge and hank P o . D . Gab iele Obe maie , D . A nim Heinemann, M s. Daniela Kasel and M s. Helga Simpe o helping me wi h he inancial suppo om Bay eu h Uni e si y women's ep esen a i e and Bay eu h In e na ional O ice. My special hank o D . Nicodemus in Bay eu h Welcome Cen e o he suppo and encou agemen in he las s age o my s udy.     I would like o be hank ul o all o my iends who ha e helped and encou aged me o o e come se backs and s ay ocused on my s udy. My hea - el g a i ude goes o bé Minh, Quỳnh Dung, Ngọc Anh, Phượng, Hồng Ánh, Lê Na, Loan, Hà, Hường, Sơn, Quỳnh, anh Bình L.V, anh Hiếu C. X, chị Ái, chị T inh, anh Định, chị Hường, chị Tuyế , Cô Vẽ, chú Thanh, Cô Nhị, Chú Viễn, Saeedeh, Nebojsa, Johannes, Milene and Li ia, my since e hanks o hem o gi ing me hei iendship, as deep and as ich as iendship can be. Las bu no leas , my deepes g a i ude goes o my amily: my b o he , my sis e s, my nephews and nieces o hei un lagging lo e and encou agemen h oughou my li e. I am o e e indeb ed o my pa en s who ha e sac i iced hei li es o me. This disse a ion is dedica ed o hem o hei uncondi ional lo e and p o iding me wi h unending encou agemen and ca e. I lo e hem all dea ly. Bay eu h, 18.01.2012     Table o con en s Table o con en s Zusammen assung....................................................................................................... 1 Summa y...................................................................................................................... 3 1. INTRODUCTION............................................................................................... 4 1.1. Bacillus sub ilis - he mos impo an gene ic model o ganism................. o he G am-posi i e bac e ia .................................................................... 4 1.1.1. O e iew o egula o y ne wo k in spo ula ion o B. sub ilis................. 4 1.1.1.1. Mo phology o B. sub ilis spo ula ion and o ma ion o p o ec i e ......... s uc u es ..................................................................................................... 4 1.1.1.2. Key ansc ip ional egula o s du ing B. sub ilis spo ula ion................ 7 1.1.2. Gene ic ne wo ks and key egula o s con olling ini ia ion ..................... o spo ula ion............................................................................................... 8 1.1.2.1. Ac i a ion o Spo0A, he mas e egula o o phase 0, occu s.................. h ough a phospho elay.............................................................................. 9 1.1.2.2. Posi i e and nega i e au o egula o y loops con ol p oduc ion............... o Spo0A~P ................................................................................................ 10 1.1.2.3. Role o phospho yla ed Spo0A du ing ini ia ion o spo ula ion .......... 12 1.1.2.4. Sigma H, a posi i e egula o o spo ula ion.......................................... 13 1.1.2.5. Ab B, an impo an ansc ip ion ac o du ing ini ia ion....................... o spo ula ion............................................................................................. 15 1.2. The me allop o ease F sH ........................................................................ 16 1.2.1. In oduc ion o F sH................................................................................. 16 1.2.2. Disco e y o F sH...................................................................................... 17 1.2.3. The s uc u e o F sH ............................................................................... 17 1.2.4. Subs a e binding...................................................................................... 19 1.2.5. Mechanism o subs a e ecogni ion and deg ada ion by F sH............ 21 1.2.5.1. Recogni ion o N- o C- e minal mo i s o F sH deg ada ion............. 21 1.2.5.2. Complex subs a e ecogni ion mechanisms .......................................... 22 i   Table o con en s 1.2.6. Biological unc ions o he F sH p o ease ............................................... 23 1.2.6.1. Memb ane p o eins as subs a es o F sH.............................................. 23 1.2.6.2. Cy oplasmic subs a es o F sH ............................................................... 24 1.3. The objec i e o he hesis ........................................................................ 27 2. MATERIALS AND METHODS ..................................................................... 29 2.1. Ma e ials .................................................................................................... 29 2.1.1. Bac e ial s ains ........................................................................................ 29 2.1.2. Plasmids ..................................................................................................... 30 2.1.3. Oligonucleo ides ........................................................................................ 31 2.1.4. Media.......................................................................................................... 31 2.1.5. An ibio ics.................................................................................................. 32 2.1.6. Chemicals and enzymes............................................................................ 32 2.1.7. An ibodies .................................................................................................. 33 2.2. Me hods...................................................................................................... 33 2.2.1. Iden i ica ion o F sH subs a es by p o eomics .................................... 33 2.2.1.1. G ow h condi ions..................................................................................... 33 2.2.1.2. Sample p epa a ion .................................................................................. 33 2.2.1.3. Two-dimensional polyac ylamide gel elec opho esis (2D-PAGE)...... 33 2.2.1.4. P o eome analysis and mass spec ome y o p o ein iden i ica ion.. 34 2.2.1.5. Cons uc ion o plasmids and ecombinan s ains............................... 35 2.2.1.5.1. Cons uc ion o pBH1 o he spo0M ansc ip ion analysis......... 35 2.2.1.5.2. Cons uc ion o pBH2 o spo0M exp ession................................. 36 2.2.1.6. Exp ession and pu i ica ion o GST- agged p o eins............................ 37 2.2.1.7. β-Galac osidase assays.............................................................................. 37 2.2.1.8. P o eolysis expe imen s............................................................................ 37 2.2.2. Iden i ica ion o F sH subs a es by ap-mu an app oach................. 38 2.2.2.1. Cons uc ion o F sH ap ........................................................................... 38 ii    Table o con en s 2.2.2.2. Cons uc ion o plasmids and s ains in B. sub ilis o p o ein ................ apping by F sH ap in i o...................................................................... 38 2.2.2.3. Complemen a ion o he sH alleles in an sH knockou s ain .......... 40 2.2.2.3.1. Mo phology complemen a ion in he wild- ype and sH ap .......... 40 2.2.2.3.2. Spo ula ion complemen a ion......................................................... 40 2.2.2.4. Iden i ica ion o F sH subs a es by he pull-down assay ..................... 40 2.2.2.4.1. Sample p epa a ion o p o ein apping in i o............................ 40 2.2.2.4.2. Ex i o c oss - linking wi h DSP .................................................... 41 2.2.2.4.3. Pull-down assay o F sH subs a e apping in i o..................... 41 2.2.2.5. SDS-PAGE and Wes e n blo ing............................................................ 41 2.2.2.6. Sil e S aining ........................................................................................... 42 3. RESULTS .......................................................................................................... 43 3.1. Iden i ica ion o F sH subs a e p o eins by p o eomics.............................. 43 3.1.1. Iden i ica ion o he Spo0M p o ein as a pu a i e subs a e..................... o F sH by 2D-gel elec opho esis............................................................ 43 3.1.2. F sH does no in luence exp ession o spo0M......................................... 48 3.1.3. Spo0M is con i med as a subs a e p o ein o F sH by an in i o........... deg ada ion expe imen ............................................................................ 49 3.2. Iden i ica ion o F sH subs a e p o eins by he sH ap mu an .................. 50 3.2.1. Cons uc ion and cha ac e iza ion o F sH ap ....................................... 51 3.2.1.1. De e mina ion o exp ession o F sH ap and i s con ols by IPTG .......... induc ion .................................................................................................... 51 3.2.1.2. Physiological cha ac e iza ion o he sH ap mu an in i o ................ 52 3.2.1.2.1. Exp ession o F sH+ es o es he wild ype pheno ype, while ...................... F sH ap is de ec i e in pheno ypic complemen a ion................................ 52 3.2.1.2.2. Exp ession o sH+ in a deple ion s ain shows eco e y o he.................. spo ula ion equency while sH ap does no ........................................... 53 3.2.1.3. Cons uc ion and cha ac e iza ion o F sH ap in i o.......................... 54 iii    Table o con en s 3.2.2. Iden i ica ion o F sH subs a es in i o using ........................................... he GST-F sH ap a ian .......................................................................... 55 3.2.3. Mos F sH ap and i s co-pu i ied p o eins we e de ec ed in he ............... memb ane ac ion and DSP c oss-linking caused p o ein....................... agg ega ion ................................................................................................ 55 3.2.4. Iden i ica ion o po en ial F sH subs a e by SDS-PAGE and ................. sil e s aining............................................................................................. 57 3.2.5. YwnF was iden i ied as a po en ial subs a e o F sH ........................... 59 3.3. Is he Eag p o ein in ol ed in he egula ion o he ac i i y o Spo0E?....... 60 3.3.1. Cons uc ion o an eag null mu an by inse ion o he pMUTIN4.......... in eg a ion ec o ...................................................................................... 60 3.3.2. Does he eag gene a ec he spo ula ion equency?............................. 62 3.3.3. Does he eag gene in luence he amoun o Spo0A p o ein? ................. 62 4. DISCUSSION .................................................................................................... 65 4.1. Iden i ica ion o he Spo0M p o ein as a no el subs a e..................... 65 4.1.1. Spo0M, a a ge o F sH and i s unc ion in spo ula ion....................... 65 4.1.2. The unc ion o F sH du ing in he egula ion o Spo0M...................... 66 4.1.3. The mechanism o subs a e ecogni ion by he F sH p o ease............ 67 4.2. Cons uc ion o an F sH ap mu an allowing iden i ica ion...................... o no el subs a e p o eins ....................................................................... 68 4.3. Pu a i e ole o he Eag p o ein in modula ing he ac i i y...................... o he Spo0E phospha ase......................................................................... 71 Re e ence Lis ............................................................................................................ 74 Lis o abb e ia ions and symbols........................................................................... 88 Publica ion................................................................................................................. 90 Publica ion submi ed............................................................................................... 90 Publica ion in p epa a ion ....................................................................................... 90 E klä ung .................................................................................................. 91 i    Zusammen assung Zusammen assung F sH is eine ATP- und Zn -abhängige Me allop o ease, welche mi els zweie 2+ T ansmemb an-Segmen e in de cy oplasma ischen Memb an e anke is . Sie is die einzige besch iebene Memb an- e anke e AAA-P o ease bei Bak e ien mi e schiedenen egula o ische Funk ionen. Eine sH-Knockou Mu an e zeig einen pleio open Phäno yp. Dazu gehö en ilamen öses Wachs um de Zellen, Sensi i i ä gegenübe einem Hi zeschock und osmo ischen Schock, und die Zellen können nich meh spo ulie en. Kü zlich konn en wi zeigen, dass sH-Knockou Zellen nich das Spo ula ions-S adium II e eichen au g und eine zu ge ingen Menge an Spo0A~P. Auße dem haben wi Spo0E, eine Spo0A~P-spezi ische Phospha ase, als e s es Subs a on F sH iden i izie . Da die Spo ula ions equenz in eine spo0E sH Doppelmu an e nu eilweise wiede he ges ell wi d, e mu en wi , dass F sH wei e e Subs a p o eine abbau , die die Spo ula ion nega i beein lussen. Um wei e e P o eine zu iden i izie en, wu den zwei e schiedene S a egien angewende . Mi els de 2D-Gel Technik wu den die P o eome eine sH Wild yp- und eine sH-Knockou -Mu an e mi einande e glichen. Es konn en eine Reihe on P o einen iden i izie we den, die in Abwesenhei on F sH en wede e meh ode eduzie p oduzie wu den. Eines de mengenmäßig e wa 4- ach e höh en P o eine wu de als Spo0M iden i izie . Da sH nich mi de T ansk ip ion on spo0M in e e ie , wu de ein in- i o-P o eolyse es mi ge einig en Komponen en e ablie . Es konn e gezeig we den, dass Spo0M ATP- und Zei -abhängig on F sH abgebau wi d. In de zwei en S a egie wu de zunächs eine sH ap Mu an e kons uie und au Ve lus de P o eolyse-Ak i i ä ge es e . P o ease T ap-Mu an en sind noch in de Lage ih e Subs a e zu binden, können diese abe nich meh abbauen. Mi Hil e eine GST- sH ap Mu an e konn e das Memb an-P o ein YwnF gebunden und dann mi els Massen-Spek ome ie iden i izie we den. Wei e e Expe imen e sind no wendig, um YwnF als Subs a -P o ein zu e i izie en. De le z e Teil de Disse a ion gal dem eag-Gen, welches mi spo0E ein bicis onisches Ope on bilde . Die Kons uk ion und Analyse eine eag Inse ions-Mu an e e gab einen leich en Ans ieg in de Spo ula ions equenz und in de Menge an Spo0A. Eine T ansk ip ions usion zwischen dem P omo o des spo0E-eag Ope ons und dem lacZ Repo e gen zeig e einen Ans ieg in de β-Galac osidase Ak i i ä ab 0 bei Wachs um de Zellen in Spo ula ionsmedium. Da es sich bei Eag e mu lich um ein in eg ales Memb anp o ein handel , kann es 1   In oduc ion Table 1.1. Key ansc ip ional egula o s du ing B. sub ilis spo ula ion. This able was aken om K oos, 2007 P o ein Aliases Func ion σARpoD, SigA Majo σ ac o in g owing cells; en y in o spo ula ion σHSpo0H En y in o spo ula ion Spo0A En y in o spo ula ion; ac i i y pe sis s in he mo he cell σFSpoIIAC, SigF Ea ly o espo e gene exp ession Rs A Yw N Regula o o σF-dependen gene exp ession σESpoIIGB, SigE Ea ly mo he cell gene exp ession SpoIIID Regula o o σE-dependen gene exp ession, p ima ilya Ge RbYlbO Regula o o σE-dependen gene exp ession σGSpoIIIG, SigG La e o espo e gene exp ession SpoVT YabL Regula o o σG-dependen gene exp ession σKSpoIVCB/SpoIIICc, SigK La e mo he cell gene exp ession Ge E Regula o o σK-dependen gene exp ession (a): SpoIIID also ep esses some σK-dependen genes (Halbe g and K oos, 1994; Ichikawa and K oos, 2000). (b): Ge , ge mina ion; a mu a ion in a ge gene in e e es wi h his p ocess, which in ol es ehyd a ion o he spo e and ou g ow h o a od-shaped cell in esponse o nu ien s. (c): σK is encoded in wo genes, spoIVCB and spoIIIC, which a e sepa a ed by 48 kb un il joined by si e-speci ic ecombina ion in he mo he cell o o m he sigK gene (S agie e al., 1989). 1.1.2. Gene ic ne wo ks and key egula o s con olling ini ia ion o spo ula ion Ini ia ion o spo ula ion in B. sub ilis is induced by nu i ional, cell densi y, and cell cycle signals ha esul in an ele a ed concen a ion o Spo0A~P (K oos, 2007). Due o nu ien dep i a ion, B. sub ilis cells lea e ege a i e g ow h and en e he s a iona y 8   In oduc ion phase ( e med ansi ion s a e). In o de o su i e, he cells edi ec hei me abolism and physiology in di e en ways o deal wi h s a a ion (Phillips and S auch, 2002). The cell’s i s p io i ies a e o egula e he al e a ions in gene exp ession o u ilize al e na i e nu ien s and o success ully compe e wi h o he species o sca ce esou ces. Va ious ex acellula p o eases and o he deg ada i e enzymes a e p oduced and he al e na e pa hways a e applied o maximize he u iliza ion o nu ien esou ces (S auch, 1993). A a ie y o an ibio ics and an imic obial compounds a e sec e ed du ing his s age o ou - compe e wi h o he mic obial species. Cells also es ablish a gene ically compe en s a e o up ake exogenous DNA and spo ula ing cells a e able o cannibalize non-spo ula ing cells (Gonzalez-Pas o e al., 2003). Spo ula ion is only commi ed as a las eso when all o he a emp s o g ow, o compe e and o su i e ha e been exhaus ed. Once ini ia ion o spo ula ion has occu ed, he e is no u ning back (Phillips and S auch, 2002). Two key egula o y p o eins in ol ed in he ini i a ion o spo ula ion a e σH and Spo0A and ano he impo an ac o is Ab B, a nega i e egula o ha egula es a ious s a iona y phase esponses du ing ini ia ion (E ing on, 1993). 1.1.2.1. Ac i a ion o Spo0A, he mas e egula o o phase 0, occu s h ough a phospho elay Spo0A, he mas e egula o o s age 0, is ac i a ed by phospho yla ion ia a phospho elay, an expanded e sion o a wo-componen sys em including p o ein kinases and phospha ases (Molle e al., 2003; Mucho a e al., 2004). When cells en e he ansi ion phase, unknown s a a ion signals igge au ophospho yla ion a an in a ian his idine esidue o one o i e senso kinases (KinA h ough KinE) (I e on e al., 1993; Jiang e al., 2000). The phospho yl g oup is hen ans e ed sequen ially om he kinase(s) o Spo0F, hen o Spo0B and inally o he esponse egula o Spo0A (Bu bulys e al., 1991). Dephospho yla ion o Spo0F~P may be caused by a leas ou Rap p o eins, RapA, RapB, RapE and RapH (Pe ego and Hoch, 1996; Bake and Neidi ch, 2011). I was hough ha hese Rap p o eins unc ion di ec ly as phospha ases. Indeed, dephospho yla ion o Spo0F~P is caused by he binding o Rap phospha ases o Spo0F~P s imula ing i s au ophospha ase ac i i y (Piggo and Hilbe , 2004; Co e and Pe ego, 2003). The Rap p o eins a e inhibi ed speci ically by hei co esponding pen apep ides Ph A, Ph B, Ph E and Ph H. Thei speci ic ac i i y on he a ge Rap phospha ase is de e mined by he amino acid sequence o each pen apep ide (Co e e al., 2001). Spo0A~P 9   In oduc ion i sel is also dephospho yla ed by he ac ion o h ee phospha ases: Spo0E is p oduced du ing he ansi ion s a e and wo homologues, YisI and YnzD, a e p esen du ing he ege a i e phase o g ow h (Pe ego and Hoch, 1987). Spo0E ac s as a nega i e egula o o spo ula ion by speci ically dephospho yla ing Spo0A~P and con e ing i in o an inac i e o m. O e p oduc ion o Spo0E ep esses spo ula ion and dele ion o spo0E esul s in inapp op ia e iming o spo ula ion (Fig. 1.2) (Pe ego and Hoch, 1991). KinA KinB KinC KinD KinE S p o0F~P S p o0A~P S p o0B~P Ra p A , Ra p B , Ra p E , Ra p HSpo0E YisI YnzD Ph A Ph B Ph E Ph H Fig. 1. 2: Schema ic ep esen a ion o he phospho yla ion o Spo0A. Spo0A is indi ec ly phospho yla ed by a mul icomponen phospho elay in ol ing he kinases KinA, KinB, KinC, KinD, KinE and wo in e media e p o eins. The kinases phospho yla e Spo0F esul ing in Spo0F~P. Then, he phospho yl g oup will be ans e ed o Spo0B and inally o Spo0A o ac i a e i . Ph pep ides sense cell densi y and inhibi se e al Rap phospha ases ha can dephospho yla e Spo0F~P; Spo0E, YisI and YnzD can dephospho yla e Spo0A~P. 1.1.2.2. Posi i e and nega i e au o egula o y loops con ol p oduc ion o Spo0A~P P oduc ion o Spo0A~P is con olled by bo h posi i e and nega i e egula o y loops du ing ini ia ion o spo ula ion (G ossman, 1995). Spo0A~P can di ec ly s imula e i s own exp ession and con ibu e o he ansc ip ion o genes ha egula e u he accumula ion o Spo0A~P ia a posi i e eedback loop in ol ing in Ab B and σH (Fig. 1.3). T ansc ip ion o he spo0A gene is con olled by a mechanism called “p omo e swi ching mechanism”, in ol ing wo Spo0A~P - dependen p omo e s: a ege a i e σA- ecognized p omo e , P , and a spo ula ion σH- ecognized p omo e , Ps, con olled by he amoun o phospho yla ed Spo0A (Chas ane and Losick, 2011). I has been p oposed ha 10    In oduc ion a low le el o spo0A is ansc ibed om P du ing he exponen ial phase o g ow h while Ps is silen because o he absence o Spo0A~P and σH. When Spo0A~P is o med ia he phospho elay, ansc ip ion o he spo0A gene is swi ched om P o Ps (Chas ane e al., 2010). Once ac i a ed, Spo0A~P ep esses ansc ip ion o ab B causing de ep ession o ansc ip ion o he spo0H gene coding o he sigma-H p o ein, he eby s imula ing ansc ip ion o spo0A om a sigma-H- ecognized p omo e . σH also di ec s ansc ip ion o wo esponse egula o s, kinA and spo0F. As a esul , a posi i e eedback loop is se up o con ol p oduc ion o Spo0A~P (Fig. 1.3) (B i on e al., 2002). A nega i e eedback loop is also con olled by Spo0A~P ia Spo0E and i s ep esso , Ab B. T ansc ip ion o spo0E is ep essed by Ab B and is de ep essed du ing ea ly spo ula ion due o Spo0A~P ep ession o ab B (Pe ego and Hoch, 1991). An inc ease in he amoun o he Spo0E phospha ase causes he emo al o phospha e om Spo0A~P ha con e s i in o he inac i e o m and p e en s cells om en y in o spo ula ion. This nega i e eedback loop p esumably unc ions in he main enance o a subpopula ion o cells ha do no spo ula e unde hese condi ions o delays as Spo0A~P induc ion (G ossman, 1995; Chas ane e al., 2010). 11    In oduc ion P = σASpo0A box Spo0A box Ps = σ H σ H Spo0A~P σ A s p o0H σ A spo0E ab B - + σ H s p o0F s p o0A σ H kinA +phospho elay Fig. 1.3. Schema ic ep esen a ion o posi i e and nega i e egula o y loops con olling he p oduc ion o Spo0A~P. Spo0A is ac i a ed h ough he phospho elay. Spo0A~P ep esses ansc ip ion o ab B. A dec ease in Ab B p o ein causes de ep ession o ansc ip ion o spo0H, leading o inc eased ansc ip ion o spo0A and wo esponse egula o s o he phospho elay, kinA and spo0F [a posi i e eedback loop (+)]. The dec ease o Ab B le el also causes de ep ession o spo0E, leading o inc eased accumula ion o he phospha ase ha emo es phospha e om Spo0A~P he eby se ing upon a nega i e eedback loop (-). 1.1.2.3. Role o phospho yla ed Spo0A du ing ini ia ion o spo ula ion The mas e egula o o spo ula ion, Spo0A~P, is a DNA-binding p o ein ac i a ed h ough a phospho elay (Molle e al., 2003). I is a membe o he esponse egula o amily o wo-componen egula o y sys ems consis ing o wo dis inc domains. The highly conse ed N- e minal domain called phosphoaccep o (o ecei e ) domain con aining an in a ian aspa ic acid esidue (Asp-56) is he a ge o phospho yla ion by he phospho elay and media es dime iza ion o Spo0A. The C- e minal DNA-binding (o e ec o ) domain which is esponsible o binding o speci ic DNA sequences, called 0A boxes, egula es ansc ip ion o a ge genes (Pe ego e al., 1991; Mucho a e al., 2004). Dime iza ion o Spo0A a e phospho yla ion is equi ed o a ge 0A boxes (Asayama e al., 1995). Spo0A~P ac s as a ep esso and ac i a o p o ein egula ing a 12    In oduc ion o al o 121 genes including genes wi h ege a i e σA- ecognized p omo e s as well as spo ula ion σH- ecognized p omo e s (Se edick and Spiegelman, 2001; Molle e al., 2003). I plays wo majo oles in he cell’s adap i e esponses o s a a ion. Fi s , a low amoun o Spo0A~P ini ially ep esses ansc ip ion o ab B ha causes an inc ease in Ab B- dependen gene exp ession du ing he ansi ion s a e. Second, when he Spo0A~P concen a ion eaches a c i ical le el, i will egula e exp ession o genes equi ed o en y in o spo ula ion (Phillips and S auch, 2002). The basal le el o Spo0A~P is no cons an om cell o cell. These egula o y loops and he in e connec edness o he phospho elay in luences p oduc ion o Spo0A~P and esul s in a bi-s able swi ch - a s a e whe e some cells in he popula ion accumula e a highe le el o Spo0A~P han o he s (K oos, 2007; Dubnau and Losick, 2006). Cells wi h a high le el o Spo0A~P p oduce killing ac o s o lyse hose cells wi h a low Spo0A~P le el o ge mo e nu ien s esul ing in a delay in ini ia ion o spo ula ion. They also esis hei killing ac o by syn hesizing an expo pump and an immuni y p o ein o p o ec hem om he oxin (G ossman, 1995; Dubnau and Losick, 2006). Abou 60% o he cells wi h a su icien amoun o Spo0A~P, called Spo0A-ON s age, a e able o spo ula e while he emaining 40% a e in he Spo0A- OFF s age and ail o en e in o spo ula ion. This mechanism is called “bis abili y” which means he simul aneous exis ence o wo subpopula ions in one popula ion o gene ically iden ical cells. The explana ion o his mechanism is s ill unknown. 1.1.2.4. Sigma H, a posi i e egula o o spo ula ion Sigma-H (σH) is an al e na i e RNA polyme ase sigma ac o ac i a ing he ansc ip ion o many genes equi ed o o ma ion o he pola sep um, he ini ia ion o cell- ype-speci ic exp ession and ac i a ion o Spo0A (Bu kholde and G ossman, 2000). Many spo ula ion genes a e di ec ly ac i a ed by sigma-H including spo0A, spo0F, kinA, spo0M, spoVG, and spoVS and he spoIIA ope on (Bai e al., 1990; Johnson e al., 1983; P edich e al., 1992; Han e al., 1998; Resneko e al., 1995; Wu e al., 1991). Sigma-H also egula es ansc ip ion o some membe s o he ph amily, coding o sec e ed pep ide phe omones ha inhibi speci ically he co esponding Rap phospha ases, modula ing cell en y in o gene ic compe ence, spo ula ion, and o he p ocesses (Pe ego and B annigan, 2001; Lazazze a e al., 1999; McQuade e al., 2001). Se e al o he genes ansc ibed by sigma-H a e also unde con ol o σA-dependen p omo e s including spo0A, sA (cell di ision), dnaG (DNA eplica ion), sigA (encoding sigma-A, he majo sigma ac o ), and ci G ( ica boxylic acid cycle) (B i on e al., 2002). 13    In oduc ion Sigma-H also con ibu es indi ec ly o he exp ession o Spo0A and KinB by ac i a ing exp ession o sinI and ep essing sinR - a spo0A syn hesis ep esso , he eby ac i a ing indi ec ly he spo0A syn hesis (Bai e al., 1993). In addi ion, sigma-H s imula es exp ession o CSF (compe ence s imula ing ac o ), which inhibi s he RapB phospha ase ha dephospho yla es Spo0F~P and he eby con ibu es o he inc ease in spo0A ansc ip ion du ing he ea ly s age o spo ula ion (Fig. 1.4). In u n, Spo0A~P con ibu es o he induc ion o sigma-H by ep essing i s ansc ip ional ep esso , Ab B (Bu kholde and G ossman, 2000). Regula ion o sigma-H i sel is qui e complica ed. spo0H, coding o sigma-H, is ansc ibed om a σA-dependen p omo e and di ec ly unde nega i e con ol o Ab B which is in u n ep essed by Spo0A~P (Bu kholde and G ossman, 2000; S auch, 1995; Wei e al., 1991). Unde app op ia e condi ions, inc eased le els o Spo0A~P esul in ep ession o Ab B esul ing in enhanced le els o spo0H ansc ip ion. The e o e, a high le el o Spo0A~P is p oduced esul ing in mo e ep ession o Ab B and inc easing le els o sigH ansc ip ion, he eby es ablishing a sel - ein o cing cycle o egula e bo h sigma- H and Spo0A. Sigma-H plays impo an oles in esponse o a di e si y o ex e nal condi ions including pH, ca bon sou ce, and exis ence o amino acids. I con ols many genes in ol ed in se e al cellula p ocesses including p o eolysis, cell wall me abolism, anspo , and cy och ome biogenesis ha helps cells o adap o condi ions o s a a ion and impac s physiological decisions du ing en y in o s a iona y phase (B i on e al., 2002). Schema ic ep esen a ion o egula ion o sigma-H ansc ip ion and i s egula ion o exp ession and ac i a ion o Spo0A is illus a ed and sho ly explained in Fig. 1.4. 14    In oduc ion Fig. 1.4. Regula ion o sigma-H ansc ip ion and i s egula ion o exp ession and ac i a ion o Spo0A. Sigma-H egula es ansc ip ion o kinA, spo0F, and spo0A, con ibu ing o he high le el accumula ion o Spo0A~P. Sigma-H also s imula es he ac i a ion o Spo0A by egula ing exp ession o he sec e ed pep ide phe omone, CSF, which inhibi s he phospha ase, RapB, ha dephospho yla es Spo0F~P. Simila ly, sigma- H egula es exp ession o sinI, which inhibi s sinR, esul ing in u he de ep ession o spo0A ansc ip ion. This igu e was aken om Bu kholde and G ossman, 2000. 1.1.2.5. Ab B, an impo an ansc ip ion ac o du ing ini ia ion o spo ula ion Ab B is a ansc ip ional ep esso ha plays an impo an ole du ing ini ia ion o spo ula ion (K oos, 2007). This DNA-binding p o ein plays a ole as a ep esso o se e al compe ence genes as well as genes exp essed du ing he ansi ion s a e (S auch and Hoch, 1993; S auch e al., 1989b). A leas h ee spo ula ion genes con olled by Ab B a e spo0E (Pe ego and Hoch, 1991), spo0H (Wei e al., 1991) and spoVG (Zube and Losick, 1987). Ab B also egula es an an ibio ic-syn he ic gene, ycA (Fü bass e al., 1991; Robe son e al., 1989), and ab B i sel (S auch e al., 1989a). O e 40 di e en genes a e di ec ly egula ed by Ab B and many o he genes indi ec ly due o i s in luence on he ansc ip ion o o he egula o y p o eins. Fo example, he egula o y p o eins ScoC, Abh, SinR and SigH a e con olled by Ab B. These p o eins also egula e nume ous genes in di e en egula o y ne wo ks leading o a wide a ie y o genes con olled indi ec ly by Ab B (Phillips and S auch, 2002). Ab B ac s as a DNA-binding ac o and con ols gene exp ession in a leas h ee di e en ways (Dixon e al., 2001; E ing on, 1996; Johnson e al., 1983). Fi s , Ab B ac s 15    In oduc ion as a unique ep esso o some genes ha a e cons i u i ely exp essed du ing all phases o g ow h in an ab B mu an s ain. In mos o he cases, Ab B plays a ole as a p e en e o become a ac o in se ies o edundan egula o y ne wo ks o ensu ing ha no egula o has comple e con ol o e genes ha mus emain silen du ing ac i e g ow h. Ab B also plays a ole as an ac i a o o some genes when i ep esses ac i a ion o o he ep esso s ( wo nega i es = a posi i e) (Phillips and S auch, 2002). The ansc ip ion o he ab B gene is au o egula ed. In an ac i e g ow h s a e, he Ab B concen a ion is main ained a a h eshold ha is su icien o i s egula o y ac i i y (S auch e al., 1989a). Du ing s a a ion, Spo0A, a ep esso o ab B ansc ip ion, is ac i a ed by phospho yla ion h ough he phospho elay, esul ing in a dec ease o he Ab B le el below he h eshold o i s nega i e egula o y ac i i y he eby inc easing he exp ession o Ab B- ep essed genes. The genes unde con ol o Ab B may unc ion in many me abolic and physiological p ocesses, including p oduc ion o ex acellula deg ada i e enzymes, an ibio ics, mo ili y, de elopmen o compe ence, anspo sys ems, oxida i e s ess esponse, phospha e, ni ogen and amino acid me abolism, cell su ace componen s and spo ula ion (Phillips and S auch, 2002). 1.2. The me allop o ease F sH 1.2.1. In oduc ion o F sH F sH is membe o he AAA amily (ATPases associa ed wi h a a ie y o cellula ac i i ies) inse ed in o he cy oplasmic memb ane by wo ansmemb ane segmen s (Schumann, 1999). I is comp ised o an N- e minal egion wi h wo ansmemb ane segmen s and a C- e minal cy oplasmic egion consis ing o AAA-ATPase and Zn2+- me allop o ease domains. While o he AAA p o eases a e loca ed in he cy oplasm, F sH is a unique memb ane-bound AAA p o ease able o deg ade in eg al memb ane p o eins. I plays c ucial oles in con olling he quali y o memb ane p o eins by apidly deg ading abno mal memb ane p o eins and some sho -li ed p o eins p esen in he cy osol (I o and Akiyama, 2005). Bac e ial cells wi h F sH mal unc ion in bac e ia esul in cell di ision de ec s and g ow h a es (Bieniossek e al., 2006). In E. coli, he F sH p o ease is essen ial o g ow h whe eas i is dispensable in B. sub ilis. Howe e , sH mu an cells in B. sub ilis appea mo e sensi i e o hea , sal , and de ec i e o cell di ision and spo ula ion (Ki an e al., 16    In oduc ion 2009). O hologs o F sH also exis in chlo oplas s and mi ochond ia o euka yo es (Bieniossek e al., 2006). The F sH p o ease o A abidopsis haliana con ibu es o he ole ance o he plan o upli ed empe a u es. I may alle ia e ligh s ess by deg ading pho odamaged pho osys em II D1 p o ein and unassembled hylakoid memb ane p o eins (Chen e al., 2006). The loss o a close F sH-o hologs in humans esul s in he edi a y spas ic pa aplegia (Bieniossek e al., 2006). 1.2.2. Disco e y o F sH The E. coli sH gene was disco e ed and desc ibed independen ly by ou g oups h ough de ec ion o di e en pheno ypes, he eby ecei ed ou di e en designa ions: sH, s ands o ilamen ous empe a u e-sensi i e; olZ, exhibi s ole ance agains colicins and h lB, causes high equency o lysogeniza ion by phage lambda and m sC, s ands o mRNA s abili y (Schumann, 1999). In B. sub ilis, he sH gene has been disco e ed sepa a ely by h ee di e en g oups. Fi s , he g oup o Schumann de ec ed F sH as an inse ion mu an causing a g ow h de ec unde hype osmo ic condi ions (Geisle and Schumann, 1993). La e , sH was de ec ed by he g oup o S. Cu ing as a egula o y ac o o SpoVM, a p o ein equi ing o spo e co ex and coa o ma ion (Cu ing e al., 1997) and he g oup o P. Zube iden i ied sH as an essen ial gene o e men a ion and ni a e espi a ion (Nakano e al., 1997). In gene al, he sH gene is p esen in one single copy in he examined p oka yo ic genomes excep o cyanobac e ia such as Synechocys is (J05708), which has ou sH genes in i s genome (Nixon e al., 2005). Yeas genomes con ain h ee copies o he gene (Schnall e al., 1994), whe eas plan genomes possess a la ge sH gene amily. Fo example, he A abidopsis genome has 12 sH genes and mu a ions in hese genes esul in lea colo a iega ion (Chen e al., 2006). 1.2.3. The s uc u e o F sH The memb ane-bound me allop o ease F sH is a ing-like homo-hexame complex ha ca ies he AAA and p o eoly ic domain on he same polypep ide chain (I o and Akiyama, 2005). The F sH monome o E. coli consis s o 647 amino acid esidues wi h a calcula ed molecula mass o 71.0 kDa. F sH is an in eg al cy oplasmic memb ane p o ein 17    In oduc ion One example is YccA, a sho -li ed memb ane p o ein o unknown unc ion. I has been sugges ed o be na u ally deg aded by F sH, and i s unc ion seems o be linked o bio ilm o ma ion (Beloin e al., 2004). F sH also deg ades unassembled memb ane p o eins such as he subuni SecY o he SecYEG anslocase and F0α o he H+-ATPase. Deg ada ion o hese p o eins only occu s when hey ail o assemble wi h hei pa ne p o eins (Akiyama e al., 1996a; Akiyama e al., 1996b). SecY o ms a s able anslocon complex wi h SecE and SecG allowing ansloca ion o p esec e o y p o eins h ough he cy oplasmic memb ane o in eg a ion in o he lipid bilaye o newly syn hesized memb ane p o eins. The e o e, incomple e assemblies o he anslocon could be ha m ul o he cell (Akiyama e al., 1996b). The F0α is a subuni o a p o on channel ac oss he memb ane and i s edundance migh be also ha m ul o he cells (Akiyama e al., 1996a). The e o e, hese examples show ha F sH p o ec s cells om he ha m ul condi ions by deg ading abundan memb ane p o ein subuni s when hey ailed o o m unc ional complexes (I o and Akiyama, 2005). 1.2.6.2. Cy oplasmic subs a es o F sH F sH deg ades a majo i y o cy oplasmic subs a es o F sH (Fig. 1.8 and Table 1.2) and many o hem a e sho -li ed soluble subs a es. A leas h ee subs a es o F sH a e bac e iophage encoded p o eins and hey belong o he g oup o sho -li e p o eins. The cII gene p oduc is a ansc ip ion ac o equi ed o se ing up he lysogenic cycle (Kiha a e al., 1997; Sho land e al., 1997; Sho land e al., 2000a). The Xis p o ein is esponsible o excision o p ophage DNA om he bac e ial genome (Le e s and Go esman, 1998). The cIII gene p oduc is a compe i i e inhibi o o F sH (He man e al., 1997). By deg ading hese subs a es, F sH exhibi s i s egula o y impac on he de elopmen and li e cycle o in ec ing by deg ading hei key egula o y molecules (I o and Akiyama, 2005). F sH also deg ades Ss A- agged p o eins whe e he Ss A- ag consis s o 11 esidues added o s alled nascen chains du ing ansla ion o enable ibosome ecycling and emo e o abno mal p o eins om he cell (Lies and Mau izi, 2008; He man e al., 1998). In ano he case, F sH can deg ade E. coli apo- la odoxin in in i o p o eoly ic 24    In oduc ion es s bu he e ec o F sH on la odoxin le els in i o is s ill unknown (Okuno e al., 2006a; Okuno e al., 2006b). F sH is conside ed as he only essen ial AAA p o ein in E. coli due o i s egula ion on he le el o LpxC, he key enzyme in lipid A biosyn hesis. Bo h oo much and oo li le lipid A is le hal o E. coli. Thus, F sH main ains a su icien amoun o lipid A wi hin he cells. F sH also plays a dual ole in LPS biosyn hesis by deg ading Kd A, a KDO ans e ase, ca alyzes he KDO a achmen o lipid A (Ka z and Ron, 2008). The e o e, F sH ac s as he c ucial p o ease equi ed o p o ein and memb ane lipid homeos asis (Na be haus e al., 2009). Ano he impo an unc ion o F sH is o egula e exp ession o σ32, he hea shock sigma ac o equi ed o hea shock o o he s ess esponses in E. coli. Regula ion o σ32 by F sH is assumed o in ol e i s associa ion wi h he DnaKJ chape one sys em in which he DnaK chape one is assumed o ha e a posi i e ole in he deg ada ion by p esen ing σ32 o F sH (Ta su a e al., 2000; Ta su a e al., 1998; Tomoyasu e al., 1998). F sH also a ec s he p o eoly ic deg ada ion o he al e na i e sigma ac o s SigF (σF) in C. c escen us ha indi ec ly egula es he oxida i e s ess esponse in s a iona y phase (Va ez-Ma inez e al., 2006). The σW o B. sub ilis migh be ano he subs a e o F sH (Zellmeie e al., 2003). The Spo0E phospha ase in ol ed in dephospho yla ion o Spo0A~P has been shown o be a subs a e o F sH, and he ecogni ion sequence is loca ed in he C- e minal end (Le and Schumann, 2009). SpoVM has been shown o be a a ge and an inhibi o o he F sH p o ease (Cu ing e al., 1997). I sha es s uc u al simila i ies wi h λ CIII, ano he a ge and inhibi o o F sH in E. coli, implying ha bo h p o eins sha e compa able inhibi ion and deg ada ion mechanisms owa d o F sH (Kobile e al., 2007). F sH is in ol ed in ni ogen me abolism in Co ynebac e ium glu amicum due o i s deg ada ion o he GlnK p o ein, a esponse p o ein o ni ogen s a a ion. Unde ni ogen s a a ion condi ions, GlnK in e ac s wi h Am R o induce exp ession o ni ogen s a a ion genes. In he medium wi h high ni ogen concen a ions, GlnK is seques e ed o he cy osolic memb ane o in e ac wi h he anspo e Am B, which esul s in blocking ammonium up ake (S osse e al., 2004). In Synechocys is sp. PCC 6803, a pho o opic model o ganism ha possesses ou copies o he sH gene in i s genome, F sH2 is hough o be in ol ed in osmo egula ion 25    In oduc ion by deg ada ion o he cy oplasmic glycosyl glyce ol (GG) syn hase GgpS (S i nbe g e al., 2007). This uncomplexed GgpS is deg aded by F sH2 when i ails o o m a complex wi h he GG phospha e phospha ase GgpP o ca alyze GG syn hesis. In summa y, F sH is a p o ease wi h many alen s ha deg ades a wide a ie y o s uc u ally and unc ionally di e se subs a es p esen ei he in he cy oplasm o in he cy oplasmic memb ane. Nume ous F sH subs a es ha e been iden i ied in a ious bac e ia and shown in Table 1.2 (Na be haus e al., 2009). Howe e , a g ea deal o F sH subs a es emain o be disco e ed o cla i y he physiological impo ance o F sH in p oka yo ic o ganisms as well as in euka yo ic cells (Na be haus e al., 2009). Fig. 1.8. Schema ic iew o F sH unc ions in E. coli. The hexame ic F sH p o ease con ols quali y o memb ane p o eins by ei he e olding mis olded p o eins o deg ading unassembled memb ane p o eins. F sH deg ades λ-encoded subs a es, and is in ol ed in he supe oxide s ess esponse, hea shock gene exp ession and con ols he syn hesis o memb ane componen s. IM: inne memb ane; OM: ou e memb ane; LPS: lipopolysaccha ides. This igu e was aken om Na be haus e al., 2009. 26    In oduc ion Table 1.2. Iden i ied cy oplasmic subs a es o he F sH p o ease in bac e ia. Adap o o modula o p o eins and localiza ion o deg ada ion signal a e gi en i analyzed; ND: no de e mined. This able was aken om he Na be haus e al., 2009. P o ein O ganism Adap o /modula o p o eins; Localiza ion o deg ada ion signal Ss A- ag E. coli The ag i sel λ CII Phage λ/E. coli H lD, H lK/C; C- e minus Λ CIII Phage λ/E. coli In e nal Λ Xis Phage λ/E. coli ND SoxS E. coli N- e minus (Lon) Fla odoxin E. coli In e nal LpxC E. coli C- e minus Kd A E. coli ND RpoH (σ32) E. coli DnaK/J, G oEL/ES; in e nal RpoH (σ32) C. c escen us ND σF C. c escen us ND σW B. sub ilis ND SpoVM B. sub ilis In e nal Spo0E B. sub ilis C- e minus GgpS Synechocys is sp. PCC 6803 ND GlnK C. glu amicum ND 1.3. The objec i e o he hesis As al eady men ioned, a B. sub ilis sH null mu an is iable, bu exhibi s a pleio opic pheno ype including a d as ically educed spo ula ion e iciency (Deue ling e al., 1997; Le and Schumann, 2009). Fu he analysis has shown ha he amoun o Spo0A is signi ican ly educed in such a knockou mu an (Le and Schumann, 2009). I hypo hesized ha F sH may deg ade one o mo e p o eins in ol ed in educing he le el o phospho yla ed Spo0A. One spo ula ion-speci ic p o ein has been ecen ly iden i ied, he phospha ase Spo0E, which speci ically dephospho yla es Spo0A~P (Le and Schumann, 2009). Since a spo0E sH double knockou es o ed he spo ula ion equency o only 0.85% (wild ype: ~ 60%), addi ional p o ein(s) ha e o be iden i ied as subs a e(s) o F sH. The e o e, he objec i e o his doc o al hesis was i s o iden i y addi ional subs a e p o eins by using wo di e en echniques and second, o unde s and hei unc ion. Two expe imen al app oaches we e applied. The i s is 2D-gel p o eomics. 27    In oduc ion The hypo hesis o his app oach is he subs a es migh be o e p oduced in an sH null mu an when compa ed wi h an sH wild- ype s ain. By he 2D gel elec opho esis echnique, hese p o eins can be de ec ed and iden i ied by mass spec ome y. Ano he app oach is called “F sH ap-mu an ”. The aim o his app oach was o cons uc an F sH mu an which binds subs a es wi hou clea ing hem. The e o e, he subs a es can be apped in he p o eoly ic chambe o F sH in i o and co-pu i ied wi h F sH by a pull- down assay. Finally, he ole o he eag gene loca ed downs eam o spo0E was analyzed. 28    Ma e ials and Me hods 2. MATERIALS AND METHODS 2.1. Ma e ials 2.1.1. Bac e ial s ains The bac e ial s ains used in his s udy a e lis ed in Table 2.1 Table 2.1. Bac e ial s ains used in his s udy S ains Desc ip ion Sou ce Esche ichia coli DH10B mc A Δ(m hsdRMS mc BC) φ80d lacZM15 ΔlacX74 deoR ecA1 a aD139 Δ(a a leu)7697 Be hesda Resea ch Labo a o ies (BRL) BL21 E. coli B F– dcm ompT hsdS( B– mB–) gal BRL A8926 s hC zad-220::Tn10 Δ sH3::kan Ta su a e al., 1998 BHEQ A8926 PIPTG – sHE424Q (AmpR) This s udy AL60 A8926 PIPTG –GST-F sH (AmpR) Le and Schumann, 2009 Bacillus sub ilis 1012 leuA8 me B5 pC2 hs M1 Sai o e al., 1979 WW01 1012 sH::e m (E mR) Weh l e al., 2000 BH1 1012 Pspo0M - bgaB (NeoR) This s udy BH2 1012 Pspo0M - bgaB sH::e m (NeoR) (E mR) This s udy BH3 1012, pbgaB (NeoR) This s udy BH4 1012 PIPTG-GST- s H ap (CmR) This s udy BH5 1012 PIPTG-GST- sH+ (CmR) This s udy BH6 1012 PIPTG-GST (CmR) This s udy BH7 1012 PIPTG-GST- sH ap ∆ sH::e m (CmR) (E mR) This s udy BH8 1012 PIPTG-GST- sH+ ∆ sH::e m (CmR) (E mR) This s udy 29    Ma e ials and Me hods BH9 1012 PIPTG -GST ∆ sH::e m (CmR) (E mR) This s udy AB07 1012 ∆spo0E::bleo (BleoR) Le and Schumann, 2009 AM01 1012 ∆eag::pMUTIN4 (E mR) A. Maie AM02 1012, Psk -lacZ, eag::Pmu in4 (SpcR) (E mR) A. Maie AM03 1012, amyE::Psk -lacZ, (SpcR) A. Maie 2.1.2. Plasmids The plasmids used in his s udy a e lis ed in Table 2.2 Table 2.2. Plasmids used in his s udy Name Desc ip ion Re e ence pBgaB In eg a ion plasmid ca ying he p omo e -less bgaB gene, NeoRMogk e al., 1996 pBH1 spo0M p omo e inse ed in o pBgaB, NeoR This s udy pGEX-2T Exp ession ec o wi h GST- ag, AmpR Ame sham pBH2 pGEX-2T wi h GST – spo0M usion, AmpRLe and Schumann, 2009 pGST- sH sH+ gene om B. sub ilis inse ed in o pGEX- 2T, AmpRThis s udy pBH3 pGEX2T ca ying sHE424Q mu an , AmpR This s udy pHT08 A plasmid-based exp ession ec o o B. sub ilis wi h he IPTG-inducible Pg ac p omo e , CmRNguyen e al., 2007 pBH4 Fusion GST - sHE424Q mu an inse ed in o pHT08, CmR This s udy pBH5 Fusion GST- sH+ inse ed in o pHT08, CmRThis s udy pBH6 GST inse ed in o pHT08, CmRThis s udy pMUTIN4 In eg a ion plasmid o c ea e a gene usion wi h he lacZ epo e gene, E mR Vagne e al., 1998 pMUTIN4- eag eag gene inse ed in o pMUTIN4, E mRA. Maie 30    Ma e ials and Me hods 2.1.3. Oligonucleo ides The oligonucleo ides used in his s udy a e lis ed in Table 2.3 Table 2.3. Oligonucleo ides used in his s udy Name Sequence (5’ o 3’) Desc ip ion ON01 CACCAGGAATTCATCGGTCTAAACTGA AATCG 5’ end o spo0M p omo e ON02 CACCAGGAATTCTCCGGCACTTGCCGC AAGCTT 3’ end o spo0M p omo e ON03 TCTGTTGGATCCATGTCATTTTTTAAGA AGCTTGCGGCA 5’ end o spo0M gene ON04 TCCCGGGGATCCCTATTACTCAACGTA TTGGTCTAGGATCT 3’ end o spo0M gene ON05 CTTATCACCAAGGCGGACACACCGT mu agenic p ime wi h subs i u ion o F sHE424Q ON06 CAATTCAAGCTTGTCACGATTTTCAGTC AGGA lanking a 3’ end o sH gene ON07 CACCATGGATCCATGAATCGGGTCTTC CGTAATACCA 5’ end o sH gene ON08 CACCATGACGTCATGTCCCCTATACTA GGTTATTGGA 5’ end o sH gene ON09 CACCATGACGTCATTACTCTTTCGTATC GTCTTTCT 3’ end o sH gene ON10 CACCATGGATCCATGTCCCCTATACTA GGTTATTGGA 5’ end o GST gene ON11 CTGGTGGGATCCTTATCAAACAGATGC ACGACGAGATCCA 3’ end o GST gene 2.1.4. Media Lu ia-Be ani b o h (LB medium): 1 % (w/ ) yp one, 0.5 % (w/ ) yeas ex ac , 1 % (w/ ) NaCl. Di co Spo ula ion Medium (DSM): 0.8 % (w/ ) Nu ien B o h, 0.1 % (w/ ) KCl and 1 mM MgSO4.7H2O. Adjus he pH o 7.4 wi h KOH. A e au ocla ing, he medium was supplied wi h 0.5 mM CaCl2, 0.01 mM MnCl2 and 0.001 mM FeCl2 Aga was added o 1.5 % (w/ ) o p epa e pla es. 31    Ma e ials and Me hods 2.1.5. An ibio ics Concen a ions o he an ibio ics used in his s udy a e gi en in Table 2.4. Table 2.4. An ibio ic solu ions used in his s udy An ibio ic Concen a ion o s ock solu ion (mg/ml) Dissol ed in Final concen a ion (μg/ml) Ampicillin 50 - 100 70% e hanol 100 Chlo amphenicol 20 E hanol 10 E y h omycin 1 o 100 E hanol 1 o 100 Neomycin 10 Wa e 10 Spec inomycin 100 Wa e 100 Bleomycin 20 Wa e 1 o 5 2.1.6. Chemicals and enzymes All s anda d enzymes and chemicals used o common bu e s and solu ions we e pu chased om Sigma-Ald ich, Me ck o Ro h, Ka ls uhe, Ge many. O he chemicals, solu ions, bu e s and ki s we e pu chased om he supplie s lis ed below: − New England Biolabs: Taq DNA polyme ase, T4 DNA-Ligase − Fe men as: Res ic ion enzymes, DNA ladde and P o ein Molecula Weigh Ma ke − Ame sham: ECL™ Reagen , an ibody − Pie ce: Di hiobis[succinimidyl p opiona e] (DSP) c oss linke − Qiagen: PCR pu i ica ion ki , gel-ex ac ion ki , midi pu i ica ion ki − Roche: Comple e P o ease inhibi o cock ail, Alkaline phospha ase, Lysozyme, P o einase K, RNase A 32    Ma e ials and Me hods 2.1.7. An ibodies Table 2.5. An ibodies used in his s udy Name Dilu ion o Immunoblo ing Re e ence Spo0A 1 : 5000 Fuji a e al., 2005 GST 1 : 5000 Ame shamTM An i-Rabbi IgG 1: 10000 Ame shamTM 2.2. Me hods 2.2.1. Iden i ica ion o F sH subs a es by p o eomics 2.2.1.1. G ow h condi ions B. sub ilis s ains 1012 and i s isogenic sH mu an (WW01) we e cul i a ed a 37oC unde igo ous agi a ion in Di co Spo ula ion Medium (DSM), e y h omycin was added o a inal concen a ion o 50 μg/ml du ing cul i a ion o WW01 s ain (∆ sH::e m). Samples we e aken a s age 0 ( o) and expe imen s we e epea ed wice. 2.2.1.2. Sample p epa a ion Cells we e ha es ed a s age 0 ( o) by cen i uga ion (6.000 x g, 4oC, 10 min), washed in TE bu e (10 mM T is, pH 7.5, 1 mM EDTA), esuspended in TE u ea bu e (8 M u ea, 2 M hio-u ea) and dis up ed by ul asonica ion. A e cen i uga ion (20,000 x g, 4°C, 30 min), he p o ein concen a ion o he ex ac was de e mined wi h he Ro iNanoquan Ki (Ro h, Ka ls uhe, Ge many). 2.2.1.3. Two-dimensional polyac ylamide gel elec opho esis (2D-PAGE) To sepa a e by 2D-PAGE, p o ein ex ac s (500 mg p o ein/sample) we e loaded on o duplica e immobilized pH g adien (IPG) s ips, pH 4-7 by ehyd a ion o 18-24 h in 33    Ma e ials and Me hods 2.2.2.3. Complemen a ion o he sH alleles in an sH knockou s ain 2.2.2.3.1. Mo phology complemen a ion in he wild- ype and sH ap Cells o sH knockou s ains BH7 and BH8 allowing sH ap and sH+ exp ession unde con ol o he IPTG-inducible Pg ac p omo e we e g own in DSM medium, induced wi h IPTG a an OD578 o 0.5, collec ed samples a s a iona y phase, washed and esuspended in ddH2O. Mix u es o 5 μl o suspensions wi h 10 μl o 1% aga ose we e sp ead on o a glass slide and he cell’s mo phology was obse ed unde he mic oscope. 2.2.2.3.2. Spo ula ion complemen a ion B. sub ilis s ains we e inocula ed in o DS medium and incuba ed wi h shaking o 24 h a 37oC. The expe imen s we e epea ed wice. Cells we e ha es ed om 10 ml cul u es, esuspended in 1 ml po assium phospha e bu e (10 mM K2HPO4, 50 mM KCl, 1 mM MgSO4) and hea ed o 30 min a 80oC. Samples o he hea ed cul u es as well as o he un ea ed pa en al cul u e we e dilu ed and pla ed on DS medium o iable cell coun ing. 2.2.2.4. Iden i ica ion o F sH subs a es by he pull-down assay 2.2.2.4.1. Sample p epa a ion o p o ein apping in i o S ains BH7, BH8, BH9 o exp ession o GST-F sH ap, GST-F sH+ and GST, espec i ely, we e ou inely g own in 1 li e o DSM wi h chlo amphenicol 5 μg/ml and e y h omycin 1 μg/ml a 37oC o an OD578 o 0.5, induced wi h 0.1 mM IPTG and u he g own un il cells eached he ansi ion s a e (s age 0 o spo ula ion). The expe imen s we e epea ed h ee imes. Then, he cul u es we e aken and chilled. Cells we e ha es ed by cen i uga ion a 4oC, 8.000 x g, washed and esuspended in 7 ml o lysis bu e (140 mM NaCl, 1,8 mM KH2PO4, 27 mM KCl, 10 mM Na2HPO4, 5% glyce ol, pH 7.3) con aining 20 mM DTT, 10 μl Comple e P o ease Inhibi o Cock ail (Roche Diagnos ics). Cells we e dis up ed by using a Mixe Mill a 15 Hz, 5 x 30s. 40    Ma e ials and Me hods 2.2.2.4.2. Ex i o c oss - linking wi h DSP A e dis up ion o he cells by he Mixe Mill, eshly DSP (Di hiobis- [succinimidylp opiona e]) s ock a 100 mg/ml was p epa ed in DMSO, 150 μl DSP s ock was added in o 7 ml cell lysa e and allowed c oss-linking eac ion p oceeding o 5 min a oom empe a u e. Then, he un eac ed DSP was quenched by adding 100 mM T is pH 8.5, and s i ed o 5-10 min a oom empe a u e. A e c ossed linking wi h DSP, he lysa es we e cen i uged o 30 min a 21.000 x g o sepa a e he cy oplasmic ac ion (supe na an ) om he memb ane ac ion (pelle ). The memb ane p o eins in he pelle we e solubilized wi h he non-ionic de e gen NP-40 ( inal concen a ion 0.5%), he cell deb is we e emo ed by cen i uga ion (25.000 x g, 4oC, 30 min) and collec ed as he supe na an con aining memb ane ac ion. 2.2.2.4.3. Pull-down assay o F sH subs a e apping in i o The memb ane ac ion and he supe na an we e added o 1 ml glu a hione aga ose beads, gen ly agi a ed a 4oC o 4 h, washed wi h 5 olumes o PBS bu e (140 mM NaCl, 1.8 mM KH2PO4, 10 mM Na2HPO4, 2.7 mM KCl, pH 7.3), elu ed in 0.5 ml elu ion bu e (10 mM GSH educed glu a hione in 50 mM T is-HCl, pH 8.0), and he elu ion ac ion was aken o analyses by SDS-PAGE. The p o ein bands we e de ec ed by sil e s aining and indi idual p o eins we e iden i ied by Mass spec ome y. 2.2.2.5. SDS-PAGE and Wes e n blo ing Sodium dodecyl sul a e polyac ylamide gel elec opho esis (SDS-PAGE) was pe o med acco ding o he me hod o Laemmli (1970) using 10, 12 o 15% SDS- polyac ylamide gels. Wes e n blo ing was pe o med as desc ibed by Towbin e al., (1979) wi h he de ec ion s ep using an ECL Wes e n blo ing de ec ion ki (Ame sham). The signals we e eco ded by he LAS4000 machine (Fuji ilm) and analyzed by Mul i Gauge Ve 3.1 So wa e (Fuji ilm). 41    Ma e ials and Me hods 2.2.2.6. Sil e S aining Gels we e ixed by Fixing Solu ion (50% E hanol, 10% glacial ace ic acid, 0.05% o malin [35% o maldehyde]) and hen shaken o 1 h. Gels we e insed wi h Rinse Solu ion (50% E hanol) and shaken o 5 min (2X). The Rinse Solu ion was eplaced wi h Sensi ize (0.02% sodium hiosulpha e), shaken o 2 min and hen washed wi h milli-Q wa e and shaken o ano he 2 min. Gels we e s ained wi h S aining solu ion (0.2% sil e ni a e, 0.075% o maldehyde 37% / ) and shaken o 20 min. Then, he gel was washed wi h wa e o 1 min (5 - 6X) and de eloped wi h De elope Solu ion (5% sodium ca bona e, 0.05% o maldehyde 37% / , 0.0004% sodium hiosulpha e), shaken o 5 - 10 min as equi ed. A S op Solu ion was added o s op he eac ion. Gels we e washed wi h milli-Q wa e (3X) and kep a 4ºC in 1% glacial ace ic acid o analyses and F sH subs a e iden i ica ion by mass spec ome y. 42    Resul s 3. RESULTS 3.1. Iden i ica ion o F sH subs a e p o eins by p o eomics 3.1.1. Iden i ica ion o he Spo0M p o ein as a pu a i e subs a e o F sH by 2D-gel elec opho esis To iden i y pu a i e subs a es o F sH, he p o eomes o a wild ype sH and i s isogenic sH::e m knockou s ain aken a s age 0 we e analyzed by 2D-gel elec opho esis and indi idual p o ein spo s we e iden i ied by mass spec ome y. The p o ein quan i y o each spo in bo h s ains was compa ed and analyzed by he Del a 2D so wa e. App oxima ely 50 p o eins we e s ongly inc eased o dec eased in he sH knockou s ain as compa ed o he wild ype s ain (Table 3.1 and Table 3.2). Acco ding o he Sub iLis unc ional ca ego ies, he iden i ied p o eins we e classi ied in o unc ional g oups and mos o hem pe o m basic me abolic unc ions in he cell such as ansla ion, amino acid me abolism, glycolysis and being pa o he ica boxylic acid (TCA) cycle (Table 3.3 and Table 3.4). 43    Resul s Table 3.1. Lis o p o eins inc easing in an sH knockou s ain No. Ra io Accession numbe P o ein name 1 4.54962 Spo0M Spo ula ion-con ol gene 2 3.73728 YjoA Unknown simila o unknown p o eins 3 3.13626 Tk T anske olase 4 3.04021 Tu A Elonga ion ac o Tu 5 2.84877 GlnA Glu amine syn he ase 6 2.59722 YoxD Unknown simila o 3-oxoacyl- acyl-ca ie p o ein educ ase 7 2.38021 SodA Supe oxide dismu ase 8 2.36637 YjbG Unknown simila o oligoendopep idase 9 2.3513 Icd Isoci a e dehyd ogenase 10 2.34449 Da P obable D-alanine amino ans e ase 11 2.31573 FabI Enoyl-acyl ca ie p o ein educ ase 12 2.31573 Y qH Unknown simila o unknown p o eins om B. sub ilis 13 2.31118 Ddl D-Alanyl-D-alanine ligase A 14 2.31118 Pgk Phosphoglyce a e kinase 15 2.28535 Y gN Unknown simila o dehyd ogenase 16 2.27029 BkdB Lipoamide acyl ans e ase 17 2.19324 YceC Unknown simila o ellu ium esis ance p o ein 18 2.19095 Hag Flagellin p o ein 19 2.15821 Pyk Py u a e kinase 20 2.12796 Tpx P obable hiol pe oxidase 21 2.0957 Eno Enolase 22 2.0957 SucC Succinyl-CoA syn he ase (be a subuni ) 23 2.08144 Y aB Unknown simila o NAD(P)H dehyd ogenase (quinine) 24 2.05179 Gc PB P obable glycine deca boxylase (subuni 2) 25 2.05179 YumC Unknown simila o hio edoxin educ ase 26 2.00393 AsnS Aspa aginyl- RNA syn he ase 27 2.00393 CysS Cys einyl- RNA syn he ase 28 2.00393 DhaS Aldehyde dehyd ogenase 44    Resul s Table 3.2. Lis o p o eins dec easing in an sH knockou s ain No. Ra io Accession numbe P o ein name 1 0.49203 D m Phosphopen omu ase 2 0.49203 RocD O ni hine amino ans e ase 3 0.48638 GapB Glyce aldehyde-3-phospha e dehyd ogenase 4 0.48287 Py AB Ca bamoyl-phospha e syn he ase (ca aly ic subuni ) 5 0.48002 CysC Pu a i e adenylylsul a e kinase 6 0.48002 Py H U idyla e kinase 7 0.47701 NusG T ansc ip ion an i e mina ion ac o 8 0.46497 PnpA Polynucleo ide phospho ylase (PNPase) 9 0.46428 Fm Me hionyl- RNA o myl ans e ase 10 0.44283 ResD Two-componen esponse egula o in ol ed in ae obic and anae obic espi a ion 11 0.44283 SucD Succinyl-CoA syn he ase (alpha subuni ) 12 0.44091 PdhC Py u a e dehyd ogenase (dihyd olipoamide ace yl ans e ase E2 subuni ) 13 0.43359 Upp U acil phospho ibosyl ans e ase 14 0.42343 OppD Oligopep ide ABC anspo e (ATP-binding p o ein) (ini ia ion o spo ula ion, compe ence de elopme 15 0.41514 RocG Glu ama e dehyd ogenase (majo ) 16 0.39438 OdhA 2-Oxoglu a a e dehyd ogenase (E1 subuni ) 17 0.38879 IolD Myo-inosi ol ca abolism 45    Resul s Table 3.3. Func ional g oups o p o eins inc easing in he absence o F sH acco ding o he Sub iLis da abase COGs P o ein Name Func ional g oups In o ma ion s o age and p ocessing COG0050J Tu A Elonga ion ac o Tu COG0017J AsnS Aspa aginyl- RNA syn he ase COG0215J CysS Cys einyl- RNA syn he ase Cellula p ocesses and signaling COG2310T YceC Unknown simila o ellu ium esis ance p o ein COG1181M Ddl D-alanyl-D-alanine ligase A COG1344N Hag Flagellin p o ein COG2077O Tpx P obable hiol pe oxidase COG0492O YumC Unknown simila o hio edoxin educ ase Me abolism COG0538C Icd Isoci a e dehyd ogenase COG0508C BkdB Lipoamide acyl ans e ase COG0045C SucC Succinyl-CoA syn he ase (be a subuni ) COG1012C DhaS Aldehyde dehyd ogenase COG0021G Tk T anske olase COG0126G Pgk Phosphoglyce a e kinase COG0469G Pyk Py u a e kinase COG0148G Eno Enolase COG0174E GlnA Glu amine syn he ase COG1003E Gc PB P obable glycine deca boxylase (subuni 2) COG0115EH Da P obable D-alanine amino ans e ase COG0623I FabI Enoyl-acyl ca ie p o ein educ ase COG1182I Y aB Unknown simila o NAD(P)H dehyd ogenase (quinone) COG0605P SodA Supe oxide dismu ase Gene al unc ion p edic ion only - unc ion unknown COG4326R Spo0M Spo ula ion-con ol gene COG0300R YoxD Unknown simila o 3-oxoacyl- acyl-ca ie p o ein educ ase - NA - YjbG Unknown simila o oligoendopep idase - NA - Y qH Unknown simila o unknown p o eins om B. sub ilis COG0656R Y gN Unknown simila o dehyd ogenase COG2318S YjoA Unknown simila o unknown p o eins COG: Clus e s o O hologous G oups; NA: No A ailable 46    Resul s Table 3.4. Func ional g oups o p o eins dec easing in he absence o F sH acco ding o Sub iLis da abase COGs P o ein Name Func ional g oups In o ma ion s o age and p ocessing COG1185J PnpA Polynucleo ide phospho ylase (PNPase) COG0223J Fm Me hionyl- RNA o myl ans e ase COG0250K NusG T ansc ip ion an i e mina ion ac o Cellula p ocesses and signaling COG0745TK ResD Two-componen esponse egula o in ol ed in ae obic and anae obic espi a ion Me abolism COG0074C SucD Succinyl-CoA syn he ase (alpha subuni ) COG0508C PdhC Py u a e dehyd ogenase (dihyd olipoamide ace yl ans e ase E2 subuni ) COG0567C OdhA 2-Oxoglu a a e dehyd ogenase (E1 subuni ) COG1015G D m Phosphopen omu ase COG0057G GapB Glyce aldehyde-3-phospha e dehyd ogenase COG4992E RocD O ni hine amino ans e ase COG0444EP OppD Oligopep ide ABC anspo e (ATP-binding p o ein) (ini ia ion o spo ula ion, compe ence de elopme COG0334E RocG Glu ama e dehyd ogenase (majo ) COG3962E IolD Myo-inosi ol ca abolism COG0458EF Py AB Ca bamoyl-phospha e syn he ase (ca aly ic subuni ) COG0528F Py H U idyla e kinase COG0035F Upp U acil phospho ibosyl ans e ase COG0529P CysC P obable adenylylsul a e kinase The p o eomic app oach was used o iden i y F sH subs a es o unde s and he unc ion o F sH du ing spo ula ion. I hypo hesize ha hese p o ein subs a es a e supposed o be o e p oduced in an sH knockou and unc ion du ing spo ula ion. As a esul , among 28 p o eins signi ican ly inc eased in he absence o F sH, he mos abundan p o ein was iden i ied as Spo0M wi h i s p edic ed unc ion as a spo ula ion con ol gene. The Spo0M le el inc eased abou 4.5- old in he sH null mu an (Fig. 3.1). The spo0M gene has been shown o con ol spo ula ion du ing he p ocess om s age 0 o s age II (Han e al., 1998). An σH-like p omo e has been de ec ed in he ups eam egion o spo0M, and i has also been shown o be down- egula ed by benzoa e a pH 7.0 o by a low ex e nal pH (Ki ko e al., 2009). A spo0M null mu an is iable, 47    Resul s blocked a s age 0, and i s spo ula ion equency is educed by 20- o 100- old. I he spo0M gene is inse ed in o a high-copy numbe plasmid, he spo ula ion equency is educed, indica ing ha o e p oduc ion o he Spo0M p o ein esul s in a nega i e e ec on spo ula ion (Han e al., 1998). Since Spo0M is o e p oduced a he beginning o s age 0 in he absence o F sH, we i s asked whe he F sH egula es exp ession o Spo0M di ec ly o indi ec ly. Figu e 3.1. Compa a i e p o eomics o a wild ype sH and null mu an s ain. (A) S ains 1012 ( sH+) and (B) WW01 ( sH::e m) we e g own in DSM o s age 0 a 37°C. Then, in acellula p o eins we e sepa a ed by 2D elec opho esis. P o eins we e sepa a ed by a pH g adien o 4 o 7 in he i s dimension ollowed by he second dimension sepa a ion o SDS-PAGE. Gels we e s ained by Coomassie b illian blue, and he p o ein spo o Spo0M is indica ed. 3.1.2. F sH does no in luence exp ession o spo0M In p inciple, F sH could egula e he amoun o Spo0M indi ec ly h ough modula ion o a nega i e egula o o di ec ly h ough i s deg ada ion. To analyze o an indi ec in luence, he p omo e egion o spo0M was ansc ip ionally used o he bgaB epo e gene and cells ca ying he bgaB epo e gene we e allowed o spo ula e in DS medium (DSM). A he beginning o he s a iona y phase, samples we e emo ed a in e als and assayed o β-galac osidase ac i i y in he wild ype sH and he isogenic knockou s ain. The esul s a e shown in Fig. 3.2. Du ing ansi ion om he exponen ial g ow h phase o he s a iona y phase, exp ession o bgaB used o he spo0M p omo e clea ly inc eased, while he bgaB 48    Resul s ac i i y was no exp essed om he ec o con ol (bgaB gene wi hou spo0M p omo e usion) (Fig. 3.2, s ain BH3). No di e ence in he BgaB ac i i y was ound be ween he wild- ype sH and i s isogenic inse ion mu an (Fig. 3.2, s ain BH1 and BH2). This esul clea ly demons a es ha F sH is no in ol ed in egula ion o ansc ip ion o spo0M. Figu e 3.2. F sH does no in luence ansc ip ion o spo0M. B. sub ilis s ains BH1, BH2 and BH3 con aining plasmid pBH1 (Pspo0M-bgaB), pBH1 wi h an sH::e m knockou and a p omo e - es ec o pBgaB, espec i ely, we e g own in DSM a 37°C, and aliquo s we e wi hd awn a he indica ed ime poin s o measu emen o β -galac osidase ac i i ies whe e 0 indica es en y in o he ansi ion phase. 3.1.3. Spo0M is con i med as a subs a e p o ein o F sH by an in i o deg ada ion expe imen Since F sH is no in ol ed in he egula ion o ansc ip ion o spo0M, I assumed ha i di ec ly modula es Spo0M ac i i y by deg ada ion. The e o e, he in i o deg ada ion o Spo0M by F sH was es ed. Fi s , he Spo0M used ansla ionally o a GST- ag, was o e p oduced and pu i ied. The pu i ied GST-Spo0M usion was incuba ed wi h pu i ied GST-F sH in he p esence and absence o ATP. Reac ions we e ca ied ou unde s anda d condi ions as desc ibed (Tomoyasu e al., 1995). 49    Resul s con i m his assump ion, isola ion o GST-F sH ap was ca ied ou using bo h he cy oplasmic and he memb ane ac ion. The e ec o DSP c oss-linking on apping subs a e p o eins in i o was also examined by compa ison o he amoun o pu i ied p o eins in bo h he p esence and absence o DSP. The pu i ied and co-pu i ied p o eins we e esol ed by SDS-PAGE and isualized by sil e -s aining. The esul s a e shown in Fig. 3.7. As expec ed, mos o he GST-F sH ap p o ein was de ec ed in he memb ane ac ion, while he majo o soluble GST exp essed in s ain BH9 was p esen in he cy oplasmic ac ion. Unexpec edly, he c oss-linking expe imen was no e ec i e enough o apping o subs a e p o eins. As shown in Fig 3.7, he amoun o pu i ied and co-pu i ied p o eins de ec ed a e c oss-linking is e y low in compa ison wi h hose p epa ed in he absence o c oss-linke . I is known ha c oss-linking can c ea e p o ein agg ega es, which can no be esol ed by SDS-PAGE (The mo Scien i ic, Pie ce C osslinking Technical Handbook). Indeed, c oss-linking expe imen s a e di icul o be ca ied ou because hey equi e an op imal amoun o c oss-linke o each speci ic expe imen . Ano he disad an age o c oss-linking is ha hey make da a analysis become di icul and un eliable due o non-speci ic in e ac ions (The mo Scien i ic, Pie ce C osslinking Technical Handbook). The e o e, we decided o con inue he F sH ap expe imen in i o wi hou c oss-linking. 56    Resul s DSP - + - + - + - + - + - + F sH+F sH ap GST F sH+F sH ap GST cy oplasmic ac ion memb ane ac ion 14.4 18.4 25.0 35.0 45.0 66.2. 116.0 GST GST-F sH Figu e 3.7. Analysis o pu i ied F sH and co-pu i ied p o eins in he absence o p esence o he DSP c oss-linke in he cy oplasmic and he memb ane ac ion. DSP c oss-linke was ei he added (+) o omi ed (-), as indica ed, cy oplasmic and memb ane ac ions o s ains BH7 (GST-F sH ap), BH8 (GST-F sH+), BH9 (GST) we e pu i ied, sepa a ed by 15% SDS-PAGE and isualized by sil e s aining. 3.2.4. Iden i ica ion o po en ial F sH subs a e by SDS-PAGE and sil e s aining The expe imen s o p o ein apping in i o in s ains BH7, BH8 and BH9 we e epea ed a leas h ee imes, and samples we e aken o pu i ica ion and SDS - PAGE analysis. P o eins we e esol ed in a 10% SDS-PAGE o iden i y he po en ial F sH subs a es wi h a molecula weigh highe han 25 kDa and in a 15% SDS-PAGE o de ec he F sH subs a es wi h a molecula weigh lowe han 25 kDa. The e we e se en p o ein bands apped in he F sH ap s ain and no p esen in he F sH+ s ain numbe ing om 1 o 7 in he gels (Fig. 3.8 & 3.9). All hese bands and he egions (si es) co esponding o hese bands in he GST-F sH+ s ain we e excised and sen o mass spec ome y analysis. 57    Resul s F sH ap GST F sH+ Figu e 3.8. Analysis o p o eins by 10% SDS-PAGE a e copu i ica ion wi h GST- F sH+ and GST-F sH ap. P o ein bands copu i ying wi h GST-F sH ap bu no wi h F sH+ and GST we e numbe ed om 1 o 6 and excised o mass spec ome y iden i ica ion. Figu e 3.9. Analysis o p o eins by 15% SDS-PAGE a e copu i ica ion wi h GST- F sH+ and GST-F sH ap. Only one band numbe ed “7a” was de ec ed in GST-F sH ap bu no in GST-F sH+ and GST samples. A band numbe ed “7b” in lane 2 supposed o be a con amina ed p o ein om lane 1 and band “7a” we e excised and iden i ied by mass spec ome y. 25.0 .0 .0 66.2. 6. 35 45 11 8 9 1 2 3 4 5 6 7 GST-F sH 4 56 3 1 2 GST 116.0 62.2 45.0 35.0 1 2 3 4 5 6 7 8 9 10 F sH+F sH ap GST 25.0 18.4 14.4 7b 7a 58    Resul s 3.2.5. YwnF was iden i ied as a po en ial subs a e o F sH The names o he apped p o ein bands iden i ied by mass spec ome y a e p esen ed in Table 3.6. Table 3.6: Iden i ica ion o p o ein bands apped by GST-F sH ap Numbe o he p o ein band P o ein name 1 F sH 2 F sH 3 F sH 4 F sH 5 GST 6 GST 7a YwnF 7b Unknown Mos o he p o ein bands iden i ied co esponded o F sH (bands 1 o 4) sugges ing ha GST-F sH ap was pa ially deg aded in i o. P o ein bands 5 and 6 e ealed as GST al hough hei size as de e mined by SDS-PAGE u ned ou o be highe han he calcula ed molecula mass. Rema kably, a s ong p o ein band o abou 17 kDa pulled-down clea ly by GST-F sH , bu no by GST-F sH was iden i ied as YwnF ap + p o ein. I is a small p o ein wi h 144 amino acids and p edic ed as a memb ane p o ein wi h wo ansmemb ane domains in ol ing amino acids 31-53 and 63-80, he unc ion o which is s ill unknown (www.Unip o .o g). The band “7b” a lane 2 (Fig 3.9) wi h he same size o YwnF is o unknown o igin and could be a con amina ing p o ein p esen in B. sub ilis. Possibly, i ep esen s he β-lac oglobulin o milk om sheep because he 18.4 kDa band o molecula weigh he ladde in lane 1 consis o he β-lac oglobulin p esence sheep’s milk so ha he mass spec ome y could no iden i y i s name om he p o ein da abank o B. sub ilis. In summa y, by using he GST-F sH app oach, one apped p o ein, YwnF, was ap iden i ied as a pu a i e p o ein subs a e o F sH. Howe e , u he expe imen s in i o and in i o showing deg ada ion o his apped p o ein by F sH a e equi ed o cla i y and con i m his conclusion. 59    Resul s 3.3. Is he Eag p o ein in ol ed in he egula ion o he ac i i y o Spo0E? The eag gene has been iden i ied as an open eading ame downs eam o he spo0E gene coding o a phospha ase (Pe ego and Hoch, 1987), whe e eag s ands o spo0E-associa ed gene. I codes o a p o ein o 143 amino acids wi h a molecula weigh o 16.4 kDa. Eag p o ein is p edic ed o be an in eg al inne memb ane p o ein wi h wo po en ial ansmemb ane segmen s. Since no p omo e has been iden i ied ups eam o eag, i is assumed ha i o ms a po en ial bicis onic ope on wi h spo0E (Pe ego and Hoch, 1987). Is eag in ol ed in spo ula ion as desc ibed o he ups eam gene, spo0E? Since Spo0E has been iden i ied as a subs a e o F sH (Le and Schumann, 2009), we specula e ha he Eag p o ein o s ill unknown unc ion migh be in ol ed in egula ion o he syn hesis o ac i i y o he Spo0E phospha ase. To es his hypo hesis, we i s isola ed an eag dis up an mu a ion by in eg a ion o a comple e plasmid he eby des oying he eading ame o eag. 3.3.1. Cons uc ion o an eag null mu an by inse ion o he pMUTIN4 in eg a ion ec o The in eg a ion ec o pMUTIN4 has been widely used o cons uc inse ion mu an s in ch omosomal genes o B. sub ilis (Vagne e al., 1998). This ec o plasmid is unable o eplica e in B. sub ilis and allows usion o he p omo e -less lacZ-gene o he p omo e o he gene o become inac i a ed (Vagne e al., 1998). In a i s s ep, abou 300 bp o he gene o be inac i a ed a e ampli ied by PCR and inse ed in on o he lacZ epo e gene. Nex , his ecombinan plasmid is ans o med in o he app op ia e B. sub ilis s ain, and inse ion mu an s a e selec ed on e y h omycin-con aining pla es. Inse ion a he co ec si e is con i med by Sou he n-blo ing. By using his echnology, s ain AM01 was ob ained. Is he eag gene exp essed du ing spo ula ion? To answe his ques ion, s ain AM01 was g own in DSM and aliquo s we e wi hd awn be o e and a di e en ime poin s a e 0. S ain y dB::pMUTIN4 was analysed as a con ol. The gene y dB does no play a ole du ing spo ula ion. Measu emen o he β-galac osidase ac i i ies o bo h s ains a e p esen ed in Fig. 3.11. While he β-galac osidase ac i i ies o he y dB inse ion mu an d opped om 8 o abou 2 uni s when cells en e ed he ansi ion phase, ha o he 60    Resul s eag::pMUTIN4 s ain inc eased om 1 o 5.5 uni s (Fig. 3.11). This esul indica es ha eag is induced du ing phase 0 o spo ula ion. 1 2 3 W T ∆ eag::pMUTIN4 -1 0 1 ∆spo0E::bleo Fig. 3.10. Wes e n blo analysis o de ec he amoun o Spo0A in wild ype B. sub ilis and wo knockou s ains. Cells we e g own in DSM a 37oC and aliquo s we e aken a he ime poin indica ed ( -1, 0, ) and analysed by Wes e n blo using Spo0A an ibodies. Fig. 3.11. β -Galac osidase ac i i ies o s ains y dB::pMUTIN4 and eag::pMUTIN4. Cells we e g own in DSM a 37oC and aliquo s we e aken a he ime poin indica ed ( 0, 1, 2, 3) and analysed o β -galac osidase ac i i ies. 61    Resul s 3.3.2. Does he eag gene a ec he spo ula ion equency? S ain AM01 (eag::pMUTIN4), 1012 (posi i e con ol) and AB07 (spo0E::bleo) we e g own in DSM, and spo es we e p epa ed and analyzed as desc ibed unde Ma e ials and Me hods. The esul s in Table 3.7 show ha he wild ype s ain 1012 exhibi ed a spo ula ion equency o abou 52%, while ha o i s isogenic spo0E::bleo de i a i e was 82% ha he spo ula ion equency is inc eased in he absence o he Spo0E phospha ase has al eady published (Pe ego and Hoch, 1991) and con i med by ou g oup (Le and Schumann, 2009). Inac i a ion o he eag gene esul ed in a sligh ly inc eased spo ula ion equency as compa ed o he wild ype s ain (58 e sus 52%, see Table 3.7). This esul sugges s a nega i e in luence o eag on he spo ula ion p ocess. Table 3.7. The spo ula ion equencies o he B. sub ilis s ains 1012, eag::pMUTIN4 and spo0E::bleo. S ains Viable cells/ml Spo es/ml Spo ula ion equency 1012 4.8 x 1082.5 x 1080.52 1012, eag::pMUTIN4 6.8 x 1083.9 x 1080.58 1012, spo0E::bleo 6.2 x 1085.1 x1080.82 3.3.3. Does he eag gene in luence he amoun o Spo0A p o ein? Spo0A is he mas e egula o o he spo ula ion phase 0. This p o ein becomes phospho yla ed h ough he phospho elay (Bu bulys e al., 1991), and Spo0A~P is a DNA-binding p o ein which ac s ei he as an ac i a o o a ep esso depending on he loca ion o he binding si e e med OA-box (Pe ego e al., 1988). Spo0A~P egula es a o al o 121 genes di ec ly (Fuji a e al., 2005). Spo0A~P is subjec o di ec egula ion o i s ac i i y o he phospha ase Spo0E (S ephenson and Pe ego, 2002). This phospha ase speci ically dephospho yla es Spo0A~P. Nex , we asked whe he eag can in luence he amoun o Spo0A p oduced. Two di e en expe imen s we e ca ied ou o answe his ques ion. Fi s , we di ec ly isualized o Spo0A by immunoblo ing and second, we measu ed he enzyma ic ac i i y o a ansc ip ional usion dependen on he amoun o ac i e Spo0A. Th ee di e en s ains, wild ype 1012 and i s isogenic inse ion mu an s spo0E::bleo and eag::pMUTIN4 62    Resul s we e g own in DSM and aliquo s we e wi hd awn a di e en ime poin s be o e and a e en y in o he ansi ion phase. The Spo0A p o ein p esen in hese aliquo s was isualized by an immunoblo using an ibodies aised agains Spo0A. As al eady published, he amoun o Spo0A in wild ype cells was below he de ec ion le el a -1, s a ed o appea a 0 and u he inc eased a 1 (Fig. 3.10). When he spo0E::bleo s ain was analysed, in con as o he wild ype ex ac s, Spo0A was al eady p esen a -1 and accumula ed o a highe amoun a 1 as compa ed o he wild ype s ain (Fig. 3.10). In he absence o a unc ional eag gene, small amoun s o Spo0A can be de ec ed a -1 and he amoun p esen a 1 is compa able o he amoun p esen a he same ime poin in he wild ype s ain. The e o e, we conclude ha he eag gene does no in luence he amoun o Spo0A signi ican ly. As al eady men ioned, Spo0A~P ac s ei he as a ansc ip ional ac i a o o ep esso . As o i s ole as an ac i a o , i has been shown ha he e a e wo classes o p omo e s. While some need only a small amoun o Spo0A~P o become ac i a ed, o he s need highe amoun s (Fuji a e al., 2005). The p omo e p eceeding he sk ope on needs only a small amoun o ac i e Spo0A. The ansc ip ional Psk - lacZ usion was in oduced by ans o ma ion in o wo di e en s ains, he wild ype 1012 used as a con ol and he eag::pMUTIN4 s ain AM01. Bo h s ains we e g own in DSM, and aliquo s we e aken a -1, 0, 1 and 2. The β-Galac osidase ac i i ies inc eased om abou 2 uni s o 80 uni s in he wild ype s ain, while i inc eased up o 120 uni s a 2 in he eag dis up ion mu an (Fig. 3.12). This esul indica es ha eag exe s a mino e ec on he amoun o ac i e Spo0A, ei he by dec easing i s amoun o a ou ing i s dephospho yla ion o bo h. 63    Resul s Fig. 3.12. β -Galac osidase ac i i y o an eag knockou and wild ype s ain. Cells con aining he Psk -lacZ usion in eg a ed a he amyE locus we e g own in DSM a 37oC. Samples we e aken a he indica ed ime poin s o measu emen o β -galac osidase ac i i y. 64    Discussion 4. DISCUSSION The p esen doc o al hesis deals wi h di e en aspec s which will be discussed sepa a ely: (1) Iden i ica ion o he Spo0M p o ein as a no el subs a e, (2) cons uc ion o an sH ap mu an allowing iden i ica ion o no el subs a e p o ein, and (3) pu a i e ole o he Eag p o ein in modula ing he ac i i y o he Spo0E phospha ase. 4.1. Iden i ica ion o he Spo0M p o ein as a no el subs a e F sH is he unique ATP-dependen and memb ane-bound p o ease uni e sally conse ed in bo h p oka yo es and euka yo es (Okuno e al., 2006b). In B. sub ilis, cells o an sH knockou s ain ail o spo ula e p esumably due o he absence o a su icien amoun o Spo0A o /and phospho yla ed Spo0A (Spo0A~P) o en y in o he spo ula ion p og amme (Deue ling e al., 1997; Le and Schumann, 2009). The i s a ge o F sH in B. sub ilis iden i ied by ou g oup was he Spo0E phospha ase, in ol ed in dephospho yla ion o Spo0A. Since a spo0E sH double knockou es o ed he spo ula ion equency o only 0.85% while he spo ula ion in wild ype s ains is app oxima e 60%, we easoned ha addi ional s age 0-dependen p o ein(s) a e subs a es o F sH (Le and Schumann, 2009). By using he p o eomic app oach and u he analysis in e ms o ansc ip ion and pos - ansla ional modi ica ions, Spo0M was con i med as a a ge o F sH, he second subs a e o F sH which was iden i ied in B. sub ilis. 4.1.1. Spo0M, a a ge o F sH and i s unc ion in spo ula ion In an a emp o iden i y p o ein subs a es o he F sH me allop o ease in ol ed in s age 0 o spo ula ion in B. sub ilis, he p o eomics app oach using he 2D gel echniquewas applied o compa e he p o eome o an sH wild- ype s ain o an sH null mu an . One o he mos abundan p o eins iden i ied in he sH knockou s ain was Spo0M, a spo ula ion con ol p o ein o s age 0. Using a bgaB epo e sys em, he spo0M p omo e was used ansc ip ionally wi h he bgaB epo e gene (Pspo0M-bgaB) and exp ession analysis did no show any in luence o F sH on ansc ip ion o spo0M gene. I implied ha F sH migh ha e a nega i e egula ion on he s abili y o Spo0M h ough i s 65    Discussion σA eag spo0E RBS1RBS2 Fig. 4.2. Genomic o ganisa ion o he spo0E-eag egion in B. sub ilis. spo0E gene o ms a bicis onic ope on wi h eag. Bo h o genes ha e hei own ibosome binding si e (RBS) and a e sepa a ed by a e mina o sequence. Due o he genomic o ganiza ion o he eag gene, we asked whe he i is in ol ed in egula ion o spo0E. By using a ansc ip ional lacZ epo e gene sys em, i could be shown ha he eag gene is induced du ing phase 0 o spo ula ion (Fig. 3.11). The analysis o spo ula ion also e ealed ha eag has a nega i e in luence on he spo ula ion equency. F om hese esul s, i can be hypo hesized ha eag exe s a mino e ec on he amoun o ac i e Spo0A, ei he by educing i s amoun o a ou ing i s dephospho yla ion o bo h. By which mechanism, ansc ip ion o he eag gene occu s when p eceded by a ansc ip ional e mina o and no ob ious p omo e ? The ecA- ecX ope on o E. coli may se e as an example (Pages e al., 2003). This ope on exhibi s an o ganiza ion compa able o ha o spo0E-eag. I con ains jus one p omo e ups eam o ecA and a pu a i e e mina o be ween ecA and ecX. Two di e en ansc ip s ha e desc ibed, one co esponding o ecA and he o he o bo h ecA- ecX genes in which he ull-leng h ansc ip ep esen s only abou 5-10% o he o al amoun o ansc ip s. The ecX exp ession is shown o be down- egula ed a he ansla ional le el abou 500- old as compa ed o ecA (Pages e al., 2003). Simila ly, he eag gene o B. sub ilis may in luence he ac i i y o he Spo0E phospha ase in he same way wi h ecA and ecX ansc ip ion. We assume ha only small amoun s o Eag a e p oduced which modula e ei he he syn hesis o he ac i i y o Spo0E. Eag may in e e e wi h ei he ansc ip ion o ansla ion o spo0E o i may di ec ly in e ac wi h he Spo0E p o ein as desc ibed o ecX, a new SOS gene loca ed 220 bp downs eam o ecA, and wo genes a e co- ansc ibed in E. coli. RecX p o ein ac s as a nega i e egula o o RecA ac i i ies by inhibi ing he RecA-dependen s and exchange eac ion and co-p o ease ac i i y by slow depolyme iza ion o RecA-DNA ilamen s (Galkin e al., 2011). We p e e he second possibili y and sugges he ollowing model shown in Fig. 4.3. 72    Discussion Eag Spo0E F sH Deg ada ion Fig. 4.3. Hypo he ical model how Eag may modula e he ac i i y o he Spo0E phospha ase. Eag may bind Spo0E o p e en i om dephospho yla ing Spo0A~P and e en ans e i o F sH o deg ada ion. The Eag p o ein has been assumed o be in eg a ed in o he cy oplasmic memb ane. I may bind Spo0E, he eby p e en ing Spo0E om in e ac ing wi h Spo0A~P ollowed by dephospho yla ion. This model could be es ed by a i icial o e p oduc ion o he Eag p o ein. I he model is co ec , his should esul in an inc ease in he spo ula ion equency and also in he amoun o Spo0A. In addi ion, Eag may ans e Spo0E o he F sH p o ease ollowed by deg ada ion. This hypo hesis is sugges ed since bo h Eag and F sH a e in e g al memb ane p o eins and may s ay close oge he in he memb ane. I Eag eally ans e s Spo0E o F sH, i may ac as an adap e p o ein - a p o ein ha ecognizes subs a e p o eins o ATP-dependen p o eases and ans e s hem o he app op ia e p o ease. Examples a e ClpS which coope a es wi h ClpAP o E. coli (Schmid e al., 2009) and MecA o B. sub ilis ans e ing subs a e p o eins o ClpCP p o ease (Ki s ein e al., 2006; Mei e al., 2009). 73    Re e ence lis Re e ence Lis Akiyama,Y. (2009). Quali y con ol o cy oplasmic memb ane p o eins in Esche ichia coli. J. Biochem. 146, 449-454. Akiyama,Y. and I o,K. (2003). Recons i u ion o memb ane p o eolysis by F sH. J. Biol. Chem. 278, 18146-18153. Akiyama,Y., Kiha a,A., and I o,K. (1996a). Subuni a o p o on ATPase F0 sec o is a subs a e o he F sH p o ease in Esche ichia coli. FEBS Le . 399, 26-28. Akiyama,Y., Kiha a,A., Tokuda,H., and I o,K. (1996b). F sH (H lB) is an ATP-dependen p o ease selec i ely ac ing on SecY and some o he memb ane p o eins. J. Biol. Chem. 271, 31196-31201. Akiyama,Y., Kiha a,A., Mo i,H., Ogu a,T., and I o,K. (1998). Roles o he pe iplasmic domain o Esche ichia coli F sH (H lB) in p o ein in e ac ions and ac i i y modula ion. J. Biol. Chem. 273, 22326-22333. Asayama,M., Yamamo o,A., and Kobayashi,Y. (1995). Dime o m o phospho yla ed Spo0A, a ansc ip ional egula o , s imula es he spo0F ansc ip ion a he ini ia ion o spo ula ion in Bacillus sub ilis. J. Mol. Biol. 250, 11-23. Bai,U., Lewandoski,M., Dubnau,E., and Smi h,I. (1990). Tempo al egula ion o he Bacillus sub ilis ea ly spo ula ion gene spo0F. J. Bac e iol. 172, 5432-5439. Bai,U., Mandic-Mulec,I., and Smi h,I. (1993). SinI modula es he ac i i y o SinR, a de elopmen al swi ch p o ein o Bacillus sub ilis, by p o ein-p o ein in e ac ion. Genes De . 7, 139-148. Bake ,M.D. and Neidi ch,M.B. (2011). S uc u al basis o esponse egula o inhibi ion by a bac e ial an i-ac i a o p o ein. PLoS. Biol. 9, e1001226. Banse,A.V., Chas ane ,A., Rahn-Lee,L., Hobbs,E.C., and Losick,R. (2008). Pa allel pa hways o ep ession and an i ep ession go e ning he ansi ion o s a iona y phase in Bacillus sub ilis. P oc. Na l. Acad. Sci. U. S. A 105, 15547-15552. Beloin,C., Valle,J., La ou -Lambe ,P., Fau e,P., Kz eminski,M., Bales ino,D., Haagensen,J.A., Molin,S., P ensie ,G., A beille,B., and Ghigo,J.M. (2004). Global impac o ma u e bio ilm li es yle on Esche ichia coli K-12 gene exp ession. Mol. Mic obiol. 51, 659-674. 74    Re e ence lis Be nha d ,J., Bu ne ,K., Scha ,C., and Hecke ,M. (1999). Dual channel imaging o wo- dimensional elec ophe og ams in Bacillus sub ilis. Elec opho esis 20, 2225-2240. Be ani,D., Oppenheim,A.B., and Na be haus,F. (2001). An in e nal egion o he RpoH hea shock ansc ip ion ac o is c i ical o apid deg ada ion by he F sH p o ease. FEBS Le . 493, 17-20. Bieniossek,C., Niede hause ,B., and Baumann,U.M. (2009). The c ys al s uc u e o apo- F sH e eals domain mo emen s necessa y o subs a e un olding and ansloca ion. P oc. Na l. Acad. Sci. U. S. A 106, 21579-21584. Bieniossek,C., Schalch,T., Bumann,M., Meis e ,M., Meie ,R., and Baumann,U. (2006). The molecula a chi ec u e o he me allop o ease F sH. P oc. Na l. Acad. Sci. U. S. A 103, 3066-3071. B i on,R.A., Eichenbe ge ,P., Gonzalez-Pas o ,J.E., Fawce ,P., Monson,R., Losick,R., and G ossman,A.D. (2002). Genome-wide analysis o he s a iona y-phase sigma ac o (sigma-H) egulon o Bacillus sub ilis. J. Bac e iol. 184, 4881-4890. Bu bulys,D., T ach,K.A., and Hoch,J.A. (1991). Ini ia ion o spo ula ion in B. sub ilis is con olled by a mul icomponen phospho elay. Cell 64, 545-552. Bu kholde ,W.F. and A.D.G ossman (2000). Regula ion o he ini ia ion o endospo e o ma ion in Bacillus sub ilis. In P oka yo ic de elopmen , Y.V.B un and L.J.Shimke s, eds. ASM P ess, Washing on, D.C., pp. 151-166. Bü ne ,K., Be nha d ,J., Scha ,C., Schmid,R., Made ,U., Eymann,C., An elmann,H., Völke ,A., Völke ,U., and Hecke ,M. (2001). A comp ehensi e wo-dimensional map o cy osolic p o eins o Bacillus sub ilis. Elec opho esis 22, 2908-2935. Chas ane ,A. and Losick,R. (2011). Jus -in- ime con ol o Spo0A syn hesis in Bacillus sub ilis by mul iple egula o y mechanisms. J. Bac e iol. 193, 6366-6374. Chas ane ,A., Vi kup,D., Yuan,G.C., No man,T.M., Liu,J.S., and Losick,R.M. (2010). B oadly he e ogeneous ac i a ion o he mas e egula o o spo ula ion in Bacillus sub ilis. P oc. Na l. Acad. Sci. U. S. A 107, 8486-8491. Chen,J., Bu ke,J.J., Vel en,J., and Xin,Z. (2006). F sH11 p o ease plays a c i ical ole in A abidopsis he mo ole ance. Plan J. 48, 73-84. 75    Re e ence lis Chiba,S., Akiyama,Y., and I o,K. (2002). Memb ane p o ein deg ada ion by F sH can be ini ia ed om ei he end. J. Bac e iol. 184, 4775-4782. Chiba,S., Akiyama,Y., Mo i,H., Ma suo,E., and I o,K. (2000). Leng h ecogni ion a he N- e minal ail o he ini ia ion o F sH-media ed p o eolysis. EMBO epo s 1, 47- 52. Co e,L. and Pe ego,M. (2003). TPR-media ed in e ac ion o RapC wi h ComA inhibi s esponse egula o -DNA binding o compe ence de elopmen in Bacillus sub ilis. Mol. Mic obiol. 49, 1509-1522. Co e,L.J., Ishikawa,S., and Pe ego,M. (2001). A ee e minal ca boxyla e g oup is equi ed o Ph A pen apep ide inhibi ion o RapA phospha ase. Pep ides 22, 1549- 1553. Cu ing,S., Ande son,M., Lysenko,E., Page,A., Tomoyasu,T., Ta ema su,K., Ta su a,T., K oos,L., and Ogu a,T. (1997). SpoVM, a small p o ein essen ial o de elopmen in Bacillus sub ilis, in e ac s wi h he ATP-dependen p o ease F sH. J. Bac e iol. 179, 5534-5542. de Hoon,M.J., Eichenbe ge ,P., and Vi kup,D. (2010). Hie a chical e olu ion o he bac e ial spo ula ion ne wo k. Cu . Biol. 20, R735-R745. Deue ling,E., Mogk,A., Rich e ,C., Pu ucke ,M., and Schumann,W. (1997). The sH gene o Bacillus sub ilis is in ol ed in majo cellula p ocesses such as spo ula ion, s ess adap a ion and sec e ion. Mol. Mic obiol. 23, 921-933. Deue ling,E., Paeslack,B., and Schumann,W. (1995). The sH gene o Bacillus sub ilis is ansien ly induced a e osmo ic and empe a u e upshock. J. Bac e iol. 177, 4105- 4112. Dixon,L.G., Se edick,S., Riche ,M., and Spiegelman,G.B. (2001). De elopmen al gene exp ession in Bacillus sub ilis c sA47 mu an s e eals glucose-ac i a ed con ol o he gene o he mino sigma ac o sigma-H. J. Bac e iol. 183, 4814-4822. Dubnau,D. and Losick,R. (2006). Bis abili y in bac e ia. Mol. Mic obiol. 61, 564-572. Eichenbe ge ,P., Fuji a,M., Jensen,S.T., Conlon,E.M., Rudne ,D.Z., Wang,S.T., Fe guson,C., Haga,K., Sa o,T., Liu,J.S., and Losick,R. (2004). The p og am o gene ansc ip ion o a single di e en ia ing cell ype du ing spo ula ion in Bacillus sub ilis. PLoS. Biol. 2, e328. 76    Re e ence lis E ing on,J. (1993). Bacillus sub ilis spo ula ion: Regula ion o gene exp ession and con ol o mo phogenesis. Mic obiol. Re . 57, 1-33. E ing on,J. (1996). De e mina ion o cell a e in Bacillus sub ilis. T ends Gene . 12, 31- 34. E ing on,J. (2003). Regula ion o endospo e o ma ion in Bacillus sub ilis. Na . Re . Mic obiol. 1, 117-126. Fische ,B., Rummel,G., Ald idge,P., and Jenal,U. (2002). The F sH p o ease is in ol ed in de elopmen , s ess esponse and hea shock con ol in Caulobac e c escen us. Mol. Mic obiol. 44, 461-478. Flynn,J.M., Nehe ,S.B., Kim,Y.I., Saue ,R.T., and Bake ,T.A. (2003). P o eomic disco e y o cellula subs a es o he ClpXP p o ease e eals i e classes o ClpX- ecogni ion signals. Mol. Cell 11, 671-683. Füh e ,F., Langklo z,S., and Na be haus,F. (2006). The C- e minal end o LpxC is equi ed o deg ada ion by he F sH p o ease. Mol. Mic obiol. 59, 1025-1036. Füh e ,F., Mulle ,A., Baumann,H., Langklo z,S., Ku sche ,B., and Na be haus,F. (2007). Sequence and leng h ecogni ion o he C- e minal u no e elemen o LpxC, a soluble subs a e o he memb ane-bound F sH p o ease. J. Mol. Biol. 372, 485-496. Fuji a,M., Gonzalez-Pas o ,J.E., and Losick,R. (2005). High- and low- h eshold genes in he Spo0A egulon o Bacillus sub ilis. J. Bac e iol. 187, 1357-1368. Fü bass,R., Goch ,M., Zube ,P., and Ma ahiel,M.A. (1991). In e ac ion o Ab B, a ansc ip ional egula o om Bacillus sub ilis wi h he p omo e s o he ansi ion s a e-ac i a ed genes ycA and spoVG. Mol. Gen. Gene . 225, 347-354. Galkin,V.E., B i ,R.L., Bane,L.B., Yu,X., Cox,M.M., and Egelman,E.H. (2011). Two modes o binding o DinI o RecA ilamen p o ide a new insigh in o he egula ion o SOS esponse by DinI p o ein. J. Mol. Biol. 408, 815-824. Geisle ,U. and Schumann,W. (1993). Isola ion o s ess mu an s o Bacillus sub ilis by a no el gene ic me hod. FEMS Mic obiol. Le . 108, 251-254. Gonzalez-Pas o ,J.E., Hobbs,E.C., and Losick,R. (2003). Cannibalism by spo ula ing bac e ia. Science 301, 510-513. 77    Re e ence lis Gö g,A., Bogu h,G., Obe maie ,C., Posch,A., and Weiss,W. (1995). Two-dimensional polyac ylamide gel elec opho esis wi h immobilized pH g adien s in he i s dimension (IPG-Dal ): he s a e o he a and he con o e sy o e ical e sus ho izon al sys ems. Elec opho esis 16, 1079-1086. G ossman,A.D. (1995). Gene ic ne wo ks con olling he ini ia ion o spo ula ion and he de elopmen o gene ic compe ence in Bacillus sub ilis. Annu. Re . Gene . 29, 477- 508. Halbe g,R. and K oos,L. (1994). Spo ula ion egula o y p o ein SpoIIID om Bacillus sub ilis ac i a es and ep esses ansc ip ion by bo h mo he -cell-speci ic o ms o RNA polyme ase. J. Mol. Biol. 243, 425-436. Han,W.D., Kawamo o,S., Hosoya,Y., Fuji a,M., Sadaie,Y., Suzuki,K., Ohashi,Y., Kawamu a,F., and Ochi,K. (1998). A no el spo ula ion-con ol gene (spo0M) o Bacillus sub ilis wi h a sigmaH- egula ed p omo e . Gene 217, 31-40. He man,C., P akash,S., Lu,C.Z., Ma ouschek,A., and G oss,C.A. (2003). Lack o a obus un oldase ac i i y con e s a unique le el o subs a e speci ici y o he uni e sal AAA p o ease F sH. Mol. Cell 11, 659-669. He man,C., Thé ene ,D., Bouloc,P., Walke ,G.C., and D'A i,R. (1998). Deg ada ion o ca boxy- e minal- agged cy oplasmic p o eins by he Esche ichia coli p o ease H lB (F sH). Genes De . 12, 1348-1355. He man,C., Thé ene ,D., D'A i,R., and Bouloc,P. (1997). The H lB p o ease o Esche ichia coli deg ades i s inhibi o λCIII. J. Bac e iol. 179, 358-363. Ho ikoshi,M., Yu a,T., Tsuchimo o,S., Fukumo i,Y., and Kanemo i,M. (2004). Conse ed egion 2.1 o Esche ichia coli hea shock ansc ip ion ac o σ32 is equi ed o modula ing bo h me abolic s abili y and ansc ip ional ac i i y. J. Bac e iol. 186, 7474-7480. Ichikawa,H. and K oos,L. (2000). Combined ac ion o wo ansc ip ion ac o s egula es genes encoding spo e coa p o eins o Bacillus sub ilis. J. Biol. Chem. 275, 13849- 13855. I e on,K., Rudne ,D.Z., Si anosian,K.J., and G ossman,A.D. (1993). In eg a ion o mul iple de elopmen al signals in Bacillus sub ilis h ough he Spo0A ansc ip ion ac o . Genes De . 7, 283-294. 78    Re e ence lis I o,K. and Akiyama,Y. (2005). Cellula unc ions, mechanism o ac ion, and egula ion o F sH p o ease. Annu. Re . Mic obiol. 59, 211-231. Jayaseke a,M.M.K., Fol in,S.K., Olson,E.R., and Holle ,T.P. (2000). Esche ichia coli equi es he p o ease ac i i y o F sH o g ow h. A ch. Biochem. Biophys. 380, 103-107. Jiang,M., Shao,W., Pe ego,M., and Hoch,J.A. (2000). Mul iple his idine kinases egula e en y in o s a iona y phase and spo ula ion in Bacillus sub ilis. Mol. Mic obiol. 38, 535-542. Johnson,W.C., Mo an,C.P., J ., and Losick,R. (1983). Two RNA polyme ase sigma ac o s om Bacillus sub ilis disc imina e be ween o e lapping p omo e s o a de elopmen ally egula ed gene. Na u e 302, 800-804. Ka z,C. and Ron,E.Z. (2008). Dual ole o F sH in egula ing lipopolysaccha ide biosyn hesis in Esche ichia coli. J. Bac e iol. 190, 7117-7122. Kiha a,A. and I o,K. (1998). T ansloca ion, olding, and s abili y o he H lKC complex wi h signal ancho opogenic sequences. J. Biol. Chem. 273, 29770-29775. Kiha a,A., Akiyama,Y., and I o,K. (1995). F sH is equi ed o p o eoly ic elimina ion o uncomplexed o ms o SecY, an essen ial p o ein anslocase subuni . P oc. Na l. Acad. Sci. USA 92, 4532-4536. Kiha a,A., Akiyama,Y., and I o,K. (1996). A p o ease complex in he Esche ichia coli plasma memb ane: H lKC (H lA) o ms a complex wi h F sH (H lB), egula ing i s p o eoly ic ac i i y agains SecY. EMBO J. 15, 6122-6131. Kiha a,A., Akiyama,Y., and I o,K. (1997). Hos egula ion o lysogenic decision in bac e iophage lambda: T ansmemb ane modula ion o F sH (H lB), he CII deg ading p o ease, by H lKC (H lA). P oc. Na l. Acad. Sci. USA 94, 5544-5549. Kiha a,A., Akiyama,Y., and I o,K. (1998). Di e en pa hways o p o ein deg ada ion by he F sH/H lKC memb ane-embedded p o ease complex: An implica ion om he in e e ence by a mu an o m o a new subs a e p o ein, YccA. J. Mol. Biol. 279, 175-188. Kiha a,A., Akiyama,Y., and I o,K. (1999). Disloca ion o memb ane p o eins in F sH- media ed p o eolysis. EMBO J. 18, 2970-2981. 79    Re e ence lis Ki an,M., Chauhan,A., Dziedzic,R., Maloney,E., Mukhe ji,S.K., Madi aju,M., and Rajagopalan,M. (2009). Mycobac e ium ube culosis sH exp ession in esponse o s ess and iabili y. Tube culosis. (Edinb. ) 89 Suppl 1, S70-S73. Ki s ein,J., Schlo haue ,T., Dougan,D.A., Lilie,H., Tischendo ,G., Mogk,A., Bukau,B., and Tu gay,K. (2006). Adap o p o ein con olled oligome iza ion ac i a es he AAA+ p o ein ClpC. EMBO J. 25, 1481-1491. Ki ko,R.D., Clee on,R.L., A men ou ,E.I., Lee,G.E., Noguchi,K., Be kmen,M.B., Jones,B.D., and Slonczewski,J.L. (2009). Cy oplasmic acidi ica ion and he benzoa e ansc ip ome in Bacillus sub ilis. PLoS. One. 4, e8255. Klobu che ,L.A., Ragkousi,K., and Se low,P. (2006). The Bacillus sub ilis spo e coa p o ides "ea esis ance" du ing phagocy ic p eda ion by he p o ozoan Te ahymena he mophila. P oc. Na l. Acad. Sci. U. S. A 103, 165-170. Kobile ,O., Rokney,A., and Oppenheim,A.B. (2007). Phage lambda CIII: a p o ease inhibi o egula ing he lysis-lysogeny decision. PLoS. One. 2, e363. K oos,L. (2007). The Bacillus and Myxococcus de elopmen al ne wo ks and hei ansc ip ional egula o s. Annu. Re . Gene . 41, 13-39. Laabe ki,M.H. and Dwo kin,J. (2008). Role o spo e coa p o eins in he esis ance o Bacillus sub ilis spo es o Caeno habdi is elegans p eda ion. J. Bac e iol. 190, 6197-6203. Laemmli,U.K. (1970). Clea age o s uc u al p o eins du ing he assembly o he head o bac e iophage T4. Na u e 277, 680-685. Langklo z,S., Schake mann,M., and Na be haus,F. (2011). Con ol o lipopolysaccha ide biosyn hesis by F sH-media ed p o eolysis o LpxC is conse ed in en e obac e ia bu no in all g am-nega i e bac e ia. J. Bac e iol. 193, 1090-1097. Lazazze a,B.A., Ku se ,I.G., McQuade,R.S., and G ossman,A.D. (1999). An au o egula o y ci cui a ec ing pep ide signaling in Bacillus sub ilis. J. Bac e iol. 181, 5193-5200. Le,A.T. and Schumann,W. (2009). The Spo0E phospha ase o Bacillus sub ilis is a subs a e o he F sH me allop o ease. Mic obiology 155, 1122-1132. 80    Re e ence lis Le e s,G.G. and Go esman,S. (1998). Lambda Xis deg ada ion in i o by Lon and F sH. J. Bac e iol. 180, 1573-1577. Lies,M. and Mau izi,M.R. (2008). Tu no e o endogenous Ss A- agged p o eins media ed by ATP-dependen p o eases in Esche ichia coli. J. Biol. Chem. 283, 22918-22929. Losick,R. and S agie ,P. (1992). C issc oss egula ion o cell- ype-speci ic gene exp ession du ing de elopmen in B. sub ilis. Na u e 355, 601-604. McQuade,R.S., Comella,N., and G ossman,A.D. (2001). Con ol o a amily o phospha ase egula o y genes (ph ) by he al e na e sigma ac o sigma-H o Bacillus sub ilis. J. Bac e iol. 183, 4905-4909. Mei,Z., Wang,F., Qi,Y., Zhou,Z., Hu,Q., Li,H., Wu,J., and Shi,Y. (2009). Molecula de e minan s o MecA as a deg ada ion ag o he ClpCP p o ease. J. Biol. Chem. 284, 34366-34375. Mille ,J.H. (1972). Expe imen s in Molecula Gene ics. (Cold Sp ing Ha bo , NY: Cold Sp ing Ha bo Labo a o y). Mogk,A., Haywa d,R., and Schumann,W. (1996). In eg a i e ec o s o cons uc ing single-copy ansc ip ional usions be ween Bacillus sub ilis p omo e s and a ious epo e genes encoding hea -s able enzymes. Gene 182, 33-36. Molle,V., Fuji a,M., Jensen,S.T., Eichenbe ge ,P., Gonzalez-Pas o ,J.E., Liu,J.S., and Losick,R. (2003). The Spo0A egulon o Bacillus sub ilis. Mol. Mic obiol. 50, 1683-1701. Mo lo ,C., Ueha a,T., Ma quis,K.A., Be nha d ,T.G., and Rudne ,D.Z. (2010). A highly coo dina ed cell wall deg ada ion machine go e ns spo e mo phogenesis in Bacillus sub ilis. Genes De . 24, 411-422. Mucho a,K., Lewis,R.J., Pe ecko,D., B annigan,J.A., Ladds,J.C., Leech,A., Wilkinson,A.J., and Ba ak,I. (2004). Dime -induced signal p opaga ion in Spo0A. Mol. Mic obiol. 53, 829-842. Nakano,M.M., Dailly,Y.P., Zube ,P., and Cla k,D.P. (1997). Cha ac e iza ion o anae obic e men a i e g ow h o Bacillus sub ilis: Iden i ica ion o e men a ion end p oduc s and genes equi ed o g ow h. J. Bac e iol. 179, 6749-6755. 81    Abb e ia ion Lis o abb e ia ions and symbols Abb e ia ion Deno a ion σ Sigma Fac o 2D-Gel Two-Dimensional Gel 2D-PAGE Two-Dimensional Polyac ylamide Gel Elec opho esis AAA ATPases Associa ed wi h a Va ie y o Cellula Ac i i ies ATP Adenosine-5'-T iphospha e AmpRResis an o Ampicillin BSA Bo ine Se um Albumin Ca Gene Coding o Chlo amphenicol-Ace y ans e ase CHAPS 3-[(3-Cholamidop opyl)Dime hylammonio]-1-P opanesul ona e CmRResis an o Chlo amphenicol COG Clus e s o O hologous G oups CSF Compe ence S imula ing Fac o ddH2O Double Dis illed Wa e DHFR Dihyd o ola e Reduc ase DMSO Dime hyl Sul oxide DSM Di co Spo ula ion Medium DSP Di hiobis[Succinimidyl P opiona e] DTT Di hio h ei ol EDTA E hylene Diamine Te aace ic Acid E m Gene Coding o E y h omycin Resis ance E mRResis an o E y h omycin GFP G een Fluo escen P o ein GSH Reduced Glu a hione GST Glu a hione-S-T ans e ase IEF Isoelec ic Focusing IPG Immobilized pH G adien IPTG Isop opyl-ß-D-Thiogalac oside 88    Abb e ia ion KDO 3-Deoxy-D-Manno-Oc -2-Ulosonic Acid LB Lu ia-Be ani LPS Lipopolysaccha ide MS Mass Spec ome y Neo Gene Coding o Neomycin Resis ance NeoRResis an o Neomycin OD Op ical Densi y OD578 (600) Op ical Densi y a a Wa eleng h o 578 (o 600) nm PBS Phospha e Bu e ed Saline PCR Polyme ase Chain Reac ion PMSF Phenylme hylsul onyl Fluo ide Pg ac An IPTG inducible p omo e , which consis s p omo e o Pg oES and lac ope a o RBS Ribosome Binding Si e Rpm Re olu ion o Round pe Minu e SDS Sodium Dodecyl Sulpha e SDS-PAGE Sodium Dodecyl Sul a e Polyac ylamide Gel Elec opho esis Spc Gene Coding o Spec imomycin Resis ance SpcRResis an o Spec inomycin SRH The Second Region o Homology TE T is – EDTA TCA T ica boxylic Acid T is T is-(Hyd oxyme hyl)-Aminome hane xS age x o Spo ula ion P og am WT Wild-Type 89    Publica ion Publica ion Resea ch in Mic obiology The spo ula ion con ol gene spo0M o Bacillus sub ilis is a a ge o he F sH me allop o ease Hue Bach Thi Nguyen and Wol gang Schumann Ins i u e o Gene ics, Uni e si y o Bay eu h, D-95440 Bay eu h, Ge many Recei ed 4 Augus 2011, Accep ed 10 Oc obe 2011. A ailable online 19 No embe 2011 ********** Publica ion submi ed The eag gene o Bacillus sub ilis in luences he ac i i y o he Spo0E phospha ase Hue Bach Thi Nguyen, Anja Maie and Wol gang Schumann Ins i u e o Gene ics, Uni e si y o Bay eu h, D-95440 Bay eu h, Ge many Submi ed o Cu en Mic obiology ********** Publica ion in p epa a ion Cons uc ion o sH ap mu an o isola e F sH p o ein subs a e in Bacillus sub ilis, Hue Bach Thi Nguyen and Wol gang Schumann. in p epa a ion. 90    E klä ung Hie mi e klä e ich, die o liegende A bei selbs s ändig e ass zu haben und keine ande en als die on mi angegebenen Quellen ode Hil smi el e wende zu haben. Fe ne habe ich wede an de Uni e si ä Bay eu h, noch an eine ande en Hochschule e such eine Disse a ion einzu eichen, ode mich eine P omo ionsp ü ung zu un e ziehen. Hue Bach Thi Nguyen Bay eu h, Janua 2012 91   