Development of novel hybrid phosphorated quinoline derivatives as topoisomerase 1B inhibitors with antiproliferative activity
Abstract
466 p.
Full text
Departamento de Química Orgánica I Facultad de Farmacia Development of novel hybrid phosphorated quinoline derivatives as topoisomerase 1B inhibitors with antiproliferative activity Memoria presentada por Asier Selas Lanseros Para optar al grado de doctor con mención Vitoria-Gasteiz, 2022 (cc) 2022 Asier Selas Lanseros (cc by-sa 4.0)
Acknowledgements/agradecimientos El trabajo recogido en la presente memoria no hubiera podido llevarse a cabo sin la asistencia, colaboración y orientación de un gran número de personas que de una forma u otra no solo estuvieron presentes, sino que contribuyeron para la finalización y presentación del mismo. En primer lugar, me gustaría agradecer a la Dra. Concepción Alonso y al profesor Francisco Palacios por abrirme las puertas del departamento de Química Orgánica I y darme la oportunidad de formar parte de su grupo de investigación, por su apoyo inquebrantable y (sobretodo) su paciencia. Aprovecho la ocasión para mostrar mi más sincero reconocimiento a su trabajo y trayectoria, logrando dar el salto a proyectos de química terapéutica de alto nivel y formar a jóvenes investigadores en el campo. También quisiera agradecer al resto de compañeros de línea de investigación (Dr. Martín, Dra. Fuertes, Dra. Rubiales y Ángela) por su dedicación y buen hacer en el mundo de las topoisomerasas. Ha sido un verdadero placer formar parte de este grupo. También me gustaría recordar y agradecer al resto de compañeros del grupo de investigación que han ido pasando por más o menos tiempo, pero que todos ellos han dejado su huella (espero no dejarme a nadie). Adrián, Alba, Aitor, Carla, Gonzalo, Ishraq, Julene, Kassia, Kharim, Leire, Maider, Saverio, Xabi, Xabi Jr, Víctor Zuriñe, Zouhair, ha sido una suerte compartir laboratorio y cafetería con vosotros, me llevo un gran recuerdo. Y no quisiera olvidarme de los profesores: Ana, Begoña, Carme, Delos, Edorta, Javi, Mirari, Yurre, por demostrar cada día que la química orgánica no es aburrida en absoluto. Sois un ejemplo y un gran equipo. And now, I may move to English for a while to express my utmost gratitude to Dr. Birgitta R. Knudsen (Department of Molecular Biology and Genetics, Aarhus University) and Dr. Cinzia Tesauro (VPCIR Biosciences), it has been such an honour to collaborate with your research groups that I had to do it twice. It has been a challenging adventure into Molecular Biology (a baptism of fire) with a happy ending and I really enjoy all the good times in the lab, cake-days, beer-days and breakfast-meetings. I will never forget all the support that I received from all the members of the group, I really needed it to hurdle all the obstacles on the way. I specially want to thank to all the amazing lab mates in Aarhus: Josephine, Kamilla, Karol, Kathrine Kirstine, Maria, Noriko and of course, Adam. This PhD memory has a strong Danish accent. Y por supuesto, muchísimas gracias a la familia y amigos por todo el cariño y la ayuda que me han dado en todo momento. Esta Aventura hubiera sido imposible sin ellos. Muchas gracias a mis padres por creer en mí y exigirme para que llegue a ser lo que puedo ser. A mis abuelos, por toda su ternura y apoyarme hasta en las peores decisiones. A Pili, por preocuparse siempre por mí. A todos mis amigos, que han sufrido mis ausencias y han prometido brindar cuando recupere parte de mi libertad. Por último, quisiera guardar unas últimas líneas para agradecer a Andrea todo su apoyo y paciencia conmigo (ella sí que se las ha ganado). Muchas gracias por tu dulzura, por estar siempre ahí, por cuidarme cuando se me olvida y por suministrarme café y comida en los malos momentos. Al final vas a acabar cogiéndole cariño a las topoisomerasas tú también.
We can speak and think only of what exists. And what exists is uncreated and imperishable for it is whole and unchanging and complete. It was not or nor shall be different since it is now, all at once, one and continuous. Attributed to Parmenides of Elea The investigation of the truth is in one way hard, in another easy. An indication of this is found in the fact that no one is able to attain the truth adequately, while, on the other hand, no one fails entirely, but everyone says something true about the nature of all things, and while individually they contribute little or nothing to the truth, by the union of all a considerable amount is amassed. Aristotle, Metaphysics, book 2 ( ), chapter I
Index Abbreviations, acronyms and symbols ......................................................................................... 1 Introduction and objectives .......................................................................................................... 7 1. Topoisomerase I as a target in anticancer drug research ..................................................... 8 1.1. DNA topoisomerases ...................................................................................................... 8 1.2. Targeting human type IB topoisomerase (hTOP1B) ..................................................... 13 1.3. Development of human TOP1B (hTOP1) inhibitors as cancer chemotherapeutic drugs in medicinal chemistry ........................................................................................................ 17 2. Synthesis of quinolines ........................................................................................................ 39 2.1. Major methods for the synthesis of quinolines ........................................................... 48 3. Objectives ............................................................................................................................ 67 Chapter I. Synthesis of phosphorated quinoline derivatives by the [4+2] Povarov reaction ..... 69 I-1. The role of phosphorus in medicinal chemistry and drug discovery ................................ 70 I-1.1. Phosphorus-based transition state intermediate analogues ..................................... 73 I-1.2. Phosphorus-containing drugs .................................................................................... 75 I-2. The Povarov reaction ........................................................................................................ 84 I-2.1. The mechanism of the Povarov reaction ................................................................... 86 I-2.2. Electrophilic activation of the diene by Lewis-acid (LA) and Brønsted-acid (BA) catalysts ............................................................................................................................... 87 I-2.3. Dienophiles in the Povarov reaction .......................................................................... 89 I-2.4. Dehydrogenation of tetrahydroquinoline adducts obtained by the Povarov reaction to achieve fully aromatic quinolines ................................................................................... 91 I-2.5. Summary, a historical approach of the Povarov reaction.......................................... 93 I-3. Synthesis of quinolinylphosphine oxide derivatives ......................................................... 94 I-3.1. Synthesis of (2-aminophenyl)diphenylphosphine oxide 1a ....................................... 94 I-3.2. Synthesis of hybrid diphenylphosphine oxide substituted 1,2,3,4tetrahydroquinolines by the Povarov reaction ................................................................... 96 I-3.3. Synthesis of diphenylphosphine oxide substituted quinolines ................................ 104 I-3.4. Summary of the synthetic routes employed for the preparation of hybrid quinolin-8yl phosphine oxide derivatives 6 and 1,2,3,4-tetrahydroquinolin-8-yl phosphine oxide derivatives 7 ...................................................................................................................... 108 I-4. Synthesis of hybrid dialkyl 1,2,3,4-tetrahydroquinolinylphosphonates and dialkyl quinolinylphosphonates ........................................................................................................ 110 I-4.1. Synthesis of anilines substituted with dialkyl phosphonate 1b, 1c and 1d ............ 110 I-4.2. Synthesis of dialkyl quinolin-8-ylphosphonates ....................................................... 114 I-4.3. Synthesis of hybrid diethyl 1,2,3,4-tetrahydroquinolin-6-ylphosphonates and diethyl quinolin-6-ylphosphonates ............................................................................................... 125
I-5. Synthesis of hybrid dialkyl indeno[2,1-c]quinolinylphosphonates.................................132 I-5.1. Synthesis of dialkyl tetrahydro-5H-indeno[2,1-c]quinolinylphosphonates ............. 132 I-5.2. Synthesis of dialkyl 7H-indeno[2,1-c]quinolinylphosphonates and dialkyl 7-oxo-7Hindeno[2,1-c]quinolinylphosphonates .............................................................................. 138 Chapter II. Study of the in vitro TOP1 inhibitory activity of the newly synthesized quinoline derivatives ................................................................................................................................. 142 II-1. Introduction: in vitro drug screening of TOP1 inhibitors .............................................. 143 II-1.1. DNA Relaxation assay .............................................................................................. 143 II-1.2. Nicking assay ........................................................................................................... 145 II-1.3. DNA cleavage experiments based on synthetic dsDNA (double stranded DNA) substrates specific for TOP1 .............................................................................................. 146 II-1.4. The REEAD assay: a DNA-based nanosensor system for the measurement of TOP1 activity ............................................................................................................................... 152 II-2. In vitro evaluation of the hTOP1B inhibitory activity of the newly synthesized compounds ............................................................................................................................ 155 II-2.1. In vitro drug screening of 1,2,3,4-tetrahydroquinolin-8-yl phosphine oxides and quinolin-8-yl phosphine oxides as TOP1 inhibitors ........................................................... 156 II-2.1.1. Evaluation of TOP1 inhibitory activity by DNA relaxation assay .......................... 156 II-2.2. In vitro drug screening of dialkyl quinolinylphosphonates and dialkyl (indeno[2,1c]quinolinyl)phosphonates as TOP1 inhibitors ................................................................. 167 II-3. Development of the REEAD assay as a novel quantitative method for the in vitro evaluation of the hTOP1B inhibitory activity in drug screening ........................................... 181 II-3.1. The REEAD-on-a-slide approach ............................................................................. 181 II-3.2. The Cleavage/Ligation REEAD assay (C/L REEAD) ................................................... 188 Chapter III. Study of the in vitro antiproliferative activity of the newly synthesized quinoline derivatives ................................................................................................................................. 196 III-1. Introduction: Human TOP1B inhibitors in cancer chemotherapy ................................ 197 III-1.1. TOP1B inhibitors as cancer chemotherapeutic drugs in multitarget and drug combination therapies ...................................................................................................... 197 III-1.2. Enhanced drug-delivery systems to improve the pharmacological properties of TOP1B inhibitors ................................................................................................................ 199 III-1.3. Current status of TOP1B inhibitors used in clinics ..................................................... 201 III-2. Introduction: in vitro antiproliferative activity of TOP1 inhibitors ........................... 204 III-2.1. Metabolic cell viability assays ................................................................................ 205 III-3. In vitro evaluation of the antiproliferative activity in human cell lines ........................ 209 III-3.1. In vitro evaluation of the antiproliferative activity in human cancer cell lines of 1,2,3,4-tetrahydroquinolin-8-yl phosphine oxides 6 and quinolin-8-yl phospine oxides 7 ........................................................................................................................................... 212
III-3.2. In vitro evaluation of the antiproliferative activity in human cancer cell lines of dialkyl quinolinylphosphonates and dialkyl (indeno[2,1-c]quinolinyl)phosphonates ...... 217 III-4. Complementary antiproliferative studies to identify the lead compounds of the phosphonate-substituted quinoline and indenoquinoline families ...................................... 226 III-4.1. Study of the antiproliferative activity in RPMI-8402 and CPT-K5 human cancer cell lines ................................................................................................................................... 227 III-4.2. Study of the antiproliferative activity in HEK-293 and HEK-293 TOP1 KD (TOP1 knockdown) human cancer cell lines ................................................................................ 232 IV. Addenda: Study of the antileishmanial effect of phosphorated quinoline derivatives in Leishmania infantum: in vitro/ex vivo cytotoxicity in L. infantum parasites and in vitro inhibitory activity against Leishmania TOP1 (LTOP1) ................................................................................ 240 IV-1. Introduction: leishmaniasis ........................................................................................... 241 IV-1.1. Parasites from Leishmania species: the ethiological agent of leishmaniasis ............ 241 IV-1.2. Clinical forms of leishmaniasis ............................................................................... 244 IV-1.3. Treatment of leishmaniasis ....................................................................................... 245 IV-1.4. LTOP1B as a druggable target in antileishmanial drug discovery .......................... 256 IV-2. Study of the antileishmanial effect of phosphorated quinoline derivatives in Leishmania infantum ................................................................................................................................ 261 IV-2.1. Antileishmanial effect of 1,2,3,4-tetrahydroquinolin-8-yl phosphine oxides and quinolin-8-yl phosphine oxides ......................................................................................... 262 IV-2.2. Antileishmanial effect of dialkyl quinolinyl phosphonates .................................... 266 V. Conclusions ........................................................................................................................... 272 VI. Experimental section ........................................................................................................... 277 VI-1. Chemistry ...................................................................................................................... 278 VI-1.1 General experimental information ......................................................................... 278 VI-1.2. Synthesis of quinolinylphosphine oxide derivatives .............................................. 280 VI-1.3. Synthesis of hybrid 1,2,3,4-tetrahydroquinolinyl and quinolinyl dialkyl phosphonates .................................................................................................................... 296 VI-1.4.. Synthesis of of hybrid dialkyl indeno[2,1-c]quinolinylphosphonates ................... 327 VI-2. TOP1 assays .................................................................................................................. 341 VI-2.1. Materials and enzyme ........................................................................................... 341 VI-2.2. DNA relaxation assay ............................................................................................. 341 VI-2.3. Nicking assay .......................................................................................................... 355 VI-2.4. Cleavage-religation equilibrium assay ................................................................... 366 VI-2.5. REEAD assay .......................................................................................................... 366 VI-3. Cell viability assays ........................................................................................................ 369 VI-3.1. Cell culture ............................................................................................................. 369 VI-3.2. CCK-8 cell viability assays ....................................................................................... 370
VI-3.3. PrestoBlue cell viability assays...............................................................................435 VI-3.4. siRNA mediated TOP1 knockdown in HEK-293 cell line ........................................ 457 VI-3.5. Western blot analysis of HEK-293 cells transfected with siRNATOP1, scrambled siRNA and mock control .............................................................................................................. 457
1 Abbreviations, acronyms and symbols
8 1. Topoisomerase I as a target in anticancer drug research Cancer is a major healthcare problem and a global death leading cause. According to its latest Cancer Global Cancer Observatory) estimated an incidence of 19 million new cancer cases, more than 50 million prevalent cases and around 10 million deaths directly associated to cancer in 2020 worldwide 1. Furthermore, GLOBOCAN predicts that there will be 28.9 new cancer cases by 2040 based on the actual trend and expected demographical changes, primarily associated to the contemplated improvement of socioeconomic conditions in developing countries and the related population growth and enlargement of life expectancy. The major purpose of cancer therapy is to specifically inhibit the growth and spread cancer cells and in this regard, therapies involving conventional chemotherapy, radiotherapy, immunotherapy and surgery are applied, along with the emerging precision medicine approaches2. Even though, chemotherapeutic drugs remain playing a key role in the oncologic treatment alone or as an essential part of a targeted cancer therapy and hence, the development of selective, safer and more pharmacologically active compounds represents an active area of research in drug discovery and medicinal chemistry3. Accordingly, human DNA topoisomerase I (TOP1) constitutes a broadly explored validated therapeutic target and therefore, TOP1 inhibitor drugs have emerged as potential anticancer agents, highlighting the fact that some TOP1 inhibitors have reached to the clinical approval and are currently administered alone or as a payload of a pharmaceutical composition4. 1.1. DNA topoisomerases Historical perspective: the discovery of topoisomerases, DNA topology-modulating enzymes essential for genome stability and DNA metabolism. The double helical structure of DNA is supercoiled as a means of compacting the genome for a stable and secure storing of the genetic information. Maintaining an appropriate topological 1 a) Sung H, Ferlay J, Siegel RL, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71(3):209-249. doi:10.3322/caac.21660 b) GLOBOCAN 2020 database. Accessed May 3, 2022 at https://gco.iarc.fr/ 2 Mollaei M, Hassan ZM, Khorshidi F, Langroudi L. Chemotherapeutic drugs: Cell deathand resistancerelated signaling pathways. Are they really as smart as the tumor cells?. Transl Oncol. 2021;14(5):101056. doi:10.1016/j.tranon.2021.101056 3 Kumar B, Singh S, Skvortsova I, Kumar V. Promising Targets in Anti-cancer Drug Development: Recent Updates. Curr Med Chem. 2017;24(42):4729-4752. doi:10.2174/0929867324666170331123648 4 Thomas A, Pommier Y. Targeting Topoisomerase I in the Era of Precision Medicine. Clin Cancer Res. 2019;25(22):6581-6589. doi:10.1158/1078-0432.CCR-19-1089
9 state of DNA was assumed to be essential even before DNA topoisomerases were discovered, either by DNA winding when genes have to be stored or by DNA unwinding when strand separation is required to access the genetic information5. In this regard, understanding the coiling and tangling of the DNA during its metabolic manipulation entailed an issue since the deciphering of the double helical architecture of the genomic DNA molecule6. The first indications of a supercoiled state in the DNA were reported by Vinograd and collaborators in 1965 while working with double-stranded DNA (dsDNA) polyoma tumour viruses7. During DNA-sedimentation analysis, Vinograd found two forms of circular dsDNA with different compactness-degree. The most compact form of dsDNA reported a higher resistance to denaturation by heating or exposure to elevated pH. Surprisingly, electron-microscopy analysis demonstrated that the unique structural difference between the two forms of dsDNA was the presence of a single-stranded breakage in the less compact form, presumably by the endonuclease activity of a DNase I enzyme. In light of these findings, Vinograd and collaborators firstly suggested the existence of two circular dsDNA with the same chemical formula and stereochemistry but varying in how the double-helix of DNA is wounded around itself in the three-dimensional space (topology), i.e. the presence of DNA topoisomers differentiated by their supercoiling state. One year later, Vinograd and Lebowitz proposed the theory of DNA supercoiling and established the basis of the quantitative measure for the DNA supercoiling state8, namely the Linking number or Lk (the number of the double-helical turns in the linear molecule of a circular dsDNA), which is defined as the sum of the twist (coiling of individual strands of DNA around the axis of DNA helix) and the writhe (coiling of the axis of DNA helix itself in the space)9. At that time, it was thought that the relaxation activity of supercoiled DNA was produced by a sequence of endonuclease (DNase I)-DNA ligase activity of two independent enzymes. However, in the late 1960s Wang purified an E. coli cell lysate reporting the putative endonuclease-ligase activity in a positively charged DEAE (diethylaminoethyl cellulose) column and he obtained a single enzyme responsible for the removal of negative supercoils (Figure 1) in a circular dsDNA 5 a) Watson JD, Crick FH. The structure of DNA. Cold Spring Harb Symp Quant Biol. 1953;18:123-131. doi:10.1101/sqb.1953.018.01.020 6 a) Delbrück M. On the replication of desoxyribonucleic acid (DNA). Proc Natl Acad Sci U S A. 1954;40(9):783-788. doi:10.1073/pnas.40.9.783 7 Vinograd J, Lebowitz J, Radloff R, Watson R, Laipis P. The twisted circular form of polyoma viral DNA. Proc Natl Acad Sci U S A. 1965;53(5):1104-1111. doi:10.1073/pnas.53.5.1104 8 Vinograd J, Lebowitz J. Physical and topological properties of circular DNA. J Gen Physiol. 1966;49(6):103125. doi:10.1085/jgp.49.6.103 9 White JH. Self-linking and the gauss integral in higher dimensions. Am J Math. 1969;91(3):693-728. doi: 10.2307/2373348
10 by a combination of both endonuclease activity (which allows the swivel of the parental DNA strands) and DNA ligase activity that seals the breakage in the phosphate backbone10. Wang and velocity of the centrifuge, as at that time the DNA relaxation activity was usually evaluated by ultracentrifugation) and published the work in 1971, resulting this E.coli topoisomerase to be discovered11. Likewise, in 1972 Champoux and coworkers published the finding of an enzyme isolated from mouse embryonic cells with DNase I-DNA ligase sequential activity, which reported not only to relax negatively supercoiled DNA, but also to resolve positively supercoiled dsDNA substrates12 eukaryotic topoisomerase. Figure 1. General overview of negatively (left side, in blue) and positively (right side, in green) supercoiled dsDNA, along with the corresponding relaxed form of circular dsDNA in between. In the middle of the figure (above) the two possible plectonemic supercoils are illustrated: by consensus, in a bidimensional plane, negative plectonemic supercoils present a clockwise crossover, while positive plectonemic supercoils are drawn showing a counterclockwise crossover. re isolated from many both eukaryotic and prokaryotic sources (human, monkey, rat, frog, duck, chicken, Drosophila flies, Bacillus bacteria and yeasts, 10 Wang JC. A journey in the world of DNA rings and beyond. Annu Rev Biochem. 2009;78:31-54. doi:10.1146/annurev.biochem.78.030107.090101 11 Wang JC. Interaction between DNA and an Escherichia coli protein omega. J Mol Biol. 1971;55(3):523533. doi:10.1016/0022-2836(71)90334-2 12 Champoux JJ, Dulbecco R. An activity from mammalian cells that untwists superhelical DNA--a possible swivel for DNA replication (polyoma-ethidium bromide-mouse-embryo cells-dye binding assay). Proc Natl Acad Sci U S A. 1972;69(1):143-146. doi:10.1073/pnas.69.1.143
11 among others), but this enzyme family did not have yet a systematic name to describe their enzymatic mode of action13. Nevertheless, studies with these enzymes led to the disclosure of their catalytic mechanism, which comprises the introduction of a transient break in the dsDNA phosphate backbone that allows the swivel of the DNA chains around the gap and a subsequent resealing of the breakage. Once disclosed the catalytic mechanism, the enzymes previously 14, a term that accurately defines their selective function in modulating the DNA topology. Since then, topoisomerases have been described in all three cellular domains of life (Archaea, Bacteria and Eucarya) and were further classified according to their catalytic mechanism and domain organization. DNA topoisomerases: structure, mechanism and classification DNA topoisomerases are ubiquitous enzymes that resolve DNA topological tension in the genome during essential cellular processes as DNA replication, transcription, chromosome segregation and recombination. The general mechanism of DNA topoisomerases involves a cleavage of the dsDNA phosphate backbone by the catalytic Tyr (Tyrosine) residue of the topoisomerase, resulting in a covalent phosphodiester linkage between the Tyr and the terminus of the cleaved strand (TOPCC, topoisomerase cleavage complex). The scission in the dsDNA permits the DNA to swivel around the nick and then the enzyme reseals the gap, leaving the dsDNA intact and relaxing negative or/and positive supercoils15. Moreover, bacterial DNA gyrase (type II topoisomerase) and reverse gyrase (type I topoisomerase) are topoisomerases present in bacteria with the ability to introduce negative or positive supercoils into the DNA, respectively16. There are three different nomenclatures used in the classification of DNA topoisomerases, i.e. historical (I-VI), mechanistic and evolutionary nomenclatures. This fact may lead to confusion but fortunately, the phylogenetic features that allow the evolutionary classification17 are in concordance and further support the characteristics used for the mechanistic categorization15. 13 Champoux JJ. Proteins that affect DNA conformation. Annu Rev Biochem. 1978;47:449-479. doi:10.1146/annurev.bi.47.070178.002313 14 Kirkegaard K, Wang JC. Escherichia coli DNA topoisomerase I catalyzed linking of single-stranded rings of complementary base sequences. Nucleic Acids Res. 1978;5(10):3811-3820. doi:10.1093/nar/5.10.3811 15 Schoeffler AJ, Berger JM. DNA topoisomerases: harnessing and constraining energy to govern chromosome topology. Q Rev Biophys. 2008;41(1):41-101. doi:10.1017/S003358350800468X 16 Champoux JJ. DNA topoisomerases: structure, function, and mechanism. Annu Rev Biochem. 2001;70:369-413. doi:10.1146/annurev.biochem.70.1.369 17 Forterre P, Gadelle D. Phylogenomics of DNA topoisomerases: Their origin and putative roles in the emergence of modern organisms. Nucleic Acids Res. 2009;37(3):679-692. doi: 10.1093/nar/gkp032
12 Accordingly, based on the Lk number alteration and the number of cleaved strands, DNA topoisomerases can be classified into type I and type II subfamilies. Type I topoisomerases (TOP1) are ATP-independent DNA modulating enzymes that relax supercoil tension by introducing transient single-strand breaks (SSB) in dsDNA substrates and change the Lk by units Lk = ±1), while type II topoisomerases (TOP2) require Mg2+ and coupled ATP-hydrolysis in order to relax supercoils (and also decatenate/unknot) dsDNA by introducing double-stranded breaks (DSB) and altering the Lk Lk = ±2)16. Type I topoisomerases (TOP1) According to their catalytic mechanism, sequence and domain organization, type I topoisomerases are further divided into three groups: IA, IB and IC. In the cleavage step of enzymatic catalysis, type IA topoisomerases form a TOP1CC (TOP1 cleavage complex) in which the catalytic Tyr residue of the enzyme remains covalently bounded (posphotyrosine linkage) to nd passes by an enzyme-bridged strand passage mechanism through the transient nick (the strand passes without swivelling across the enzyme-bridged gate, as depicted in Figure 2) and finally the enzyme religates the cleaved strand leaving the DNA duplex relaxed and intact18. At this point, it has to be mentioned that divalent metallic cations (mainly Mg2+) are necessary cofactors for TOP1A catalysis, in particular to orient the free hydroxyl group of the cleaved strand to the phosphotyrosine bound and favour the religation19. On the contrary, in IB and IC subfamilies the Tyr residue remains of a controlled strand rotation mechanism in which the second strand rotates (swivels) around the transient nick, as illustrated in the Figure 220. TOP1B and TOP1C do not need Mg2+ cations to be active, even though it is reported that bivalent metallic cations as Mg2+, Mn2+ and Ca2+ could stimulate TOP1B activity as much as 25-fold21. 18 Dekker NH, Rybenkov VV, Duguet M, et al. The mechanism of type IA topoisomerases. Proc Natl Acad Sci U S A. 2002;99(19):12126-12131. doi:10.1073/pnas.132378799 19 Corbett KD, Berger JM. Structure, molecular mechanisms, and evolutionary relationships in DNA topoisomerases. Annu Rev Biophys Biomol Struct. 2004;33:95-118. doi:10.1146/annurev.biophys.33.110502.140357 20 Capranico G, Marinello J, Chillemi G. Type I DNA Topoisomerases. J Med Chem. 2017;60(6):2169-2192. doi:10.1021/acs.jmedchem.6b00966 21 Stewart L, Ireton GC, Parker LH, Madden KR, Champoux JJ. Biochemical and biophysical analyses of recombinant forms of human topoisomerase I. J Biol Chem. 1996;271(13):7593-7601. doi:10.1074/jbc.271.13.7593
13 Figure 2. Catalytic mechanism of TOP1 enzymes: type IA topoisomerases resolve positive/negative supercoils by a strand passage mechanism, while type IB/C topoisomerases effect controlled strand rotation. Type II topoisomerases (TOP2) Type II topoisomerases share the mode of relaxing supercoils by forming an enzyme-bridged DSB in the DNA duplex and effecting a strand passage of another dsDNA segment through the nick, which is subsequently resealed16. Type II topoisomerases are further divided into IIA (TOP2A) and IIB (TOP2B) subclasses according to their sequence and domain structure. The type IIA topoisomerase family comprises the eukaryotic TOP2 (including the human TOP2 and TOP2 isoforms), viral/bacteriophage TOP2 and bacterial DNA gyrase and TopoIV. On the other hand, the presence of type IIB topoisomerases is restricted to Archaea organisms, plants and algae15. 1.2. Targeting human type IB topoisomerase (hTOP1B) Targeting topoisomerases in drug research The human genome encodes six DNA topoisomerases: two type IB (nuclear TOP1B and mitochondrial TOP1B), two type IIA (TOP2 , TOP2 ) and two type IA topoisomerases (TOP3
14 and TOP3 22. Among human topoisomerases, nuclear TOP1 and TOP2 are well-established and validated therapeutic targets of anticancer drugs. Regarding TOP2, the chemotherapeutic drugs etoposide, doxorubicin and mitoxantrone are interfacial inhibitors (poisons) of TOP2 that act by stabilizing TOP2CC (TOP2 cleavage complexes), whereas the TOP2 catalytic inhibitor dexrazoxane is used as an adjuvant to decrease the cardiotoxicity induced by doxorubicin23. Besides human topoisomerases, eukaryotic TOP1B of Leishmania genus is reported as an emerging druggable target for the development of antileishmanial agents with therapeutic potential24. In like manner, moving on to prokaryotic topoisomerases, bacterial DNA gyrase (a type IIA topoisomerase) is the biomolecular target of current antibiotics quinolones and coumarin. Furthermore, type IA bacterial topoisomerase has been identified as a biological target and consequently, selective bacterial TOP1A inhibitors are under investigation for the development of new antibiotics against Mycobacterium tuberculosis, Helicobacter pylori, Pseudomonas aeruginosa and Streptococcus pneumoniae infective agents25. Within the context of this introduction, the present section will focus mainly on human TOP1B inhibitors, since human (nuclear) TOP1 has been the most widely studied DNA topoisomerase as a biological target in medicinal chemistry26. TOP1B catalytic cycle Among type IB topoisomerases in eukaryotic cells, human nuclear topoisomerase 1 (hTOP1) is a broadly studied biological target in anticancer drug discovery. Eukaryotic TOP1B remove negative and positive supercoils in dsDNA by means of a catalytic cycle comprising 5 steps, as depicted in Figure 3: (A) Binding: the enzyme binds to the DNA duplex. (B) Cleavage: Nucleophilic attack by the catalytic tyrosine residue (located at the position 723 in humans) to a DNA phosphodiester group (transesterification reaction) to introduce a SSB. The reaction results in a covalent TOP1-DNA cleavage complex (TOP1CC) that allows the controlled strand rotation 22 Pommier Y, Nussenzweig A, Takeda S, Austin C. Human topoisomerases and their roles in genome stability and organization [published online ahead of print, 2022 Feb 28]. Nat Rev Mol Cell Biol. 2022;121. doi:10.1038/s41580-022-00452-3 23 Delgado JL, Hsieh CM, Chan NL, Hiasa H. Topoisomerases as anticancer targets. Biochem J. 2018;475(2):373-398. Published 2018 Jan 23. doi:10.1042/BCJ20160583 24 Reguera RM, Elmahallawy EK, García-Estrada C, Carbajo-Andrés R, Balaña-Fouce R. DNA Topoisomerases of Leishmania Parasites; Druggable Targets for Drug Discovery. Curr Med Chem. 2019;26(32):5900-5923. doi:10.2174/0929867325666180518074959 25 Seddek A, Annamalai T, Tse-Dinh YC. Type IA Topoisomerases as Targets for Infectious Disease Treatments. Microorganisms. 2021;9(1):86. Published 2021 Jan 1. doi:10.3390/microorganisms9010086 26 Martín-Encinas E, Selas A, Palacios F, Alonso C. The design and discovery of topoisomerase I inhibitors as anticancer therapies [published online ahead of print, 2022 Mar 23]. Expert Opin Drug Discov. 2022;121. doi:10.1080/17460441.2022.2055545
15 (C) of the cleaved strand. (D)Religation: the transesterification reaction is reversible and the transient DNA nick formed in the cleavage step is religated by TOP1 through the nucleopilic attack of the free hydroxyl (OH- -end to terminus. (E) Unbinding: finally, the enzyme leaves the DNA intact and relaxed. Figure 3. Catalytic cycle of TOP1B. TOP1 inhibitors: poisons or suppressors The crystallization of human TOP1CC stabilized by the exogenous ligand camptothecin (CPT, a natural alkaloid compound with a selective TOP1B inhibitory activity) allowed its characterization by X-ray diffraction (Figure 4, 1T8I PDB). The study of the CPT-TOP1B-dsDNA ternary complex revealed the mode of action of the natural TOP1B inhibitor CPT and its synthetic derivatives topotecan and SN-38, which actually are clinically relevant anticancer drugs.
16 Accordingly, based on their mode of action TOP1 inhibitors are mainly classified into TOP1 poisons (or interfacial inhibitors) and TOP1 suppressors27. Figure 4. 1T8I PDB crystal structure of human TOP1-CPT-DNA ternary complex in 3D obtained by X-ray diffraction. Instead of inhibiting the enzyme in a direct manner, TOP1 interfacial inhibitors target the macromolecular interface of catalytic intermediates when TOP1 is covalently bounded to DNA (hence the name). TOP1 interfacial inhibitors are also known as poisons, as they stabilize the of the TOP1 catalytic cycle28. As depicted in the Figure 5, cleavage and religation steps of TOP1B catalytic cycle are in equilibrium (displaced toward religation in order to finish the cycle) as the transesterification reaction catalyzed by the Tyr residue is a reversible process that may turn backwards (by the From a pharmacodynamic point of view, poison-like TOP1 inhibitors target the catalytic intermediates TOP1CCs, whereas suppressor-like TOP1 inhibitors act by interfering in any other catalytic step of TOP1 cycle without trapping TOP1CCs (e.g. impeding the binding/unbinding of the enzyme or hindering the cleavage step)20 and are also referred as catalytic inhibitors in the scientific literature. 27 Pommier Y. DNA topoisomerase I inhibitors: chemistry, biology, and interfacial inhibition. Chem Rev. 2009;109(7):2894-2902. doi:10.1021/cr900097c 28 Pommier Y, Kiselev E, Marchand C. Interfacial inhibitors. Bioorg Med Chem Lett. 2015;25(18):3961-3965. doi:10.1016/j.bmcl.2015.07.032
17 Figure 5. A schematic overview of the cleavage-religation equilibrium in TOP1B. In regard to poison-like TOP1 inhibitors, the accumulation of trapped TOP1CCs results in DNA damage by collision with replication forks or transcription machinery, and subsequent apoptosis of the cell4. Consequently, the cytotoxic effect of poisons such as CPT correlates directly with the level of intracellular activity of TOP1. This fact has convert TOP1 poisons into suitable chemotherapeutic drugs since cancer cells show an increased TOP1 activity and a higher replication rate than non-cancer cells29. 1.3. Development of human TOP1B (hTOP1) inhibitors as cancer chemotherapeutic drugs in medicinal chemistry In the present section, the most relevant human TOP1B inhibitors reported in the scientific literature are going to be classified, analysing first those ones derived from natural sources and then semisynthetic/synthetic TOP1 inhibitors developed as cancer chemotherapeutic drugs or drug candidates. 1.3.1. Natural compounds targeting hTOP1B Natural products represent an important source of anticancer drugs, highlighting the fact that more than the half of the drugs used in cancer chemotherapy are based on natural compounds30. Regarding natural anticancer drugs targeting TOP1, the most representative example is camptothecin (CPT, 1, Figure 6). Camptothecin is a natural alkaloid firstly isolated in 1963 from the bark and wood of the Chinese tree Camptoteca acuminata, which presented a strong and a wide-spectrum anticancer activity in several cytotoxicity in vitro screenings as well as in a mouse 29 Postma C, Koopman M, Buffart TE, et al. DNA copy number profiles of primary tumors as predictors of response to chemotherapy in advanced colorectal cancer. Ann Oncol. 2009;20(6):1048-1056. doi:10.1093/annonc/mdn738 30 Newman DJ, Cragg GM. Natural Products as Sources of New Drugs over the Nearly Four Decades from 01/1981 to 09/2019. J Nat Prod. 2020;83(3):770-803. doi:10.1021/acs.jnatprod.9b01285
24 chemotherapeutic treatments triggers the emerging of resistance toward CPT59. In light of the aforementioned drawbacks and taking into account the high anticancer potential of CPT due to a TOP1-poison mode of action, scientific efforts were initiated focusing in the SAR (structureactivity relationship) optimization of the CPT structure in order to improve the pharmacokinetic profile and clinical efficacy of the natural parental compound. The main points to introduce modifications in the CPT scaffolds are A and B rings (Figure 9). The insertion of hydrophilic substituents in positions C9, C10 and C11 increases the water solubility of the drug, while B ring functionalization at C7 with lipophilic substituents enhances the biological activity and the lactone stability58. Some minor modifications in the E ring are well tolerated in order to stabilize the lactone without decreasing the biological activity (Figure 9), while modifications in C and D rings (including the carbonyl group of the pyridine ring) lead to the loss of the biological effect60. A-ring modifications The introduction of a N-alkyl chain at C9 results in the improvement of biological activity and water solubility. Following this strategy, the insertion of side alkyl chains with tertiary amines at C9 led to the development of drugs as topotecan (23, Figure 10), a clinically used TOP1 poison with enhanced hydrophilic properties as the tertiary amine is charged at physiological pH61. In the same way, belotecan (24, Figure 10) is another CPT derivative with a secondary amino group at C9 that increases even more the water solubility62. Similarly, the insertion of a nitro group in C9 gave place to the development of the water insoluble CPT derivative rubitecan (25, Figure 10), a strong antiproliferative TOP1 poison which was initially oriented to be orally administrated. The equilibrium between 9-nitrocamptothecin (inactive form) and its metabolite 9-aminocamptothecin (active and hydrosoluble form) was 59 Tesauro C, Morozzo della Rocca B, Ottaviani A, et al. Molecular mechanism of the camptothecin resistance of Glu710Gly topoisomerase IB mutant analyzed in vitro and in silico. Mol Cancer. 2013;12(1):100. doi:10.1186/1476-4598-12-100 60 Huang Q, Wang L, Lu W. Evolution in medicinal chemistry of E-ring-modified Camptothecin analogs as anticancer agents. Eur J Med Chem. 2013;63:746-757. doi:10.1016/j.ejmech.2013.01.058 61 Jaxel C, Kohn KW, Wani MC, Wall ME, Pommier Y. Structure-activity study of the actions of camptothecin derivatives on mammalian topoisomerase I: evidence for a specific receptor site and a relation to antitumor activity. Cancer Res. 1989;49(6):1465-1469 62 Kim JH, Lee SK, Lim JL, Shin HJ, Hong CI. Preformulation studies of a novel camptothecin anticancer agent, CKD-602: physicochemical characterization and hydrolytic equilibrium kinetics. Int J Pharm. 2002;239(1-2):207-211. doi:10.1016/s0378-5173(02)00099-6
25 predicted to be displaced towards the amino form, but clinical trials were finally interrupted due to a limited antitumor activity63. Figure 10. A-ring modifications in the CPT scaffold. 10-Hydroxycamptothecin (10-OH-CPT) is a natural alkaloid that also occurs naturally in Camptotheca acuminata. The presence of a hydroxyl group in C10 was demonstrated to improve the biological activity in vivo64. This hydroxyl group in position C10 has been maintained in some CPT semisynthetic analogues such as topotecan (23, Figure 10) and SN-38 (26, Figure 10), while 63 Clark JW. Rubitecan. Expert Opin Investig Drugs. 2006;15(1):71-79. doi:10.1517/13543784.15.1.71 64 Das B, Madhusudhan P, Reddy PV, Anitha Y. Natural camptothecins. Ind J Chem. 2001;40b:453-464
26 10-OH-CPT derivatives (27, Figure 6) were prepared by the transformation of the tertiary amine of topotecan hydrochloride into alkylthiomethyl functionalities in the presence of thiols65. Derivatization of the 10-OH substituent has led to the preparation of prodrugs (compounds 28, Figure 10) that preserve the alcohol group. In this regard, irinotecan (28a) is a broadly studied and clinically used drug formed by a dipiperidino moiety linked through an ester bond to the C10 position of 7-ethyl-10-hydroxycamptothecin, which is hydrolyzed in vivo to obtain the parent drug SN-38 (4, Figure 10) after intravenous administration66. More recently, a 10-OHCPT prodrug (F-10, 28b, Figure 6) protected with a piperidin-1-yl moiety reported promising antiproliferative effect and TOP1 inhibition in vitro, as well as an improved antitumor effect in a xenograft model comparing to the reference SN-3867. Another remarkable example is the compound 28c, a prodrug of 10-OH-CPT which was found to be 80 times more soluble than the parental drug, even though it was significantly less cytotoxic than the unprotected compound in vitro68. Inspired by the strategy of protecting 10-OH in CPT derivatives, some groups have focused in the preparation of CPT derivatives combining subsitutions in C9 and C10 (compounds 29, Figure 10). In this context, 1,3-oxazine-fused camptothecins (29a) were found to present improved in vitro cytotoxicities compared to the references CPT and topotecan69, while 9,10-[1,3]- dioxocamptothecin 29b showed similar biological behaviour with an enhanced pharmacokinetic profile70. Regarding hexacyclic analogues of CPT, the insertion of halogenated substituents and an extra alicyclic ring to the AB quinoline ring system led to the development of exatecan (30, 65 Tan H, Wang G, Li J, et al. Synthesis of novel 10-hydroxycamptothecin derivatives utilizing topotecan hydrochloride as ortho-quinonemethide precursor. Bioorg Med Chem. 2015;23(1):118-125. doi:10.1016/j.bmc.2014.11.020 66 Bailly C. Irinotecan: 25 years of cancer treatment. Pharmacol Res. 2019;148:104398. doi:10.1016/j.phrs.2019.104398 67 Fan S, Cao YX, Li GY, et al. F10, a new camptothecin derivative, was identified as a new orallybioavailable, potent antitumor agent. Eur J Med Chem. 2020;202:112528. doi:10.1016/j.ejmech.2020.112528 68 Leu YL, Chen CS, Wu YJ, Chern JW. Benzyl ether-linked glucuronide derivative of 10hydroxycamptothecin designed for selective camptothecin-based anticancer therapy. J Med Chem. 2008;51(6):1740-1746. doi:10.1021/jm701151c 69 Wang S, Li Y, Liu Y, Lu A, You Q. Novel hexacyclic camptothecin derivatives. Part 1: synthesis and cytotoxicity of camptothecins with an A-ring fused 1,3-oxazine ring. Bioorg Med Chem Lett. 2008;18(14):4095-4097. doi:10.1016/j.bmcl.2008.05.103 70 Rodríguez-Berna G, Mangas-Sanjuán V, Gonzalez-Alvarez M, et al. A promising camptothecin derivative: Semisynthesis, antitumor activity and intestinal permeability. Eur J Med Chem. 2014;83:366-373. doi:10.1016/j.ejmech.2014.06.050
27 Figure 10)71, a highly water soluble CPT derivative found to be more active than CPT, topotecan and SN-38 in vitro and in vivo72. B-ring modifications The insertion of lipophilic side chains in C7 as alkyl groups has been demonstrated to enhance the biological activity of TOP1. Accordingly, longer and bulkier alkyl chains increases the lipid solubility of the molecule, leading to favourable lipophilic interactions with the TOP1-DNA cleavage complex, which correlates with a higher activity73. Silyl-substituted CPT analogues (31, Figure 11) were described as a novel class of TOP1 inhibitors74. Among them, the 7-silyl substituted derivatives cositecan (31a) and silatecan (31b) were reported as potent TOP1 poisons with improved pharmacokinetic profile. 71 Mitsui I, Kumazawa E, Hirota Y, Aonuma M, Sugimori M, Ohsuki S, Uoto K, Ejima A, Terasawa H, Sato K. A new water-soluble camptothecin derivative, DX-8951f, exhibits potent antitumor activity against human tumors in vitro and in vivo. Jpn J Cancer Res. 1995;86:776-782 72 a) Kumazawa E, Tohgo A. Antitumour activity of DX-8951f: a new camptothecin derivative. Expert Opin Investig Drugs. 1998;7(4):625-632. doi:10.1517/13543784.7.4.625. b) Li F, Jiang T, Li Q, Ling X. Camptothecin (CPT) and its derivatives are known to target topoisomerase I (Top1) as their mechanism of action: did we miss something in CPT analogue molecular targets for treating human disease such as cancer?. Am J Cancer Res. 2017;7(12):2350-2394 73 Liang X, Wu Q, Luan S, et al. A comprehensive review of topoisomerase inhibitors as anticancer agents in the past decade. Eur J Med Chem. 2019;171:129-168. doi:10.1016/j.ejmech.2019.03.034 74 Josien H, Bom D, Curran DP, Zheng Y, Chou T. 7-silylcamptothecins (silatecans): A new family of camptothecin antitumor agents. Bioorg Med Chem Lett. 1997;7(24):3189-3194. doi: 10.1016/S0960894X(97)10181-0
28 Figure 11. B-ring and E-ring modifications in the CPT scaffold. In like manner, the functionalization with O-substituted oxime substituents at C7 (32, Figure 11) led to the development of the lipophilic derivative gimatecan (32a), an O-tert-butyl oxime substituted analogue that reported an increased biological activity on human tumor xenograft model in vivo75. Nevertheless, not only lipophilic replacements resulted in successful modifications, but also namitecan (32b), an O-(2-aminoethyl)-substituted oxime derivative, resulted in an enhanced pharmacokinetic profile with a maintained biological activity76. 75 DE Cesare M. High Efficacy of Intravenous Gimatecan on Human Tumor Xenografts. Anticancer Res. 2018;38(10):5783-5790. doi:10.21873/anticanres.12917 76 Beretta GL, Zuco V, De Cesare M, Perego P, Zaffaroni N. Namitecan: a hydrophilic camptothecin with a promising preclinical profile. Curr Med Chem. 2012;19(21):3488-3501. doi:10.2174/092986712801323252
29 E-ring modifications The most limiting drawback of CPTs is its poor chemical stability due to the opening of the - lactone ring. Hydrolysis of the lactone results in the opening of the six membered ring, generating a water-soluble carboxylate (Scheme 1)77. Hence, the displacement of the lactone (active form) towards the carboxylate (inactive form) hinders the plasma stability. Moreover, the inactive carboxylate form binds readily to human serum albumin, making it inaccessible for cellular uptake and decreasing even more the bioavailability of the drug78. Scmeme 1. Hydrolysis of the -lactone ring of CPT at physiological conditions. In this regard, the expansion of the lactone ring to a 7-membered system has led to the discovery of the more active family of homocamptothecins (hCPT). The insertion of a methylene group between the C20 and the carboxyl group increases the chemical stability by avoiding the conversion of the lactone into carboxylate79. The first hCTP selected for clinical studies was diflomotecan (33, Figure 11). Oral diflomotecan showed a favourable pharmacokinetic profile and a maintained biological activity, even though the urinary excretion was very low. This drug candidate exposed a high bioavailability but considerably variability between the patients80. The lactone function in the S conformation was believed to be crucial for the TOP1 inhibitory activity. Surprisingly, the reduction of the E ring size has been explored81, which led to a series 77 Fassberg J, Stella VJ. A kinetic and mechanistic study of the hydrolysis of camptothecin and some analogues. J Pharm Sci. 1992;81(7):676-684. doi:10.1002/jps.2600810718 78 Burke TG, Mi Z. Preferential binding of the carboxylate form of camptothecin by human serum albumin. Anal Biochem. 1993;212(1):285-287. doi:10.1006/abio.1993.1325 79 a) Lavergne O, Demarquay D, Bailly C, et al. Topoisomerase I-mediated antiproliferative activity of enantiomerically pure fluorinated homocamptothecins. J Med Chem. 2000;43(11):2285-2289. doi:10.1021/jm000129j. b) Tangirala RS, Antony S, Agama K, et al. Synthesis and biological assays of E-ring analogs of camptothecin and homocamptothecin. Bioorg Med Chem. 2006;14(18):6202-6212. doi:10.1016/j.bmc.2006.05.073 80 Gelderblom H, Salazar R, Verweij J, et al. Phase I pharmacological and bioavailability study of oral diflomotecan (BN80915), a novel E-ring-modified camptothecin analogue in adults with solid tumors. Clin Cancer Res. 2003;9(11):4101-4107 81 a) Hautefaye P, Cimetière B, Pierré A, et al. Synthesis and pharmacological evaluation of novel nonlactone analogues of camptothecin. Bioorg Med Chem Lett. 2003;13(16):2731-2735. doi:10.1016/s0960894x(03)00534-1. b) Li M, Tang W, Zeng F, Lou L, You T. Semi-synthesis and biological activity of gamma-
30 of biologically active CPT derivatives with a 5-membered ketone ring. Among this family of - lactones, compound 34 (Figure 11) presented a strong in vitro TOP1 activity, comparable to topotecan and SN-38. In order to avoid the transformation of the lactone into the inactive carboxylic acid, several other strategies have been further developed focusing on the protection of the hydroxyl group present in the C20 of the CPT structure. Such is the case of XMT-1001 (35a, Figure 11), a CPT prodrug functionalized with a PHF polyacetal polymer (poly-1-hydroxymethylethylene hydroxymethylformal), was developed via esterification of the hydroxyl group of the lactone82. XMT-1001 showed a wider therapeutic window and an improved drug exposure than CPT in human tumor xenograft models. Likewise, -amino acid ester prodrugs of CPT (35b, Figure 11) was succesfully explored obtaining a predictable and suitable hydrolysis of the ester bond and the consequent release of CPT in physiological conditions, which resulted to be pH dependant and proportional to the R side chain length.83. Furthermore, CPT prodrugs with voluminous substituents linked to the CPT scaffold in C20 by carbamate functionalities (compounds 36, Figure 11) were investigated. Accordingly, a family of pegylated sulfonilamidines84 and a second set of sulfonilamidines functionalized with phenyl substituents85 were found to present more potent in vitro antiproliferative effect than the reference drugs CPT and topotecan. 1.3.2.2. Non-CPT derivatives Aside from CPT derivatives, there are other relevant families of synthetic compounds described as TOP1 inhibitors, which in some cases have been developed starting from natural drugs obtaining selective, potent and chemically stable synthetic derivatives. In the present section, lactones analogs of camptothecin. Bioorg Med Chem Lett. 2008;18(24):6441-6443. doi:10.1016/j.bmcl.2008.10.074 82 Yurkovetskiy AV, Fram RJ. XMT-1001, a novel polymeric camptothecin pro-drug in clinical development for patients with advanced cancer. Adv Drug Deliv Rev. 2009;61(13):1193-1202. doi:10.1016/j.addr.2009.01.007 83 Deshmukh M, Chao P, Kutscher HL, Gao D, Sinko PJ. A series of alpha-amino acid ester prodrugs of camptothecin: in vitro hydrolysis and A549 human lung carcinoma cell cytotoxicity. J Med Chem. 2010;53(3):1038-1047. doi:10.1021/jm901029n 84 Song ZL, Chen HL, Wang YH, et al. Design and synthesis of novel PEG-conjugated 20(S)-camptothecin sulfonylamidine derivatives with potent in vitro antitumor activity via Cu-catalyzed three-component reaction. Bioorg Med Chem Lett. 2015;25(13):2690-2693. doi:10.1016/j.bmcl.2015.04.060 85 Song ZL, Wang MJ, Li L, et al. Design, synthesis, cytotoxic activity and molecular docking studies of new 20(S)-sulfonylamidine camptothecin derivatives. Eur J Med Chem. 2016;115:109-120. doi:10.1016/j.ejmech.2016.02.070
31 the most representative families of semisynthetic/synthetic TOP1 inhibitors will be slightly exposed, attending to a classification based on the central core of the chemical structure. Indenoisoquinolines Pommier, Cushman and collaborators developed indeno[1,2-c]isoquinoline derivatives as strong TOP1 inhibitors86. These indenoisoquinolines are probably the most remarkable examples of non-CPT like TOP1 poisons, which retain better the biological response toward CPT- (and CPT derivatives-) resistant mutant forms of TOP187. Among this family of indenoisoquinolines, the experimental drugs indotecan (LMP400), indimitecan (LMP776) and LMP744 (Figure 12) headed to phase I and II clinical trials for the treatment of solid tumors as they are chemically more stable, stabilize TOP1CCs more persistently and present an enlarged plasma-life than CPT and CPT derivatives86. Figure 12. Indenoisoquinoline scaffold containing TOP1 inhibitors. Aromathecins In like manner, Pommier and coworkers developed the so-called aromathecins (Figure 13), a set of stable molecules that were outlined as formal composites of CPT and indenoisoquinolines88. These compounds possess a remarkable inhibition of TOP1 via stabilizing TOP1CCs and a related anticancer potential. The structure of aromathecins comprises a benzo[6,7]indolizine framework fused to a quinolinone motif, where substitutions in position 14 are well tolerated 86 Cinelli MA, Reddy PV, Lv PC, et al. Identification, synthesis, and biological evaluation of metabolites of the experimental cancer treatment drugs indotecan (LMP400) and indimitecan (LMP776) and investigation of isomerically hydroxylated indenoisoquinoline analogues as topoisomerase I poisons. J Med Chem. 2012;55(24):10844-10862. doi:10.1021/jm300519w 87 Antony S, Jayaraman M, Laco G, et al. Differential induction of topoisomerase I-DNA cleavage complexes by the indenoisoquinoline MJ-III-65 (NSC 706744) and camptothecin: base sequence analysis and activity against camptothecin-resistant topoisomerases I. Cancer Res. 2003;63(21):7428-7435. 88 Cinelli MA, Morrell AE, Dexheimer TS, et al. The structure-activity relationships of A-ring-substituted aromathecin topoisomerase I inhibitors strongly support a camptothecin-like binding mode. Bioorg Med Chem. 2010;18(15):5535-5552. doi:10.1016/j.bmc.2010.06.040
32 and allow the insertion of hydrophilic substituents to enhance the water solubility with a maintained or improved biological activity89. Figure 13. General structure of aromathecins, a family of TOP1 inhibitors. Benzophenanthridines We previously presented nitidine as a natural quaternary-ammonium alkaloid with several toxicities that limit clinical studies (in section 3.1, vide supra). In order to overcome these chemical drawbacks, La Voie et al. successfully developed neutral benzo[i]phenanthridine derivatives that inhibit only TOP1 or both enzymes TOP1 and TOP2. In this regard, further investigations proved that 2,3-methylenedioxy and 8,9-dimethoxy substitution patterns (1, Figure 14) result crucial for dual TOP1/TOP2 inhibition, while 2,3-dimethoxyand 8,9methylenedioxysubstituted benzo[i]phenanthridine derivative 2is a selective TOP1 inibitor90. Figure 14. Benzophenanthridine scaffold containing TOP1 inhibitors. Naphthyridines SAR studies for the optimization of the N-heterocyclic core of the previous mentioned family of dibenzo[i]phenantridines led to La Voie´s group to develop a set of fused dibenzonaphthyridines as TOP1 poisons. Among these, the dibenzo[c,h][1,6]naphthyridine analog Genz-644282 (37, 89 Cinelli MA, Morrell A, Dexheimer TS, Scher ES, Pommier Y, Cushman M. Design, synthesis, and biological evaluation of 14-substituted aromathecins as topoisomerase I inhibitors. J Med Chem. 2008;51(15):46094619. doi:10.1021/jm800259e 90 Makhey D, Li D, Zhao B, et al. Substituted benzo[i]phenanthridines as mammalian topoisomerasetargeting agents. Bioorg Med Chem. 2003;11(8):1809-1820. doi:10.1016/s0968-0896(03)00053-1
33 Figure 15) resulted a promising drug candidate which arrived to clinical studies91. In regard to the dibenzonaphthyridine core, Cushman and collaborators successfully explored dibenzo[c,h][1,6]naphthyridinones (38, Figure 15) as anticancer agents and TOP1 inhibitors that act by trapping TOP1CCs92. Figure 15. 1,6-Naphthyridine scaffold containing TOP1 inhibitors. Besides the dibenzonaphthyridine family, naphthyridine-based scaffolds have been broadly studied as topoisomerase I inhibitors. For instance 2,4-disubstituted 1,5-naphthyridines93 (39, Figure 16) and fused 7H-indeno[2,1-c][1,5]naphthyridines94 (40) were reported as TOP1 catalytic inhibitors with in vitro antiproliferative effect toward human cancer cell lines. During the development of a nanosensor for measuring TOP1 activity in a novel drug-screening system, these fused indenonaphthyridines were found to interfere in the TOP1 activity by blocking the TOP1 enzyme DNA complex dissociation, inhibiting the post-ligation step of catalysis95. In an attempt to expand on the previous work, the preparation of a new generation of novel fused naphthyridine derivatives was investigated, broadening the size of the polyheterocyclic central 91 Ruchelman AL, Houghton PJ, Zhou N, Liu A, Liu LF, LaVoie EJ. 5-(2aminoethyl)dibenzo[c,h][1,6]naphthyridin-6-ones: variation of n-alkyl substituents modulates sensitivity to efflux transporters associated with multidrug resistance. J Med Chem. 2005;48(3):792-804. doi:10.1021/jm049447z 92 Kiselev E, Dexheimer TS, Pommier Y, Cushman M. Design, synthesis, and evaluation of dibenzo[c,h][1,6]naphthyridines as topoisomerase I inhibitors and potential anticancer agents. J Med Chem. 2010;53(24):8716-8726. doi:10.1021/jm101048k 93 Alonso C, Fuertes M, González M, Rodríguez-Gascón A, Rubiales G, Palacios F. Synthesis and biological evaluation of 1,5-naphthyridines as topoisomerase I inhibitors. A new family of antiproliferative agents. Curr Top Med Chem. 2014;14(23):2722-2728. doi:10.2174/1568026614666141215152441 94 Alonso C, Fuertes M, González M, et al. Synthesis and biological evaluation of indeno[1,5]naphthyridines as topoisomerase I (TopI) inhibitors with antiproliferative activity. Eur J Med Chem. 2016;115:179-190. doi:10.1016/j.ejmech.2016.03.031 95 Andersen MB, Tesauro C, Gonzalez M, et al. Advantages of an optical nanosensor system for the mechanistic analysis of a novel topoisomerase I targeting drug: a case study. Nanoscale. 2017;9(5):18861895. doi:10.1039/c6nr06848k
40 Figure 21. Frameworks of quinoline (1) and oxidized (2) or reduced forms (3,4,5) thereof. Along with the fully aromatic and neutral quinoline structure 49, the frameworks corresponding to oxidized (50) or reduced forms (51, 52, 53) are collected in the Figure 21. These alternative reduced hydroquinolines are common motifs present in many bioactive compounds114, while quinoline N-oxides are revealed as useful precursors for synthetic modifications of quinolines115. Furthermore, the closely related quinolones (quinolinones, i.e. derivatives with a carbonyl group in the quinoline scaffold) also occur in natural products and result essential for the biological activity of numerous compounds116 (Figure 22, see the quinolinones 54, 55, 56 and 57). The main quinolones are the 2-quinolone 54 (Figure 22) and 4-quinolone 55, and both maintain a ketoenol tautomery with the corresponding hydroxiquinoline, being the quinolone form the major tautomer. 114 Muthukrishnan I, Sridharan V, Menéndez JC. Progress in the chemistry of tetrahydroquinolines. Chem Rev. 2019;119(8):5057-5191. doi: 10.1021/acs.chemrev.8b00567 115 Gribble GW, Kishbaugh TLS. Chapter 6.1 - six-membered ring systems: Pyridine and benzo derivatives. Adv Heterocycl Chem. 2016;28:391-437. doi: https://doi.org/10.1016/B978-0-08-100755-6.00012-0 116 a) Winter RW, Kelly JX, Smilkstein MJ, Dodean R, Hinrichs D, Riscoe MK. Antimalarial quinolones: synthesis, potency, and mechanistic studies. Exp Parasitol. 2008;118(4):487-497. doi:10.1016/j.exppara.2007.10.016. b) Pham TDM, Ziora ZM, Blaskovich MAT. Quinolone antibiotics. Med Chem Commun. 2019;10(10):1719-1739. http://dx.doi.org/10.1039/C9MD00120D. doi: 10.1039/C9MD00120D. c) Aly AA, El-Sheref EM, Mourad AE, Bakheet MEM, Bräse S. 4-Hydroxy-2quinolones: syntheses, reactions and fused heterocycles. Mol Divers. 2020;24(2):477-524. doi:10.1007/s11030-019-09952-5
41 Figure 22. Framework of quinolones and tautomeric equilibrium with hydroxyquinolines. Quinoline: natural sources, chemical applications and bioactive compounds Quinoline is considered a privileged scaffold due to its natural abundance, biological significance and wide range of applications. Thus, the quinoline core is present in many different natural sources, such as the antimalarial quinine alkaloids (58, Figure 23) obtained from Cinchona spp.117 Remarkably, Cinchona alkaloids quinine and quinidine are also reported as the first organocatalysts used in asymmetric organic synthesis in 1912118. In like manner, the indoloquinoline alkaloid cryptolepine (60), obtained from the African plant Cryptolepis sanguinolenta, has shown antimalarial and antiproliferative activity in vitro. The neurotoxin gephirotoxin (61) is a decahydroquinoline alkaloid isolated from the skin of Dendrobates histrionicus frogs (native from Colombia)119. Veranamine (62), a -carboline alkaloid isolated from the marine sponge Verongula rigida (Florida, USA), showed both in vivo and in vitro antidepressant activity via inhibition of serotonin receptor 2B (5-HT2B) and sigma-1 receptor 1R )120. Likewise, the previously mentioned camptothecin (1), a pentacyclic alkaloid isolated 117 Shang XF, Morris-Natschke SL, Liu YQ, et al. Biologically active quinoline and quinazoline alkaloids part I. Med Res Rev. 2018;38(3):775-828. doi:10.1002/med.21466 118 Bredig G, Fiske WS. Beiträge zur chemischen Physiologie und Pathologie. Biochem Z. 1912;46:7 119 Wijnsma R, Verpoorte R. CHAPTER 19 - Quinoline alkaloids of cinchona. In: CONSTABEL F, VASIL IK, eds. Phytochemicals in plant cell cultures. Academic Press; 1988:335-355. https://doi.org/10.1016/B978-0-12715005-5.50026-1 120 Kochanowska-Karamyan A, Araujo HC, Zhang X, et al. Isolation and synthesis of veranamine, an antidepressant lead from the marine sponge verongula rigida. J Nat Prod. 2020;83(4):1092-1098. doi: 10.1021/acs.jnatprod.9b01107
42 from Camptotheca acuminata, is a broadly studied anticancer agent via interfacial inhibition of TOP14. Figure 23. Natural bioactive compounds containing a quinoline-based central core. Besides natural occurring quinolines, they can be found in many synthetic compounds with various chemical and industrial applications, as shown in the Figure 24. Quinoline scaffolds are commonly used as ligands121 for metallic catalysts in cross-coupling reactions and asymmetric synthesis, such is the case for the so-called APAC ligand (63, Figure 24). Moreover, quinolinecontaining dyes have been oriented to various applications. The water-soluble colorant 64 (E104 in Europe, D&C yellow no. 10 in USA) is mainly applied as a colorant in food industry122, whereas the water insoluble dye 65 (D&C yellow no. 11 in USA) is used as colouring agent in cosmetics123. Likewise, photovoltaic dyes (such as the compound 66) with quinoline skeletons represent a significant class of chemical materials to produce photovoltaic cells124. Furthermore, 121 Romero EA, Chen G, Gembicky M, Jazzar R, Yu J, Bertrand G. Understanding the activity and enantioselectivity of acetyl-protected aminoethyl quinoline ligands in palladium- -C(sp3) H bond arylation reactions. J Am Chem Soc. 2019;141(42):16726-16733. https://doi.org/10.1021/jacs.9b06746. doi: 10.1021/jacs.9b06746 122 Weisz A, James IC, Mazzola EP, Ridge CD, Ijames CF, Markey SP. Identification of 1',5'- naphthyridinophthalone and its quantification in the color additive D&C Yellow No. 10 (Quinoline Yellow) using high-performance liquid chromatography. Food Addit Contam Part A Chem Anal Control Expo Risk Assess. 2018;35(3):439-447. doi:10.1080/19440049.2017.1416183 123 Chequer FM, Venâncio Vde P, de Souza Prado MR, et al. The cosmetic dye quinoline yellow causes DNA damage in vitro. Mutat Res Genet Toxicol Environ Mutagen. 2015;777:54-61. doi:10.1016/j.mrgentox.2014.11.003 124 Lewinska G, Sanetra J, Marszalek KW. Application of quinoline derivatives in third-generation photovoltaics. J Mater Sci : Mater Electron. 2021;32(14):18451-18465. https://doi.org/10.1007/s10854021-06225-6. doi: 10.1007/s10854-021-06225-6
43 a red fluorescent biosensor based on a BODIPY (4,4-difluoro-4-bora-3a,4a-diaza-s-indacene) skeleton 67125 has been developed for the detection of iridium(III) in biological systems, as a sensitive bioimaging tool with medical applications. Figure 24.Representative examples of quinoline-containing compounds with chemical and industrial significance. The quinoline scaffold in medicinal chemistry and pharmacology Quinolines are structures of particular significance in the area of medicinal chemistry. In this sense, quinine (58, Figure 25) is the oldest known drug based on a quinoline scaffold and from the XVII century, when in 1630 Spanish Jesuit missionaries established in South America reported the use of powdered cinchona bark to treat paludal fever. Historically, the native Indian population had used infusions of cinchona bark powder as an antimalarial medicine and they transferred this knowledge to the Spaniards to the extent that the Countess of Chinchón (Francisca Enríquez de Rivera), the wife of the Viceroy of Peru, was cured with cinchona. Later in 1640, she introduced the cinchone bark in Europe and in 1742, Linnaeus named the tree Cinchona officinalis Cinchona misspelling by Linnaeus)126. Quinine alkaloid was firstly isolated in 1820 by J. Pelletier and J.B. 125 Qu X, Bian Y, Li J, Pan Y, Bai Y. A red fluorescent BODIPY probe for iridium (III) ion and its application in living cells. R Soc Open Sci. 2019;6(1):181090. doi:10.1098/rsos.181090 126 Bruce-Chwatt LJ. Three hundred and fifty years of the Peruvian fever bark. Br Med J (Clin Res Ed). 1988;296(6635):1486-1487. doi:10.1136/bmj.296.6635.1486
44 Caventou from Cinchona spp. trees and aforementioned purified quinine replaced the classic bark powder. Quinine has been the only effective antimalarial agent until the 1920´s, when a new generation of synthetic quinine derivatives were developed, highlighting the launch of chloroquine 68 e.g. hydroxychloroquine 69, piperaquine 70, mefloquine 71, and primaquine 72). Figure 25. Quinoline core-based antimalarial agents. It is noteworthy to mention that the pharmacological use of quinine remains nowadays, almost 400 years after the first proved historical evidence. At present, the main first line drugs for the treatment of malaria are chloroquine and artemisin derivatives, but quinine and chloroquine are indicated in some clinical situations such as drug resistance scenarios or pregnancy127. The mechanism of action of quinoline-based antimalarial drugs (quinine and synthetic derivatives) remains unclear, but is accepted that they accumulate into the food vacuoles and act by inhibiting the digestion of haemoglobin during the blood stages of malaria parasites, leading to parasite death128. Furthermore, chloroquine was revealed as an anti-inflammatory agent and is currently used in inflammatory rheumatic diseases such as rheumatoid arthritis or lupus erythematosus129, and more recently has been tried as an antiviral agent to treat acute infections with SARS-CoV-2130. 127 WHO Guidelines for malaria. https://www.who.int/publications/i/item/guidelines-for-malaria. Accessed December 28, 2021 128 Tse EG, Korsik M, Todd MH. The past, present and future of anti-malarial medicines. Malar J. 2019;18(1):93. doi:10.1186/s12936-019-2724-z 129 Schrezenmeier E, Dörner T. Mechanisms of action of hydroxychloroquine and chloroquine: implications for rheumatology. Nat Rev Rheumatol. 2020;16(3):155-166. doi:10.1038/s41584-020-0372-x 130 Touret F, de Lamballerie X. Of chloroquine and COVID-19. Antiviral Res. 2020;177:104762. doi:10.1016/j.antiviral.2020.104762
45 Besides antimalarial agents, the quinoline ring system is present in several other clinically approved drugs and the most representative examples are described herein (the chemical structures are collected in the Figure 26): Pitavastatin (73, Figure 26) belongs to the drug class called statins, which act decreasing lowdensity lipoprotein cholesterol (LDL-C) levels via competitive inhibition of 3-hydroxy-3methylglutaryl coenzyme A (HMG-Co-A)131. Pitavastatin was the latest statin launched to the market. Figure 26. Clinically approved drugs based on a quinoline scaffold. 131 Chan P, Shao L, Tomlinson B, Zhang Y, Liu ZM. An evaluation of pitavastatin for the treatment of hypercholesterolemia. Expert Opin Pharmacother. 2019;20(1):103-113. doi:10.1080/14656566.2018.1544243
46 Saquinavir (74) has been the first protease inhibitor approved for the treatment of HIV infection in 1995, acting as an inhibitor of HIV protease. Saquinavir showed a high affinity towards the HIV virus protease, with limited effect on human structurally related proteases132. Montelukast (75) is a cysteinyl leukotriene receptor 1 (CysLT1R) reversible antagonist133, which has been widely used in asthma as a complementary drug in therapies involving inhalated corticosteroids or -2 adrenergic agonists. Cabozanitib (76) is a multikinase inhibitor used in metastatic renal cell carcinoma and medullary thyroid cancer134. More recently, it has been approved as a second line treatment for hepatocellular carcinoma by European Medicines Agency (EMA) and FDA in 2018 and 2019 respectively135. Irinotecan (28a) and topotecan (23) are TOP1 inhibitors currently used as a second-line chemotherapeutic agents in advanced cancers4 (previously shown in section 1.3.2.1. of the introduction, Figure 10). Besides clinically approved drugs including fully aromatic quinoline cores in their pharmacophore, there are some other therapeutic agents containing closely related quinoline derivative-scaffolds, mainly quinolones or hydrogenated forms of quinoline (Figure 27). This is the case of fluoroquinolones, a class of broad-spectrum bactericidal antibiotics currently used in respiratory, ocular and urinary tract infections (ciprofloxacin, levofloxacin and moxifloxacin, structures 77, 78 and 79 in the Figure 27). Fluoroquinolones are selective inhibitors of the bacterial type II topoisomerases TopIV and DNA gyrase, causing the interruption of the DNA synthesis136. 132 la Porte CJ. Saquinavir, the pioneer antiretroviral protease inhibitor. Expert Opin Drug Metab Toxicol. 2009;5(10):1313-1322. doi:10.1517/17425250903273160 133 Diamant Z, Mantzouranis E, Bjermer L. Montelukast in the treatment of asthma and beyond. Expert Rev Clin Immunol. 2009;5(6):639-658. doi:10.1586/eci.09.62 134 Martínez Chanzá N, Xie W, Asim Bilen M, et al. Cabozantinib in advanced non-clear-cell renal cell carcinoma: a multicentre, retrospective, cohort study. Lancet Oncol. 2019;20(4):581-590. doi:10.1016/S1470-2045(18)30907-0 135 Personeni N, Rimassa L, Pressiani T, Smiroldo V, Santoro A. Cabozantinib for the treatment of hepatocellular carcinoma. Expert Rev Anticancer Ther. 2019;19(10):847-855. doi:10.1080/14737140.2019.1674141 136 Luan G, Drlica K. Fluoroquinolone-gyrase-DNA cleaved complexes. In: Drolet M, ed. DNA topoisomerases: Methods and protocols. New York, NY: Springer New York; 2018:269-281. https://doi.org/10.1007/978-1-4939-7459-7_19
47 Figure 27. Other quinoline-derived scaffolds in clinically approved drugs. Accordingly, indacaterol (80) is a 2-quinolone containing bronchodilator used for the treatment of COPD (Chronic Obstrucive Pulmonary Disease). Indacaterol acts as a ultralong-acting agonist of -2 adrenergic receptors in the smooth muscle, allowing a daily administration regime137. Aripiprazole (81) is an atypical antipsychotic used in the treatment of schizophrenia, bipolar disorder, Tourette´s disorder, bipolar mania and depression. The antipsychotic effect of aripiprazole is due to the agonism of dopamine receptor D2 and serotonin type 1 receptor 5HT1138. Quinagolide (82) is a non-ergot (non ergoline derivative) used in hyperprolactinemia therapy, acting as a selective agonist of dopamine D2 receptors at pharmaceutical concentrations139. 137 Rossi A, Polese G. Indacaterol: a comprehensive review. Int J Chron Obstruct Pulmon Dis. 2013;8:353363. doi:10.2147/COPD.S21625 138 Kinghorn WA, McEvoy JP. Aripiprazole: pharmacology, efficacy, safety and tolerability. Expert Rev Neurother. 2005;5(3):297-307. doi:10.1586/14737175.5.3.297 139 Barlier A, Jaquet P. Quinagolide--a valuable treatment option for hyperprolactinaemia. Eur J Endocrinol. 2006;154(2):187-195. doi:10.1530/eje.1.02075
48 2.1. Major methods for the synthesis of quinolines 2.1.1. Metal-free synthesis of quinolines 2.1.1.1. Aniline-based conventional syntheses of quinolines Conventional syntheses include the oldest and well established methods for the preparation of quinolines, from Skraup (1880) to Povarov (1963). These synthetic strategies revolve around nucleophile additions of primary (and in some cases secondary) amines to diverse electrophilic species (carbonyls, electron deficient alkenes such as -carbon of , -unsaturated carbonyls etc.). In most of the conventional methods the synthesis is conducted by an aniline and an annulation partner which acts as electrophilic target (Scheme 2). The reaction undergoes a cyclization to yield the quinoline, but in some cases the annulation product is the non-aromatic dihydro/tetrahydroquinoline. These semi-hydrogenated derivatives can be further subjected to oxidation, which allows the formation of the corresponding aromatic quinoline. Scheme 2. Aniline-based conventional syntheses of quinolines.
49 Skraup (1) -1880In the Skraup synthesis of quinolines (route 1, Scheme 2), primary anilines are heated with glycerol (even substituted glycerols) and a strong acid in the presence of an oxidant140. Acidcatalyzed dehydration of glycerol produces acroleine in situ, which receives a nucleophilic 1,4 addition of the aniline and cyclizates to form a hydroquinoline. In the last step, the hydroquinoline is converted to the quinoline by oxidation. Skraup´s route requires the use of a strong acid that may difficult the isolation of the final products from the crude and have to deal with low yields141. Combes (2) -1888Combes reported the synthesis of quinolines involving the acid-catalyzed condensation of - diketones and aniline to form an enamine intermediate followed by a cyclization142 (2, Scheme 2). The use of unsymetric -diketones gives a mixture of regioisomers and it may complicate the separation process of the reaction products. Conrad-Limpach (3) -1887Conrad and Limpach disclosed a straightforward route to afford quinolines substituted with a hydroxyl group in C4, via acid- -ketoesters followed by ring closure of the enamine intermediate143 (3, Scheme 2). When the reaction is performed at high temperatures, it may derive to the Conrad-Limpach-Knorr quinolone synthesis obtaining the consequent quinol-4-one144. Doebner-Von Miller (4) -1881In 1881 Doebner and Von Miller disclosed an alternative method for the Skraup´s synthesis. In this procedure, anilines undergo annulation with , -unsaturated ketones or aldehydes in the 140 1. Manske RHF, Kulka M. The skraup synthesis of quinolines. Org React. 2011:59-98. https://doi.org/10.1002/0471264180.or007.02 141 AlMarzouq DS, Elnagdi NMH. Glycerol and Q-Tubes: Green Catalyst and Technique for Synthesis of Polyfunctionally Substituted Heteroaromatics and Anilines. Molecules. 2019; 24(9):1806. https://doi.org/10.3390/molecules24091806 142 Bergstrom FW. Heterocyclic nitrogen compounds. part IIA. hexacyclic compounds: Pyridine, quinoline, and isoquinoline. Chem Rev. 1944;35(2):77-277. https://doi.org/10.1021/cr60111a001 143 Conrad M, Limpach L. Synthesen von chinolinderivaten mittelst acetessigester. Chem Ber. 1891; 24:2990. https://doi.org/10.1002/cber.188702001215 144 Heindel ND, Bechara IS, Lemke TF, Fish VB. Cyclization of aniline-acetylenedicarboxylate adducts. improved synthesis of 8-nitro-2-carbomethoxy-4(1H)-quinolones. J Org Chem. 1967;32(12):4155-4157. https://doi.org/10.1021/jo01287a127
56 Scheme 9. Triphenylphosphine catalyzed heteroannulation between N-tosylated 2-aminobenzaldehydes and acetylenes outlined by Kwon et al. In 2017, an alternative method for the Pfitzinger reaction organocatalyzed by CTAOH (cetyltrimethyl-ammonium hydroxide) was developed by Shankarling et al., involving the heteroannulation of isatins and ketones under mild basic and ultrasonic conditions161 (Scheme 10). The combination of CTAOH and ultrasonic irradiation led to the formation of 2-substituted 4-carboxyl quinolines in high yields and fast reaction rates. Additionally, the surfactant character of CTAOH allows the use of water as the solvent as the reactants are solubilized in micelles. Scheme 10. CTAOH catalyzed Pfizinger reaction disclosed by Shankarling et al. Organocatalysts mediated synthesis of quinolines Besides catalysts based on their acidic/basic nature, there are some other strategies involving organocatalysis with natural occurring aminoacids as L-proline or organocatalyzed one-pot approaches of sequential/cascade reactions to afford the quinoline framework. In the present section, some representative examples will be exposed. The study of L-proline in organocatalysis is an active area of research, either playing the role of the catalyst per se or acting as a ligand of a transition-metal catalyst. Proline is an accessible aminoacid available in both enantiomeric forms (L or R) and consequently, it has been widely 161 More PA, Shankarling GS. Energy efficient Pfitzinger reaction: A novel strategy using a surfactant catalyst. New J Chem. 2017;41(21):12380-12383. http://dx.doi.org/10.1039/C7NJ01937H
57 used in asymmetric synthesis. Moreover, it is also considered a bifunctional organocatalyst as is composed of both acidic (carboxylate) and basic (secondary amine) moieties162. In 2012, Panahi and coworkers presented a L-proline-catalyzed multicomponent method for the synthesis of 2amino-3-cyano-4-arylquinoline derivatives, involving a heteroannulation reaction between anilines, benzaldehydes and malononitrile (Scheme 11)163. Scheme 11. L-Proline catalyzed multicomponent reaction disclosed by Panahi et al. Likewise, one-pot cascade reactions stablish highly efficient straightforward synthetic methodologies. In this regard, Shi and collaborators presented a one-pot synthesis of 2and 3- (di)substituted quinolines through a sequential Michael/Staudinger/aza-Wittig reaction164 (Scheme 12). The process starts with a Michael addition of carbonyl derivatives to o-azido- - nitrostyrenes, which is followed by a Staudinger reaction with triphenylphosphine and a subsequent intramolecular aza-Wittig reaction to yield the corresponding quinolines, upon dehydrogenation by releasement of nitromethane. 162 Jarvo ER, Miller SJ. Amino acids and peptides as asymmetric organocatalysts. Tetrahedron. 2002;58(13):2481-2495. doi: https://doi.org/10.1016/S0040-4020(02)00122-9 163 Khalafi-Nezhad A, Sarikhani S, Shahidzadeh ES, Panahi F. L-proline-promoted three-component reaction of anilines, aldehydes and barbituric acids/malononitrile: Regioselective synthesis of 5arylpyrimido[4,5-b]quinoline-diones and 2-amino-4-arylquinoline-3-carbonitriles in water. Green Chem. 2012;14(10):2876-2884. doi: 10.1039/C2GC35765H 164 Yu Z, Zheng H, Yuan W, Tang Z, Zhang A, Shi D. An unexpected one-pot synthesis of multi-substituted quinolines via a cascade reaction of Michael/Staudinger/aza-Wittig/aromatization of ortho-azido- -nitrostyrenes with various carbonyl compounds. Tetrahedron Lett. 2013;69(38):8137-8141. doi: https://doi.org/10.1016/j.tet.2013.07.050
58 Scheme 12. L-Proline catalyzed Michael/Staudinger/aza-Wittig cascade reaction disclosed by Shi et al. In 2019, Cheng and collaborators disclosed a one-pot atroposelective Friedländer synthesis of quinolines by annulation of -aminoaryl ketones and -dicarbonyl derivatives catalyzed by CPA (Chiral Phosphoric Acid), as illustrated in the Scheme 13. Axially chiral 4-arylquinolines were obtained in high yields and enantioselectivities (more than 90% in both cases), representing a remarkable application for the development of novel asymmetric catalysts165. Scheme 13. CPA catalyzed one-pot atroposelective Friedländer reaction disclosed by Cheng et al. 165 Shao Y, Dong M, Wang Y, Cheng P, Wang T, Cheng D. Organocatalytic atroposelective Friedländer quinoline heteroannulation. Org Lett. 2019;21(12):4831-4836. https://doi.org/10.1021/acs.orglett.9b01731
59 2.1.2. Metal catalyzed synthesis of quinolines Transition-metal catalyzed coupling reactions provides rapid and robust tools to create or destroy single or multiple bonds in a unique synthetic operation. Accordingly, in the present section representative examples will be briefly exposed, involving transition metal salts or complexes to achieve highly functionalized quinolines by simple, quick and straightforward methodologies. Transition-metal catalyzed Friedländer reactions As shown in the previous section (2.2.1.), the development of modified Friedländer variations is thereby attracting increasing attention, and metal-catalyzed organic synthesis is not an exception. Two main strategies have been reported in the scientific literature: A) Conventional Friedländer heteroannulation of 2-aminophenyl carbonyls with activated carbonyl derivatives (aldehydes or ketones) catalyzed by metals. Hence, an yttrium(III) triflate catalyzed Friedländer reaction at room temperature was described by Gibbs and collaborators in 2005166 (Scheme 14, route A). B) Oxidative and/or reductive Fiedländer approaches of unreactive Friedländer precursors (e.g. nitro groups that need to be converted into amino moieties by hydrogen transfer or alcohols that are oxidized to carbonyls). The metal catalyst plays a dual role: acts as an oxidant/reductant to transform the precursor into the reactive substrate, and additionally catalyzes the Friedländer reaction. This represents an interesting strategy due to a higher chemical stability of the precursors, which may be directly converted into quinolines in one unique action. In this regard, Miller et al. described a reductive Friedländer reaction between 2-nitrobenzaldehydes and enolizable carbonyls catalyzed by tin(II) chloride and zinc(II) chloride (Scheme 14, route B), which involves the reduction of the nitro derivative followed by a condensation in a single operation167. In the same way, Vander Mierde and collaborators disclosed an oxidative Friedländer variant of 2-aminobenzyl alcohol (which requires to be oxidized to the corresponding aldehyde form) with activated ketones, catalyzed by a second generation Grubbs catalyst and KOtBu168 (Scheme 14, route C). Wu et al. presented an oxidative/reductive Friedländer synthesis catalyzed by 166 De SK, Gibbs RA. A mild and efficient one-step synthesis of quinolines. Tetrahedron Lett. 2005;46(10):1647-1649. doi: https://doi.org/10.1016/j.tetlet.2005.01.075 167 McNaughton BR, Miller BL. A mild and efficient one-step synthesis of quinolines. Org Lett. 2003;5(23):4257-4259. doi:10.1021/ol035333q 168 Vander Mierde H, Van Der Voort P, De Vos D, Verpoort F. A ruthenium-catalyzed approach to the Friedländer quinoline synthesis. Eur J Org Chem. 2008;2008(9):1625-1631. doi: https://doi.org/10.1002/ejoc.200701001
60 Ru(PPh3)3Cl2(Scheme 14, route D), in which the catalyst reduces the 2-nitrobenzaldehyde to 2aminobenzaldehyde and also oxidizes the 2-aminobenzyl alcohol to the carbonyl form. Finally, Friedländer annulation leads to the desired quinolines169. Scheme 14. Transition-metal catalyzed Fiedländer reactions. Palladium(II), iron(III), zinc(II) and CuBr-ZnI2 transition-metal catalyzed reactions In 2014, Orellana et al. described a one-pot protocol to afford a series of 2and 3-quinoline derivatives. Palladium catalyzed condensation between 2-bromoanilines and cyclopropanols and the subsequent oxidation of the cross-coupling products lead to the formation of the corresponding quinolines (Scheme 15, route A). Furthermore, 2-bromoaniline acts as the oxidant agent in the Pd catalyzed condensation-oxidation sequence and accordingly 2 equivalents thereof are required170. 169 Li H, Wang C, Zhu S, Dai C, Wu Y. Ruthenium(II)-catalyzed hydrogen transfer/annulation cascade processes between alcohols and 2-nitrobenzaldehydes. Adv Synth Catal. 2015;357(2-3):583-588. doi: https://doi.org/10.1002/adsc.201400898 170 Nikolaev A, Nithiy N, Orellana A. One-step synthesis of quinolines via palladium-catalyzed crosscoupling of cyclopropanols with unprotected ortho-bromoanilines. Synlett. 2014;25(16):2301-2305. doi: 10.1055/s-0034-1378613
61 In the same way, Sun and co-workers reported an efficient one-pot quinoline synthesis via Pd(OAc)2 catalyzed oxidative cyclization between anilines and aryl allyl alcohols171 (Scheme 15, route B). Scheme 15. Palladium(II) catalyzed synthesis of quinolines. Liu and co-workers developed an iron(III) catalyzed oxidative cross coupling reaction of N-alkyl anilines with styrenes/acetylenes in the presence of di-tert-butyl peroxide [(tBuO)2] to generate 2,4-disubstituted quinolines172 (Scheme 16). Scheme 16. Iron(III) catalyzed synthesis of quinolines disclosed by Liu et al. A simple, efficient and solvent-free zinc(II) triflate catalyzed MCR method was disclosed by Chandak et al. in 2016. Anilines, aldehydes and acetylenes underwent a tandem condensationcyclization reaction via Zn(OTf)2 induced C-H activation to afford 2,4-disubstituted quinolines 173, as shown in the Scheme 17. 171 Xu J, Sun J, Zhao J, Huang B, Li X, Sun Y. Palladium-catalyzed synthesis of quinolines from allyl alcohols and anilines. RSC Adv. 2017;7(58):36242-36245. doi: 10.1039/C7RA06425J 172 Liu P, Li Y, Wang H, Wang Z, Hu X. Synthesis of substituted quinolines by iron-catalyzed oxidative coupling reactions. Tetrahedron Lett. 2012;53(49):6654-6656. doi: https://doi.org10.1016/j.tetlet.2012.09.090 173 Sarode PB, Bahekar SP, Chandak HS. Zn(OTf)2-mediated CH activation: An expeditious and solvent-free synthesis of aryl/alkyl substituted quinolines. Tetrahedron Lett. 2016;57(51):5753-5756. doi: https://doi.org/10.1016/j.tetlet.2016.10.113
62 Scheme 17. Zinc(II) cayalyzed synthesis of quinoline presented by Chandak et al. In 2016, Maiti and co-workers presented a solvent-free MCR approach via Zn(II)-Cu(I) combocatalyzed oxidative cyclization of anilines, aldehydes and acetylenes to obtain 2,4-quinoline derivatives in moderate to high yields (61-82 %)174 (Scheme 18). Scheme 18. Zinc-copper catalyzed oxidative MCR reaction disclosed by Maiti et al. 174 Mondal RR, Khamarui S, Maiti DK. CuBr ZnI2 combo-catalysis for mild CuI CuIII switching and sp2 C H activated rapid cyclization to quinolines and their sugar-based chiral analogues: A UV Vis and XPS study. ACS Omega. 2016;1(2):251-263. doi: 10.1021/acsomega.6b00185
63 2.1.3. Miscellaneous methods for the synthesis of quinolines Besides the expounded methods for the preparation of quinolines, there are some approaches that were not classified into the aforementioned categorization (namely conventional methods, acid/base/aminoacid catalyzed approaches and metal-catalyzed reactions) and some of the most representative examples are going to be exposed. Halogen-catalyzed synthesis of quinolines A solvent-free and bromodimethylsulfonium bromide (BDMS) catalyzed Fiedländer synthesis was published by Vittal Rao and collaborators in 2012. Heteroannulation of 2-aminoaryl ketones with enolizable ketones in the presence of 10 mol% BDMS (as bromine source) led to the formation of 2-, 3and 4-substituted quinolines175 (Scheme 19). Scheme 19. Bromine catalyzed Fiedländer reaction disclosed by Vittal Rao et al. Accordingly, Cheon and collaborators developed an iodide (I2) catalyzed direct approach for the preparation of 2-quinoline derivatives176. Tetrabutylammonium iodide (TBAI) is used as source of I2 and plays the role of a nucleophilic catalyst. The reaction proceeds via nucleophilic iodination to the electrophilic -carbon of 2-aminostyryl ketones, leading to the formation of strans -iodoketones, which undergo conformational change and sequential condensationelimination of HI to yield the corresponding quinolines (Scheme 20). 175 Venkatesham R, Manjula A, Vittal Rao B. (Bromodimethyl)sulfonium bromide catalyzed solvent-free Friedlander synthesis of substituted quinolines. J Heteroc Chem. 2012;49(4):833-838. doi: https://doi.org/10.1002/jhet.873 176 Lee SY, Jeon J, Cheon C. Synthesis of 2-substituted quinolines from 2-aminostyryl ketones using iodide as a catalyst. J Org Chem. 2018;83(9):5177-5186. doi: 10.1021/acs.joc.8b00552
64 Scheme 20. Iodine catalyzed methodology presented by Cheon et al. Radical-mediated synthesis of quinolines Alternatively, radical-mediated heteroannulations suppose a straightforward approach to obtain quinolines with high atom (and step) economy. These transient and highly reactive radical intermediates are usually is situ generated by removing a hydrogen from the substrate with strong bases, peroxides or by switching the transition state of a metallic catalyst. In 1984, Tundo and collaborators disclosed a direct method for the preparation of 2,4disubstituted quinolines through a heteroannulation reaction between aryliminyl radicals and alkynes177. Aryliminium radicals were generated in situ from diaryl imines in the presence of DPDC (di-isopropyl peroxydicarbonate), which underwent a sequence of alkylation and cyclization to obtain the desired quinolines (Scheme 21). This represents a relatively ancient example that employs a highly explosive and hazardous peroxide (DPDC), but results illustrative of the radical-mediated approach. As time went on, safer methodologies with mild reaction conditions were disclosed and hence, some recent syntheses are going to be exposed. 177 Leardini R, Pedulli GF, Tundo A, Zanardi G. Aromatic annelation by reaction of arylimidoyl radicals with alkynes: A new synthesis of quinolines. J Chem Soc Chem Commun. 1984(20):1320-1321. doi: 10.1039/C39840001320
65 Scheme 21. Heteroannulation reaction between aryliminyl radicals and alkynes disclosed by Tundo et al. In 2016, Li and co-workers developed an intramolecular oxidative radical heteroannulation of ocyanoarylacrylamides and -keto acids, using silver(I) nitrate (Scheme 22, route A) or potassium persulfate (route B) as oxidant agent. The reaction proceeds via an addition/cyclization cascade to obtain 3-carboxyl-2,4-quinolines in moderate to high yields178. Likewise, in 2020 Mei, Zhu, Han and collaborators presented an oxidative radical reaction between o-cyanoarylacrylamide and aromatic thiols in the presence of DCP (dicumyl peroxide), to afford 3-thiomethylated 2,4-quinolones (Scheme 22, route C) 179. 178 Wang S, Fu H, Shen Y, Sun M, Li Y. Oxidative radical addition/cyclization cascade for the construction of carbonyl-containing quinoline-2,4(1H,3H)-diones. J Org Chem. 2016;81(7):2920-2929. doi: 10.1021/acs.joc.6b00210 179 Yin Z, Yu Y, Li C, Mei H, Zhu K, Han J. Sulfuration-triggered radical cyclization of o-cyanoarylacrylamides to 3-thiomethylated quinoline-2,4-dione. ChemistrySelect. 2020;5(46):14534-14537. https://doi.org/10.1002/slct.202003999
72 Table 2. Principal P(V)-based organophosphorus functionalities. Phosphorus containing isosteres may be used to replace a similar moiety of an active molecule and modify the biological activity. For instance, isosters of neurotransmitters -aminobutiric acid (GABA) and glutamic acid bearing phosphonic/phosphinic acid instead of carboxylic acid resulted in a substantial modification of pharmacodynamic properties: even the affinity was generally maintained, intrinsic activity and selectivity varied considerably. In this regard, the natural ligand GABA (83, Figure 30) is a well-known agonist for GABAA and GABAB receptors, but the replacement of the carboxylate by mono/di-alkylphosphine moieties 84 gave place to a potent and selective agonist effect towards GABAB metabotropic receptors185. Likewise, L-glutamic acid (85, Figure 30) is an endogenous agonist for both metabotropic (mGluR) and ionotropic (iGluR) receptors while the corresponding phosphonate isostere 86 selectively activates group III mGluRs186. 185 Froestl W, Mickel SJ, Hall RG, et al. Phosphinic acid analogues of GABA. 1. New potent and selective GABAB agonists. J Med Chem. 1995;38(17):3297-3312. doi:10.1021/jm00017a015 186 Watkins JC, Krogsgaard-Larsen P, Honoré T. Structure-activity relationships in the development of excitatory amino acid receptor agonists and competitive antagonists. Trends Pharmacol Sci. 1990;11(1):25-33. doi:10.1016/0165-6147(90)90038-a
73 Figure 30. Structures of the neurotransmitters GABA and glutamic acid, along with their corresponding phosphinic/phosphonic acid isosteres. I-1.1. Phosphorus-based transition state intermediate analogues From a biochemical perspective, enzymes are proteins that catalyze specific chemical reactions in living organisms by substantially accelerating the conversion of substrates (S) into products (P) without being themselves consumed or permanently altered. Catalysis mediated increment of the reaction rate arises from a decrease in the activation energy of the reaction, and this fact can be explained by the transition-state theory postulated by Pauling187. During the progress of a reaction, the transition-state represents a temporary and short-living configuration with the highest value of free-energy188. Pauling proposed that the reaction rate of an enzymatic activity is determined by the degree of the enzyme-transition-state complex stability (a higher stability leads to a faster reaction), and in this regard, enzymes act by stabilizing these transition-state complexes (see the diagram depicted in Figure 31)189. Accordingly, surrogates that stabilize the transition-state complex with a higher affinity than intrinsic ligands are known as transition-state analogues that present a higher affinity towards the enzyme, resulting in A) potent enzymatic inhibitors (drug candidates) or B) robust tools for structural, mechanistic and kinetic studies of the respective enzymatic activity. 187 Pauling L. Nature of forces between large molecules of biological interest. Nature. 1948;161(4097):707-709. doi:10.1038/161707a0 188 Schramm VL. Enzymatic transition state theory and transition state analogue design. J Biol Chem. 2007;282(39):28297-28300. doi:10.1074/jbc.R700018200 189 Pauling L. Molecular Architecture and Biological Reactions. Chem Eng News. 1946;24:1375
74 Figure 31. Energy diagram showing how the activation energy needed for a chemical reaction (conversion of the substrate/s into a product) is reduced when an enzyme stabilizes the transition-state intermediate. Over the last 50 years phosphorated transition-state analogues have been successfully explored in medicinal chemistry. For instance, Gobec and collaborators presented a set of phosphonate containing transition-state analogues of antigen 85C, an enzyme of Mycobacterium Tuberculosis with mycolyltransferase activity (Figure 32)190. Antigen 85C is a protein complex that catalyzes the transfer of mycolic acid from one molecule of , -trehalose monomycolate (TMM) to another TMM, leading to the formation of , -trehalose dimycolate (TDM), essential step for the cell wall synthesis191. The tetrahedral phosphonate transition-state analogue shown in Figure 32 was found to stabilize more efficiently the transition-state of the reaction catalysed by antigen 85 C than the intrinsic trehalose, therefore resulting in a high affinity and strong inhibition of the enzyme via a phosphate-based transition-state-complex. 190 Gobec S, Plantan I, Mravljak J, et al. Design, synthesis, biochemical evaluation and antimycobacterial action of phosphonate inhibitors of antigen 85C, a crucial enzyme involved in biosynthesis of the mycobacterial cell wall. Eur J Med Chem. 2007;42(1):54-63. doi:10.1016/j.ejmech.2006.08.007 191 Jackson M, Raynaud C, Lanéelle MA, et al. Inactivation of the antigen 85C gene profoundly affects the mycolate content and alters the permeability of the Mycobacterium tuberculosis cell envelope. Mol Microbiol. 1999;31(5):1573-1587. doi:10.1046/j.1365-2958.1999.01310.x
75 Figure 32. A transition-state analogue bearing a phosphonate functionality. I-1.2. Phosphorus-containing drugs In regards to drug discovery, the phosphorus moiety can be integrated into the pharmacophore structure, or contrarily the P-group can play its role as the pro-moiety of a prodrug that gives place to the corresponding parent drug after in vivo bioactivation. There are some exceptions that do not fit fully within this classification, for instance, in nucleo(s)tide analogues as the ProTide approach the P-group emerges masked as a phosphate surrogate which is part of the pharmacophore, but at the same time acts as a pro-moiety-like group involved in the metabolic activation of the prodrug (see the ProTides, reference). In this section, a representative selection of phosphorated drugs will be briefly exposed, along with P-containing inorganic molecules as counter-ions and excipients in drug formulations. I-1.2.1. Phosphorus as part of the pharmacophore Herein, we focus our attention on pharmacologically relevant drugs containing a phosphorated functionality as part of the pharmacophore. (Phosphonate)-Fosfomycin Fosfomycin (87, Figure 33) is a broad-spectrum antibiotic effective towards both Gram-positive and Gram-negative bacteria. Fosfomycin acts as a bactericidal analogue of phosphoenolpyruvate (PEP) that irreversibly inhibits the UDP-N-acetylglucosamine enolpyruvyltransferase (Mur A), resulting in a blockade of the biosynthesis of peptidoglycan192. Fosfomycin is currently formulated in salt forms for oral (with calcium or trimethamine counterions) and intravenous (with sodium counter-ions) administration193. 192 Kwan ACF, Beahm NP. Fosfomycin for bacterial prostatitis: a review. Int J Antimicrob Agents. 2020;56(4):106106. doi:10.1016/j.ijantimicag.2020.106106 193 Arteche-Eguizabal L, Domingo-Echaburu S, Urrutia-Losada A, Grau-Cerrato S. Fosfomycin: Salt is what really matters. Enferm Infecc Microbiol Clin (Engl Ed). 2021;39(4):206-207. doi:10.1016/j.eimc.2020.06.006
76 (Phosphine oxide)-Brigatinib Out of phosphine oxide containing drugs, brigatinib (88, Figure 33) is a second generation anaplastic lymphoma kinase (ALK) inhibitor approved by the FDA in 2017 for ALK+ non-small cell lung cancer194. Brigatinib presents an enhanced CNS penetration and consequently an improved anti-tumor effect on brain metastasis, a promising advantage considering that lung cancers tend to spread by metastasis since are located in a highly vascularized tissue195. (Phosphinate)-Fosinopril Fosinopril (89, Figure 33) is an angiotensin converting enzyme (ACE) inhibitor used in the treatment of hypertension and chronic heart failure. Fosinopril is the only ACE inhibitor containing a phosphorated moiety, which is in fact a phosphinate ester prodrug which is activated in vivo to give place to the corresponding active phosphinic acid derivative fosinoprilat (90)196. (S and F containing phosphates)-Dyflos and ecothiopate iodide Dyflos (91, Figure 33) and ecothiopate iodide (92) are both acetylcholinesterase (ACHE) inhibitors based on fluorine/sulphur containing phosphates (phosphorofluoridate for dyflos and phosphorothiate for ecothiopate iodide), which are currently used in chronic ocular hypertension (initially were used in humans and later in veterinary medicine)184. 194 FDA resources page. https://www.fda.gov/drugs/resources-information-approved-drugs/brigatinib. Accessed December 28, 2021. 195 Rigaud C, Dourthe M. Chapter 4 - management of ALK positive patients with tumors other than lung cancer. In: Friboulet L, ed. Therapeutic strategies to overcome ALK resistance in cancer. Vol 13. Academic Press; 2021:71-86. doi:10.1016/B978-0-12-821774-0.00008-5 196 Davis R, Coukell A, McTavish D. Fosinopril. A review of its pharmacology and clinical efficacy in the management of heart failure. Drugs. 1997;54(1):103-116. doi:10.2165/00003495-199754010-00012
77 Figure 33. Drugs bearing a phosphorated group in the pharmacophore. (Phosphate)-Nucleo(s)tide phosphate/phosphonate prodrugs Nucleo(s)tide prodrugs are pharmacologically inactive but pharmacokinetically suitable drugs that are metabolically activated in vivo. Out of this category, is noteworthy to highlight the nucleotide prodrugs (ProTides, prodrugs of nucleotides) introduced by McGuigan and collabo 197. In the ProTide approach (Figure 34), the phosphorus moiety is not part of the protective group. Contrarily, the phosphorus is part of an enmasked phosphate of a nucleo(s)tide as a aryloxyphosphor(n)amidate form, which plays a primary role in the bioactivation by consecutive 197 McGuigan C, Tsang HW, Sutton PW, De Clercq E, Balzarini J. Synthesis and anti-HIV activity of some novel chain-extended phosphoramidate derivatives of d4T (stavudine): esterase hydrolysis as a rapid predictive test for antiviral potency. Antivir Chem Chemother. 1998;9(2):109-115. doi:10.1177/095632029800900202
78 action of intrinsic metabolic enzymes. After releasing the two masking protective groups (the aryloxy ester first and the amino acid moiety later), the resulting monophosphate nucleo(s)tide is phosphorylated (twice) to obtain the active nucleo(s)tide triphosphate198. Figure 34. ProTide drugs containing an aryloxyphosphor(n)amidate scaffold. Phosphate ProTide: Sofosbuvir Sofosbuvir (93, Figure 34) in a guanosine analogue prodrug, composed of a guanosine monophosphate derivative protected with a phenol ether and a L-alanine residue in the phosphate moiety. Sofosbuvir is activated in the liver by means of sequential steps involving the combination of various enzymes as shown in Scheme 24: hydrolysis of carboxyl esters by cathepsin A (Cat A) and carboxylesterase 1 (CES 1), phosphoraminidase activity of hHint 1 hydrolase, and finally phosphorylation reaction by both UMP-CMPK and NDPK kinases199. The corresponding active guanosine triphosphate analogue (94) is a direct antiviral used to treat the hepatitis C virus (HCV) via inhibition of HCV polymerase. 198 Slusarczyk M, Serpi M, Pertusati F. Phosphoramidates and phosphonamidates (ProTides) with antiviral activity. Antivir Chem Chemother. 2018;26:2040206618775243. doi:10.1177/2040206618775243 199 Dousson CB. Current and future use of nucleo(s)tide prodrugs in the treatment of hepatitis C virus infection. Antivir Chem Chemother. 2018;26:2040206618756430. doi:10.1177/2040206618756430
79 Scheme 24. In vivo bioactivation of sofosbuvir. Phosphonate ProTide: Tenofovir alafenamide Tenofovir alafenamide fumarate (TAF, chemical structure 97 in Figure 34, vide supra) is formed by an aryloxyfosfonamidate of alanine linked to an adenosine derivative which lacks the ribose moiety. The metabolic bioactivation of TAF gives place to tenofovir, a dAMP analogue with antirretroviral activity. TAF is currently used for the treatment of infections with hepatitis B virus (HBV) and human immunodeficiency virus (HIV)198. Bisphosphonates Bisphosphonates are bone seeking agents clinically used in diseases involving bone loss such as osteoporosis or Paget´s disease, and are structurally composed of two phosphonate groups (P(O)(OH)2) linked to a central C atom (A, Figure 35; e.g. sodium risendronate 97)200. Bisphosphonates are analogues of pyrophosphate (B, Figure 35; e.g. etiodronate disodium 98) with an improved chemical stability provided by the C atom in between, which confers resistance to the activity of intestinal phosphatases, therefore bisphosphonates are suitable drugs for oral administration201. 200 Cawthray J, Wasan E, Wasan K. Bone-seeking agents for the treatment of bone disorders. Drug Deliv Transl Res. 2017;7(4):466-481. doi:10.1007/s13346-017-0394-3 201 Buchet R, Millán JL, Magne D. Multisystemic functions of alkaline phosphatases. Methods Mol Biol. 2013;1053:27-51. doi:10.1007/978-1-62703-562-0_3
80 Figure 35. Comparison between the main structures of bisphosphonates and pyrophosphates with an example of each. Bisphosphonates preferably bind to Ca2+ ions with high affinity and hence, once absorbed they are accumulated in high concentrations in the bone tissue. When osteoclasts destroy the bone, bisphosphonates are released and selectively internalized by the same osteoclasts, resulting in the induction of osteoclast apoptosis by following different molecular pathways (depending on the structure of the bisphosphonate). The final pharmacological result is a reduction of the osteoclastic bone resorption200. I-1.2.2. Phosphorus as part of the pro-moiety As mentioned before, a considerable part of metabolism involves biotransformation of phosphate esters. Hence, unprotected phosphate-containing compounds are likely to be quickly transformed in vivo and this may explain their wide use as pro-moieties in the preparation of ester prodrugs to improve the water solubility of orally and intravenously administered drugs. Phosphate prodrugs are activated by phosphatases such as alkaline phosphatases present in plasma and enterocytes of the intestinal barrier via hydrolysis of the phosphate esters202, among others. 202 Huttunen KM, Raunio H, Rautio J. Prodrugs--from serendipity to rational design. Pharmacol Rev. 2011;63(3):750-771. doi:10.1124/pr.110.003459
81 Steroid-derived sodium phosphates Dexamethasone (DXM) is a long acting glucocorticoid used in inflammatory/allergic disorders, cerebral edema and in the management of circulatory shock such as septic shock203. Dexamethasone sodium phosphate is a prodrug of the active DXM protected with a phosphate group and formulated in a sodium salt form in order to allow intravenous administration. The employment of (disodium) phosphate as the protective group comparing with other promoieties (as hemisuccinates) confers to DXM a high degree of solubility and chemical stability in aqueous environment, as well as a faster bioconversion by alkaline phosphatases of the water soluble prodrug into the active form (free DXM)204. Besides DXM, there are other corticosteroid ester phosphates used in clinics as prednisolone sodium phosphate202 and hydrocortisone sodium phosphate205. The structures of dexamethasone/prednisolone/hydrocortisone (99, 100, 101) sodium phosphate are depicted in Figure 36. Figure 36. Structures of dexamethasone, prednisolone and hydrocortisone formulated in their sodium phosphate salt form. 203 1. Flower RJ, Gavins F. Dexamethasone. In: Enna SJ, Bylund DB, eds. xPharm: The comprehensive pharmacology reference. New York: Elsevier; 2008:1-6. doi:10.1016/B978-008055232-3.61572-7 204 Rohdewald P, Möllmann H, Barth J, Rehder J, Derendorf H. Pharmacokinetics of dexamethasone and its phosphate ester. Biopharm Drug Dispos. 1987;8(3):205-212. doi:10.1002/bdd.2510080302 205 Shankar-Hari M, Santhakumaran S, Prevost AT, et al. Defining phenotypes and treatment effect heterogeneity to inform acute respiratory distress syndrome and sepsis trials: secondary analyses of three RCTs. Southampton (UK): NIHR Journals Library; July 2021.
88 activate the ethylene. These two scenarios require the electrophilic activation of the imine by coordinating a Lewis-acid catalyst to the nitrogen atom, which removes electronic density from the iminic carbon to promote the Povarov reaction218. A wide range of LA have been described as convenient catalyst in the Povarov cycloaddition, e.g. BF3.Et2O, lanthanide triflates, lanthanide salts such as cerium ammonium nitrate (CAN)219 or indium salts220. In 1988, Grieco and co-workers found that Brønsted-acids, which are able to protonate the iminic nitrogen, could be conveniently used to catalyze the Povarov reaction. Accordingly, during DA cycloaddition between cyclopentadiene and aldimines in the presence of trifluoroacetic acid (TFA), Grieco and collaborators expected a formal [4+2] Diels-Alder reaction (pathway A, Scheme 30), but they found that N-aryl imines were acting as the dienophile in an inverse electron-demand [4+2]-cycloaddition after electrophilic activation by TFA, obtaining adducts 118 derived from the Povarov reaction (pathway B, Scheme 30) instead of the expected DA products221. Scheme 30. Inverse electron-demand [4+2]-cycloaddition obtained by Grieco and coworkers between cyclopentadiene and aldimines activated by TFA. 218 Kouznetsov VV. Recent synthetic developments in a powerful imino Diels Alder reaction (Povarov reaction): Application to the synthesis of N-polyheterocycles and related alkaloids. Tetrahedron. 2009;65(14):2721-2750. doi:10.1016/j.tet.2008.12.059 219 Sridharan V, Menéndez JC. Cerium(IV) ammonium nitrate as a catalyst in organic synthesis. Chem Rev. 2010;110(6):3805-3849. doi: 10.1021/cr100004p 220 Manian, Rathna Durga R. S., Jayashankaran J, Ramesh R, Raghunathan R. Rapid synthesis of tetrahydroquinolines by indium trichloride catalyzed monoand bis-intramolecular imino Diels Alder reactions. ChemInform. 2007;38(6). doi:10.1002/chin.200706139 221 Grieco PA, Bahsas A. Role reversal in the cyclocondensation of cyclopentadiene with heterodienophiles derived from aryl amines and aldehydes: Synthesis of novel tetrahydroquinolines. Tetrahedron Lett. 1988;29(46):5855-5858. doi:10.1016/S0040-4039(00)82208-X
89 Key advances in the discovery of efficient catalysts for the Povarov reaction In 1995 Kobayashi et al. reported the Povarov reaction of olefins with aldimines electronicallly activated by 10 mol% of lanthanide triflates, obtaining tetrahydroquinoline adducts in high yields222. Kobayashi´s discovery opened the door to the development of highly efficient Lewisacid (e.g. lanthanide triflates and chlorides) and metal-free Brønsted-acid catalysts223, which allowed to move from stoichiometric to catalytic amounts of catalyst. Nowadays, a wide variety of powerful catalysts are used to promote the Povarov reaction, including Lewis-acids (BF3.Et2O, (Yb(OTf)3, Sc(OTf)3, CAN, SnCl4, FeCl3, ZnCl2, CuBr2, BiCl3, InCl3, phosphoric acids), Brønsted-acids (p-TSOH, TFA, HCl, TfOH, Tf2NH), or molecular iodine (I2), among others. One year Later, Kobayashi and co-workers disclosed the first asymmetric Povarov reaction between hydroxyaldimines 119 (Scheme 31) and non-chiral vinyl ether/2,3-dihyfrofurane/ciclopentadiene 120 using a chiral lanthanide triflate complex as LA catalyst in the presence of a base, to obtain cistetrahydroquinoline adducts 121 with high enantiomeric excesses224. The discoveries of MCR and enantioselective versions and specially the development of highly efficient catalysts initiated by Kobayashi re-attracted the attention of synthetic organic chemists towards the Povarov reaction. Scheme 31. Asymetric Povarov reaction catalyzed by a lanthanide triflate-complex as a Lewis-acid catalyst. I-2.3. Dienophiles in the Povarov reaction The Povarov reaction tolerates a wide range on dienophiles, acceding to many different tetrahydroquinoline-derived scaffolds. 222 Kobayashi S, Ishitani H, Nagayama S. Lanthanide Triflate Catalyzed Imino Diels-Alder Reactions; Convenient Syntheses of Pyridine and Quinoline Derivatives. Synthesis. 1995;1995(9):1195-1202 223 Akiyama T, Morita H, Fuchibe K. Chiral brønsted acid-catalyzed inverse electron-demand aza J Am Chem Soc. 2006;128(40):13070-13071. doi: 10.1021/ja064676r 224 Ishitani H, Kobayashi S. Catalytic asymmetric aza diels-alder reactions using a chiral lanthanide lewis acid. enantioselective synthesis of tetrahydroquinoline derivatives using a catalytic amount of a chiral source. Tetrahedron Lett. 1996;37(41):7357-7360. doi: https://doi.org/10.1016/0040-4039(96)01655-3
90 Alkenes and alkynes as dienophiles Our research group presented styrenes 124a (Scheme 32)93 and the cyclic derivative indene 124b94 as dienophiles in a BF3.Et2O promoted Povarov MCR (with imines derived from 3aminopyridine 122 and aldehydes 123) for the synthesis of highly functionalized tetrahydroquinoline/quinoline derivatives 125a/126a or indenotetrahydroquinoline/indenoiquinolines 125b/126b. Likewise, our group also presented acetylenes 124c as suitable dienophile in the Povarov reaction to yield directly quinoline derivatives 126a225, a strategy oriented to avoid the final oxidation step. Scheme 32. Styrenes, indene and acetylenes as dienophiles in the Povarov reaction. Vynil/enol ethers/enamin(d)es and cyclic derivatives as dienophiles Povarov performed the first imino-DA [4+2]-cycloaddition employing vinyl ethers and vinyl thioethers as dienophiles. In the same way enol ethers and cyclic derivatives have been broadly explored, including their analogues vinyl enamides/enamines (and cyclic derivatives thereof). As an example, in 2012 Jacobsen, Marcurelle and collaborators disclosed an asymmetric Povarov 225 Alonso C, González M, Palacios F, Rubiales G. Study of the hetero-[4+2]-cycloaddition reaction of aldimines and alkynes. synthesis of 1,5-naphthyridine and isoindolone derivatives. J Org Chem. 2017;82(12):6379-6387. doi: 10.1021/acs.joc.7b00977
91 reaction of imine glyoxalate 127 (Scheme 33) and 2,3-dihydro-1H-pyrrole 128 as dienophiles, in the presence of a chiral urea Brønsted-acid catalyst, obtaining tetrahydroquinoline adducts 129 which were the precursors of derivatives 130 (a whole library of >2000 derivatives)226. Scheme 33. Asymetric Povarov reaction described by Jacobsen and collaborators Intramolecular Povarov reaction Besides the standard Povarov reaction, if the diene and the dienophile are present in the same molecule, the Povarov reaction can occur intramolecularly to achieve fused N-containing polycyclic structures of high complexity. For instance, in our group, Martín-Encinas disclosed a smart intramolecular Povarov reaction (described in the Scheme 34) to yield fused quinolino[4,3-b][1,5]naphthyridine scaffolds 131, acceding to N-polyheterocycles with elevated biological interest as TOP1 inhibitors97. Scheme 34. Intramolecular Povarov reaction described by Martín-Encinas. I-2.4. Dehydrogenation of tetrahydroquinoline adducts obtained by the Povarov reaction to achieve fully aromatic quinolines The formation of tetrahydroquinoline adducts provided by the Povarov reaction may be subjected to selective dehydrogenation with oxidizing agents to obtain the corresponding 226 et al. Application of a catalytic asymmetric Povarov reaction using chiral ureas to the synthesis of a tetrahydroquinoline library. ACS Comb Sci. 2012;14(11):621-630. doi:10.1021/co300098v
92 aromatic quinolines. The process comprises the formal removal of 4 hydrogen atoms and further implies the loss of the stereoselectivity obtained during the Povarov reaction. Several oxidants have been successfully explored for the dehydrogenation of tetrahydroquinoline adducts, such as DDQ, CAN, manganese acetate, molecular sulphur and nitrobenzene227. It must be mentioned that during the oxidation step undesired side-elimination reactions can occur (specially with non-aromatic N-C and O-C bonds), reducing the yield of the process. Accordingly, Lavilla and coworkers presented a method for the selective oxidation of lactam-fused tetrahydroquinoline derivatives with manganese oxide in the presence of stoichiometric amounts of pyridine, which yields to the corresponding quinoline 132 derivatives avoiding side elimination reactions driving to undesired opened derivatives 133 (the process is described in the Scheme 35). Scheme 35. Selective oxidation of tetrahydroquinoline adducts disclosed by Lavilla and collaborators. 227 Vicente-García E, Ramón R, Preciado S, Lavilla R. Multicomponent reaction access to complex quinolines via oxidation of the Povarov adducts. Beilstein J Org Chem. 2011;7:980-987. doi:10.3762/bjoc.7.110
93 I-2.5. Summary, a historical approach of the Povarov reaction We have described the mechanism and synthetic applicability of the Povarov reaction, along with the key advances achieved since its discovery by Povarov and Mikhailov in 1963 until the late 1990s, when the interest of the Povarov reaction grew considerably and nowadays is still a broadly used synthetic method. These key findings are collected in the timeline depicted in the Figure 39, in where the main advances are placed into a historical frame. Figure 39. Schematic timeline covering the discovery and main advances of the Povarov reaction.
94 I-3. Synthesis of quinolinylphosphine oxide derivatives *Note: from this point on, compounds, schemes, figures and tables will be enumerated starting from the number 1. This numerical order will be maintained to reference the compounds herein synthesized in the following chapters dedicated to their biological evaluation. Continuing with our research group´s previous work focused in the development of small Ncontaining heterocycles as TOP1 inhibitors93,94, we designed a set of 2,4-diarylsubstituted 1,2,3,4-tetrahydroquinolines and quinolines bearing a pentavalent diphenylphosphine oxide moiety which may be conveniently prepared by the Povarov reaction which involves a Lewis acid promoted [4+2] cycloaddition reaction. For the preparation of 8-quinolinylphosphine oxide derivatives III, this reaction could be performed between N-aryl imines II (obtained by condensation between anilines I and aldehydes) and electron rich dienophiles, acceding to a broad variety of tetrahydroquinolines III (Scheme 1). Scheme 1. Lewis-acid catalyzed Povarov reaction I-3.1. Synthesis of (2-aminophenyl)diphenylphosphine oxide 1a In order to accomplish the synthesis of quinoline derivatives through the Povarov reaction, firstly we had to prepare the corresponding o-phosphine oxide aniline 1a (Figure 1) as long as this initial substrate is not commercially available. Figure 1. Structure of (2-aminophenyl)diphenylphosphine oxide 1a. Based on the existing bibliography, apparently the most reliable method for the preparation of o-phosphine oxide aniline 1a (Figure 2) implies a 2 step procedure involving a nucleophilic
95 aromatic substitution reaction (SNAr) of 1,2-dinitrobenzenes with trivalent organophosphorus reagents (Scheme 2). Scheme 2. SNAr of 1,2-dinitrobenzenes and nucleophilic trivalent phosphorus reagents outlined by Cardogan and collaborators. The present SNAr methodology was disclosed by Cardogan and collaborators in 1969228 but is still being used in recent publications229. Cardogan´s group described the displacement of a nitro group by nucleophilic phosphorus reagents through a Michaelis-Arbuzov-like mechanism. The reaction involves the nucleophilic addition of a trivalent phosphite/phosphinite to 1,2dinitrobenzenes and a subsequent nucleophilic displacement of the activated nitro group to form a phosphonium salt intermediate. Finally, a dealkylation reaction mediated by the displaced nitro anion leads to the corresponding 2-nitrodiphenyl pentavalent phosphine oxide derivative (Scheme 2). The aniline 1a was prepared following the synthetic route depicted in scheme 3, which comprises a nucleophilic displacement of a nitro group of 1,2-dinitrobenzene with ethyl diphenylphosphinite and a subsequent selective hydrogenation of the nitro functionality. 228 Cadogan JIG, Sears DJ, Smith DM. The reactivity of organophosphorus compounds. part XXV. displacement of activated aromatic nitro-groups by tervalent phosphorus reagents. J Chem Soc C. 1969(10):1314-1318. doi:10.1039/J39690001314 229 a) Rad'kova NY, Tolpygin AO, Rad'kov VY, et al. Bis(alkyl) rare-earth complexes coordinated by bulky tridentate amidinate ligands bearing pendant Ph2P=O and Ph2P=NR groups. Synthesis, structures and catalytic activity in stereospecific isoprene polymerization. Dalton Trans. 2016;45(46):18572-18584. doi: 10.1039/C6DT03074B b) Navarro Y, García López J, Iglesias MJ, López Ortiz F. Chelation-assisted interrupted copper(I)-catalyzed Azide Alkyne Azide domino reactions: Synthesis of fully substituted 5triazenyl-1,2,3-triazoles. Org Lett. 2021;23(2):334-339. doi: 10.1021/acs.orglett.0c03838.
96 Scheme 3. Synthesis of the starting substrate 1a. Reaction monitoring by 31P-NMR spectroscopy revealed that the ethyl diphenylphosphinite was not totally converted into (2-nitrophenyl)diphenylphosphine oxide, even though after purification of the crude reaction, (2-nitrophenyl)diphenylphosphine oxide was obtained in a good yield (69%). Moreover, the present SNAr prodecure allows an easy recovery of the starting 1,2-dinitrobenzene, which can be re-used in future reactions. After the insertion of the pentavalent phosphorous functionalities in the benzene ring, the nitro group was easily reduced into amino functionality in a quantitative yield (shown as 99 %) by selective catalytic hydrogenation in the presence of Raney nickel, obtaining the desired (2aminophenyl)diphenylphosphine oxide 1a (Scheme 3). I-3.2. Synthesis of hybrid diphenylphosphine oxide substituted 1,2,3,4tetrahydroquinolines by the Povarov reaction I-3.2.1. One-pot step-by-step reaction with olefins (route A) Once the starting substrate 1a was prepared, we proceeded to use it in the subsequent steps. Phosphine oxide derived aldimines 4 can be easily prepared by the condensation of phosphorated aniline 1a and aromatic aldehydes 2 in refluxing chloroform (Scheme 4). In order to protect the imines from hydrolysis, reactions were conducted under inert nitrogen atmosphere (N2 gas) and molecular sieves were added to the reaction media.
97 Scheme 4. Synthetic route A (stepwise Povarov) for the preparation of 1,2,3,4-tetrahydroquinolin-8-yl phosphine oxides 6. The formation of aldimines 4was monitored by 1H and 31P-NMR spectroscopy. Despite their chemical instability, conversion of aniline 1a into the corresponding aldimine 4can be observed to a certain extent by NMR if the reaction is performed in deuterated chloroform and aliquots are taken under inert N2atmosphere (in the case of 31P-NMR, the reaction can be made in CHCl3 and then dilute the sample in CDCl3). The reaction conditions for the formation of aldimines 4 are collected in the Table 1. Table 1. Preparation of 2-(diphenylphosphine oxide) aldimines 4. Entry Compound Reaction time Nº R1 14a 2-MeO-C6H412h 24b 4-(EtO)2P(O)OC6H424h 3 4c 1 - naphthyl 24h 44i 3,4-F2-C6H324h Unfortunately, aldimines 4result sensitive to hydrolysis, and therefore they were prepared in situ for the subsequent cycloaddition reactions, without previous isolation. After completion of imine formation in refluxing chloroform, the reaction was cooled down and phosphorated Naryl imines 4 were used in the subsequent conventional Povarov approach comprised a Lewis acid (LA) catalyzed aza-Diels Alder reaction with electron rich olefins 3, in the presence of boron trifluoride diethyl etherate (BF3.Et2O) as a Lewis acid catalyst (Scheme 4, route A). In order to protect imines from hydrolysis, Povarov reactions were conducted under an inert nitrogen atmosphere (N2gas) and molecular sieves (4 Å) were added to the reaction media. The reaction
104 I-3.3. Synthesis of diphenylphosphine oxide substituted quinolines I-3.3.1. Oxidation of 1,2,3,4-tetrahydroquinolin-8-yl phosphine oxides 6 After the preparation of tetrahydroquinoline primary adducts 6 by the Povarov reaction, we considered the synthesis of the corresponding quinolines 7by a subsequent dehydrogenation process (Scheme 6). Tetrahydroquinolines 6are subjected to oxidation to obtain the corresponding quinolines 7, which involves the removal of four hydrogens by an oxidant agent and leads to the loss of the stereoselectivity. The selective dehydrogenation of THQ frameworks leads to fully aromatic quinolines, and this fact may have a remarkable effect towards inhibition of TOP1 as flat or quasi-flat polyaromatic systems may stablish favourable interactions with TOP1-DNA complexes (mainly -stacking interactions with DNA base pairs)230. DDQ is one of the most used oxidizing agent to dehydrogenate Povarov adducts. Our group had previous experience working with DDQ and in the present oxidations, rapid conversions with no evidences of side reaction products were observed. In this manner, we optimized a standard protocol using tetrahydroquinolines 6and 2 equivalents of DDQ in refluxing chloroform (Scheme 6). The reaction progress was followed by TLC and NMR spectroscopy (1H, 31P) and, in all cases, reactions were completed after 2 h. The isolation of quinolines 7from the reaction crudes may result challenging, because of the dirtiness derived from the excess of DDQ and reduced form thereof. Thus, as DDQ and reduced form result partially soluble in water, we realized that a work up comprising washing the organic solution just with water several times (5-10) allows to get rid of the impurities that hinder the purification step. Scheme 6. Aromatization of 1,2,3,4-tertrahydroquinolin-8-yl phosphine oxides 6to yield quinoline-8-yl phosphine oxides 7. Following the current DDQ oxidation protocol, we proceeded to the preparation of the quinoline-8-yl derivative 7a by the selective dehydrogenation of 1,2,3,4-tetrahydroquinolin-8-yl derivative 6a as a model reaction. The formation of (2-(2-methoxyphenyl)-4-phenylquinolin-8yl)diphenylphosphine oxide 7a was confirmed by 1H-NMR spectroscopy. In the 1H-NMR 230 Pommier Y, Marchand C. Interfacial inhibitors: targeting macromolecular complexes [published correction appears in Nat Rev Drug Discov. 2012 Mar;11(3):250]. Nat Rev Drug Discov. 2011;11(1):25-36. Published 2011 Dec 16. doi:10.1038/nrd3404
105 spectrum of the fully aromatic quinoline derivative 7a, the characteristic signals corresponding to the aliphatic protons present in the tetrahydroquinoline ring of 6a disappeared, while a new -9 ppm) as shown in Figure 6. Figure 6. Comparison between 1H-NMR spectra of tetrahydroquinolin-8-yl phospine oxide 6a and the corresponding quinolin-8-yl phospine oxide 7a.
106 Once established the reaction conditions, we next studied the scope of the selective dehydrogenation process. Thus, the optimized DDQ protocol was applied to the rest of 1,2,3,4tetrahydroquinolin-8-yl phosphine oxides 6. The afforded quinolin-8-yl phosphine oxides 7 were isolated by column chromatography and recrystallyzed in hexane:ethyl acetate. Yields of quinolines 7 prepared by the aforementioned DDQ oxidation approach are summarized in Table 3. Table 3. Yields of quinoline-8-yl phosphine oxides 7 obtained by DDQ oxidation of compounds 6. Entry Compound Yield (%) Nº R 1 R 2 1 7a 2 - MeO - C 6 H 4 H 74 2 7b 4 - (EtO) 2 P(O)O - C 6 H 4 H 65 3 7c 1 - naphthyl H 72 4 7d 2 - naphthyl H 82 5 7f C 6 H 5 4 - Me 88 6 7g 4 - F - C 6 H 4 4 - Me 93 7 7h 4 - F - C 6 H 4 4 - F 96 8 7i 3,4 - F 2 - C 6 H 3 4 - F 99 If we attend to the results listed in the Table 3, we can observe that the DDQ dehydrogenation procedure of tetrahydroquinolines 6 to obtain the fully aromatic quinolinyl phosphine oxides 7 was found to be an efficient method with overall high yields (65-99%). The best yields were obtained with quinoline derivatives 7g (R1 = 4-F-C6H4; R2 = 4-Me; entry 6), 7h (R1 = 4-F-C6H4; R2 = 4-Me; entry 7), and 7i (R1= 3,4-F-C6H3; R2 = 4-F; entry 8), showing excellent yields (between 9399%). I-3.3.2. Povarov reaction with acetylenes (route C) Once we obtained quinolines 7a-i by the oxidation of isolated Povarov tetrahydroquinoline adducts 6 with DDQ, we moved to investigate a straightforward method to obtain directly quinolines 7 involving a Povarov reaction between 2-(diphenylphosphine oxide) aldimines 4 and acetylenes 8 (Scheme 7, route C).
107 Scheme 7. Synthetic route for the direct preparation of quinoline-8-yl phosphine oxides 7. To start the investigation, a Povarov approach starting from in situ generated imines was explored. In this regard, aldimines 4were prepared from the condensation of aniline 1a and aromatic aldehydes 2in refluxing chloroform within 24 h (we used the same conditions described for the imines prepared in route A (Scheme 4, vide supra). Imines 4were reacted with acetylenes 8, 2 equivalents of BF3.Et2O and DDQ, to obtain regioselectively quinolines 7 (Scheme 7, Table 4). The structure of the obtained compounds 7by the route C (oxidative Povarov reaction) was confirmed by comparison with derivatives 7obtained by oxidation of compounds 6. Table 4. Yields of quinoline-8-yl phosphine oxides 7obtained by route C. Entry Compound Yield (%) Nº R1R2 17f C6H54-Me 82 27g 4-F-C6H44-Me 71 37h 4-F-C6H44-F 68 47j C6H54-F 56 57k 4-F-C6H4H 50 As it can be observed in the table 4, the straightforward preparation of quinolinyl phosphine oxides 7 through the step-by-step Povarov-DDQ oxidation reaction sequence (route C) reported moderate to high yields (50-82%) and resulted specially effective for the direct preparation of the compound 7f (R1 = C6H5; R2 = 4-Me; Table 4, entry 1) in a one-pot approach. At this point it has to be mentioned that during the Povarov reaction with acetylenes (Scheme 7), in the absence of DDQ evidences of an unexpected side oxidation reaction of intermediates
108 6were observed by the in situ generated imines 4, as these imines 4can act as H acceptors and therefore reduce to the corresponding secondary amine form (isolated from the reaction crudes), resulting in an undesired loss of efficiency231. This undesired reduction of imines 4 can be prevented by directly adding DDQ to the Povarov reaction. The formation of quinolines 7 between aldimines and acetylenes in the presence of DDQ can be explained by a step-by-step Povarov reaction225 that proceeds through the intermediate adducts 9, whose subsequent tatutomerization-dehydrogenation sequence in the presence of DDQ leads to the formation of quinolines 7 (Scheme 7). Furthermore, it should be noted that the Povarov MCR with acetylenes is not favoured, as the reaction is reported to undergo a predominant side-reaction between aldehydes and acetylenes. In acidic media, aromatic aldehydes and acetylenic compounds lead to the formation of undesired , -unsaturated ketones232. For this reason, the development of a MCR approach was discarded and we ruled out the study of the stepwise Povarov-DDQ oxidation one-pot cascade reaction, using acetylenes as dienophiles. I-3.4. Summary of the synthetic routes employed for the preparation of hybrid quinolin-8yl phosphine oxide derivatives 6 and 1,2,3,4-tetrahydroquinolin-8-yl phosphine oxide derivatives 7 Initially, quinoline derivatives 7 (Scheme 8) were the main object of research, but preliminary studies with tetrahydroquinolines 6 revealed certain biological activity as antiproliferative/TOP1 inhibitor agents. Based on these inferences, we had to consider the isolation and further evaluation of tetrahydroquinoline adducts along with fully aromatic quinolines. Accordingly, various strategies based on the Povarov reaction were investigated for the synthesis of 2,4disubstituted 1,2,3,4-tetrahydroquinolines (6) and quinoline (7) derivatives bearing a diphenyl phosphine oxide functionality in position 8 (namely route A, route B, oxidation of compounds 6 and route C). All the syntetic routes studied in this section are collected in the Scheme 8. 231 Selas A, Ramírez G, Palacios F, Alonso C. Design, synthesis and cytotoxic evaluation of diphenyl(quinolin-8-yl)phosphine oxides. Tetrahedron Lett. 2021;70:153019. doi:10.1016/j.tetlet.2021.153019 232 Rueping M, Bootwicha T, Baars H, Sugiono E. Beilstein J. Org. Chem. 2011;7:1680 1687. doi:10.3762/bjoc.7.198
109 Scheme 8. Synthetic routes for the preparation of 1,2,3,4-tetrahydroquinolin-8-yl phosphine oxides 6and quinolin-8yl phospine oxides 7. A general overview.
110 I-4. Synthesis of hybrid dialkyl 1,2,3,4-tetrahydroquinolinylphosphonates and dialkyl quinolinylphosphonates Continuing our previous work initiated with the preparation of phosphine oxide substituted quinoline derivatives as candidates for TOP1 inhibitors233, we decided to expand our research and focus on the preparation of novel phosphonate-functionalized quinolines for a further biological study. Accordingly, we framed the study of novel hybrid 2,4-quinoline derivatives with dialkyl phosphonate functionalities. In light of the experience obtained from the previous work, we estimate to the Povarov reaction a highly convenient procedure to access to the aforementioned hybrid quinolinyl phosphonates. I-4.1. Synthesis of anilines substituted with dialkyl phosphonate 1b, 1c and 1d First of all, we started with the preparation of dialkyl phosphonate-substituted anilines 1b, 1c and 1d (Figure 7) as starting material for the Povarov reaction as these compounds are not commercially available. Figure 7. Structure of dialkyl phosphonate-substituted anilines 1b, 1c and 1d. In order to obtain the dialkyl phosphonate-substituted anilines 1b, 1c and 1d (Figure 7), we firstly tried the aforementioned SNAr of dinitrobenzenes with trivalent organophosphorus reagents described by Cardogan (shown in the section 3.1. vide supra). Cardogan described the displacement of a nitro group by nucleophilic trialkyl phosphites that leads to the corresponding dialkylphosphonate derivative (Scheme 9, route A). The route A has been successfully employed in the preparation of dialkyl phosphonate-substituted anilines 1b and 1c. Nevertheless, the reaction did not occur with p-dinitrobenzene under the same reaction conditions, at least in a measurable range after 120 hours (this fact was also observed by Cardogan and collaborators). Consequently, when we decided to extend the scope of the Povarov reaction using an aniline bearing a dialkyl phosphonate group in paraposition (aniline 1d), alternative methods had to be explored. 233 Alonso C, Fuertes M, Martín-Encinas E, et al. Novel topoisomerase I inhibitors. Syntheses and biological evaluation of phosphorus substituted quinoline derivates with antiproliferative activity. Eur J Med Chem. 2018;149:225-237. doi:10.1016/j.ejmech.2018.02.058
111 Scheme 9. Synthetic routes studied for the preparation of dialkyl phosphonate-substituted anilines 1b-d. The SNAr approach (route A, Scheme 9) results to be intrinsically limited to the preparation of ortho phosphorated nitrobenzenes, and therefore we found the Pd-catalyzed cross coupling approach (route B and route C, Scheme 9) a convenient method for the preparation of phosphorylated anilines 1b, 1c and 1d. In this regard, the Pd-catalyzed reaction between aryl halides and dialkyl-H-phosphites described by Hirao and co-workers resulted a suitable method234. Tetrakis(triphenylphosphine)palladium(0) [Pd(PPh3)4]-mediated catalysis allows a direct C-P bound formation by inserting dialkyl phosphonate moieties into aromatic systems with a nitro substituent. More recently, Guilard et al. disclosed a novel entry to extend the present cross-coupling reaction to aryl halides bearing primary amines235. Guilard and collaborators described the in situ formation of Pd(PPh3)4 from Pd(OAc)2 2 mol% and PPh3 6 mol%. Based on these works, we elaborated a procedure involving a Pd cross coupling reaction between aryl halides and dialkyl-H-phosphites in two ways: 1) a protocol employing nitrosubstituted aryl halides, which requires an additional step to transform the nitro group into a 234 Hirao T, Masunaga T, Yamada N, Ohshiro Y, Agawa T. Palladium-catalyzed new carbon-phosphorus bond formation. Bull Chem Soc Jpn. 1982;55(3):909-913. doi:10.1246/bcsj.55.909. 235 Bessmertnykh A, Douaihy CM, Guilard R. Direct synthesis of amino-substituted aromatic phosphonates via palladium-catalyzed coupling of aromatic monoand dibromides with diethyl phosphite. Chem Lett. 2009;38(7):738-739. doi:10.1246/cl.2009.738.
112 primary amine (route B1) or 2) a straightforward protocol using NH2-containing aryl halides (route B2). In contrast to the o-halogenated anilines, p-halogenated aniline proceeded through the crosscoupling reaction with a certainly low yield (route B2), so we decided to investigate other methodologies to afford p-diethylphosphonate aniline 1d. We followed the protocol disclosed by Iranpoor et al., which consists of a ligand-free-Pd catalyzed reaction between aryl halides and trialkylphosphites to yield dialkyl arylphosphonates236. By following this procedure (route C), we obtained the desired p-dialkylphosphoryl aniline 1d in a relatively high yield. The synthetic routes followed for each dialkyl phosphonate-substituted anilines (1b, 1c, 1d) are shown below: Synthesis of diethyl (2-aminophenyl)phosphonate 1b We proceeded the routes A, B1 and B2 as depicted in the Scheme 10, and based on the obtained results we considered the route B2 the most appropriate protocol to prepare diethyl (2aminophenyl)phosphonate 1b in relatively high yields by a single step methodology. Scheme 10. Synthetic routes studied for the preparation of the aniline 1b. 236 Iranpoor N, Firouzabadi H, Moghadam KR, Motavalli S. First reusable ligand-free palladium catalyzed C P bond formation of aryl halides with trialkylphosphites in neat water. RSC Adv. 2014;4(99):5573255737. doi:10.1039/C4RA07680J
113 Synthesis of diisopropyl (2-aminophenyl)phosphonate 1c The routes A, B1 and B2 were investigated for the preparation of diisopropyl (2aminophenyl)phosphonate 1c (Scheme 11). Attending to the results, it can be noted that the route B2 leads to phosphorylated aniline 1c in a moderate yield but in a single operation. Nevertheless, the route A was considered the most appropriate protocol to prepare the compound 1c in higher yields, resulting also an easily scalable synthetic methodology. Scheme 11. Synthetic routes studied for the preparation of the aniline 1c. Synthesis of diethyl (4-aminophenyl)phosphonate 1d Both routes B1 and C have demonstrated to be convenient approaches to prepare the aniline 1d in similar yields (synthetic routes are shown in the Scheme 12), but we lean towards the route C as it implies a single operation process.
120 Figure 12. 13C-NMR spectrum of diethyl (2,4-diphenylquinolin-8-yl)phosphonate 13a,with a region compared to the 13C DEPT 135 NMR spectrum thereof. To further expand the substrate scope of this one-pot methodology, we extended the current stepwise Povarov-DDQ dehydrogenation reaction sequence (Scheme 14, route A) to a wider range of aromatic aldehydes and styrenes with different electron-withdrawing and electrondonating substituents. In the table 5 are collected the yields of diethyl quinolin-8-yl phosphonates (entries 1-14) obtained upon column chromatography and crystallization (see entries with route A).
121 Table 5. Yields of dialkyl quinolin-8-ylphosphonates 13 obtained by step-by-step Povarov reaction (route A) and a subsequent DDQ oxidation or Povarov MCR and a subsequent DDQ oxidation (route B) and subsequent DDQ oxidation. Entry Compound Route Yield (%) Nº R R 1 R 2 1 13a Et C 6 H 5 H A 74 2 13b Et 2 - MeO - C 6 H 4 H A 48 3 13c Et 3 - MeO - C 6 H 4 H B 89 4 13d Et 4 - MeO - C 6 H 4 H A 41 5 13e Et 4 - (EtO) 2 P(O)O - C 6 H 4 H A 64 6 13f Et 1 - naphthyl H B 60 7 13g Et 2 - naphthyl H B 83 8 13h Et 3,4 - F 2 - C 6 H 3 H B 76 9 13i Et C 6 H 5 4 - Me A 54 10 1 3j Et 4 - F - C 6 H 4 4 - Me A 52 11 13k Et 3,4 - F 2 - C 6 H 3 4 - Me A 47 12 13l Et C 6 H 5 4 - F A 60 13 13m Et 4 - F - C 6 H 4 4 - F A 68 14 13n Et 3,4 - F 2 - C 6 H 3 4 - F A 43 15 13o i Pr 4 - F - C 6 H 4 H B 34 16 13p i Pr 3,4 - F 2 - C 6 H 4 H B 38 17 13q i Pr 4 - F - C 6 H 4 4 - Me B 58 18 13r i Pr 3,4 - F 2 - C 6 H 3 4 - Me B 39 19 13s iPr 4-F-C6H4 4-F B 68 20 13t iPr 3,4-F2-C6H3 4-F B 88 I-4.2.2. MCR reaction with olefins (route B) Afterwards, we planned to study the oxidative Povarov MCR variant for the preparation of quinoline derivatives 13 (the synthetic methodology is depicted in the Scheme 15, i.e. the route B followed by the in situ oxidation of compounds 12 with DDQ). We started our study with the preparation of compound 13f (R = Et; R1 = 1-naphthyl; R2 = H; Table 5, entry 6) following a three-component Povarov reaction between aniline 1b (R = Et), naphthaldehyde 2 (R1 = 1-naphthyl) and phenylstyrene 3 (R2 = H), in the presence of 2 equivalents of BF3.Et2O. After 12 hours, 1Hand 31P-NMR indicated that the reaction was completed. The procedure was followed by the in situ addition of 2 equivalents of DDQ and the mixture was heated to reflux for 2 h (Scheme 15). Diethyl (2-(naphthalen-1-yl)-4-phenylquinolin-8yl)phosphonate 12f was obtained upon isolation by column chromatography in a moderate yield (60%).
122 Scheme 15. Synthetic route B (MCR Povarov reaction) followed by the in situ oxidation of compounds 12 for the preparation of dialkyl quinolin-8-ylphosphonates 13. The 1H-NMR spectrum for the compound 13f is shown in the Figure 13, where we can observe the aromatic H atoms in a range between 7.51-8.60 ppm and two signals corresponding to the protons of the 2 CH3-1.20 ppm) along with the protons of the 2 CH2(obse -4.30 ppm). Figure 13. 1H-NMR spectrum of diethyl (2-(naphthalen-1-yl)-4-phenylquinolin-8-yl)phosphonate 13f.
123 In the Figure 14 (13C-NMR spectrum of the compound 13f), we can observe the signals corresponding to the aromatic assigned to the CH3 and CH2 carbons of the diethyl phosphonate moiety respectively. Figure 14. 13C-NMR spectrum of diethyl (2-(naphthalen-1-yl)-4-phenylquinolin-8-yl)phosphonate 13f. Once we afford the quinolin-8-yl derivative 13f following the MCR Povarov-DDQ dehydrogenation cascade, we extended the scope of the current methodology comprising the MCR Povarov reaction (route B) followed by a DDQ oxidation of the in situ generated Povarov adducts. In this manner, the reactivity of 2-dialkylphosphonate-substituted anilines (1b R =Et; 1c R = iPr) and a variety of styrenes and aromatic aldehydes (Scheme 15) was explored. In the table 5 are listed the corresponding yields of quinolines 13 obtained by the current synthetic route B upon purification by column chromatography and recrystallization (see entries with route B). Summary of the synthetic routes employed for the preparation of quinolin-8-yl dialkyl phosphonate derivatives 13 Considering the results collected in the Table 5, the presented one-pot Povarov-DDQ dehydrogenation reaction sequence was found to be an appropriate methodology for the preparation of diethyl quinolin-8-yl phosphonates 13a-n (Table 5, entries 1-13) and diisopropyl quinolin-8-yl phosphonates 13o-t (entries 14-19) with a wide range of aromatic, electron-
124 donating and electron-withdrawing substituents. Despite the fact that the tetraydroquinoline adducts 12 were not stable and we had to outline a synthetic approach to directly yield the fully aromatic derivatives, the disclosed one-pot methodologies (Scheme 16, route A step-by-step; route B MCR) lead to the obtention of quinolines 13 in a regioselective way and with overall moderate to high yields. The MCR approach allowed a more direct approach with step-economy and resulted specially efficient for the preparation of dialkyl quinolin-8-ylphosphonates 13c (R = Et; R1 = 3-MeOC6H4; R2 = H; Table 5, entry 3), 13g (R = Et; R1 = 2-naphthyl; R2 = H; entry 7) and 13t (R = iPr; R1 = 3,4-F2C6H3; R2 = 4-F; entry 20). Scheme 16. Synthetic routes for the preparation of dialkyl quinolin-8-ylphosphonates 13.
125 I-4.3. Synthesis of hybrid diethyl 1,2,3,4-tetrahydroquinolin-6-ylphosphonates and diethyl quinolin-6-ylphosphonates In order to expand the scope of the reaction and increase the structural diversity in the synthesis of dialkyl phosphonate-substituted quinoline derivatives, we proposed the preparation of 2,4quinoline derivatives with the diethyl phosphonate functionality in position 6. For this purpose, we started the study of the Povarov MCR reaction with the phosphorylated aniline 1d. I-4.3.1. Preparation of diethyl 1,2,3,4-tetrahydroquinolin-6-ylphosphonates by the Povarov MCR approach We investigated a three-component Povarov reaction between aniline 1d, aldehydes 2and styrenes 3, in the presence of molecular sieves and 2 equivalents of BF3.Et2O (Povarov MCR, Scheme 17). We started exploring the model reaction between diethyl (4aminophenyl)phosphonate 1d, 4-fluorobenzaldehyde 2 (R1= 4-F2-C6H5)and 4fluorophenylstyrene 3 (R2= 4-F). The reaction was stirred to reflux in chloroform until 31P/1HNMR experiments indicated the consumption of starting material (1.5 h) and tetrahydroquinoline 15e was afforded. Surprisingly, the diethyl (2,4-bis(4-fluorophenyl)-1,2,3,4tetrahydroquinolin-6-yl)phosphonate 15e (R1 = 4-F-C6H4; R2 = 4-F) resulted to be stable under purification conditions and we were able to successfully isolate by column chromatography (86% yield) and further purification by recrystallization in diethyl ether. Scheme 17. Povarov MCR synthetic route for the preparation of diethyl 1,2,3,4-tetrahydroquinolin-6-ylphosphonates 15. The structure of the obtained 1,2,3,4-tetrahydroquinolines 15 was determined by onedimensional and two-dimensional NMR spectroscopy (i.e. 1D-NMR and 2D-NMR) and HRMS experiments. Hence, the 1H-NMR spectrum of tetrahydroquinoline derivative 15e is shown in the Figure 15, where we can observe the characteristic aliphatic protons corresponding to the non-aromatic piperidine ring of the tetrahydroquinoline moiety. On the one hand, at high field we can observe the signals corresponding to two diastereotopic protons (namely 3a-H and 3b-
126 H) of the methylene (position 3 of the tetrahydroquinoline core) detected as a doublet of 2JHH = 12.3 Hz, 3JHH = 11.3 Hz) and a multiplet at 2.23-2.28 ppm respectively. Moreover, it can be appreciated the presence of two doublet of doublets assigned to the 2-H and 43JHH = 12.3 Hz, 3JHH = 5.2 Hz) and 4.64 ppm (3JHH = 11.3 Hz and 3JHH = 2.9 Hz) respectively. Finally, the proton of the NH group is visible as a wide upon treatment of the sample with D2O. Figure 15. 1H-NMR spectrum of diethyl (2,4-bis(4-fluorophenyl)-1,2,3,4-tetrahydroquinolin-6-yl)phosphonate 15e. The regiochemistry of the process was determined by a HMBC (Heteronuclear Multiple Bond Correlation) 2D-NMR experiment of the compound 15e (the spectra of HMBC is shown in Figure 16), where a cross-linking connectivity is observed between the proton of the NH group and the C-3 methylenic carbon. This correlation confirms that the 4-fluorophenyl substituent has been regioselectively introduced in the position 4 of the quinoline moiety and not in the position 3. The other possible regioisomer bearing the 4-fluorophenyl substituent in position 3 was certainly discarded, which would imply a cross-linking connectivity between the proton of the amino group and the carbon attached to the 4-fluorophenyl group instead, and we did not observe this cross-peak pattern.
127 Figure 16. HMBC spectra of of diethyl (2,4-bis(4-fluorophenyl)-1,2,3,4-tetrahydroquinolin-6-yl)phosphonate 15e. Likewise, the stereoselectivity of the process was determined by 1D-NOESY-NMR spectroscopy as depicted in the Figure 17. The selective saturation of the 2-H proton presented a positive NOESY effect on the 4-H proton (3.50%) and the methylenic protons (2.81% and 0.62% respectively). In addition, the selective saturation of the 4-H proton presented positive NOESY effect on the 2-H proton (3.28%) and the methylenic protons (3.74% and 0.75%). The collected results indicate a relative cis-configuration between the protons in position 2 and 4 of the quinoline core and therefore suggests that the [4+2] Povarov-like cycloaddition reaction occurs through an endo transition state.
128 Figure 17. Relative configuration of diethyl (2,4-bis(4-fluorophenyl)-1,2,3,4-tetrahydroquinolin-6-yl)phosphonate 15e assigned by 1D-NOESY experiments. Once afforded the tetrahydroquinoline 15e and elucidated its chemical structure, we applied the current optimized Povarov MCR methodology to a variety of diverse aromatic aldehydes and styrenes in order to broaden the scope of the reaction. Accordingly, we obtained a set of 1,2,3,4tetrahydroquinolin-6ylphosphonates 15 in good to excellent yields as shown in the Table 6. Table 6. Synthesis of diethyl 1,2,3,4-tetrahydroquinolin-6.ylphosphonates 15 by the Povarov MCR approach. Entry Compound Reaction time (h) Yield (%) Nº R1 R2 1 15a 4-F-C6H4 H 1,5 81 2 15b 3,4-F2-C6H3 H 1,5 97 3 15c 4-F-C6H4 4-Me 2 65 4 15d 3,4-F2-C6H3 4-Me 1 79 5 15e 4-F-C6H4 4-F 1,5 86 6 15f 3,4-F2-C6H3 4-F 1,5 65 In contrast to the previously unsuccessfully attempted preparation of diethyl 1,2,3,4tetrahydroquinolin-8-ylphosphonates 12 (Scheme 16), the Povarov MCR reaction was found to be an exceptionally convenient method for the preparation of diethyl tetrahydroquinolin-6ylphosphonates 15 in high yields (65-97%). In particular, it is noteworthy to highlight the 97% of yield achieved for the derivative 15b (R1 = 3,4-F2-C6H3; R2 = H; Table 6, entry 2).
129 I-4.3.2. Preparation of diethyl quinolin-6-ylphosphonates by DDQ oxidation of 1,2,3,4tetrahydroquinolin-6-yl derivatives 15 Once we achieved the tetrahydroquinolines 15 by the MCR Povarov reaction, we proceeded to their dehydrogenation to yield the corresponding quinolines 16 by oxidation with DDQ (Scheme 18). We started studying the dehydrogenation of 1,2,3,4-tetrahydroquinolin-6yl phosphonate 15a (R1 = 4-F-C6H4; R2 = H;) as the model reaction. Scheme 18. Aromatization of diethyl 1,2,3,4-tetrahydroquinolin-6-ylphosphonates 15 to yield diethyl quinoline-6ylphosphonates 16. Accordingly, the tetrahydroquinolin-6-yl derivative 15a was reacted with 2 equivalents of DDQ in chloroform at 60 oC and the evolution of the dehydrogenation of the corresponding aromatic quinoline derivative 16a was monitored by 31P/1H-NMR spectroscopy. In the Figure 18 we can observe the conversion of tetrahydroquinoline 15a into dehydrogenated quinoline 16a in 1HNMR experiments. After 1 h of dehydrogenation with DDQ, an aliquot was taken and the 1HNMR spectrum revealed that the reaction was still in progress but not finished yet. In the Figure 18 it can be clearly observed how as the dehydrogenation was proceeding, the signals corresponding to the four aliphatic protons of the tetrahydroquinoline moiety (plus the NH group) disappeared, and new aromatic protons corresponding to the newly formed pyridine ring of 16a appeared.
136 During the purification process, tetrahydro-5H-indenoquinolines 19a and 19b were spontaneously dehydrogenated and a fraction of the corresponding indenoquinoline 20 was obtained (Table 8, entries 1 and 2). Moreover, in the case of compounds 19e and 19g, we obtained directly the fully aromatic indenoquinolines 20e and 20g. For instance, when following the current Povarov MCR protocol for the preparation of the compound 19g, upon the purification step we only obtained the corresponding fully aromatic 7H-indenoquinoline 20g (R = 4-P(O)(OiPr)2; R1 = 4-CF3-C6H4; Entry 7, Table 8). In the Figure 22 we can appreciate the 1H-NMR spectrum of the 7H-indenoquinolinyl derivative 20g, and it can be noted that the characteristic signals corresponding to the aliphatic protons of the tetrahydro-5H-indenoquinoline ring disappeared, while the signals of the fully aromatic 7Hindenoquinoline core appeared in the aromatic region. Moreover, in the aliphatic area we can only observe the two diastereotopic protons of the methylene (position C-7) as a singlet at 4.25 ppm and the protons assigned to the diisopropyl phosphonate functionality: the four CH3 groups visualized as two doublets at 1.17 ppm (2JHH = 6.2 Hz) for two methyl groups and 1.38 ppm (2JHH = 6.2 Hz) for the other two methyl groups; and the CH groups observed as a multiplet at 2.03 ppm that integrates for two protons. Figure 22. 1H-NMR spectrum of diisopropyl (6-(4-(trifluoromethyl)phenyl)-7H-indeno[2,1-c]quinolin-4-yl)phosphonate 20g.
137 In like manner, in the 13C-NMR spectrum of the 7H-indenoquinolinyl derivative 20g (Figure 23) we can also observe the absence of the aliphatic protons, except for the methylene group located in the position 7 of the indenoquinoline core, which visualized as a signal in the upfield with a chemical shift of 37.7 ppm (it appears in the reverse phase in the DEPT-135 13C-NMR experiment). Furthermore, at 23.8 ppm appears a doublet with a coupling constant of 3JCP = 4.2 Hz assigned to the CH3 of one of the isopropyl groups and at 24.3 ppm appears another doublet (3JCP = 3.1 Hz) assigned to the two methyl groups of the other isopropyl. Finally, the two CH of the isopropyls are visualized as a doublet at 70.7 ppm with a coupling constant of 2JCP= 5.5 Hz. Figure 23. 13C-NMR spectrum of diisopropyl (6-(4-(trifluoromethyl)phenyl)-7H-indeno[2,1-c]quinolin-4yl)phosphonate 20g. According to the results listed in the Table 8, it can be noted that overall the three-component Povarov reaction allowed the preparation of tetrahydro-5H-indenoquinolines 19 with various substituents in a single operation and in good yields (62-73%). In the case of the tetrahydro-5Hindenoquinolinyl 19b (R = 4-P(O)(OEt)2; R1 = 4-MeO-C6H4; Table 8, entry 2), a 73% of yield was obtained. However, in some cases, during the purification by column chromatography of tetrahydro-5H-indenoquinolines 19, small fractions of the corresponding dehydrogenated aromatic quinolines were isolated. Such is the case for compounds 19a (R = 4-P(O)(OEt)2; R1 = 3MeO-C6H4; entry 1) and 19b (R = 4-P(O)(OEt)2; R1 = 4-MeO-C6H4; entry 2), where the corresponding 7H-indenoquinolinyl derivative 20a and 20b were isolated respectively (yields =
138 22% and 11%). Furthermore, the tetrahydro-5H-indenoquinolinyl derivatives 19e (R = 2P(O)(OEt)2; R1 = 4-MeO-C6H4; entry 5) and 19g(R = 4-P(O)(OiPr)2; R1 = 4-CF3-C6H4; entry 7) resulted not to be stable under purification conditions and the corresponding aromatic 7Hindenoquinoline derivatives 20e and 20g were isolated. I-5.2. Synthesis of dialkyl 7H-indeno[2,1-c]quinolinylphosphonates and dialkyl 7-oxo-7Hindeno[2,1-c]quinolinylphosphonates The dehydrogenation of tetrahydro-5H-indenoquinolines 19 (Scheme 21) was studied following two protocols. On the one hand, we explored the previously mentioned DDQ oxidation protocol (2 equiv. of DDQ in chloroform at 60oC for 2h). Scheme 21. Oxidation of compounds 19 to yield the dialkyl 7H-indeno[2,1-c]quinolinylphosphonates 20 and dialkyl 7oxo-7H-indeno[2,1-c]quinolinylphosphonates 21. We started studying the dehydrogenation of diethyl (6-(4-(trifluoromethyl)phenyl)-6,6a,7,11btetrahydro-5H-indeno[2,1-c]quinolin-2-yl)phosphonate 19f with 2 equivalents of DDQ in refluxing chloroform for 2h. NMR-structure elucidation experiments revealed that the corresponding diethyl (7-oxo-6-(4-(trifluoromethyl)phenyl)-7H-indeno[2,1-c]quinolin-2yl)phosphonate 21f was obtained upon purification by column chromatography and crystallization (Table 9, entry 6). In the Figure 24, the 13C-NMR spectra of tetrahydro-5Hindenoquinoline 19f and the corresponding 7H-indenoquinolinone 21f are compared, where it can be appreciated the disappearance of all the aliphatic carbons of the tetrahydro-5Hindenoquinoline core and the appearance of the newly formed aromatic carbons. Moreover, in the comparative of the 13C-NMR spectra we can observe that diethyl (7-oxo-6-(4- (trifluoromethyl)phenyl)-7H-indeno[2,1-c]quinolin-2-yl)phosphonate 21f lacks the methylenic carbon at C-7 position (observed as a singlet at 31.2 ppm in the tetrahydro-5H-indenoquinolinyl derivative 19f, Figure 24), presenting a signal in the furthest downfield at 191.7 ppm instead, which means that the CH2at position C7 has been oxidized to the corresponding carbonyl functionality.
139 Figure 24. Comparison between the 13C-NMR spectrums of diethyl (6-(4-(trifluoromethyl)phenyl)-6,6a,7,11btetrahydro-5H-indeno[2,1-c]quinolin-2-yl)phosphonate 19f and diethyl (7-oxo-6-(4-(trifluoromethyl)phenyl)-7Hindeno[2,1-c]quinolin-2-yl)phosphonate 21f. Furthermore, with the purpose of investigate the methylene carbonylation, we proceeded to investigate the oxidation conditions of tetrahydro-5H-indenoquinolinyl derivatives 19. In this regard, manganese (III) acetate (3 equivalents) was evaluated as a mild oxidant agent, employing acetic acid as a solvent and stirring the reaction mixtures at reflux temperature. The reactions were monitored by 31P/1H-NMR and TLC. We tried this procedure to aromatize the tetrahydro5H-indenoquinolinyl derivatives 19a and 19c and we obtained the corresponding 7Hindenoquinolinones 21a (R= 4-P(O)(OEt)2; R1 = 3-MeO-C6H4; Table 8, entry 1) and 21c (R = 4P(O)(OEt)2; R 1= 4-MeO-C6H4; entry 2) in low yields (33% and 28%, respectively). Afterwards, we applied these two oxidation protocols (DDQ and Mn III acetate) as described in the Scheme 21, and both methods lead to the formation of compounds 20 and 21 (yields are collected in the Table 9).
140 Table 9. Synthesis of dialkyl 7H-indenoquinolinylphosphonates 20 and dialkyl 7-oxo-7Hindenoquinolin-7one-ylphosphonates 21. Entry Compound Oxidant T (ºC) Reaction time (h) Yield (%) Nº R R 1 1 21a 4 - P(O)(OEt) 2 3 - MeO - C 6 H 4 Mn(OAc) 3 118 36 33 2 21b 4 - P(O)(OEt) 2 4 - MeO - C 6 H 4 DDQ 60 2 14 3 20c 4 - P(O)(OEt) 2 4 - CF 3 - C 6 H 4 DDQ 60 2 26 4 21c 4 - P(O)(OEt) 2 4 - CF 3 - C 6 H 4 Mn(OAc) 3 118 36 28 5 21d 2 - P(O)(OEt) 2 3 - MeO - C 6 H 4 DDQ 60 2 38 6 21f 2 - P(O)(OEt) 2 4 - CF 3 - C 6 H 4 DDQ 60 2 32 In view of the results collected in Table 9, we can conclude that the dehydrogenation/oxidation of tetrahydro-5H-indenoquinoline derivatives 19 with DDQ and Mn(OAc)3 led to the formation of compounds 7H-indeno[2,1-c]quinolines 20 and/or 7H-indeno[2,1-c]quinolin-7-ones 21. The DDQ dehydrogenation protocol led to the obtainment of the 7H-indenoquinoline 20c (R = 4-P(O)(OEt)2; R1 = 4-CF3-C6H4; Entry 3) with a low yield (26%). On the contrary, following the same reaction conditions, the DDQ protocol led to 7H-indenoquinolinones 21b, 21d and 21f in low yields (14-38%). The dehydrogenation of tetrahydro-5H-indeno[2,1-c]quinoline derivatives 19 following the Mn(OAc)3 in protocol, on the whole led to the dehydrogenation of the four aliphatic hydrogens but also to the oxidation of the methylenic carbon (position 7 of the indenoquinoline core) into a carbonyl group, obtaining directly the fully aromatic 7H-indeno[2,1-c]quinolin-7-ones 21a (R = 4-P(O)(OEt)2; R1 = 3-MeO-C6H4; Table 9, entry 1) and 21c (R = 4-P(O)(OEt)2; R1 = 4-CF3-C6H4; entry 4) in low yields (33% and 28% respectively).
141 Summary of the synthetic routes employed for the preparation of dialkyl indeno[2,1c]quinolinylphosphonates 18, 19 and 20 Scheme 22. Synthetic routes for the preparation of dialkyl tetrahydro-5H-indeno[2,1-c]quinolinylphosphonates 19, dialkyl 7H-indeno[2,1-c]quinolinylphosphonates 20 and dialkyl 7-oxo-7H-indeno[2,1-c]quinolinylphosphonates 21. In conclusion, we found the Povarov MCR a convenient synthetic method for the preparation of dialkyl tetrahydro-5H-indeno[2,1-c]quinolinylphosphonates 19 (Scheme 22). Terahydroindenoquinolines 19 may be dehydrogenated to obtain the corresponding 7Hindeno[2,1-c]quinolines 20, although considering that the methylenic carbon (position 7 of the indenoquinoline scaffold) could be subjected to oxidation and lead to 7H-indeno[2,1c]quinolinones 21. Accordingly, the oxidation of the methylenic carbon allowed us to incorporate a new diversity point in the indeno[2,1-c]quinoline core. However, it has to be mentioned that future investigations should be made to improve the current oxidation protocols.
142 Chapter II. Study of the in vitro TOP1 inhibitory activity of the newly synthesized quinoline derivatives
143 II-1. Introduction: in vitro drug screening of TOP1 inhibitors Human topoisomerase 1B (hTOP1) is a potential and well stablished target of anti-cancer drugs26. In this sense, in vitro drug screening assays for the identification of novel hTOP1B inhibitors and further studies of their mode of action represent the first step for the biological evaluation of novel TOP1 inhibitors. The most employed state-of-the-art assays for the screening of TOP1 targeting small compounds are featured below, as well as a novel, quantitative and highly sensitive methodology for the real-time assessment of the TOP1 activity in vitro. II-1.1. DNA Relaxation assay DNA relaxation assay is the standard and most common in vitro assay for large drug screenings of novel sets of compounds as candidates for TOP1 inhibitors, and is based on the separation of the different topological forms of DNA by agarose gel electrophoresis. TOP1 is able to relax supercoiled circular plasmid DNA substrates (double stranded bacterial circular DNA) by introducing transient nicks (cleavage step) in one of the strands, allowing a controlled rotation of the non-cleaved strand through the nick. These nicks are rapidly sealed during the religation step, obtaining relaxed forms of the plasmid. In the DNA relaxation assay, negatively supercoiled DNA plasmids are incubated with purified TOP1 and the reaction is stopped with 0.5% of SDS (sodium dodecyl sulphate), generating a variation in the linking number (Lk) of DNA by action of the enzyme. Topoisomers are DNA substrates with identical composition but different Lk and are further differentiated by electrophoresis in 1% agarose gel. Supercoiled DNA (Sc) remains compact and presents a faster electrophoretic mobility, thereby reaching the lowest part of the gel (Figure 25, below). On the contrary, relaxed forms (Relax) have an extended shape and consequently exhibit a slower migration. Accordingly, relaxed forms remain above, occupying a wider space as long as TOP1 action results in various relaxed topoisomers with different Lk (Figure 25, above). If the electrophoresis runs at low voltage during long times (e.g. 20-30 V during 12-20 h), these relaxed topoisomers could be clearly observed as shown in the example depicted in the Figure 25.
144 Figure 25. DNA relaxation assay, kinetic experiment with DMSO (inert solvent) and CPT (TOP1 inhibitor). After electrophoresis completion, for the further visualization of the results, the DNA has to be stained by soaking the gel in a dissolution containing a nucleic-acid dye (mainly DNA intercalators as EtBr, SYBR safe or GelRed). Then, the gels are ready to be photographed in an UV-transilluminator. The TOP1 activity is analysed by measuring the conversion ratio of supercoiled plasmid into the relaxed form, and this assessment can be applied in order to study the inhibitor effect of drugs/candidates. If a TOP1 inhibitor agent is introduced in the reaction media, the inhibitor interferes the action of the enzyme obtaining less relaxed plasmid and a larger fraction of supercoiled form238, as shown in the Figure 25 (the reversible TOP1 inhibitor accumulation of Sc DNA relaxation assays could be performed in a time-course style (kinetic experiments) or in an end-point experiment manner. Kinetic experiments permit the study of the inhibitory activity during a selected time interval (applicable to evaluate the reversibility of the inhibition over the time)94, while end-point experiments are indicated to reveal the optimum concentration of the 238 Nitiss JL, Kiianitsa K, Sun Y, Nitiss KC, Maizels N. Topoisomerase Assays. Curr Protoc. 2021;1(10):e250. doi:10.1002/cpz1.250
145 drug to be used for the inhibition of TOP1239. In particular, in the Figure 25 is depicted an example of a kinetic experiment of the DNA relaxation assay. II-1.2. Nicking assay The nicking assay is mainly the same experiment as the DNA relaxation assay, but the DNA samples are loaded into an agarose gel containing ethidium bromide (EtBr). EtBr is a DNA intercalator and unwinding agent, which introduces positive supercoils into intact DNA plasmid238. As explained in the section II-1.1. of this chapter (vide supra), when performing the DNA relaxation assay experiment, during incubation in the presence of TOP1 the negatively supercoiled plasmid is relaxed by the enzyme action, obtaining the corresponding relaxed form (Relax). In the absence of TOP1, the negatively supercoiled form (Sc) is maintained (e.g. in a negative control, Figure 25, lane 7). However, during incubation of plasmid DNA with TOP1, some compounds are able to stabilize TOP1CC and generate a nicked plasmid (Nick), as illustrated in the Figure 26. The nicking assay allows the differentiation of these three forms of plasmid DNA (Nick, Sc and relax). Figure 26. Supercoiled, relaxed and nicked forms of plasmid DNA after incubation with TOP1. In the so-called nicking assay, a 1% agarose gel prestained with EtBr (0.5-1 µg/mL) is used to distinguish nicked plasmid from intact plasmid (relaxed and supercoiled)97. During the electrophoresis, the DNA samples are progressively being intercalated by EtBr, leading to an untwisting of the double helix of the DNA. At this point, it has to be mentioned that extended 239 Tejería A, Pérez-Pertejo Y, Reguera RM, et al. Antileishmanial activity of new hybrid tetrahydroquinoline and quinoline derivatives with phosphorus substituents. Eur J Med Chem. 2019;162:18-31. doi:10.1016/j.ejmech.2018.10.065
248 phosphatidylcholine, interfering with the lipid metabolism and therefore affecting the membrane remodelling315. Moreover, it is reported that miltefosine also induces the inhibition of the cytochrome C oxidase, altering the mitochondrial response317. Nonetheless, it seems that there may be some other targets involved in the antileishmanial effect of miltefosine. At present, miltefosine is the most effective APL both in Leishmania amastigotes and in promastigotes. Furthermore, miltefosine has been the first oral antileishmanial agent. It was introduced in 2002, and up to now is still being the unique oral antileishmanial drug accepted by the FDA for the treatment of visceral and cutaneous leishmaniasis296 (the rest of antileishmanial drugs are administrated intravenously by an initial load dosage and subsequent maintenance administrations). Paromomycin Paromomycin (5, Figure 79) is a wide spectrum aminoglycoside antibiotic that has revealed as an effective antimalarial agent, even though its mode of action is largely unclear. As an aminoglycoside antibiotic, paromomycin specifically binds to the 30s ribosomal subunit and therefore stabilizes the ribosomal complex, leading to a blockade in the protein translocation step. Hence, some authors claim that the antileishmanial effect may be related with the inhibition of the protein synthesis318. Conversely, other authors suggest that the cationic paromomycin acts by binding to anionic components of the leishmanial cell membrane (i.e. glycocalix and lipophosphoglycan), leading to a fatal cell membrane alteration319. Paromomycin is clinically used by intravenous administration in both visceral and cutaneous leishmaniasis since 2006 and, in some cases, it is topically administered to treat cutaneous leishmaniasis296. Pentamidine Pentamidine (6, Figure 79) is an antimicrobial agent employed in the treatment of leishmaniasis. The mode of action of pentamidine relies on a selective intracellular accumulation in Leishmania 317 Santa-Rita RM, Henriques-Pons A, Barbosa HS, de Castro SL. Effect of the lysophospholipid analogues edelfosine, ilmofosine and miltefosine against Leishmania amazonensis. J Antimicrob Chemother. 2004;54(4):704-710. doi:10.1093/jac/dkh380 318 Davidson RN, den Boer M, Ritmeijer K. Paromomycin. Trans R Soc Trop Med Hyg. 2009;103(7):653-660. doi:10.1016/j.trstmh.2008.09.008 319 Chawla B, Jhingran A, Panigrahi A, Stuart KD, Madhubala R. Paromomycin affects translation and vesicle-mediated trafficking as revealed by proteomics of paromomycin -susceptible -resistant Leishmania donovani. PLoS One. 2011;6(10):e26660. doi:10.1371/journal.pone.0026660
249 cells and proceeds by selectively binding to the kinetoplast DNA, resulting in the inhibition of the DNA synthesis320. Pentamidine is currently used as a second-line drug in both visceral and cutaneous leishmaniasis due to the reported elevated toxicity. In this regard, the pharmacological treatment with pentamidine could be accompanied by gastrointestinal toxicity, cardiotoxicity and the induction of irreversible insulin-dependent diabetes mellitus321. 320 Singh K, Garg G, Ali V. Current Therapeutics, Their Problems and Thiol Metabolism as Potential Drug Targets in Leishmaniasis. Curr Drug Metab. 2016;17(9):897-919. doi:10.2174/1389200217666160819161444 321 Scholar E. Pentamidine. In: Enna SJ, Bylund DB, eds. xPharm: The comprehensive pharmacology reference. New York: Elsevier; 2009:1-7. https://doi.org/10.1016/B978-008055232-3.62388-8
250 Figure 79. Structures of principal drugs currently used in chemotherapy of leishmaniasis. IV-1.3.2. Immunotherapy for the treatment of leishmaniasis The immune response of the host to Leishmania intracelular infection results quite complex and its efficacy is determined by the species and strains of Leishmania parasites, the host-parasite interaction and both innate and adaptive immunities of the host. Regarding to the immune response, it has to be considered that Leishmania parasites have developed systematic resistance toward the immune system of the host. Hence, macrophages, dendritic cells and neutrophils are essentially the phagocytes implicated in the cellular uptake of Leishmania metacyclic promastigotes in the very first stage of the infection, and consequently, Leishmania parasites have adapted to survive and evade the immune system once
251 infected the phagocytes322. For instance, L. donovani has been found to inhibit the apoptosis of macrophages upon cellular uptake by stimulating the production of GM-CSF (granulocytemacrophage colony-stimulating factor, a cytokine that slows down the induced apoptosis of macrophages) and TNF- (tumour necrotic factor an inflammatory cytokine that can block the apoptosis of macrophages)323, whereas TNFresents the contrary effect (stimulating apoptosis) in polimorphonuclear granulocytes such as neutrophils324. On the other hand, it has to be mentioned that Leishmania seems to use different pathways to induce apoptosis of PAM and in the case of neutrophils, L. major promastigotes have been reported to inhibit the apoptosis of neutrophils by blocking the caspase 3 pathway325. As usually occurs with infections, when Leishmania parasites enters in the phagocytes of the host, dendritic cells (DCs) emerge to initiate and regulate the adaptive immune response toward the Leishmania infection. DCs play a key role in the modulation of the adaptive immunity in leishmaniasis and influence the ability of the host T cells to produce IFN326. IFNsential cytokine that promotes the production of nitric oxide (NO) and reactive oxygen species (ROS), leading to the activation of macrophages, which turn able to kill the intracellular Leishmania parasites327. For instance, the treatment with human recombinant IFNome of Leishmania alone328 and (specially) as adjuvant of chemotherapy drugs322. The outcome of Leishmania infection depends to a large extent on the nature of the cytokines secreted by the antigen presenting cells (APCs), mainly DCs but also macrophages (Figure 80). For example, the release of IL-12 (interleukin 12) by APCs stimulates the development of CD4+ Th1 (T helper cells) lymphocytes that primarily produce IFN322 Okwor I, Uzonna JE. Immunotherapy as a strategy for treatment of leishmaniasis: a review of the literature. Immunotherapy. 2009;1(5):765-76. doi: 10.2217/imt.09.40 323 Moore KJ, Matlashewski G. Intracellular infection by Leishmania donovani inhibits macrophage apoptosis. J Immunol. 1994;152(6):2930-7. PMID: 8144893 324 Niwa M, Hara A, Kanamori Y, Hatakeyama D, Saio M, Takami T, Matsuno H, Kozawa O, Uematsu T. Nuclear factor-kappaB activates dual inhibition sites in the regulation of tumor necrosis factor-alphainduced neutrophil apoptosis. Eur J Pharmacol. 2000;407(3):211-9. doi: 10.1016/s0014-2999(00)00735-4 325 Aga E, Katschinski DM, van Zandbergen G, Laufs H, Hansen B, Müller K, Solbach W, Laskay T. Inhibition of the spontaneous apoptosis of neutrophil granulocytes by the intracellular parasite Leishmania major. J Immunol. 2002;169(2):898-905. doi: 10.4049/jimmunol.169.2.898. 326 Tibúrcio R, Nunes S, Nunes I, Rosa Ampuero M, Silva IB, Lima R, Machado Tavares N, Brodskyn C. Molecular Aspects of Dendritic Cell Activation in Leishmaniasis: An Immunobiological View. Front Immunol. 2019;10:227. doi: 10.3389/fimmu.2019.00227 327 Liu D, Uzonna JE. The early interaction of Leishmania with macrophages and dendritic cells and its influence on the host immune response. Front Cell Infect Microbiol. 2012;2:83. doi: 10.3389/fcimb.2012.00083 328 Sundar S, Murray HW. Effect of treatment with interferon-gamma alone in visceral leishmaniasis. J Infect Dis. 1995;172(6):1627-9. doi: 10.1093/infdis/172.6.1627
252 macrophage activation and therefore, to a higher antileishmanial adaptive immune response329. On the contrary, the secretion of IL-4 by APCs enhances the development of CD4+ Th2 cells that produce IL-4 and IL-10 (among other cytokines), leading progressively to complications in the outcome of leishmaniasis330. Figure 80. The effect of secreted cytokines in the outcome of leishmaniasis. Cytokine and monoclonal antibody-based immunotherapy We previously expounded the relevance of the released cytokines in the outcome of leishmaniasis disease. The vast majority of the information regarding the effect of cytokines in leishmaniasis are collected from studies in mice models, which means that their application in humans is still challenging. For instance, the treatment with IL-12 recombinant cytokine and anti-IL-4 monoclonal antibody in the susceptible BALB/c mice model led to the reverse of chronic disease caused by L. major infection, by the stimulation of the IFN331. On the other hand, the use of anti-IL-10 monoclonal antibody in human patients with cutaneous leishmaniasis 329 Mirzaei A, Maleki M, Masoumi E, Maspi N. A historical review of the role of cytokines involved in leishmaniasis. Cytokine. 2021;145:155297. doi: 10.1016/j.cyto.2020.155297 330 Mattner F, Alber G, Magram J, Kopf M. The role of IL-12 and IL-4 in Leishmania major infection. Chem Immunol. 1997;68:86-109. doi: 10.1159/000058696 331 Uzonna JE, Bretscher PA. major infection in BALB/c mice. Eur. J. Immunol. 2001;31:3175-3184. doi: 10.1002/1521-4141(200111)31:11<3175::AID-IMMU3175>3.0.CO;2-L
253 caused by L. braziliensis induced a remarkable decrease in the levels of IL-4, IL-10 and TNFcytokines associated with complications in the outcome of the disease332. Likewise, the combination of chemotherapeutic drugs with cytokines has been explored as an alternative to the use of cytokines alone. Cytokines present a short half-life329 and some difficulties to adjust the dose, but exhibit a therapeutic potential and are further investigated as adjuvants of drugs currently used in clinics. Accordingly, the effect of human recombinant GMCSF (hr-GM-CSF) used in combination with pentavalent antimonial drugs was investigated for the treatment of acute leishmaniasis caused by L.donovani and L. major in human neutropenic patients, reporting a rapid recovery of the neutropenia and a complete resolution of the infection within 3 months333. In like manner, hr-GM-CSF also showed a synergic effect when using in combination with liposomal amphotericin B to treat visceral leishmaniasis/HIV coinfection, leading to the restore of the immune response of the patient (leukocytopenia was reverted and a higher macrophage activation rate was observed)334. Vaccine-based immunotherapy Many efforts have been focused in order to afford effective, stable and affordable vaccines to induce a long-term immunization towards Leishmania infections, specially to protect from VL. Nonetheless, up to now, antileishmanial vaccines have not been reached to the approval for their clinical use. Investigations to develop vaccines against Leishmania were initiated by using killed or inactivated Leishmania parasites (the so-called first generation vaccines), alone or with adjuvants. In this regard, vaccines containing killed Leismania promastigotes alone335 or in combination with BCG336 (Bacillus Calmette Guérin) as an adjuvant were found to improve the evolution of the disease. Moreover, the employment of pasteurized Leishmania promastigotes along with BCG also reported an improvement in the recovery rate of patients with severe 332 Castellano LR, Argiro L, Dessein H, Dessein A, da Silva MV, Correia D, Rodrigues V. Potential Use of Interleukin-10 Blockade as a Therapeutic Strategy in Human Cutaneous Leishmaniasis. J Immunol Res. 2015;2015:152741. doi: 10.1155/2015/152741 333 Al-Zamel F, Al-Shammary FJ, El-Shewemi S, Soliman R. Enhancement of leishmanicidal activity of human macrophages against Leishmania major and Leishmania donovani infection using recombinant human granulocyte macrophage colony stimulating factor. Zentralbl Bakteriol. 1996;285(1):92-105 334 Mastroianni A. Liposomal amphotericin B and rHuGM-CSF for treatment of visceral leishmaniasis in AIDS. Infez Med. 2004;12(3):197-204 335 Mayrink W, Magalhaes PA, Michalick MS, da Costa CA, Lima Ade O, Melo MN, Toledo VP, Nascimento E, Dias M, Genaro O, et al. Immunotherapy as a treatment of American cutaneous leishmaniasis: preliminary studies in Brazil. Parassitologia. 1992;34(1-3):159-65 336 Genaro O, de Toledo VP, da Costa CA, Hermeto MV, Afonso LC, Mayrink W. Vaccine for prophylaxis and immunotherapy, Brazil. Clin Dermatol. 1996;14(5):503-12. doi: 10.1016/0738-081x(96)00040-5
254 leishmaniasis337. In like manner, the combination of chemotherapy (sodium stibogluconate) with a first generation vaccine (autoclaved L. major + BCG) elucidated an improved cure-rate in VL patients in comparison with the chemotherapeutic treatment alone338, which suggests a beneficial effect of the vaccine in patients sensitive to chemotherapeutic drugs. In order to solve the standardization difficulties of the first generation vaccines, a second generation was developed based on purified (or recombinant) Leishmania fractions/protein subunits and DCs. Among investigated Leishmania subunits, A2 amastigote antigen, FML (fucose-mannose ligand), L-Ag (L. donovani membrane antigen) and HSP-70/HSP-83 (heat shock proteins) have been reported to induce Th1 cell-based immunity that favours the outcome of leishmaniasis in animal models339. Furthermore, the polyprotein-based vaccine LEISH-F1 (a L. major derived three recombinant antigen mixture named as 111-f) formulated with MPL-SE (monophosphoryl lipid Ain stable emulsion) is reported as the first defined vaccine for leishmaniasis and reached to phase I and phase II clinical trials. LEISH-F1/MPL-SE vaccine presented a safe profile but further studies have to be made in order to prove its efficacy to prevent VL340. More recently, the disclosure of a third generation vaccines based on DNA (namely DNA vaccines), allowed the development of more stable and highly immunogenic vaccines. DNA vaccines are based on plasmids containing specific Leishmania antigens that are transfected to the cells of the host. Thereby, the host cell transcribes the transfected genes and translates the corresponding mRNA to express the encoded protein (i.e. the specific Leishmania antigens), which induces a T-cell based immune response341. For instance, a vaccine based on bifunctional HbR-encoding DNA (HbR: haemoglobin receptor, an essential receptor for the viability of Leishmania cells by acting on the haemoglobin metabolism of the parasites) that induced a 337 Convit J, Ulrich M, Polegre MA, Avila A, Rodríguez N, Mazzedo MI, Blanco B. Therapy of Venezuelan patients with severe mucocutaneous or early lesions of diffuse cutaneous leishmaniasis with a vaccine containing pasteurized Leishmania promastigotes and bacillus Calmette-Guerin: preliminary report. Mem Inst Oswaldo Cruz. 2004;99(1):57-62. doi: 10.1590/s0074-02762004000100010 338 Musa AM, Khalil EA, Mahgoub FA, Elgawi SH, Modabber F, Elkadaru AE, Aboud MH, Noazin S, Ghalib HW, El-Hassan AM; Leishmaniasis Research Group/Sudan. Immunochemotherapy of persistent post-kalaazar dermal leishmaniasis: a novel approach to treatment. Trans R Soc Trop Med Hyg. 2008;102(1):58-63. doi: 10.1016/j.trstmh.2007.08.006 339 Das A, Ali N. Vaccine Development Against Leishmania donovani. Front Immunol. 2012;3:99. doi: 10.3389/fimmu.2012.00099 340 Chakravarty J, Kumar S, Trivedi S, Rai VK, Singh A, Ashman JA, Laughlin EM, Coler RN, Kahn SJ, Beckmann AM, Cowgill KD, Reed SG, Sundar S, Piazza FM. A clinical trial to evaluate the safety and immunogenicity of the LEISH-F1+MPL-SE vaccine for use in the prevention of visceral leishmaniasis. Vaccine. 2011;29(19):3531-7. doi: 10.1016/j.vaccine.2011.02.096 341 Kumar A, Samant M. DNA vaccine against visceral leishmaniasis: a promising approach for prevention and control. Parasite Immunol. 2016;38(5):273-81. doi: 10.1111/pim.12315
255 complete protection on BALB/c mice model against VL caused by L. donovani. The immune response was found to be related with the upregulation of IL-12, TNF- - accompanied by a decrease in the secretion of IL-4 and IL-10 cytokines342. In like manner, a DNAbased vaccine containing UBQ-ORFF (ubiquitin conjugation of open reading frame F) was found to develop a protective effect in BALB/c mice model against L. donovani induced VL via upregulation of IL-12 and IFN- -4 and IL-10 cytokines343. Finally, it has to be mentioned that genetically modified live attenuated vaccines are also under preclinical development. Accordingly, leishmanization with LmCen (centrin gene deleted L. major) strain in preclinical animal models has recently been found to induce an inflammatory immune response and provide protection against both L. major and L.donovani infections344. IV-1.3.3. Miscellaneous treatments of leishmaniasis Besides chemotherapy and immunotherapy, there are some other experimental approaches to treat leishmaniasis as auxiliary therapies or under preclinical development (Figure 81). For instance, physical modalities as cryotherapy/thermotherapy and application of CO2 laser imply a direct method to apply cold/heat in the affected skin area in CL345, in an attempt to kill the parasites in the open wounds. Furthermore, surgery is necessary in the most severe intraabdominal injuries and in some disfiguring local wounds296. Likewise, drug repurposing emerged as a rational strategy to identify new antileishmanial drug candidates from existing clinical/preclinical drugs for other purposes, which have been widely studied and usually offer a safe pharmacokinetic profile. In this regard, the azole antifungal drugs 342 Guha R, Gupta D, Rastogi R, et al. Vaccination with leishmania hemoglobin receptor-encoding DNA protects against visceral leishmaniasis. Sci Transl Med. 2013;5(202):202ra121. doi:10.1126/scitranslmed.3006406 343 Sharma A, Madhubala R. Ubiquitin conjugation of open reading frame F DNA vaccine leads to enhanced cell-mediated immune response and induces protection against both antimony-susceptible and -resistant strains of Leishmania donovani. J Immunol. 2009;183(12):7719-7731. doi:10.4049/jimmunol.0900132 344 Karmakar S, Ismail N, Oliveira F, Oristian J, Zhang WW, Kaviraj S, Singh KP, Mondal A, Das S, Pandey K, Bhattacharya P, Volpedo G, Gannavaram S, Satoskar M, Satoskar S, Sastry RM, Oljuskin T, Sepahpour T, Meneses C, Hamano S, Das P, Matlashewski G, Singh S, Kamhawi S, Dey R, Valenzuela JG, Satoskar A, Nakhasi HL. Preclinical validation of a live attenuated dermotropic Leishmania vaccine against vector transmitted fatal visceral leishmaniasis. Commun Biol. 2021;4(1):929. doi: 10.1038/s42003-021-02446-x 345 a) Wolf Nassif P, DE Mello TFP, Navasconi TR, et al. Safety and efficacy of current alternatives in the topical treatment of cutaneous leishmaniasis: a systematic review. Parasitology. 2017;144(8):995-1004. doi:10.1017/S0031182017000385. b) Valencia BM, Miller D, Witzig RS, Boggild AK, Llanos-Cuentas A. Novel low-cost thermotherapy for cutaneous leishmaniasis in Peru. PLoS Negl Trop Dis. 2013;7(5):e2196. doi:10.1371/journal.pntd.0002196
256 (fluconazole346 and itraconazole347) evidenced a promising antileishmanial potential in CL patients and clarithromycin macrolide antibiotic presented a leishmanicidal effect toward L. donovani parasites in vitro348. Furthermore, Tamoxifen, an estrogen receptor modulator for the treatment of breast cancer, reported an in vitro antileishmanial effect by affecting the sphingolipid metabolism in Leishmania cells and presents promising results in preclinical assays with animal models and in a pilot clinical trial with human patients349. Figure 81. Summary of experimental and clinical therapies for the treatment of leishmaniasis. IV-1.4. LTOP1B as a druggable target in antileishmanial drug discovery TOP1B is present in all trypanosomatids and results essential for their cell viability. Trypanosomal TOP1B differs from other eukaryotic analogues on its oligomeric nature, which results a curious particularity in a highly conserved enzyme family. The genes encoding each monomer are located in different chromosomes and upon gene expression, both protomers 346 Sousa AQ, Frutuoso MS, Moraes EA, Pearson RD, Pompeu MM. High-dose oral fluconazole therapy effective for cutaneous leishmaniasis due to Leishmania (Vianna) braziliensis. Clin Infect Dis. 2011;53(7):693-695. doi:10.1093/cid/cir496 347 Calvopina M, Guevara AG, Armijos RX, Hashiguchi Y, Davidson RN, Cooper PJ. Itraconazole in the treatment of New World mucocutaneous leishmaniasis. Int J Dermatol. 2004;43(9):659-663. doi:10.1111/j.1365-4632.2004.02183.x 348 Roy K, Das S, Mondal S, Roy AK, Bera T. The in Vitro effect of clarithromycin on amastigote of Leishmania Donovani. Int J Drug Dev Res. 2013;5(3):425 431 349 Zewdie KA, Hailu HG, Ayza MA, Tesfaye BA. Antileishmanial Activity of Tamoxifen by Targeting Sphingolipid Metabolism: A Review. Clin Pharmacol. 2022;14:11-17. doi:10.2147/ CPAA.S344268
257 need to be assembled in order to get the active form of the enzyme350. Accordingly, the large subunit (composed of 636 amino acids with a molecular mass of ~73 kDa in L. donovani) contains the core domain, while the small subunit (composed of 262 amino acids with a molecular mass ~28 kDa in L. donovani) encloses the C terminal domain bearing the phylogenetically conserved SKxxY motif that harbors the catalytic Tyr residue (located in position 222 in the case of LTOP1B)351. The schematic representation of LTOP1B domain organization from L. donovani is illustrated in the Figure 82, along with the human isoform (hTOP1B). Figure 82. Schematic overview of the domain organization of human hTOP1B (monomeric) and L.donovani LTOP1B (heterodimeric, small and large subunits). LTOP1B, as a member of eukaryotic TOP1B subfamily, relaxes both positive and negative DNA by introducing transient single-stranded breaks in dsDNA that allows strand rotation (as expounded in the introduction, vide supra). Thereby, LTOP1B generates transient TOP1CCs in an ATP-independent manner by covalently binding to t permit strand passage and then, religates the scission. Leishmanial topoisomerase IB (LTOP1B) inhibitors as drug candidates for leishmaniasis LTOP1B shares the catalytic mechanism with the other eukaryotic TOP1B isoforms as the SKxxY motif is maintained, including the catalytic Tyr residue. Conversely, there coexist clear 350 Balaña-Fouce R, Alvarez-Velilla R, Fernández-Prada C, García-Estrada C, Reguera RM. Trypanosomatids topoisomerase re-visited. New structural findings and role in drug discovery. Int J Parasitol Drugs Drug Resist. 2014;4(3):326-37. doi: 10.1016/j.ijpddr.2014.07.006 351 Villa H, Otero Marcos AR, Reguera RM, Balaña-Fouce R, García-Estrada C, Pérez-Pertejo Y, Tekwani BL, Myler PJ, Stuart KD, Bjornsti MA, Ordóñez D. A novel active DNA topoisomerase I in Leishmania donovani. J Biol Chem. 2003;278(6):3521-6. doi: 10.1074/jbc.M203991200
264 Table 23. Antileishmanial activity of 1,2,3,4-tetrahydroquinolin-8-yl phosphine oxides 6and quinolin-8-yl phosphine oxides 7. Entry Compound EC 50 ( µ M) L. infantum a GI 50 ( µ M) b SIc promastigotes amastigotes splenocytes Nº R 1 R 2 ( Leishmania ) ( Leishmania ) (murine) 1 AmB - - 0.77 ± 0.15 0.32 ± 0.05 20 62.50 2 6a 2 - MeO - C 6 H 4 H 9.29 ± 2.25 0.98 ± 0.73 34.23 ± 1.78 34.93 3 6g 4 - F - C 6 H 4 4 - Me 7.10 ± 0.81 1.85 ± 1.09 13.82 ± 0.39 7.47 4 6i 3,4 - F 2 - C 6 H 3 4 - F 6.15 ± 1.24 1.46 ± 0.16 63.70 ± 1.88 43.63 5 7d 2 - naphthyl H 4.91 ± 0.38 4.14 ± 1.64 57.11 ± 6.60 13.79 6 7i 3,4 - F 2 - C 6 H 3 4 - F 2.23 ± 0.25 2.15 ± 1.23 23.95 ± 1.36 11.14 7 7j C 6 H 5 4 - F 6.01 ± 0.80 1.39 ± 1.08 71.03 ± 2.11 51.10 a,b The cytotoxicity EC50/GI50 values collected in the present table were calculated by cell viability assays and are defined as the concentrations corresponding to a 50% cell growth inhibition. The EC50/ GI50 results are shown as the mean ± the standard deviation from independent cell viability assay experiments performed in quadruplicate. c The SI was calculated as the ratio between GI50 splenocytes/ EC50 promastigotes. Overall, all of the studied (tetrahydro)quinolin-8-yl phosphine oxide derivatives 6 and 7 reported a notable antileishmanial effect toward L.infantum promastigotes and amastigotes in the single digit micromolar range, with EC50 values ranging between 2.23-9.29 µM in free living promastigotes in vitro and between 0.98-4.14 µM toward intramacrophage amastigotes ex vivo. The antileishmanial activity of the studied compounds 6/7 was slightly minor but comparable to the reference drug amphotericin B (Table 23, entry 1), which reported EC50 values of 0.77 ± 0.15 µM in free living promastigotes and 0.32 ± 0.05 µM toward intracellular amastigotes. However, AmB presented an elevated SI of 62.50 and only the compounds 6i (R1 = 3,4-F2-C6H3; R2 = 4-F; entry 4) and 7j (R1 = C6H5; R2 = 4-F; entry 7) were close in terms of selective cytotoxicity toward L. infantum parasites. In fact, the (tetrahydro)quinolin-8-yl phosphine oxide derivatives 6i and 7j reported the best antileishmanial activity of the current study due to the selective antileishmanial effect. Inhibition of L. infantum LTOP1B Once concluded the evaluation of antileishmanial activity with compounds 6/7, the L. infantum LTOP1B inhibitory activity of (2-(3,4-difluorophenyl)-4-(4-fluorophenyl)quinolin-8yl)diphenylphosphine oxide 7i was then evaluated. The quinolin-8-yl derivative 7i was previously found as a suppressor-like hTOP1B (human isoform) inhibitor with a quite strong potency at
265 short reaction times (up to 1 min) in DNA relaxation assays (see Figure 38 and Table 11, entry 8; in Chapter II, vide supra). In view of the former results, the compound 7i was tested in the previously expounded DNA relaxation assay with LTOP1B of L. infantum and human hTOP1B in order to investigate whether the inhibitory activity is maintained in the leishmanial heterodimeric isoform or not, and hence, to further compare the potential inhibitory activities in both eukaryotic TOP1B enzymes. Accordingly, in vitro DNA relaxation assays were performed as previously explained with the negatively supercoiled pBluescript-SK DNA (pSK DNA) plasmid. The enzymatic reactions were incubated at 26oC (LTOP1B)/ 37oC (hTOP1B) in the presence of 100 µM of compound 7i and aliquots were stopped at 2 min, 4 min, 8 min and 16 min reaction times with 1% sarkosyl (final concentration). Moreover, endpoint DNA relaxation assays were made for a fixed time period of 5 min with increasing compound concentrations (in triplicate) in order to calculate IC50 values for the inhibition of TOP1B239. IC50 was referred as the 50% of the effective concentration to effectively inhibit the TOP1B relaxation activity. The results obtained in the present DNA relaxation assays are collected in the Table 24. Table 24. LTOP1B and hTOP1B inhibitory activity of quinolin-8-yl phosphine oxide derivative 7i. Entry Compoun d % Inhibition LTOP1B a IC50 LTOP1B (µM) IC50 hTOP1B (µM) Nº 2 min 4 min 8 min 16 min 1 7i +++ +++ +++ - 48.11 ± 0.33 69.65 ± 1.29 aThe activity of the compound inhibiting LTOP1B relaxation at 1O0 µM was expressed semiquantitatively by comparison with the maximum inhibitory activity observed for CPT at 100 µM as follows: -, no activity; +, weaker activity than CPT; ++ similar activity to CPT; +++ stronger activity than CPT Attending to the Table 24, the compound 7i was found to inhibit LTOP1B in a higher rate than CPT and the inhibitory activity was maintained up to 8 min of incubation. Moreover, the quinolyn-8-yl phosphine oxide 7i presented IC50 value of 48.11 ± 0.33 µM on LTOP1B and a IC50 value of 69.65 ± 1.29 µM on hTOP1B. In view of the collected results, we may conclude that the
266 compound 7i maintained the TOP1B inhibitory activity previously presented toward the human isoform in the L. infantum LTOP1B. Finally, it has to me mentioned that the IC50 values obtained in both eukaryotic enzymes resulted to be quite similar, even though it was a bit higher in the case of hTOP1B enzyme. IV-2.2. Antileishmanial effect of dialkyl quinolinyl phosphonates In the present section is shown the screening of dialkyl quinolin-8-yl phosphonates 13 and diethyl quinolin-6-yl phosphonates 16 (Figure 89) as antileishmanial drug candidates. Figure 89. General structures of dialkyl quinolin-8-yl phosphonates 12 and diethyl quinolin-6-yl phospjonates 15. In vitro antileismanial activity in L. infantum parasites (amastigotes and promastigotes) In first place, the antileishmanial effect of dialkyl quinolin-8-ylphosphonates 13 and diethyl quinolin-6-ylphosphonates 16 was evaluated against L. infantum promastigotes and amastigotes. The optimized experiment conditions used in the section IV-2.1. of this addenda were followed (vide supra). Accordingly, the antileishmanial effect of dialkyl quinolinylphosphonate derivatives 13 and 16 was assessed in L. infantum-iRFP promastigotes in vitro, L. infantum-iRFP intramacrophage amastigotes (from an ex vivo murine splenic explant culture) and murine splenocytes (an ex vivo splenic explant culture). The cell viability of viable L. infantum promastigotes and amastigotes was measured by the detection of near-infrared radiation ( compounds (three independent experiments per compound) in different concentrations. The obtained Leishmania-cell viability was plotted in dose-response curves and therefore EC50 values were calculated with Sigma-Plot 10.0 software. On the other hand, the cell viability of ex vivo murine splenocytes was measured by using the Alamar Blue viability assay upon 96 h of incubation with the tested compounds at different
267 concentrations (experiments were performed in triplicate). The resulting cell viability was plotted in dose-response curves and GI50 values were further calculated by using Sigma-Plot 10.0 statistical package. Finally, the SI was calculated as the relationship between EC50 of ex vivo intramacrophage amastigotes and GI50 of ex vivo splenocytes. The results involving EC50 in amastigotes, EC50 in promastigotes, GI50 in splenocytes and SI are collected in the Table 25.
268 Table 25. Antileishmanial activity of dialkyl quinolin-8-ylphosphonates 13 and diethyl quinolin6-ylphosphonates 16. Entry Compound EC 50 ( µ M) L. infantum GI 50 ( µ M) SI promastigot es amastigotes splenocytes Nº R R 1 R 2 ( Leishmania ) ( Leishmania ) (murine) 1 AmB - - - 0.77 ± 0.15 0.32 ± 0.05 20 62.50 2 13a Et C 6 H 5 H 0.91 ± 0.04 4.03 ± 0.30 3.61 ± 0.45 0.90 3 13b Et 2 - MeO - C 6 H 4 H 11.37 ± 0.62 19.46 ± 2.38 30.09 ± 6.05 1.55 4 13d Et 4 - MeO - C 6 H 4 H 9.46 ± 1.67 8.23 ± 1.70 15.90 ± 1.65 1.93 5 13f Et 1 - naphthyl H 20. 55 ± 2.19 19.66 ± 2.39 12.22 ± 1.49 0.62 6 13g Et 2 - naphthyl H 20.38 ± 1.57 20.44 ± 5.62 51.62 ± 1.52 2.53 7 13j Et 4 - F - C 6 H 4 4 - Me 7.29 ± 0.94 9.80 ± 0.48 14.54 ± 1.56 1.48 8 13k Et 3,4 - F 2 - C 6 H 3 4 - Me 2.59 ± 0.48 26.23 ± 3.65 24.07 ± 7.79 0.92 9 13l Et C 6 H 5 4 - F 16.05 ± 1.94 11.89 ± 5.17 33.86 ± 7.98 2.85 10 13 m Et 4 - F - C 6 H 4 4 - F 8.43 ± 0.92 24.17 ± 2.37 20.26 ± 7.49 0.84 11 13n Et 3,4-F2-C6H3 4-F 6.35 ± 0.16 13.43 ± 5.53 20.64 ± 3.11 1.54 12 13o iPr 4-F-C6H4 H 9.57 ± 0.40 19.47 ± 2.23 22.10 ± 4.70 1.13 13 13p iPr 3,4-F2-C6H3 H 11.18 ± 0.74 10.20 ± 1.34 19.79 ± 3.76 1.94 14 13q iPr 4-F-C6H4 4-Me 5.01 ± 0.35 24.32 ± 2.53 21.23 ± 3.50 0.87 15 13r iPr 3,4-F2-C6H3 4-Me 7.46 ± 0.76 13.91 ± 3.65 28.33 ± 9.16 2.04 16 13s iPr 4-F-C6H4 4-F 4.86 ± 0.50 5.52 ± 1.11 15.29 ± 1.72 2.77 17 13t iPr 3,4-F2-C6H3 4-F 19.26 ± 1.79 19.65 ± 1.73 18.60 ± 1.10 0.94 18 16a Et 4-F-C6H4 H 15.22 ± 1.14 29.23 ± 14.00 28.07 ± 1.23 0.96 19 16b Et 3,4 - F 2 - C 6 H 3 H 14.72 ± 1.78 14.20 ± 2.83 26.23 ± 0.51 1.85 20 16c Et 4-F-C6H4 4-Me 7.02 ± 0.94 17.56 ± 7.81 11.18 ± 4.42 0.64 21 16d Et 3,4-F2-C6H3 4-Me 21.29 ± 2.34 32.95 ± 6.55 32.33 ± 3.36 0.98 22 16e Et 4-F-C6H4 4-F 16.73 ± 0.72 31.46 ± 2.71 44.97 ± 10.24 1.43 23 16f Et 3,4-F2-C6H3 4-F 7.07 ± 0.61 26.36 ± 2.33 100 3.79 a,b The cytotoxicity EC50/GI50 values collected in the present table were calculated by cell viability assays and are defined as the concentrations corresponding to a 50% cell growth inhibition. The EC50/ GI50 results are shown as the mean ± the standard deviation from independent cell viability assay experiments performed in quadruplicate. c The SI was calculated as the ratio between GI50 splenocytes/ EC50 promastigotes. As it can be observed in the Table 25, all the tested compounds 13/16 were found to be active in both promastigote and amastigote forms of L. infantum-iRFP strain, presenting EC50 values ranging from 0.91 ± 0.04 µM (compound 13a, R = Et; R1 = C6H5; R2 = H; Table 25, entry 2) to 21.29 ± 2.34 µM (compound 16d, R= Et; R1 = 4-F-C6H4; R2 = 4-Me; entry 21) in free living promastigotes in vitro and from 4.03 ± 0.30 µM (compound 13a, R = Et; R1 = C6H5; R2 = H; entry 2) to 26.36 ± 2.33 µM (compound 16a, R = Et; R1 = 4-F-C6H4; R2 = H; entry 18) toward ex vivo intramacrophage
269 amastigotes. However, the SI was generally low (below 2.85 in all the quantifiable cases) for all the studied dialkyl quinolinyl phosphonates 13/16, which indicates a high toxicity toward the host cells except for the compound 16f (R = Et; R1 = 3,4-F2-C6H3; R2 = 4-F; entry 23) that reported a GI50 value higher than 100 µM in murine splenocytes and therefore presents a much better selectivity toward the infective agent. Inhibition of L. infantum LTOP1B The LTOP1B inhibitory activity of dialkyl quinolinyl phosphonate derivatives 13 and 16 was evaluated by DNA relaxation assays performed with pSK DNA plasmid and L. infantum LTOP1B. Endpoint DNA relaxation assays were carried out by incubating the enzymatic reactions at 26oC in the presence of the tested compounds (100 µM) and stopping them after a reaction time of 5 min with 1% of sarkosyl (final concentration). The inhibitory activity of the tested compounds was expressed as the percentage of LTOP1B inhibition (0-100%), which was determined by measuring the band corresponding to the supercoiled pSK plasmid363. The obtained results are listed in the Table 26. 363 Selas A, Fuertes M, Melcón-Fernández E, et al. Hybrid Quinolinyl Phosphonates as Heterocyclic Carboxylate Isosteres: Synthesis and Biological Evaluation against Topoisomerase 1B (TOP1B). Pharmaceuticals (Basel). 2021;14(8):784. doi:10.3390/ph14080784
270 Table 26. LTOP1B inhibitory activity of dialkyl quinolin-8-ylphosphonates 13 and diethyl quinolin-6-ylphosphonates 16. Entry Compound LTOP1B inhibitiona Nº R R 1 R 2 1 13a Et C 6 H 5 H 58.87 2 13b Et 2 -MeO - C 6 H 4 H 46.41 3 13d Et 4 -MeO - C 6 H 4 H 45.45 4 13f Et 1 - naphthyl H 7.50 5 13g Et 2 - naphthyl H 18.36 6 13j Et 4 - F - C 6 H 4 4 - Me 41.21 7 13k Et 3,4 - F 2 - C 6 H 3 4 - Me 77.02 8 13l Et C 6 H 5 4 - F 16.49 9 13 m Et 4 - F - C 6 H 4 4 - F 22.44 10 13n Et 3,4 - F 2 - C 6 H 3 4 - F 54.01 11 13o i Pr 4 - F - C 6 H 4 H 3.55 12 13p i Pr 3,4-F2-C6H3 H 5.41 13 13q iPr 4-F-C6H4 4-Me 41.62 14 13r iPr 3,4-F2-C6H3 4-Me 52.65 15 13s iPr 4-F-C6H4 4-F 43.31 16 13t iPr 3,4-F2-C6H3 4-F 73.27 17 16a Et 4-F-C6H4 H 1.94 18 16b Et 3,4-F2-C6H3 H 14.56 19 16c Et 4-F-C6H4 4-Me 43.25 20 16d Et 3,4-F2-C6H3 4-Me 43.84 21 16e Et 4 - F - C 6 H 4 4 - F 37.86 22 16f Et 3,4-F2-C6H3 4-F 50.24 a The LTOP1B inhibitory activity is shown as the percentage of TOP1 inhibition (0-100%) As it can be observed in Table 26, at 100 µM and a reaction time of 5 min the majority of the compounds were found to inhibit LTOP1B from L. infantum in vitro in overall moderate to good inhibition rates. In particular, the dialkyl quinolin-8-ylphosphonate derivatives 13k (R = Et; R1 = 3,4-F2-C6H3; R2 = 4-Me; Table 26, entry 7) and 13t (R = iPr; R1 = 3,4-F2-C6H3; R2 = 4-F, entry 16) reported the best LTOP1B inhibitory rates (77.02% and 73.27% respectively) upon 5 min of enzymatic reaction. The compound 13k previously presented a strong TOP1 inhibitory activity against the human hTOP1B isoform (see the Table 12 of the Chapter II, entry 11; vide supra) at very short enzymatic reaction times (15 sec) and a moderate inhibition at 1-3 min time frame, so it seems slightly more active toward the L. infantum LTOP1B isoform. On the other hand, the
271 quinolin-8-yl derivative 13t had previously reported a moderate hTOP1B activity up to 3 min at 160 µM (see the Table 12, Chapter II, entry 20; vide supra), whereas demonstrated a stronger inhibitory effect toward the LTOP1B of L. infantum at 100 µM. On balance, in light of the obtained results we may conclude that the tested dialkyl quinolinylphosphonates 13/16 reported overall moderate to high LTOP1B inhibition in vitro at 100 µM. Likewise, compounds 13/16 demonstrated a promising antileishmanial effect in L. infantum promastigotes (in vitro) and amastigotes (ex vivo) in the micromolar range, even though the selectivity toward the infective agent in the BALB/c mice model was on the whole low, resulting in elevated toxicities against the host cells. Finally, the absence of a clear relationship between the LTOP1 inhibitory activity and the EC50 values in L. infantum promastigotes/amastigotes suggests that other targets may be involved in the antileishmanial response of the compounds subject to study.
272 V. Conclusions
273 Conclusions: I-1. The versatility of the Povarov reaction allowed us the preparation of diverse libraries of compounds based on hybrids of 2,4-disubstituted quinoline derivatives and phosphine oxide or dialkyl phosphonate moieties in positions 6 and 8 of the quinoline core. In this regard, the adaptability of the Povarov reaction by using styrenes/acetylenes as dienophiles facilitated the optimization of step-by-step/MCR one-pot methodologies to straightforwardly obtain 1,2,3,4.tetrahydroquinolines and fully aromatic and quinolines. I-2. Futhermore, the range-expansion of the olefinic component, from styrenes to their cyclic analogue indene, allowed us to jump from a combinatorial chemistry strategy (i.e. exploring hybrids of phosphorated 1,2,3,4-tetrahydroquinolines/quinolines) to a diversity oriented chemistry, obtaining scaffolds of quinolines fused with indene with a higher structural complexity and a similar substitution pattern. I-3. In summary, the applicability of the Povarov reaction to a wide range of dienophiles opened the door to a higher structural diversity in quinoline/indenoquinoline-based scaffolds, permitted the molecular hybridization between the pentavalent phosphorus-containing moieties (diphenyl phosphine oxide and dialkyl phosphonates) in the quinoline core and enabled the functionalization of the quinoline-derived frameworks with a broad variety of substituents. II-1. The biological screening of the novel hybrid phosphorated quinoline derivatives as TOP1 inhibitors allowed to identify those ones with the ability to inhibit the enzyme at 160 µM (as reversible TOP1 inhibitors). Further mechanistic studies (nicking assays and cleavage/religation equilibrium experiment) revealed that the studied phosphorated quinolines act as suppressorlike TOP1 inhibitors, as they do not induce the accumulation of TOP1-dependant nicked plasmid in the nicking assay and no accumulation of TOP1CC products was observed in the cleavage/religation equilibrium experiment. II-2. Furthermore, we participated in the development of the REEAD assay applied to the in vitro drug screening of novel TOP1 inhibitors in early stages of the drug discovery process, with the aim of discriminate among all the drug candidates those small compounds with the ability to inhibit the hTOP1B at pharmacologically relevant concentrations. We achieved to successfully study some of the novel hybrid phosphorated quinoline derivative by the REEAD assay, proving that this novel scrrening methodology provides the TOP1 activity rate in quantitative terms with a high sensitivity, which primarily implies to obtain reliable and precise inhibitory values during the biological evaluation of the tested drug candidates.
280 VI-1.2. Synthesis of quinolinylphosphine oxide derivatives Preparation of (2-aminophenyl)diphenylphosphine oxide 1a (2-nitrophenyl)diphenylphosphine oxide. A solution of ethyl diphenylphosphinite (19.44 mL, 90 mmol, 1.2 equiv.) in 30 mL of dry dimethylformamide (DMF) was added drop by drop during 2.5 h to a stirred -10oC solution of 1,2-dinitrobenzene (12.61 g, 75 mmol, 1 equiv.) in 40 mL of dry acetonitrile (MeCN). Upon addition, the reaction mixture was maintained stirring at room temperature for 12h. The resultant precipitate was filtered off, washed with DMF, dried in vacuo and recrystalized in ethyl acetate (EtOAc) at 4oC, obtaining 20.08 g (62.10 mmol) of (2nitrophenyl)diphenylphosphine oxide as a yellow solid (69%); mp 226-227oC (EtOAc). (2-Aminophenyl)diphenylphosphine oxide (1a): (2-Nitrophenyl)diphenylphosphine oxide (19.40 g, 60 mmol) was hydrogenated with a spoon of RANEY® Nickel (approx. 5 g) in 60 mL of MeOH at 80 psi at room temperature for 12 h. The reaction mixture was then filtered off through a pad of cellite and evaporated to dryness to obtain (2aminophenyl)diphenylphosphine oxide 1a (17.59 g, 59.97 mmol) as a white solid (99%); mp 167168oC (methanol). General procedure for the preparation of aldimines 4 To a solution of (2-aminophenyl)diphenylphosphine oxide 1 (2.93 g, 10 mmol, 1 equiv.) in CHCl3 (25 mL) was added the corresponding aldehyde (10 mmol). The mixture was stirred at CHCl3 reflux until consumption of starting materials was confirmed by 1H NMR, 31P NMR and/or 19F NMR spectroscopy. The yielded aldimines 4 were proved unstable during distillation and/or chromatography conditions, so they were used in situ without further purification for the upcoming reactions. General procedure for the preparation of 1,2,3,4-tetrahydroquinolin-8-yl phosphine oxides 6 A) Step-by step Povarov procedure (route A). Styrenes 3 (12 mmol, 1.2 equiv.) and 2 equivalent of BF3·Et2O (1.23 mL, 10 mmol) were added to a solution of the corresponding in situ prepared aldimine 4 (10 mmol) in CHCl3 (25 mL). The mixture was stirred and heated to CHCl3 reflux until TLC, 31P NMR and 1H NMR spectroscopy analysis indicated the disappearance of the aldimine. The molecular sieves were removed by
281 filtration and the resulting solution was diluted with methylene chloride (20 ml), washed with a solution of NaOH 2M (50 ml), extracted with methylene chloride (2 x 10 mL) and dried over MgSO4. Upon in vacuo solvent evaporation, the resultant reaction crude was further purified by silica gel flash column chromatography on silica gel using a gradient of elution of 5-70% ethyl acetate in hexane to afford 1,2,3,4-tetrahydroquinolin-8-yl phosphine oxides 6. B) MCR Povarov procedure (route B): A mixture of (2-aminophenyl)diphenylphosphanoxide 1a (10 mmol, 1 equiv.), freshly distilled aldehydes 2 (10 mmol, 1 equiv.), styrenes 3 (12 mmol, 1.2 equiv.) and 2 equivalents of BF3·Et2O (2.47 mL, 20 mmol) dissolved in CHCl3 (25 mL) was stirred and heated to reflux in the presence of molecular sieves (4 Å), until TLC, 31P NMR and 1H NMR spectroscopy analysis indicated the consumption of the starting materials. The molecular sieves were removed by filtration and the resulting solution was diluted with methylene chloride (15 ml), washed with a solution of NaOH 2M (50 ml), extracted with methylene chloride (2 x 10 mL) and dried over MgSO4. Upon in vacuo solvent evaporation, the resultant reaction crude was further purified by silica gel flash column chromatography on silica gel using a gradient of elution of 5-70% ethyl acetate in hexane to afford 1,2,3,4-tetrahydroquinolin-8-yl phosphine oxides 6. (2-(2-Methoxyphenyl)-4-phenyl-1,2,3,4-tetrahydroquinolin-8-yl)diphenylphosphine oxide (6a). The general procedure A was followed using o-anisaldehyde (1.21 mL, 10 mmol) and styrene (1.37 mL, 12 mmol). The reaction was heated to CHCl3 reflux for 36 h, affording the compound 6a (4.69 g, 91%) as a white solid. Melting point: 233-235oC (ethyl acetate/hexane). 1H RMN (400 MHz, CDCl3): = 1.80 (ddd, 3JHH = 12.3 Hz, 3JHH = 11.1 Hz, 2JHH = 12.5 Hz, 1 H, CH2), 1.82 (s, NH), 2.36-2.41 (m, 1 H, CH2), 3.68 (s, 3 H, OCH3), 4.23 (dd, 4JHH = 4.3 Hz, 3JHH = 12.3 Hz, 1 H, CH), 5.11 (dd, 4JHH = 4.3 Hz, 3JHH = 12.3.1 Hz, 1 H, CH), 6.25 (ddd 3JHH = 7.6 Hz, 3JHH = 7.4 Hz, 4JHP = 2.9 Hz, 1 H), 6.51-6.75 (m, 5 H), 7.03-7.73 (m, 16 H) ppm.
282 13C RMN (100 MHz, CDCl3): 2), 44.8 (HC), 50.0 (OCH3), 55.4 (HC), 110.2 (HC), 110.9 (d, 1JCP = 105.6 Hz, C), 114.4 (d, 3JCP = 13.8 Hz, HC), 121.0 (HC), 125.8-133.8 (m, 19 HC and 4 C), 144.5 (C), 150.5 (d, 2JCP = 4.6 Hz, C), 156.5 (C) ppm. 31P NMR (120 MHz, CDCl3).3 ppm. HRMS (EI): calculated for C34H30NO2P [M]+ 515.2014; found 515.2022. 4-(8-(diphenylphosphoryl)-4-phenyl-1,2,3,4-tetrahydroquinolin-2-yl)phenyl diethyl phosphate (6b). The general procedure A was followed using diethyl (4-formylphenyl) phosphate (2.58 g, 10 mmol) and styrene (1.37 mL, 12 mmol). The reaction was heated to CHCl3 reflux for 24 h, affording the compound 6b (2.81 g, 44%) as a white solid. Melting point: 66-68oC (ethyl acetate/hexane). 1H RMN (300 MHz, CDCl3): = 1.31-1.36 (m, 6 H, 2 CH3), 1.92-1.99 (m, 1H, CH2), 2.16-2.26 (m, 1H, CH2), 4.17-4.22 (m, 5 H, 1 CH and 2 CH2), 4.70 (dd, 3JHH = 11.2 Hz, 3JHH =2.9 Hz, 1H, HC), 6.337.78 (m, NH and 22 H) ppm. 13C RMN (75 MHz, CDCl3): 16.2 (2 CH3), 41.0 (CH2), 44.7 (HC), 56.2 (HC), 64.7 (2 CH2), 111.0 (d, 1JCP = 106.0 Hz, C), 115.0 (d, 3JCP = 13.8 Hz, HC), 120.0-133.2 (m, 21 HC and 4 C), 140.6 (C), 144.1 (C), 149.8 (d, 2JCP = 5.9 Hz, C) ppm. 31P NMR (120 MHz, CDCl3)-5.3, 36.3 ppm. HRMS (EI): calculated for C37H37NO5P2 [M]+ 637.2147; found 637.2158.
283 (2-(Naphthalen-1-yl)-4-phenyl-1,2,3,4-tetrahydroquinolin-8-yl)diphenylphosphine oxide (6c). The general procedure A was followed using 1-naphthaldehyde (1.36 mL, 10 mmol) and styrene (1.37 mL, 12 mmol). The reaction was heated to CHCl3 reflux for 24 h, affording the compound 6c (3.48 g, 65%) as a white solid. Melting point: 267-269oC (ethyl acetate/hexane). 1H RMN (300 MHz, CDCl3): = 2.11 (ddd, 3JHH = 12.7 Hz, 3JHH = 11.3 Hz, 2JHH = 12.5 Hz, 1 H, CH2), 2.48-2.55 (m, 1 H, CH2), 4.39 (dd, 3JHH = 4.3 Hz, 3JHH = 12.7 Hz, 1 H, CH), 5.56 (dd, 3JHH = 2.7 Hz, 3JHH = 11.3 Hz, 1 H, CH), 6.40 (ddd 3JHH = 7.6 Hz, 3JHH = 7.5 Hz, 4JHP = 3.0 Hz, 1 H), 6.66-6.75 (m, 2 H), 7.16-7.99 (m, NH, 22 H) ppm. 13C RMN (75 MHz, CDCl3): 2), 45.1 (HC), 52.9 (HC), 114.4 (d, 1JCP = 105.5 Hz, C), 114.8 (d, 3JCP = 13.8 Hz, HC), 120.5 (C), 125.5 (HC), 122.8 (HC), 125.4 (HC), 125.9 (HC), 126.1 (HC), 126.3 (d, 3JCP = 7.8 Hz, C), 126.9 (HC), 127.8 (HC), 128.5-129.0 (m, 6 HC), 130.7 (C), 131.8-133.9 (m, 11 HC and 2C), 139.3 (C), 144.3 (C), 150.3 (d, 2JCP = 4.6 Hz, C) ppm. 31P NMR (120 MHz, CDCl3) HRMS (EI): calculated for C37H30NOP [M]+ 535.2065; found 535.2076. (2-(Naphthalen-2-yl)-4-phenyl-1,2,3,4-tetrahydroquinolin-8-yl)diphenylphosphine oxide (6d). The general procedure B was followed using 2-naphthaldehyde (1.36 g, 10 mmol) and styrene (1.37 mL, 12 mmol). The reaction was heated to CHCl3 reflux for 36 h, affording the compound 6d (3.85 g, 72%) as a white solid. Melting point: 245-247oC (ethyl acetate/hexane).
284 1H RMN (400 MHz, CDCl3): = 2.12 (ddd, 3JHH = 12.6 Hz, 3JHH = 11.9 Hz, 2JHH = 12.7 Hz, 1 H, CH2), 2.33-2.39 (m, 1 H, CH2), 4.33 (dd, 3JHH = 4.1 Hz, 3JHH = 12.2 Hz, 1 H, CH), 4.93 (dd, 3JHH = 3.1 Hz, 3JHH = 11.5 Hz, 1 H, CH), 6.42 (ddd 3JHH = 7.6 Hz, 3JHH = 7.6 Hz, 4JHP = 2.9 Hz, 1 H), 6.67-6.75 (m, 2 H), 7.16-7.86 (m, NH, 22 H) ppm. 13C RMN (100 MHz, CDCl3): 2), 44.9 (HC), 56.9 (HC), 111.2 (d, 1JCP = 105.5 Hz, C), 114.8 (d, 3JCP = 13.8 Hz, HC), 124.6 (HC), 124.6 (HC), 125.7 (HC), 125.9 (HC), 126.2 (d, 3JCP = 7.8 Hz, C), 126.8 (HC), 127.6 (HC), 128.0-133.5 (m, 19 HC and 3 C), 141.4 (C), 144.3 (C), 150.2 (d, 2JCP = 4.6 Hz, C) ppm. 31P NMR (120 MHz, CDCl3) HRMS (EI): calculated for C37H30NOP [M]+ 535.2065; found 535.2086. (4-Phenyl-2-(pyridin-2-yl)-1,2,3,4-tetrahydroquinolin-8-yl)diphenylphosphine oxide (6e). The general procedure B was followed using 2-Pyridinecarboxaldehyde (0.95 mL, 10 mmol) and styrene (1.37 mL, 12 mmol). The reaction was heated to CHCl3 reflux for 12 h, affording the compound 6e (3.36 g, 69%) as a yellow solid. Melting point: 110-112oC (ethyl acetate/hexane). 1H RMN (300 MHz, CDCl3): = 1.97 (ddd, 3JHH = 12.5 Hz, 3JHH = 11.4 Hz, 2JHH = 12.5 Hz, 1 H, CH2), 2.45-2.52 (m, 1 H, CH2), 4.27 (dd, 3JHH = 4.6 Hz, 3JHH = 12.5 Hz, 1 H, CH), 4.85 (dd, 3JHH = 3.3 Hz, 3JHH = 11.3 Hz, 1 H, CH), 6.38 (ddd 3JHH = 7.6 Hz, 3JHH = 7.6 Hz, 4JHP = 3.0 Hz, 1 H), 6.63-6.74 (m, 2 H), 6.96 (d, 3JHH = 7.9 Hz, 1 H), 7.17-7.81 (m, NH, 18 H) ppm. 13C RMN (75 MHz, CDCl3): 2), 45.6 (HC), 57.9 (HC), 111.0 (d, 1JCP = 105.6 Hz, C), 115.1 (d, 3JCP = 13.9 Hz, HC), 119.6 (C), 122.2 (HC), 126.2 (d, 3JCP = 7.9 Hz, C), 126.8 (HC), 128.2-132.1 (m, 15 HC and C), 133.3 (d, 1JCP = 104.8 Hz, C), 133.4 (2 HC), 137.2 (HC), 144.3 (C), 148.9 (HC), 149.9 (d, 2JCP = 4.5 Hz, C) ppm. 31P NMR (120 MHz, CDCl3) HRMS (EI): calculated for C32H27N2OP [M]+ 486.1861; found 486.1869.
285 (2-Phenyl-4-(p-tolyl)-1,2,3,4-tetrahydroquinolin-8-yl)diphenylphosphine oxide (6f). The general procedure B was followed using benzaldehyde (1.02 mL, 10 mmol) and 1-methyl-4vinylbenzene (1.58 mL, 12 mmol). The reaction was heated to CHCl3 reflux for 48 h, affording the compound 6f (3.05 g, 61%) as a white solid. Melting point: 223-225oC (ethyl acetate/hexane). 1H RMN (300 MHz, CDCl3): = 1.97-2.25 (m, 2 H, CH2), 2.33 (s, 3 H, CH3), 4.19 (dd, 3JHH = 4.0 Hz, 3JHH = 12.4 Hz, 1 H, CH), 4.71 (dd, 3JHH = 3.4 Hz, 3JHH = 11.4 Hz, 1 H, CH), 6.35 (ddd 3JHH = 7.8 Hz, 3JHH = 7.4 Hz, 4JHP = 2.8 Hz, 1 H), 6.57-6.68 (m, 2 H), 6.99-7.78 (m, NH, 19 H) ppm. 13C RMN (75 MHz, CDCl3): 3), 41.0 (CH2), 44.4 (HC), 57.0 (HC), 111.0 (d, 1JCP = 108.0 Hz, C), 114.8 (d, 3JCP = 11.7 Hz, HC), 126.1-133.6 (m, 21 HC and 3 C), 136.4 (C), 141.2 (C), 143.9 (C), 150.0 (d, 2JCP = 3.6 Hz, C) ppm. 31P NMR (120 MHz, CDCl3) HRMS (EI): calculated for C34H30NOP [M]+ 499.2065; found 499.2077. 2-(4-fluorophenyl)-4-(p-tolyl)-1,2,3,4-tetrahydroquinolin-8-yl)diphenylphosphine oxide (6g). The general procedure B was followed using 4-fluorobenzaldehyde (1.08 mL, 10 mmol) and 1methyl-4-vinylbenzene (1.58 mL, 12 mmol). The reaction was heated to CHCl3 reflux for 36 h, affording the compound 6g (3.67 g, 71%) as a white solid. Melting point: 207-209oC (ethyl acetate/hexane). 1H RMN (300 MHz, CDCl3): = 1.93 (ddd, 3JHH = 12.7 Hz, 3JHH = 11.5 Hz, 2JHH = 12.7 Hz, 1 H, CH2), 2.18 (ddd, 3JHH = 4.7 Hz, 3JHH = 3.4 Hz, 2JHH = 12.7 Hz, 1 H, CH2), 2.34 (s, 3 H, CH3), 4.18 (dd, 3JHH =
286 4.7 Hz, 3JHH = 12.7 Hz, 1 H, CH), 4.69 (dd, 3JHH = 3.4 Hz, 3JHH = 11.5 Hz, 1 H, CH), 6.36 (ddd 3JHH = 10.4 Hz, 3JHH = 7.6 Hz, 4JHP = 3.0 Hz, 1 H), 6.81-7.15 (m, NH and 11 H), 7.44-7.78 (m, 10 H) ppm. 13C RMN (75 MHz, CDCl3): 3), 41.2 (CH2), 44.3 (HC), 56.3 (HC), 111.0 (d, 1JCP = 105.0 Hz, C), 114.9 (d, 3JCP = 13.1 Hz, HC), 115.3 (d, 3JCF = 21.3 Hz, 2 HC), 126.3 (d, 3JCP = 7.5 Hz, C), 127.6129.5 (m, 12 HC), 131.8-133.5 (m, 6 HC and 2 C), 136.5 (C), 139.8 (C), 141.1 (C), 149.0 (C), 162.0 (d, 1JCF = 243.8 Hz, C-F) ppm. 31P NMR (120 MHz, CDCl3) 19F NMR crude reaction mixture (282 MHz, CDCl3)-116.3 to -116.1 ppm. HRMS (EI): calculated for C34H29FNOP [M]+ 517.1971; found 517.1982. 2,4-Bis(4-fluorophenyl)-1,2,3,4-tetrahydroquinolin-8-yl)diphenylphosphine oxide (6h). The general procedure B was followed using 4-fluorobenzaldehyde (1.08 mL, 10 mmol) and 4fluorostyrene (1.44 mL, 12 mmol). The reaction was heated to CHCl3 reflux for 24 h, affording the compound 6h (2.30 g, 44%) as a white solid. Melting point: 183-185oC (ethyl acetate/hexane). 1H RMN (300 MHz, CDCl3): = 1.90 (ddd, 3JHH = 12.4 Hz, 3JHH = 11.3 Hz, 2JHH = 12.7 Hz, 1 H, CH2), 2.14-2.20 (m, 1 H, CH2), 4.22 (dd, 3JHH = 4.3 Hz, 3JHH = 12.4 Hz, 1 H, CH), 4.70 (dd, 3JHH = 3.2 Hz, 3JHH = 11.3 Hz, 1 H, CH), 6.37 (ddd 3JHH = 7.6 Hz, 3JHH = 7.4 Hz, 4JHP = 3.0 Hz, 1 H), 6.62-7.19 (m, NH and 11 H), 7.44-7.78 (m, 9 H) ppm. 13C RMN (75 MHz, CDCl3): 2), 44.0 (HC), 56.2 (HC), 111.3 (d, 1JCP = 105.5 Hz, C), 114.9 (d, 3JCP = 13.8 Hz, HC), 115.4 (d, 3JCF = 21.3 Hz, 2 HC), 115.6 (d, 3JCF = 21.3 Hz, 2 HC), 125.8 (d, 3JCP = 8.0 Hz, C), 127.6-133.6 (m, 16 HC and 2 C), 139.6 (d, 4JCF = 3.1 Hz, C), 139.8 (d, 4JCF = 3.2 Hz, C), 149.9 (d, 2JCP = 4.6 Hz, C), 161.8 (d, 1JCF = 245.0 Hz, C-F) ppm. 31P NMR (120 MHz, CDCl3) 19F NMR crude reaction mixture (282 MHz, CDCl3)-116.5 to -116.4 and -116.0 to -115.8 (m) ppm. HRMS (EI): calculated for C33H26F2NOP [M]+ 521.1720; found 521.1727.
287 2-(3,4-difluorophenyl)-4-(4-fluorophenyl)-1,2,3,4-tetrahydroquinolin-8-yl)diphenylphosphine oxide (6i). The general procedure A was followed using 3,4-difluorobenzaldehyde (1.10 mL, 10 mmol) and 4-fluorostyrene (1.44 mL, 12 mmol). The reaction was heated to CHCl3 reflux for 36 h, affording the compound 6i (2.64 g, 49%) as a white solid. Melting point: 167-169oC (ethyl acetate/hexane). 1H RMN (300 MHz, CDCl3): = 1.72 (s, 1 H, NH), 1.88 (ddd, 3JHH = 11.7 Hz, 3JHH = 11.4 Hz, 2JHH = 11.4 Hz, 1 H, CH2), 2.15-2.20 (m, 1 H, CH2), 4.21 (dd, 3JHH = 4.6 Hz, 3JHH = 11.7 Hz, 1 H, CH), 4.67 (dd, 3JHH = 3.4 Hz, 3JHH = 11.7 Hz, 1 H, CH), 6.40 (ddd 3JHH = 10.4 Hz, 3JHH = 7.5 Hz, 4JHP = 3.0 Hz, 1 H), 6.64-7.14 (m, 9 H), 7.46-7.77 (m, 10 H) ppm. 13C RMN (75 MHz, CDCl3): 2), 43.9 (HC), 55.9 (HC), 111.8 (d, 1JCP = 103.7 Hz, C), 114.9 (d, 2JCF = 17.7 Hz, HC), 115.4 (d, 3JCP = 13.6 Hz, HC), 115.7 (d, 3JCF = 20.2 Hz, 2 HC), 117.3 (d, 2JCF = 17.7 Hz, HC), 121.1 (HC), 125.7 (C), 128.6-133.3 (m, 14 HC and 2 C), 139.6 (C), 141.0 (C), 149.4 (Dd, 1JCF = 246.5 Hz, 2JCF = 12.8 Hz, C-F), 161.8 (d, 1JCF = 243.4 Hz, C-F) ppm. 31P NMR (120 MHz, CDCl3) 19F NMR crude reaction mixture (282 MHz, CDCl3)-116.2 to -116.1, -137.8 to -137.6 and - 115.9 to -115.8 (m) ppm. HRMS (EI): calculated for C33H25F3NOP [M]+ 539.1626; found 539.1636.
288 General procedure for the preparation of quinolin-8-yl phospine oxides 7 A) Oxidation of compounds 6 with DDQ DDQ (0.45 g, 2 mmol, 2 equiv.) was added to a solution of the corresponding 1,2,3,4tetrahydroquinolin-8-yl phosphine oxide 6 (1 mmol, 1 equiv.) in chloroform (5 mL) and the reaction mixture was stirred and heated to reflux until TLC, 31P NMR and 1H NMR spectroscopy analysis indicated the consumption of the 1,2,3,4-tetrahydroquinolin-8-yl phosphine oxide 6 and the subsequent formation of the quinolin-8-yl phospine oxide 7 (2 h). The formed reaction brute was filtered off, dried in vacuo and purified by silica gel flash column chromatography (40% of ethyl acetate in hexane) and a further recrystallization in EtOAc/hexane to yield quinolin-8-yl phosphine oxides 7. B) One-pot Povarov reaction with acetylenes (Route C). The corresponding acetylene 8 (2 mmol, 1 equiv.) and 2 equivalents of BF3·Et2O (0.5 mL, 4 mmol) were added to a solution of the in situ prepared aldimine 4 (2 mmol) in dry CHCl3 and the mixture was stirred at reflux during 2 h. Then, the reaction was allow to reach room temperature and DDQ (0.91 g, 4 mmol, 2 equiv.) was added, to subsequently heat again to reflux for 30 minutes. The reaction mixture was then washed with an aqueous solution of NaOH 2M (25 mL) and water (25 mL), extracted with dichloromethane (2 × 25 mL), and dried over anhydrous MgSO4. Upon the removal of the solvent under vacuum, the resultant crude oil was purified by silica gel flash column chromatography using acetate in hexane to afford quinolin-8-yl phospine oxides 7. (2-(2-Methoxyphenyl)-4-phenylquinolin-8-yl)diphenylphosphine oxide (7a). The general procedure A (oxidation of compounds 6 with DDQ) was employed with 6a (0.52 g, 1 mmol) to afford 7a (0.38 g, 74%) as a white solid. Melting point: 267-269oC (ethyl acetate/hexane).
289 1H RMN (300 MHz, CDCl3): = 3.80 (s, 3 H, OCH3), 6.52 (dd J = 1.6 Hz, J = 7.6 Hz, 1 H), 6.69-6.75 (m, 1 H), 6.94 (d, 3JHH = 8.7 Hz, 1 H), 7.20-7.66 (m, 13 H), 7.89 (dd, 3JHP = 12.5 Hz, 3JHH = 7.0 Hz, 4 H), 7.96 (s, 1 H), 8.12 (d, 3JHH = 9.0 Hz, 1 H), 8.67 (ddd, 3JHP = 13.9 Hz, 3JHH = 7.1 Hz, 4JHH = 1.6 Hz, 1 H) ppm. 13C RMN (75 MHz, CDCl3): 3), 111.3 (HC), 120.9 (HC), 121.0-138.5 (m, 21 HC and 6 C), 147.7 (d, 2JCP = 5.6 Hz, C), 155.5 (C), 157.5 (C) ppm. 31P NMR (120 MHz, CDCl3) HRMS (EI): calculated for C34H26NO2P [M]+ 511.1701; found 511.1719. 4-(8-(diphenylphosphoryl)-4-phenylquinolin-2-yl)phenyl diethyl phosphate (7b). The general procedure A (oxidation of compounds 6 with DDQ) was employed with 6b (0.64 g, 1 mmol) to afford 7b (0.41 g, 65%) as a white solid. Melting point: 128-130oC (ethyl acetate/hexane). 1H RMN (400 MHz, CDCl3): = 1.36-1.41 (m, 6 H, 2 CH3), 4.20-4.30 (m, 4 H, 2 CH2), 7.11-7.15 (m, 2 H), 7.36-7.65 (m, 14 H), 7.75 (s, 1 H), 7.88-7.95 (m, 4 H), 8.15 (d, 3JHH = 8.4 Hz, 1 H), 8.64 (ddd, 3JHP = 13.9 Hz, 3JHH = 7.1 Hz, 4JHH = 1.5 Hz, 1 H) ppm. 13C RMN (75 MHz, CDCl3): 16.3 (2 CH3), 64.9 (2 CH2), 119.1 (HC), 120. (HC), 120.1 (HC), 120.4 (C), 126.0-132.3 (m, 19 HC and 2 C), 134.2 (d, 1JCP = 108.2 Hz, 2 C), 135.5 (C), 138.0 (d, 3JCP = 5.8 Hz, HC), 148.2 (d, 2JCP = 5.7 Hz, C), 149.8 (C), 152.3 (d, 2JCP = 6.7 Hz, C), 154.8 (C) ppm. 31P NMR (120 MHz, CDCl3)-5.4, 28.9 ppm. HRMS (EI): calculated for C37H33NO5P2 [M]+ 633.1834; found 633.1849.
296 VI-1.3. Synthesis of hybrid 1,2,3,4-tetrahydroquinolinyl and quinolinyl dialkyl phosphonates Preparation of anilines substituted with dialkyl phosphonate 1b, 1c and 1d Diethyl (2-aminophenyl)phosphonate 1b. To a suspension of 2-bromoaniline (4.30 g, 25 mmol, 1 equiv.), diethyl phosphite (3.86 mL, 30 mmol, 1.2 equiv.) and freshly distilled triethlamine (5.23 mL, 37.5 mmol, 1.5 equiv.) in 30 mL of dry deoxydenated EtOH were added 5% mol of Pd(OAc)2 (0.28 g) and 15% mol of triphenylphosphine (1.01 g). The reaction mixture was stirred and heated to EtOH reflux for 12h and the resulted reaction crude was purified by silica gel column chromatography (30% of ethyl acetate in hexane) and subsequently vacuum-evaporated to dryness to afford 15.28 g (59 mmol) of diethyl (2aminophenyl)phosphonate 1b as a yellow solid (73%); mp 58 ). Diisopropyl (2-nitrophenyl)phosphonate. 1,2-Dinitrobenzene (12.61 g, 75 mmol, 1 equiv.) and triisopropyl phosphite (22.21 mL, 90 mmol, 1.2 equiv.) were dissolved in 70 mL of dry dimethylformamide (DMF) and the reaction mixture was maintained stirring at MeCN reflux for 12 h. The resultant reaction crude was filtered off, dried in vacuo, and purified by silica gel column chromatography (10% of ethyl acetate in hexane) to yield 17.88 g (62.25 mmol) of diisopropyl (2-nitrophenyl)phosphonate as a brown oil (83%); Rf = 0.39 (50:50 EtOAc/hexane). Diisopropyl (2-aminophenyl)phosphonate 1c. (Diisopropyl (2-nitrophenyl)phosphonate (19.40 g, 60 mmol) was hydrogenated with a spoon of RANEY® Nickel (approx. 5 g) in 60 mL of MeOH at 80 psi at room temperature for 12 h. The reaction mixture was then filtered off through a pad of cellite and evaporated to dryness to obtain (2aminophenyl)diphenylphosphine oxide 1a (17.59 g, 59.97 mmol) as a white solid (99%).
297 Diethyl (4-aminophenyl)phosphonate 1d. To a suspension of 4-bromoaniline (4.30 g, 25 mmol, 1 equiv.), triethylphosphite (17.15 ml, 100 mmol, 4 equiv.), TBAB (tetrabutylammonium bromide, 8.06 g, 25 mmol, 1 equiv.) and freshly distilled triethylamine (6.97 mL, 50 mmol, 2 equiv.) in 30 mL of deoxygenated distilled water, 4.4% mol of palladium(II) chloride (0.20g) were added and the reaction mixture was stirred at 100oC for 8h. The obtained reaction crude was purified by silica gel column chromatography (30% of ethyl acetate in hexane) and vacuumevaporated to dryness, affording 4.15 g (18.11 mmol) of diethyl (4-aminophenyl)phosphonate 1d as a white solid (72%); mp 125 127oC (ethyl acetate/hexane). General procedure for the preparation of dialkyl quinolin-8-ylphosphonates 13 A) Step-by-step Povarov-DDQ oxidation sequential procedure Styrenes 3 (1.2 mmol, 1.2 equiv.) and 2 equivalent of BF3·Et2O (0.25 mL, 2 mmol) were added to a solution of the corresponding in situ prepared aldimine 4 (1 mmol) in CHCl3 (3 mL). The mixture was stirred and heated to CHCl3 reflux until TLC, 31P NMR and 1H NMR spectroscopy analysis indicated the disappearance of the aldimine. Then, the reaction was allow to reach room temperature and DDQ (0.45 g, 2 mmol, 2 equiv.) was added, to subsequently heat the reaction again to reflux for 2 h. The reaction mixture was then diluted in 10 mL of dichloromethane, washed with a 2M aqueous solution of NaOH (25 mL) and water (25 mL), extracted with dichloromethane (2 × 10 mL), and dried over anhydrous MgSO4. The solvent was removed under vacuum affording an oil that was purified by silica gel flash column chromatography using an elution of 20 80% ethyl acetate-hexane to afford dialkyl quinolin-8-yl phosphonates 13. B) MCR Povarov-DDQ oxidation sequential procedure A mixture of dialkyl (4-aminophenyl)phosphonate 1b/1c (1 mmol, 1 equiv.), freshly distilled aldehydes 2 (1 mmol, 1 equiv.), styrenes 3 (1.2 mmol, 1.2 equiv.) and 2 equivalents of BF3·Et2O (0.25 mL, 2 mmol) dissolved in CHCl3 (3 mL) was stirred and heated to reflux in the presence of molecular sieves (4 Å), until TLC, 31P NMR and 1H NMR spectroscopy analysis indicated the consumption of the starting materials (16 h). Then, the reaction was allow to reach room temperature and DDQ (0.45 g, 2 mmol, 2 equiv.) was added, to subsequently heat the reaction again to reflux for 2 h. The reaction mixture was then diluted in 10 mL of dichloromethane, washed with a 2M aqueous solution of NaOH (25 mL) and water (25 mL), extracted with dichloromethane (2 × 10 mL), and dried over anhydrous MgSO4. The solvent was removed under vacuum affording an oil that was purified by silica gel flash column chromatography using an elution of 20 80% ethyl acetate-hexane to afford dialkyl quinolin-8-yl phosphonates 13.
298 Diethyl (2,4-diphenylquinolin-8-yl)phosphonate (13a). The general procedure A (step-by step Povarov-DDQ oxidation sequential procedure) was followed using aminophenylphosphonate 1b (0.23 g, 1 mmol), benzaldehyde (0.10 mL, 1 mmol), styrene (0.14 mL, 1.2 mmol) and BF3·Et2O, affording (0.31 g, 74%) of a white solid identified as 13a. Melting point: 118-120oC (ethyl acetate/hexane). 1H RMN (300 MHz, CDCl3): = 1.32-1.36 (m, 6 H, 2 CH3), 4.26-4.44 (m, 4 H, 2 CH2), 7.45-7.57 (m, 9 H), 7.92 (s, 1 H), 8.06-8.08 (d, 3JHH = 8.4 Hz, 1 H) 8.37-8.43 (m, 3 H) ppm. 13C RMN (75 MHz, CDCl3): 16.7 (d, 3JCP = 6.6 Hz, 2 CH3), 62.5 (d, 2JCP = 5.7 Hz, 2 CH2), 119.3 (HC), 125.5 (d, 3JCP = 16.2 Hz, HC), 126.0 (d, 3JCP = 10.7 Hz, C), 128.0 (2 HC), 128.6 (d, 1JCP = 193.7 Hz, C), 128.7 (HC), 128.8 (2 HC), 128.9 (2 HC), 129.7 (2 HC), 129.9 (HC), 130.7 (HC), 136.9 (d, 2JCP = 7.4 Hz, HC), 138.2 (C), 139.0 (C), 148.8 (d, 2JCP = 6.7 Hz, C), 149.6 (C), 156.6 (C) ppm. 31P NMR (120 MHz, CDCl3) HRMS (EI): calculated for C25H24NO3P [M]+ 417.1494; found 417.1494. Diethyl (2-(2-methoxyphenyl)-4-phenylquinolin-8-yl)phosphonate (13b). The general procedure A (step-by-step Povarov-DDQ oxidation sequential procedure) was followed using aminophenylphosphonate 1b (0.23 g, 1 mmol), o-anisaldehyde (0.12 mL, 1 mmol), styrene (0.14 mL, 1.2 mmol) and BF3·Et2O, affording (0.21 g, 48%) of a white solid identified as 13b. Melting point: 121-123oC (ethyl acetate/hexane).
299 1H RMN (400 MHz, CDCl3): = 1.25-1.28 (m, 6 H, 2 CH3), 3.81 (s, 3 H, OCH3), 4.17-4.35 (m, 4 H, 2 OCH2), 6.95-6.97 (m, 2 H), 7.36-7.49 (m, 6 H), 7.77 (s, 1 H), 7.95-7.97 (d, 3JHH = 8.4 Hz, 1 H), 8.268.31 (m, 3 H) ppm. 13C RMN (100 MHz, CDCl3): 16.5 (d, 3JCP = 6.6 Hz, 2 CH3), 55.4 (OCH3), 62.3 (d, 2JCP = 5.5 Hz, 2 OCH2), 114.1 (3 HC), 118.6 (HC), 124.9 (d, 3JCP = 16.2 Hz, HC), 125.6 (d, 3JCP = 10.7 Hz, C), 128.1 (d, 1JCP = 187.9 Hz, C), 128.5 (HC), 128.6 (3 HC), 129.3 (HC), 129.5 (HC), 130.6 (HC), 131.5 (C), 136.7 (d, 2JCP = 7.5 Hz, HC), 138.2 (C), 148.7 (d, 2JCP = 6.7 Hz, C), 149.2 (C), 156.1 (C), 161.1 (C) ppm. 31P NMR (120 MHz, CDCl3) HRMS (EI): calculated for C26H26NO4P [M]+ 447.1599; found 447.1597. Diethyl (2-(3-methoxyphenyl)-4-phenylquinolin-8-yl)phosphonate (13c). The general procedure B (MCR Povarov-DDQ oxidation sequential procedure) was followed using aminophenylphosphonate 1b (0.23 g, 1 mmol), m-anisaldehyde (0.12 mL, 1 mmol), styrene (0.14 mL, 1.2 mmol) and BF3·Et2O, affording (0.42 g, 89%) of a white solid identified as 13c. Melting point: 127-129oC (ethyl acetate/hexane). 1H RMN (300 MHz, CDCl3): = 1.25-1.28 (m, 6 H, 2 CH3), 3.81 (s, 3 H, OCH3), 4.17-4.35 (m, 4 H, 2 OCH2), 6.95-6.97 (m, 2 H), 7.36-7.49 (m, 6 H), 7.77 (s, 1 H), 7.95-7.97 (d, 3JHH = 8.4 Hz, 1 H), 8.268.31 (m, 3 H) ppm. 13C RMN (75 MHz, CDCl3): 16.5 (d, 3JCP = 6.6 Hz, 2 CH3), 55.4 (OCH3), 62.3 (d, 2JCP = 5.5 Hz, 2 OCH2), 114.1 (3 HC), 118.6 (HC), 124.9 (d, 3JCP = 16.2 Hz, HC), 125.6 (d, 3JCP = 10.7 Hz, C), 128.1 (d, 1JCP = 187.9 Hz, C), 128.5 (HC), 128.6 (3 HC), 129.3 (HC), 129.5 (HC), 130.6 (HC), 131.5 (C), 136.7 (d, 2JCP = 7.5 Hz, HC), 138.2 (C), 148.7 (d, 2JCP = 6.7 Hz, C), 149.2 (C), 156.1 (C), 161.1 (C) ppm. 31P NMR (120 MHz, CDCl3) HRMS (EI): calculated for C26H26F3NO4P [M]+ 447.1599; found 447.1597.
300 Diethyl (2-(4-methoxyphenyl)-4-phenylquinolin-8-yl)phosphonate (13d). The general procedure A (step-by-step Povarov-DDQ oxidation sequential procedure) was followed using aminophenylphosphonate 1b (0.23 g, 1 mmol), p-anisaldehyde (0.12 mL, 1 mmol), styrene (0.14 mL, 1.2 mmol) and BF3·Et2O, affording (0.18 g, 41%) of a white solid identified as 13d. Melting point: 120-122oC (ethyl acetate/hexane). 1H RMN (400 MHz, CDCl3): = 1.23-1.27 (m, 6 H, 2 CH3), 3.86 (s, 3 H, OCH3), 4.16-4.35 (m, 4 H, 2 OCH2), 6.93-6.95 (m, 1 H), 7.31-7.48 (m, 7 H), 7.79-7.82 (m, 2 H), 7.98-8.00 (m, 2 H), 8.28-8.34 (m, H) ppm. 13C RMN (100 MHz, CDCl3): 16.5 (d, 3JCP = 6.7 Hz, 2 CH3), 55.4 (OCH3), 62.3 (d, 2JCP = 5.7 Hz, 2 OCH2), 112.6 (HC), 116.3 (HC), 119.2 (HC), 120.0 (HC), 125.4 (d, 3JCP = 16.3 Hz, HC), 125.9 (d, 2JCP = 10.7 Hz, C), 128.5 (d, 1JCP = 188.5 Hz, C), 128.6 (HC), 128.7 (2 HC), 129.5 (2 HC), 129.6 (HC), 130.6 (HC), 136.9 (d, 2JCP = 7.5 Hz, HC), 138.0 (C), 140.3 (C), 148.5 (d, 2JCP = 6.8 Hz, C), 149.4 (C), 156.1 (C), 160.1 (C) ppm. 31P NMR (120 MHz, CDCl3) HRMS (EI): calculated for C26H26NO4P [M]+ 447.1599; found 447.1597.
301 Diethyl (2-(4-methoxyphenyl)-4-phenylquinolin-8-yl)phosphonate (13e). The general procedure A (step-by-step Povarov-DDQ oxidation sequential procedure) was followed using aminophenylphosphonate 1b (0.23 g, 1 mmol), diethyl (4-formylphenyl) phosphate (0.26 mL, 1 mmol), styrene (0.14 mL, 1.2 mmol) and BF3·Et2O, affording (0.36 g, 64%) of a brown oil identified as 13e. Rf: 0.22 (20:80 ethyl acetate/hexane). 1H RMN (300 MHz, CDCl3): = 1.31-1.39 (m, 12 H, 4 CH3), 4.20-4.40 (m, 8 H, 4 CH2), 7.26-7.53 (m, 8 H), 7.86 (s, 1 H), 8.04-8.07 (m, 1 H), 8.33-8.40 (m, 3 H) ppm 13C RMN (75 MHz, CDCl3): 16.2 (d, 3JCP = 6.5 Hz, 2 CH3), 16.6 (d, 3JCP = 6.4 Hz, 2 CH3), 62.5 (d, 2JCP = 5.6 Hz, 2 CH2), 64.9 (d, 2JCP = 5.9 Hz, 2 CH2), 118.9 (HC), 125.4-138.0 (m, 4 C and 12 HC), 148.7 ppm (d, 2JCP = 6.7 Hz, C), 149.7 (m, C), 152.3 (m, C), 155.5 (C) ppm. 31P NMR (120 MHz, CDCl3)-5.4 ppm. HRMS (EI): calculated for C29H33NO7P2 [M]+ 569,1732; found 569,1732. Diethyl (2-(naphthalen-1-yl)-4-phenylquinolin-8-yl)phosphonate (13f). The general procedure B (MCR Povarov-DDQ oxidation sequential procedure) was followed using aminophenylphosphonate 1b (0.23 g, 1 mmol), 1-napthaldehyde (0.13 mL, 1 mmol), styrene (0.14 mL, 1.2 mmol) and BF3·Et2O, affording (0.28 g, 60%) of a yellow solid identified as 13f. Melting point: 140-142oC (ethyl acetate/hexane).
302 1H RMN (400 MHz, CDCl3): = 1.16-1.20 (m, 6 H, 2 CH3), 4.19-4.30 (m, 4 H, 2 CH2), 7.51-7.62 (m, 9 H), 7.77 (s, 1 H), 7.86-7.97 (m, 3 H), 8.15-8.17 (d, 3JHH = 8.4 Hz, 1 H), 8.39-8.44 (m, 1 H), 8.588.60 (d, 3JHH = 8.3 Hz, 1 H) ppm. 13C RMN (100 MHz, CDCl3): 16.5 (d, 3JCP = 6.1 Hz, 2 CH3), 62.9 (d, 2JCP = 5.3 Hz, 2 CH2), 124.0 (HC), 125.4 (HC), 125.7 (C), 125.8 (HC), 125.9 (HC), 126.2 (HC), 126.5 (HC), 126.9 (HC), 128.4 (HC), 128.8 (HC), 128.9 (2 HC), 129.5 (d, 1JCP = 191.1 Hz, C), 129.6 (HC), 129.8 (2 HC), 130.6 (HC), 131.1 (C), 134.0 (C), 136.5 ppm (d, 2JCP = 6.6 Hz, HC), 137.9 (C), 138.1 (C), 148.7 ppm (d, 2JCP = 5.8 Hz, C), 149.2 (C), 159.0 (C) ppm. 31P NMR (120 MHz, CDCl3) HRMS (EI): calculated for C29H26NO3P [M]+ 467.1650; found 467.1651. Diethyl (2-(naphthalen-2-yl)-4-phenylquinolin-8-yl)phosphonate (13g). The general procedure B (MCR Povarov-DDQ oxidation sequential procedure) was followed using aminophenylphosphonate 1b (0.23 g, 1 mmol), 2-napthaldehyde (0.16 g, 1 mmol), styrene (0.14 mL, 1.2 mmol) and BF3·Et2O, affording (0.39 g, 83%) of a yellow solid identified as 13g. Melting point: 135-137oC (ethyl acetate/hexane). 1H RMN (300 MHz, CDCl3): 1.34-1.39 (m, 6 H, 2 CH3), 4.30-4.48 (m, 4 H, 2 CH2), 7.53-7.58 (m, 8 H), 7.90-8.11 (m, 5 H), 8.38-8.46 (m, 1 H), 8.65-8.75 (m, 2 H) ppm. 13C RMN (75 MHz, CDCl3): = 16.7 (d, 3JCP = 6.5 Hz, 2 CH3), 62.6 (d, 2JCP = 5.3 Hz, 2 CH2), 119.5 (HC), 125.5 (HC), 125.6 (HC), 125.7 (HC), 126.1 (d, 3JCP = 10.6 Hz, C), 126.5 (HC), 127.1 (HC), 127.4 (HC), 127.6 (HC), 128.6 (HC), 128.7 (d, 1JCP = 187.5 Hz, C), 128.8 (HC), 128.9 (2 HC), 129.0 (HC), 129.7 (2 HC), 130.7 (HC), 133.5 (C), 134.3 (C), 136.5 (C), 137.0 (d, 2JCP = 7.3 Hz, HC), 138.2 (C), 148.9 (d, 2JCP = 6.3 Hz C), 149.7 (C), 156.5 (C) ppm. 31P NMR (120 MHz, CDCl3) HRMS (EI): calculated for C29H26NO3P [M]+ 467.1650; found 467.1649.
303 Diethyl (2-(3,4-difluorophenyl)-4-phenylquinolin-8-yl)phosphonate (13h). The general procedure B (MCR Povarov-DDQ oxidation sequential procedure) was followed using aminophenylphosphonate 1b (0.23 g, 1 mmol), 3,4-difluorobenzaldehyde (0.11 g, 1 mmol), styrene (0.14 mL, 1.2 mmol) and BF3·Et2O, affording (0.34 g, 76%) of a white solid identified as 13h. Melting point: 153-155oC (ethyl acetate/hexane). 1H RMN (400 MHz, CDCl3): 1.25-1.29 (m, 6 H, 2 CH3), 4.19-4.30 (m, 4 H, 2 CH2), 7.18-7.20 (m, 1 H), 7.42-7.44 (m, 6 H), 7.74 (s, 1 H), 7.97-8.01 (m, 2 H), 8.18-8.33 (m, 2 H) ppm. 13C RMN (100 MHz, CDCl3): = 16.6 (d, 3JCP = 6.5 Hz, 2 CH3), 62.4 (d, 2JCP = 5.8 Hz, 2 CH2), 116.9 (d, 2JCF = 18.6 Hz, HC), 117.5 (d, 2JCF = 17.5 Hz, HC),118.5 (HC), 123.8 (dd, 3JCF = 6.6 Hz, 4JC-F = 3.3 Hz, HC), 125.8 (d, 3JCP = 16.2 Hz, HC), 126.0 (d, 3JCP = 10.6 Hz, C), 128.5 (d, 1JCP = 188.6 Hz, C), 129.5 (2 HC), 136.1.3 (dd, 3JCF = 5.7 Hz, 4JCF = 3.6 Hz, C), 137.2 (d, 2JCP = 7.6 Hz, HC), 137.8 (C), 148.5 (d, 2JCP = 6.6 Hz, C), 150.2 (C), 150.9 (dd, 1JCF = 248.6 Hz, 2JCF = 12.2 Hz, C), 151.7 (dd, 1JCF = 250.5 Hz, 2JCF = 12.3 Hz, C), 154.1 (C) ppm. 31P NMR (120 MHz, CDCl3) 19F NMR crude reaction mixture (282 MHz, CDCl3)-136.6 to -136.5 (m) and -137.5 to -137.4 (m) ppm. HRMS (EI): calculated for C25H22F2NO3P [M]+ 453.1305; found 453.1321.
304 Diethyl (2-(4-methoxyphenyl)-4-phenylquinolin-8-yl)phosphonate (13i). The general procedure A (step-by-step Povarov-DDQ oxidation sequential procedure) was followed using aminophenylphosphonate 1b (0.23 g, 1 mmol), benzaldehyde (0.10 mL, 1 mmol), 4-methylstyrene (0.16 mL, 1.2 mmol) and BF3·Et2O, affording (0.24 g, 54%) of a white solid identified as 13i. Melting point: 125-127oC (ethyl acetate/hexane). 1H RMN (300 MHz, CDCl3): = 1.31-1.36 (m, 6 H, 2 CH3), 2.48 (s, 3 H, CH3), 4.27-4.43 (m, 4 H, 2 CH2), 7.26-7.35 (m, 10 H), 7.91 (s, 1 H), 8.09-8.02 (m, 1 H), 8.35-8.42 (m, 3 H) ppm. 13C RMN (75 MHz, CDCl3): 16.6 (d, 3JCP = 6.5 Hz, 2 CH3), 21.4 (CH3), 62.5 (d, 2JCP = 5.8 Hz, 2 CH2), 119.2 (HC), 125.4 (d, 3JCP = 16.1 Hz, HC), 126.1 (d, 2JCP = 10.7 Hz, C), 128.0 (2HC), 128.8 (2HC), 127.3-130.8 (m, 1 C and 7 HC), 135.2 (C), 136.9 (d, 3JCP = 10.7 Hz, C), 138.7 (C), 138,9 (C), 148.7 (m, C), 149.8 (C), 156.5 (C) ppm. 31P NMR (120 MHz, CDCl3) HRMS (EI): calculated for C26H26NO3P [M]+ 431,1650; found 431,1651. Diethyl (2-(4-fluorophenyl)-4-(p-tolyl)quinolin-8-yl)phosphonate (13j). The general procedure A (step-by-step Povarov-DDQ oxidation sequential procedure) was followed using aminophenylphosphonate 1b (0.23 g, 1 mmol), 4-fluorobenzaldehyde (0.11 mL, 1 mmol), 4-methylstyrene (0.16 mL, 1.2 mmol) and BF3·Et2O, affording (0.23 g, 52%) of a white solid identified as 13j. Melting point: 139-141oC (ethyl acetate/hexane).
305 1H RMN (300 MHz, CDCl3): = 1.32-1.36 (m, 6 H, 2 CH3), 2.48 (s, 3 H, CH3), 4.22-4.44 (m, 4 H, 2 CH2), 7.17-7.23 (m, 2 H), 7.35-7.43 (m, 4 H), 7.47-7.53 (m, 1 H), 7.86 (s, 1 H), 8.08-8.11 (m, 1 H), 8.32-8.40 (m, 3 H) ppm. 13C RMN (75 MHz, CDCl3): 16.6 (d, 3JCP = 6.5 Hz, 2 CH3), 21.5 (CH3), 62.5 (m, 2 CH2), 115.9 (d, 2JCF = 21.7 Hz, 2 HC), 118.9 (HC), 125.5 (d, 3JCP = 18.0 Hz, HC), 126.0 (d, 3JCP = 10.7 Hz, C), 128.2 (d, 1JCP = 166.3 Hz, C), 129.6 (3 HC), 129.8 (HC), 129.9 (HC), 130.9 (2 HC), 135.1 (2 C), 136.9 (HC), 138.9 (C), 148.7 (C), 150.1 (d, 2JCP = 17.2 Hz, C), 155.4 (C), 164.2 (d, 1JCF = 249.8 Hz, C-F) ppm. 31P NMR (120 MHz, CDCl3) 19F NMR crude reaction mixture (282 MHz, CDCl3)-112.1 to -111.9 (m) ppm. HRMS (EI): calculated for C26H25FNO3P [M]+ 449.1556; found 449.1562. Diethyl (2-(3,4-difluorophenyl)-4-(p-tolyl)quinolin-8-yl)phosphonate (13k). The general procedure A (step-by-step Povarov-DDQ oxidation sequential procedure) was followed using aminophenylphosphonate 1b (0.23 g, 1 mmol), 3,4-difluorobenzaldehyde (0.11 g, 1 mmol), 4-methylstyrene (0.16 mL, 1.2 mmol) and BF3·Et2O, affording (0.32 g, 47%) of a white solid identified as 13k. Melting point: 133-135oC (ethyl acetate/hexane). 1H RMN (300 MHz, CDCl3): = 1.34-1.39 (m, 6 H, 2 CH3), 2.49 (s, 1 H, CH3), 4.21-4.43 (m, 4 H, 2 CH2), 7.28-7.31 (m, 1 H), 7.36-7.43 (m, 4 H), 7.49-7.56 (m, 1 H), 7.82 (s, 1 H), 8.07-8.12 (m, 2 H), 8.26-8.43 (m, 2 H) ppm. 13C RMN (75 MHz, CDCl3): 16.7 (d, 3JCP = 6.5Hz, 2 CH3), 21.5 (CH3), 62.4 (d, 2JCP = 5.8 Hz, 2 CH2), 117.0 (d, 2JCF = 18.9 Hz, HC), 117.6 (d, 2JCF = 17.4 Hz, HC),118.6 (HC), 123.9 (dd, 3JCF = 6.5 Hz, 4JC-F = 3.3 Hz, HC), 125.8 (d, 3JCP = 16.2 Hz, HC), 126.2 (d, 3JCP = 10.6 Hz, C), 128.5 (d, 1JCP = 188.5 Hz, C), 129.5 (2 HC), 129.6 (2 HC), 130.9 (C), 135.0 (C), 136.3 (C), 137.2 (d, 2JCP = 7.6 Hz, HC), 139.0 (C), 148.7 (d, 2JCP = 6.6 Hz, C), 150.2 (C), 150.8 (dd, 1JCF = 247.4 Hz, 2JCF = 12.1 Hz, C), 151.7 (dd, 1JCF = 250.7 Hz, 2JCF = 12.3 Hz, C), 153.5 (C) ppm.
312 Diisopropyl (2-(3,4-difluorophenyl)-4-(p-tolyl)quinolin-8-yl)phosphonate (13r). The general procedure B (MCR Povarov-DDQ oxidation sequential procedure) was followed using aminophenylphosphonate 1c (0.26 g, 1 mmol), 3,4-difluorobenzaldehyde (0.11 mL, 1 mmol), 4-methylstyrene (0.16 mL, 1.2 mmol) and BF3·Et2O, affording (0.19 g, 39%) of a white solid identified as 13r. Melting point: 140-142oC (ethyl acetate/hexane). 1H RMN (400 MHz, CDCl3): = 1.15 (d, 3JHH = 6.2 Hz, 2 CH3), 1.34 (d, 3JHH = 6.2 Hz, 2 CH3), 2.39 (CH3), 4.88-4.96 (m, 2 H, 2 CH), 7.16-7.23 (m, 1 H), 7.26-7.33 (m, 4 H), 7.40-7.44 (m, 1 H), 7.72 (s, 1 H), 7.99-8.02 (m, 2 H), 8.23-8.36 (m, 2 H) ppm. 13C RMN (100 MHz, CDCl3): = 21.2 (CH3), 23.9 (d, 3JCP = 5.0 Hz, 2 CH3), 24.3 (d, 3JCP = 4.8 Hz, 2 CH3), 70.7 (d, 2JCP = 5.9 Hz, 2 CH), 116.8 (d, 2JCF = 18.7 Hz, HC), 117.3 (d, 2JCF = 17.5 Hz, HC), 118.2 (HC), 123.6 (dd, 3JCF = 6.6 Hz, 4JCF = 3.4 Hz, HC), 125.5 (d, 3JCP = 16.2 Hz, HC), 126.0 (d, 3JCP = 10.4 Hz, C), 129.4 (2 HC), 129.4 (2 HC), 129.5 (d, 1JCP = 188.1 Hz, C), 130.5 (HC), 134.9 (HC), 136.2 (dd, 3JCF = 5.8 Hz, 4JCF = 3.6 Hz, C), 137.1 (d, 3JCF = 7.7 Hz, HC), 138.7 (C), 148.4 (d, 2JCP = 6.4 Hz, C), 149.9 (C), 150.8 (dd, 2JCF = 12.6 Hz, 1JCF = 247.6 Hz, C), 151.6 (dd, 2JCF = 12.7 Hz, 1JCF = 251.3 Hz, C), 153.7 (C) ppm. 31P NMR (120 MHz, CDCl3) 19F NMR crude reaction mixture (282 MHz, CDCl3)-136.9 to -136.7 (m) and -137.9 to 137.7 (m) ppm. HRMS (EI): calculated for C28H28F2NO3P [M]+ 435.1400; found 435.1415.
313 Diisopropyl (2,4-bis(4-fluorophenyl)quinolin-8-yl)phosphonate (13s). The general procedure B (MCR Povarov-DDQ oxidation sequential procedure) was followed using aminophenylphosphonate 1c (0.26 g, 1 mmol), 4-fluorobenzaldehyde (0.11 mL, 1 mmol), 4-fluorostyrene (0.14 mL, 1.2 mmol) and BF3·Et2O, affording (0.30 g, 68%) of a white solid identified as 13s. Melting point: 113-115oC (ethyl acetate/hexane). 1H RMN (400 MHz, CDCl3): = 1.15 (d, 3JHH = 6.2 Hz, 2 CH3), 1.35 (d, 3JHH = 6.1 Hz, 2 CH3), 4.904.99 (m, 2 H, 2 CH), 7.11-7.20 (m, 4 H), 7.40-7.46 (m, 3 H), 7.75 (s, 1 H), 7.91-7.93 (m, 1 H), 8.298.35 (m, 3 H) ppm. 13C RMN (100 MHz, CDCl3): 23.9 (d, 3JCP = 5.1 Hz, 2 CH3), 24.3 (d, 3JCP = 3.8 Hz, 2 CH3), 70.7 (d, 2JCP = 6.0 Hz, 2 CH), 115.6 (d, 2JCF = 21.5 Hz, 2 HC), 115.8 (d, 2JCF = 21.6 Hz, 2 HC), 118.6 (HC), 125.5 (d, 3JCP = 16.1 Hz, HC), 125.7 (d, 3JCP = 10.6 Hz, C), 129.6 (d, 1JCP = 189.7 Hz, C), 131.2 (d, 3JCF = 8.1 Hz, 2 HC), 134.0 (C), 134.9 (C), 136.8 (d, 2JCP = 7.4 Hz, HC), 148.4 (C), 148.5 (d, 2JCP = 6.8 Hz, C), 150.1 (C), 163.0 (d, 1JCF = 248.3 Hz, C-F), 164.0 (d, 1JCF = 249.7 Hz, C-F) ppm. 31P NMR (120 MHz, CDCl3) 19F NMR crude reaction mixture (282 MHz, CDCl3)-112.2 to -112.0 (m) and -113.4 to -113.2 (m) ppm. HRMS (EI): calculated for C27H26F2NO3P [M]+ 481.1618; found 481.1632.
314 Diisopropyl (2-(3,4-difluorophenyl)-4-(4-fluorophenyl)quinolin-8-yl)phosphonate (13t). The general procedure B (MCR Povarov-DDQ oxidation sequential procedure) was followed using aminophenylphosphonate 1c (0.26 g, 1 mmol), 3,4-difluorobenzaldehyde (0.11 mL, 1 mmol), 4-fluorostyrene (0.44 mL, 1.2 mmol) and BF3·Et2O, affording (0.19 g, 88%) of a white solid identified as 13t. Melting point: 144-146oC (ethyl acetate/hexane). 1H RMN (400 MHz, CDCl3): = 1.06 (d, 3JHH = 6.2 Hz, 2 CH3), 1.25 (d, 3JHH = 6.2 Hz, 2 CH3), 4.794.87 (m, 2 H, 2 CH), 7.17-7.23 (m, 1 H), 7.40-7.49 (m, 6 H), 7.74 (s, 1 H), 7.95-7.98 (m, 1 H), 8.008.03 (m, H), 8.23-8.28 (m, H), 8.30-8.37 (m, H) ppm. 13C RMN (100 MHz, CDCl3): = 23.8 (d, 3JCP = 5.0 Hz, 2 CH3), 24.1 (d, 3JCP = 3.9 Hz, 2 CH3), 70.7 (d, 2JCP = 6.0 Hz, 2 CH), 115.7 (d, 3JCF = 20.6 Hz, 2 HC), 116.8 (d, 2JCF = 18.7 Hz, HC), 117.2 (d, 2JCF = 17.5 Hz, HC), 118.2 (HC), 123.6 (dd, 3JCF = 6.5 Hz, 4JCF = 3.3 Hz, HC), 125.7 (d, 3JCP = 17.6 Hz, HC), 125.7 (C), 129.4 (d, 1JCP = 189.5 Hz, C), 129.9 (HC), 131.1 (HC), 131.2 (2 HC), 133.6 (C), 135.8 (dd, 3JCF = 5.7 Hz, 4JCF = 3.5 Hz, C), 136.9 (d, 3JCF = 7.6 Hz, HC), 148.3 (d, 2JCP = 6.5 Hz, C), 148.6 (C), 150.6 (dd, 2JCF = 12.6 Hz, 1JCF = 247.8 Hz, C), 151.5 (dd, 2JCF = 12.7 Hz, 1JCF = 251.6 Hz, C), 153.6 (C), 162.9 (d, 1JCF = 248.9 Hz, C-F) ppm. 31P NMR (120 MHz, CDCl3) 19F NMR crude reaction mixture (282 MHz, CDCl3)-113.0 to -112.8 (m), -136.8 to -136.5 (m) and -137.8 to 137.6 (m) ppm. HRMS (EI): calculated for C27H25F3NO3P [M]+ 499.1524; found 499.1534.
315 General procedure for the preparation of diethyl 1,2,3,4-tetrahydroquinolin-6ylphosphonates 15 MCR Povarov procedure A mixture of diethyl (4-aminophenyl)phosphonate 1d (1 mmol, 1 equiv.), freshly distilled aldehydes 2 (1 mmol, 1 equiv.), styrenes 3 (1.2 mmol, 1.2 equiv.) and 2 equivalents of BF3·Et2O (0.25 mL, 2 mmol) dissolved in CHCl3 (3 mL) was stirred and heated to reflux in the presence of molecular sieves (4 Å), until TLC, 31P NMR and 1H NMR spectroscopy analysis indicated the consumption of the starting materials. The molecular sieves were removed by filtration and the resulting solution was diluted with methylene chloride (15 ml), washed with a solution of NaOH 2M (25 ml), extracted with methylene chloride (2 x 10 mL) and dried over MgSO4. Upon in vacuo solvent evaporation, the resultant reaction crude was further purified by flash column chromatography on silica gel using a gradient of elution of 5-70% ethyl acetate in hexane, to afford 1,2,3,4-tetrahydroquinolin-6-yl phosphonates 15. Diethyl (2-(4-fluorophenyl)-4-phenyl-1,2,3,4-tetrahydroquinolin-6-yl)phosphonate (15a). The general procedure (MCR Povarov) was followed using aminophenylphosphonate 1d (0.26 g, 1 mmol), 4-fluorobenzaldehyde (0.11 mL, 1 mmol), styrene (0.14 mL, 1.2 mmol) and BF3·Et2O, affording (0.36 g, 81%) of a white solid identified as 15a. Melting point: 146-148oC (ethyl acetate/hexane). 1H RMN (400 MHz, CDCl3): = 1.13-1.24 (m, 6 H, 2 CH3), 1.75 (ddd, 3JHH = 12.3 Hz, 3JHH = 11.3 Hz, 2JHH = 11.4 Hz, 1 H, CH2), 2.25-2.30 (m, 1 H, CH2), 3.83-4.02 (m, 4 H, 2 CH2), 4.26 (dd, 3JHH = 5.0 Hz, 3JHH = 12.8 Hz, 1 H, CH), 4.42 (s, NH), 4.64 (dd, 3JHH = 2.8 Hz, 3JHH = 11.3 Hz, 1 H, CH), 6.58-6.61 (m, 7.01-7.07 (m, 3 H), 7.20-7.32 (m, 5 H), 7.38-7.49 (m, 3 H) ppm. 13C RMN (100 MHz, CDCl3): 16.4 (d, 3JCP = 6.7 Hz, 2 CH3), 41.8 (CH2), 44.6 (HC), 56.5 (HC), 61.8 (d, 2JCP = 5.4 Hz, 2 CH2), 113.8(d, 3JCP = 16.1 Hz, HC), 114.8 (d, 1JCP = 196.9 Hz, C), 115.8 (d, 2JCF =
316 21.5 Hz, 2 HC), 124.4 (d, 3JCP = 15.5 Hz, C), 127.0 (HC), 128.2 (HC), 128.3 (2 HC), 128.6 (2 HC), 128.9 (2 HC), 131.8 (d, 2JCP = 11.3 Hz, HC), 133.6 (d, 2JCP = 12.0 Hz, HC), 138.9 (d, 4JCF = 3.1 Hz, C), 144.2 (C), 148.8 (d, 4JCP = 3.0 Hz, C), 162.5 (d, 1JCF = 246.3 Hz, C-F) ppm. 31P NMR (120 MHz, CDCl3) 19F NMR crude reaction mixture (282 MHz, CDCl3)-114.7 to -114.5 (m) ppm. HRMS (EI): calculated for C25H27FNO3P [M]+ 439,1713; found 439,1725. Diethyl (2-(3,4-difluorophenyl)-4-phenyl-1,2,3,4-tetrahydroquinolin-6-yl)phosphonate (15b). The general procedure (MCR Povarov) was followed using aminophenylphosphonate 1d (0.26 g, 1 mmol), 3,4-difluorobenzaldehyde (0.11 mL, 1 mmol), styrene (0.14 mL, 1.2 mmol) and BF3·Et2O, affording (0.44 g, 97%) of a white solid identified as 15b. Melting point: 164-166oC (ethyl acetate/hexane). 1H RMN (400 MHz, CDCl3): = 1.19-1.29 (m, 6 H, 2 CH3), 2.17 (ddd, 3JHH = 12.5 Hz, 3JHH = 11.6 Hz, 2JHH = 11.5 Hz, 1 H, CH2), 2.31-2.36 (m, 1 H, CH2), 3.89-4.07 (m, 4 H, 2 CH2), 4.28 (dd, 3JHH = 5.3 Hz, 3JHH = 12.5 Hz, 1 H, CH), 4.52 (s, NH), 4.67 (dd, 3JHH = 2.5 Hz, 3JHH = 11.1 Hz, 1 H, CH), 6.65-6.68 (m, 7.07-7.10 (m, 1 H), 7.18-7.37 (m, 8 H), 7.49-7.54 (m, 1 H) ppm. 13C RMN (100 MHz, CDCl3): 16.3 (d, 3JCP = 6.8 Hz, 2 CH3), 41.8 (CH2), 44.4 (HC), 56.3 (HC), 61.8 (d, 2JCP = 5.1 Hz, 2 CH2), 114.0 (d, 2JCF = 16.2 Hz, HC), 115.6 (d, 2JCF = 17.6 Hz, HC), 117.6 (d, 2JCF = 17.3 Hz, HC), 122.6 (dd, 3JCF = 6.2 Hz, 4JCF = 3.6 Hz, HC), 124.3 (d, 3JCP = 15.6 Hz, C), 127.1 (HC), 128.6 (2 HC), 128.9 (2 HC), 131.8 (d, 3JCP = 11.2 Hz, HC), 133.6 (d, 2JCP = 11.8 Hz, HC), 140.3 (dd, 3JCF = 5.0 Hz, 4JCF = 3.7 Hz, C), 144.0 (2 C), 148.5 (d, 4JCP = 3.1 Hz, C), 149.9 (dd, 2JCF = 12.6 Hz, 1JCF = 248.6 Hz, C), 150.7 (dd, 2JCF = 12.7 Hz, 1JCF = 248.9 Hz, C) ppm. 31P NMR (120 MHz, CDCl3) 19F NMR crude reaction mixture (282 MHz, CDCl3)-137.5 to -137.2 (m) and -139.1 to 139.3 (m) ppm. HRMS (EI): calculated for C25H26F2NO3P [M]+ 457,1618; found 457,1630.
317 Diisopropyl (2-(4-fluorophenyl)-4-(p-tolyl) -1,2,3,4-tetrahydroquinolin-8-yl)phosphonate (15c). The general procedure (MCR Povarov) was followed using aminophenylphosphonate 1d (0.26 g, 1 mmol), 4-fluorobenzaldehyde (0.11 mL, 1 mmol), 4-methylstyrene (0.16 mL, 1.2 mmol) and BF3·Et2O, affording (0.29 g, 65%) of a white solid identified as 15c. Melting point: 160-162oC (ethyl acetate/hexane). 1H RMN (400 MHz, CDCl3): = 1.13-1.40 (m, 6 H, 2 CH3), 2.13 (ddd, 3JHH = 12.3 Hz, 3JHH = 11.6 Hz, 2JHH = 11.7 Hz, 1 H, CH2), 2.21-2.27 (m, 1 H, CH2), 2.32 (s, 1 H, CH3), 3.83-4.01 (m, 4 H, 2 CH2), 4.21 (dd, 3JHH = 5.2 Hz, 3JHH = 12.2 Hz, 1 H, CH), 4.49 (s, NH), 4.49 (dd, 3JHH = 2.8 Hz, 3JHH = 11.2 Hz, 1 H, CH), 6.56-6.601 (m, 7.01-7.12 (m, 6 H), 7.37-7.46 (m 3 H) ppm. 13C RMN (100 MHz, CDCl3): 16.3 (d, 3JCP = 6.8 Hz, 2 CH3), 21.1 (CH3), 41.8 (CH2), 44.2 (HC), 56.5 (HC), 62.2 (d, 2JCP = 4.8 Hz, 2 CH2), 113.7 (d, 2JCF = 16.2 Hz, HC), 114.5 (d, 1JCP = 196.4 Hz, C), 115.7 (d, 2JCF = 21.4 Hz, 2 HC), 124.5 (d, 3JCP = 15.4 Hz, C), 128.2 (HC), 128.3 (HC), 128.4 (2 HC), 129.5 (3 HC), 131.7 (d, 2JCP = 11.2 Hz, HC), 133.6 (d, 2JCP = 12.0 Hz, HC), 136.5 (C), 139.0 (d, 4JCP = 3.2 Hz, C), 141.1 (C), 148.8 (d, 4JCP = 3.0 Hz, C), 162.4 (d, 1JCF = 246.1 Hz, C-F) ppm. 31P NMR (120 MHz, CDCl3) 19F NMR crude reaction mixture (282 MHz, CDCl3)-114.7 to -114.6 (m) ppm. HRMS (EI): calculated for C26H25FNO3P [M]+ 453,1869; found 453,1879.
318 Diethyl (2-(3,4-difluorophenyl)-4-(p-tolyl)-1,2,3,4-tetrahydroquinolin-6-yl)phosphonate (15d). The general procedure (MCR Povarov) was followed using aminophenylphosphonate 1d (0.26 g, 1 mmol), 3,4-difluorobenzaldehyde (0.11 mL, 1 mmol), 4-methylstyrene (0.16 mL, 1.2 mmol) and BF3·Et2O, affording (0.37 g, 79%) of a white solid identified as 15d. Melting point: 156-158oC (ethyl acetate/hexane). 1H RMN (400 MHz, CDCl3): = 1.14-1.24 (m, 6 H, 2 CH3), 2.10 (ddd, 3JHH = 12.8 Hz, 3JHH = 11.4 Hz, 2JHH = 11.5 Hz, 1 H, CH2), 2.22-2.27 (m, 1 H, CH2), 2.32 (s, 3 H, CH3), 3.83-4.02 (m, 4 H, 2 CH2), 4.20 (dd, 3JHH = 5.1 Hz, 3JHH = 12.4 Hz, 1 H, CH), 4.49 (s, NH), 4.61 (dd, 3JHH = 2.7 Hz, 3JHH = 11.2 Hz, 1 H, CH), 6.59-6.62 (m, 1 H), 7.02-7.15 (m, 7 H), 7.23-7.29 (m, 1 H), 7.41-7.47 (m, 1 H) ppm. 13C RMN (100 MHz, CDCl3): = 16.3 (d, 3JCP = 6.8 Hz, 2 CH3), 21.2 (CH3), 41.8 (CH2), 44.1 (HC), 56.3 (HC), 61.7 (d, 2JCP = 5.1 Hz, 2 CH2), 113.9 (d, 2JCF = 16.1 Hz, HC), 115.1 (d, 1JCP = 220.4 Hz, C), 115.5 (d, 2JCF = 17.7 Hz, HC), 117.6 (d, 3JCP = 17.3 Hz, HC), 122.6 (dd, 3JCF = 6.2 Hz, 4JCF = 3.5 Hz, HC), 124.5 (d, 3JCP = 15.5 Hz, C), 128.4 (2 HC), 129.6 (2 HC), 131.0 (d, 2JCP = 11.2 Hz, HC), 133.6 (d, 2JCP = 11.9 Hz, HC), 136.6 (C), 140.4 (dd, 4JCF = 3.6 Hz, 3JCF = 5.0 Hz, C), 140.8 (C), 148.5 (d, 4JCP = 3.0 Hz, C), 149.9 (dd, 2JCF = 12.7 Hz, 1JCF = 248.4 Hz, C), 150.7 (dd, 2JCF = 12.8 Hz, 1JCF = 248.8 Hz, C) ppm. 31P NMR (120 MHz, CDCl3) 19F NMR crude reaction mixture (282 MHz, CDCl3)-137.3 to -137.2 (m) and -139.2 to 139.0 (m) ppm. HRMS (EI): calculated for C26H28F2NO3P [M]+ 471,1775; found 471,1786.
319 Diethyl (2,4-bis(4-fluorophenyl)-1,2,3,4-tetrahydroquinolin-6-yl)phosphonate (15e). The general procedure (MCR Povarov) was followed using aminophenylphosphonate 1d (0.26 g, 1 mmol), 4-fluorobenzaldehyde (0.11 mL, 1 mmol), 4-fluorostyrene (0.14 mL, 1.2 mmol) and BF3·Et2O, affording (0.39 g, 86%) of a white solid identified as 15e. Melting point: 185-187oC (ethyl acetate/hexane). 1H RMN (400 MHz, CDCl3): = 1.16-1.25 (m, 6 H, 2 CH3), 2.10 (ddd, 3JHH = 12.5 Hz, 3JHH = 11.2 Hz, 2JHH = 11.5 Hz, 1 H, CH2), 2.23-2.28 (m, 1 H, CH2), 3.86-4.04 (m, 4 H, 2 CH2), 4.26 (dd, 3JHH = 5.2 Hz, 3JHH = 12.3 Hz, 1 H, CH), 4.41 (s, NH), 4.64 (dd, 3JHH = 2.9 Hz, 3JHH = 11.2 Hz, 1 H, CH), 6.57-6.60 (m, 6.98-7.07 (m, 5 H), 7.16-7.20 (m, 2 H), 7.37-7.48 (m, 3 H) ppm. 13C RMN (100 MHz, CDCl3): 16.4 (d, 3JCP = 6.7 Hz, 2 CH3), 41.9 (CH2), 43.9 (HC), 56.5 (HC), 61.8 (d, 2JCP = 5.2 Hz, 2 CH2), 113.9 (d, 2JCF = 16.1 Hz, HC), 115.1 (d, 1JCP = 197.2 Hz, C), 115.6-115.9 (m, 4 HC), 124.1 (d, 3JCF = 16.0 Hz, C), 128.2-130.1 (m, 4 HC), 131.8 (d, 2JCP = 11.1 Hz, HC), 133.5 (d, 2JCP = 11.8 Hz, HC), 138.8 (d, 4JCF = 3.1 Hz, C), 139.9 (d, 4JCF = 3.2 Hz, C), 148.7 (d, 4JCP = 3.1 Hz, C), 162.2 (d, 1JCF = 245.0 Hz, C-F), 162.5 (d, 1JCF = 246.4 Hz, C-F) ppm. 31P NMR (120 MHz, CDCl3) 19F NMR crude reaction mixture (282 MHz, CDCl3)-114.5 to -114.4 (m) and -116.5 to -116.4 (m) ppm. HRMS (EI): calculated for C25H26F2NO3P [M]+ 457,1618; found 457,1626.
320 Diethyl (2-(3,4-difluorophenyl)-4-(4-fluorophenyl)-1,2,3,4-tetrahydroquinolin-6-yl)phosphonate (15f). The general procedure (MCR Povarov) was followed using aminophenylphosphonate 1d (0.26 g, 1 mmol), 3,4-difluorobenzaldehyde (0.11 mL, 1 mmol), 4-fluorostyrene (0.44 mL, 1.2 mmol) and BF3·Et2O, affording (0.31 g, 65%) of a white solid identified as 15f. Melting point: 178-180oC (ethyl acetate/hexane). 1H RMN (400 MHz, CDCl3): = 1.15-1.24 (m, 6 H, 2 CH3), 2.06 (ddd, 3JHH = 12.6 Hz, 3JHH = 11.4 Hz, 2JHH = 11.7 Hz, 1 H, CH2), 2.22-2.27 (m, 1 H, CH2), 3.84-4.00 (m, 4 H, 2 CH2), 4.24 (dd, 3JHH = 5.1 Hz, 3JHH = 12.2 Hz, 1 H, CH), 4.58 (s, NH), 4.61 (dd, 3JHH = 2.7 Hz, 3JHH = 11.3 Hz, 1 H, CH), 6.60-6.63 (m, 1 H), 6.96-7.01 (m, 3 H), 7.11-7.28 (m, 5 H), 7.40-7.46 (m, 1 H) ppm. 13C RMN (100 MHz, CDCl3): = 16.3 (d, 3JCP = 6.7 Hz, 2 CH3), 41.9 (CH2), 43.7 (HC), 56.1 (HC), 61.8 (d, 2JCP = 5.2 Hz, 2 CH2), 114.1 (d, 2JCF = 16.1 Hz, HC), 115.3 (d, 1JCP = 197.1 Hz, C), 115.4-115.6 (m, 5 HC), 117.6 (d, 3JCF = 17.2 Hz, HC), 122.6 (dd, 3JCF = 6.3 Hz, 4JCF = 3.6 Hz, HC), 124.0 (d, 3JCP = 15.7 Hz, C), 130.0-136.5 (m, 4 HC), 139.7 (d, 4JCF = 3.3 Hz, C), 140.1 (dd, 4JCF = 3.7 Hz, 3JCF = 4.9 Hz, C), 148.5 (d, 4JCP = 3.0 Hz, C), 150.0 (dd, 2JCF = 12.8 Hz, 1JCF = 248.6 Hz, C), 150.6 (dd, 2JCF = 12.8 Hz, 1JCF = 248.9 Hz, C) 161.9 (d, 1JCF = 245.1 Hz, C-F) ppm. 31P NMR (120 MHz, CDCl3) 19F NMR crude reaction mixture (282 MHz, CDCl3)-116.4 to -116.2 (m), -137.3 to -137.1 (m) and -139.0 to 138.9 (m) ppm. HRMS (EI): calculated for C25H25F3NO3P [M]+ 475,1524; found 475,1534. General procedure for the preparation of diethyl quinolin-6-yl phosphonates 16 Oxidation of compounds 16 with DDQ DDQ (0.45 g, 2 mmol, 2 equiv.) was added to a solution of the corresponding 1,2,3,4tetrahydroquinolin-6-yl phosphonate 15 (1 mmol, 1 equiv.) in chloroform (5 mL) and the reaction mixture was stirred and heated to reflux until TLC, 31P NMR and 1H NMR spectroscopy
321 analysis indicated the consumption of the 1,2,3,4-tetrahydroquinolin-6-yl phosphonate 15 and the subsequent formation of the diethyl quinolin-6-yl phosphonate 16 (2 h). The formed reaction brute was filtered off, dried in vacuo and purified by silica gel flash column chromatography (40% of ethyl acetate in hexane) and a further recrystallization in EtOAc/hexane to yield quinolin-6-yl phosphonates 16. Diethyl (2-(4-fluorophenyl)-4-phenylquinolin-6-yl)phosphonate (16a). The general procedure (oxidation of compounds 15 with DDQ) was employed with 15a (0.44 g, 1 mmol) to afford 16a (0.40 g, 91%) as a white solid. Melting point: 137-139oC (ethyl acetate/hexane). 1H RMN (400 MHz, CDCl3): = 1.29-1.33 (m, 6 H, 2 CH3), 4.06-4.19 (m, 4 H, 2 CH2), 7.19-7.26 (m, 2 H), 7.53-7.60 (m, 5 H), 7.84 (s, 1 H), 8.00-8.05 (m, 1 H), 8.20-8.24 (m, 2 H), 8.26-8.29 (m, 1 H), 8.45-8.49 (m, 1 H) ppm. 13C RMN (100 MHz, CDCl3): 16.3 (d, 3JCP = 6.5 Hz, 2 CH3), 62.3 (d, 2JCP = 5.5 Hz, 2 CH2), 115.9 (d, 2JCF = 21.7 Hz, 2 HC), 119.8 (HC), 124.9 (d, 3JCP = 17.3 Hz, C), 126.2 (d, 1JCP = 189.7 Hz, C), 128.9 (2 HC), 128.9 (HC), 129.5 (2 HC), 129.6 (d, 3JCF = 8.5 Hz, 2 HC), 130.4 (d, 2JCP = 3.8 Hz, HC), 130.6 (HC), 131.6 (d, 2JCP = 11.9 Hz, HC), 135.2 (C), 137.4 (C), 150.2 (d, 4JCP = 3.0 Hz, C), 150.3 (C), 157.6 (C), 164.1 (d, 1JCF = 250.2 Hz, C-F) ppm. 31P NMR (120 MHz, CDCl3) 19F NMR crude reaction mixture (282 MHz, CDCl3)-111.9 to -111.7 (m) ppm. HRMS (EI): calculated for C25H23FNO3P [M]+ 435.1400; found 435.1415.
328 31P NMR (120 MHz, CDCl3) HRMS (EI): calculated for C27H30NO4P [M]+ 463.1935; found 463.1942. Diethyl (6-(4-methoxyphenyl)-6,6a,7,11b-tetrahydro-5H-indeno[2,1-c]quinolin-4yl)phosphonate (19b). The general procedure (MCR Povarov) was followed using diethyl (2-aminophenyl)phosphonate 1b (1 mmol, 0.23 g), 4-methoxybenzaldehyde (0.12 mL, 1 mmol), indene (0.14 mL, 1.2 mmol) and BF3·Et2O. The reaction mixture was heated to reflux for 6 h to yield 0.34 g 73%) of a white solid identified as 19b. Melting point: 183-185oC (ethyl acetate/hexane). 1H RMN (400 MHz, CDCl3): = 1.32-1.36 (m, 6 H, 2 CH3), 2.37-2.48 (m, 1 H), 3.20-3.27 (m, 2 H), 3.86 (s, 3 H, OCH3), 4.07-4.24 (m, 5 H), 4.56-4.58 (m, 1 H), 4.83 (s, 1 H) 6.68-6.74 (m, 1 H), 6.886.91 (m, 1 H), 7.07-7.56 (m, 7 H), 7.52-7.56 (m, 2 H) ppm; 13C RMN (100 MHz, CDCl3): = 16.6 (d, 3JCP = 6.4 Hz, 2 CH3), 31.6 (CH2), 46.3 (HC), 47.8 (HC), 55.4 (OCH3), 55.5 (HC), 62.3 (d, 2JCP = 4.9 Hz, 2 OCH2), 109.0 (d, 1JCP = 181.7 Hz, C), 112.4 (HC), 112.7 (HC), 117.0 (d, 3JCP = 15.0 Hz, HC), 118.8 (HC), 124.2 (d, 2JCP = 12.0 Hz, C), 125.2 (HC), 125.3 (HC), 126.6 (HC), 127.4 (HC), 130.0 (HC), 131.8 (d, 3JCP = 6.8 Hz, HC), 135.7 (d, 3JCP = 1.8 Hz, HC), 143.2 (C), 144.1 (C), 146.5 (C), 149.6 (d, 3JCP = 9.3 Hz, C), 160.2 (C) ppm. 31P NMR (120 MHz, CDCl3) HRMS (EI): calculated for C27H30NO4P [M]+ 463.1935; found 463.1910.
329 Diethyl (6-(4-fluorophenyl)-6,6a,7,11b-tetrahydro-5H-indeno[2,1-c]quinolin-4-yl)phosphonate (19c). The general procedure (MCR Povarov) was followed using diethyl (2-aminophenyl)phosphonate 1b (1 mmol, 0.23 g), 4-trifluoromethylbenzaldehyde (0.16 mL, 1 mmol), indene (0.14 mL, 1.2 mmol) and BF3·Et2O. The reaction mixture was heated to reflux for 6 h to yield 0.24 g 48%) of a white solid identified as 19b. Melting point: 157-159oC (ethyl acetate/hexane). 1H RMN (400 MHz, CDCl3): = 1.29-1.36 (m, 6 H, 2 CH3), 2.28-2.37 (m, 1 H), 3.11-3.21 (m, 2 H), 4.01-4.18 (m, 4 H, 2 OCH2), 4.56-4.58 (m, 1 H), 4.86-4.87 (m, 1 H), 6.66-6.71 (m, 1 H), 7.04-7.34 (m, NH and 4 H), 7.48-7.52 (m, 2 H), 7.60-7.67 (m, 4 H) ppm. 13C RMN (100 MHz, CDCl3): = 16.4 (s, 3JCP = 6.7 Hz, CH3), 31.3 (CH2), 46.1 (HC), 47.0 (HC), 56.2 (CH), 62.3 (s, 2JCP = 5.1 Hz, 2 OCH2), 108.9 (d, 1JCP = 181.7 Hz, C), 123.9 (d, 3JCP = 12.1 Hz, C), 124.3 (d, 1JCF = 272.9 Hz, CF3), 125.1-127.4 (m, 8 HC), 131.6 (d, 2JCP = 6.7 Hz, HC), 134.5 (d, 4JCF = 2.6 Hz, HC), 142.7 (C), 146.1 (C), 146.3 (d, 3JCP = 1.3 Hz, C), 149.3 (d, 3JCP = 9.5 Hz, C) ppm. 31P NMR (120 MHz, CDCl3) 19F NMR crude reaction mixture (282 MHz, CDCl3)-62.8. to -62.7 (m) ppm HRMS (EI): calculated for C27H27F3NO3P [M]+ 501,1681; found 501,1685.
330 Diethyl (6-(4-fluorophenyl)-6,6a,7,11b-tetrahydro-5H-indeno[2,1-c]quinolin-2-yl)phosphonate (19d). The general procedure (MCR Povarov) was followed using diethyl (4-aminophenyl)phosphonate 1d (1 mmol, 0.23 g), 3-methoxybenzaldehyde (0.12 mL, 1 mmol), indene (0.14 mL, 1.2 mmol) and BF3·Et2O. The reaction mixture was heated to reflux for 6 h to yield 0.30 g 65%) of a white solid identified as 19d. Melting point: 157-159oC (ethyl acetate/hexane). 1H RMN (400 MHz, CDCl3): 1.15-1.22 (m, 6 H, 2 CH3), 2.30-2.34 (m, 1 H), 3.11-3.17 (m, 2 H), 3.77 (s, 3 H, OCH3), 3.83-3.99 (m, 4 H, 2 OCH2), 4.18 (s, 1 H, NH), 4.46-4.48 (m, 1 H), 4.67-4.69 (m, 1 H), 6.52-6.55 (m, 1 H), 6.78-6.80 (m, 1 H), 6.98-7.09 (m, 5 H), 7.23-7.32 (m, 2 H), 7.47-7.50 (m, 1 H), 7.65-7.69 (m, 1 H) ppm. 13C RMN (100 MHz, CDCl3): = 16.4 (d, 3JCP = 6.7 Hz, CH3), 16.5 (d, 3JCP = 6.7 Hz, CH3), 31.4 (CH2), 45.9 (HC), 47.9 (HC), 55.5 (OCH3), 57.2 (HC), 61.8 (s, 2JCP = 5.3 Hz, OCH2), 61.9 (s, 2JCP = 5.1 Hz, OCH2), 112.5 (HC), 112.8 (HC), 115.3 (d, 3JCP = 16.0 Hz, HC), 116.4 (d, 1JCP = 196.0 Hz, C), 118.9 (HC), 123.6 (d, 3JCP = 15.5 Hz, C), 124.9 (HC), 125.2 (HC), 124.9 (HC), 125.2 (HC), 126.7 (HC), 127.2 (HC), 129.9 (HC), 130.8 (d, 2JCP = 10.8 Hz, HC), 134.1 (d, 2JCP = 11.7 Hz, HC), 142.6 (C), 143.6 (C), 145.8 (C), 149.0 (d, 3JCP = 3.0 Hz, C), 160.0 (C) ppm. 31P NMR (120 MHz, CDCl3) HRMS (EI): calculated for C27H30NO4P [M]+ 463.1912; found 463.1911.
331 Diethyl (6-(4-trifluoromethylphenyl)-6,6a,7,11b-tetrahydro-5H-indeno[2,1-c]quinolin-2yl)phosphonate (19f). The general procedure (MCR Povarov) was followed using diethyl (4-aminophenyl)phosphonate 1d (1 mmol, 0.23 g), 4-trifluoromethylbenzaldehyde (0.16 mL, 1 mmol), indene (0.14 mL, 1.2 mmol) and BF3·Et2O. The reaction mixture was heated to reflux for 6 h to yield 0.34 g 67%) of a white solid identified as 19d. Melting point: 225-227oC (ethyl acetate/hexane). 1H RMN (400 MHz, CDCl3): = 1.15-1.22 (m, 6 H, 2 CH3), 2.22-2.29 (m, 1 H), 3.07-3.16 (m, 2 H), 3.82-4.00 (m, 4 H, 2 OCH2), 4.25 (s, 1 H, NH), 4.47-4.49 (m, 1 H), 4.75-4.78 (m, 1 H), 6.56-6.59 (m, 1 H), 6.94-6.97 (m, 1 H), 7.00-7.10 (m, 2 H), 7.28-7.33 (m, 1 H), 7.48-7.60 (m, 5 H), 7.67-7.70 (m, 1 H) ppm. 13C RMN (100 MHz, CDCl3): = 16.4 (s, 3JCP = 6.7 Hz, CH3), 16.5 (s, 3JCP = 7.0 Hz, CH3), 31.2 (CH2), 45.7 (HC), 47.6 (HC), 57.0 (CH), 61.8 (s, 2JCP = 5.3 Hz, 2 OCH2), 115.5 (d, 3JCP = 15.9 Hz, HC), 116.9 (d, 1JCP = 197.6 Hz, C), 123.4 (d, 3JCP = 15.5 Hz, C), 124.2 (d, 1JCF = 272.1 Hz, CF3), 124.9 (HC), 125.1 (HC), 125.5-130.3 (m, 1 C and 6 HC), 130.8 (d, 2JCP = 10.8 Hz, HC), 134.0 (d, 2JCP = 11.6 Hz, HC), 142.1 (C), 145.5 (C), 146.0 (d, 3JCP = 1.3 Hz, C), 148.6 (d, 3JCP = 3.0 Hz, C) ppm. 31P NMR (120 MHz, CDCl3) 19F NMR crude reaction mixture (282 MHz, CDCl3)-62.9. to -62.7 (m) ppm. HRMS (EI): calculated for C27H27F3NO3P [M]+ 501.1681; found 501.1698.
332 Diethyl (6-(2-methoxyphenyl)-7H-indeno[2,1-c]quinolin-4-yl)phosphonate (20a). The general procedure (MCR Povarov) was followed using diethyl (2-aminophenyl)phosphonate 1b (1 mmol, 0.23 g), 3-methoxybenzaldehyde (0.12 mL, 1 mmol), indene (0.14 mL, 1.2 mmol) and BF3·Et2O. The reaction mixture was heated to reflux for 6 h to yield 0.10 g (22%) of a white solid identified as 20a. Melting point: 143-145oC (ethyl acetate/hexane). 1H RMN (400 MHz, CDCl3): = 1.27-1.32 (m, 6 H, 2 CH3), 3.97 (s, 3 H, OCH3), 4.28-4.42 (m, 6 H), 7.04-7.08 (m, 1 H), 7.45-7.88 (m, 7 H), 8.37-8.47 (m, 2 H), 8.92-8.95 (m, 1 H) ppm. 13C RMN (100 MHz, CDCl3): = 16.6 (d, 3JCP = 6.5 Hz, 2 CH3), 38.1 (CH2), 55.6 (OCH3), 62.6 (d, 2JCP = 5.9 Hz, 2 OCH2), 114.8 (HC), 115.2 (HC), 121.7 (HC), 123.9 (d, 3JCP = 10.7 Hz, HC), 124.1 (HC), 125.4 (HC), 125.7 (d, 2JCP = 16.2 Hz, HC), 127.4 (HC), 128.1 (d, 4JCP = 3.1 Hz, HC), 128.5 (HC), 129.3 (HC), 129.6 (d, 1JCP = 189.5 Hz, C), 134.4 (C), 135.5 (d, 3JCP = 7.1 Hz, HC), 140.2 (C), 141.2 (C), 144.2 (C), 145.9 (d, 4JCP = 2.0 Hz, C), 148.0 (d, 3JCP = 6.7 Hz, C),155.0 (d, 4JCP = 1.2 Hz,C), 159.7 (C) ppm. 31P NMR (120 MHz, CDCl3): HRMS (EI): calculated for C27H30NO4P [M]+ 459.1599; found 459.1603. Diethyl (6-(4-methoxyphenyl)-5H-indeno[2,1-c]quinolin-4-yl)phosphonate (20b). The general procedure (MCR Povarov) was followed using diethyl (2-aminophenyl)phosphonate 1b (1 mmol, 0.23 g), 4-methoxybenzaldehyde (0.12 mL, 1 mmol), indene (0.14 mL, 1.2 mmol)
333 and BF3·Et2O. The reaction mixture was heated to reflux for 6 h to yield 0.05 g 11%) of a white solid identified as 20b. Melting point: 183-185oC (ethyl acetate/hexane). 1H RMN (400 MHz, CDCl3): = 1.27-1.30 (m, 6 H, 2 CH3), 3.96 (s, 3 H, OCH3), 4.25-4.39 (m, 6 H), 7.04-7.07 (m, 1 H), 7.45-7.87 (m, 6 H), 8.37-8.47 (m, 2 H), 8.92-8.95 (m, 1 H) ppm. 13C RMN (100 MHz, CDCl3): = 16.6 (d, 3JCP = 6.0 Hz, 2 CH3), 38.2 (CH2), 55.7 (OCH3), 62.7 (d, 2JCP = 4.9 Hz, 2 OCH2), 114.9 (HC), 115.9 (HC), 121.8 (HC), 124.1 (d, 3JCP = 10.6 Hz, HC), 124.4 (HC), 125.4 (HC), 125.8 (d, 2JCP = 16.1 Hz, HC), 127.6 (HC), 128.2 (HC), 128.6 (HC), 129.4 (HC), 129.8 (d, 1JCP = 189.8 Hz, C), 134.6 (C), 135.6 (d, 3JCP = 6.3 Hz, HC), 140.8 (C), 141.4 (C), 145.2 (C), 146.1 (C), 148.2 (d, 3JCP = 6.0 Hz, C),155.2 (C), 159.8 (C) ppm. 31P NMR (120 MHz, CDCl3) HRMS (EI): calculated for C27H26NO4P [M]+ 459.1599; found 459.1594. Diethyl (6-(2,4-difluorophenyl)-5H-indeno[2,1-c]quinolin-2-yl)phosphonate (20e). The general procedure (MCR Povarov) was followed using diethyl (4-aminophenyl)phosphonate 1d (1 mmol, 0.23 g), 4-methoxybenzaldehyde (0.12 mL, 1 mmol), indene (0.14 mL, 1.2 mmol) and BF3·Et2O. The reaction mixture was heated to reflux for 6 h to yield 0.25 g 55%) of a white solid identified as 20e. Melting point: 138-140oC (ethyl acetate/hexane). 1H RMN (400 MHz, CDCl3): = 1.28-1.32 (m, 6 H, 2 CH3), 3.82 (s, 3 H, OCH3), 4.06-4.21 (m, 6 H), 7.40-7.51 (m, 2 H), 7.59-7.61 (m, 1 H), 7.86-7.95 (m, 3 H), 8.23-8.27 (m, 1 H), 8.47-8.49 (m, 1 H), 9.23-9.27 (m, 1H) ppm. 13C RMN (100 MHz, CDCl3): = 16.6 (d, 3JCP = 6.5 Hz, 2 CH3), 36.1 (CH2), 55.6 (OCH3), 62.5 (d, 2JCP = 5.3 Hz, 2 OCH2), 114.2 (2 HC), 123.1 (d, 2JCP = 17.7 Hz, C), 124.9 (HC), 125.2 (HC), 125.9 (d, 1JCP = 189.1 Hz, C), 129.5 (d, 2JCP = 9.5 Hz, HC), 129.9 (d, 3JCP = 11.5 Hz, HC), 130.5 (2 HC), 131.1 (d, 3JCP = 14.3 Hz, HC), 132.6 (C), 135.2 (d, 4JCP = 1.1 Hz, C), 140.2 (C), 145.1 (C), 146.6 (C), 149.9 (d, 2JCP = 3.1 Hz, C), 157.9 (C), 160.7 (C) ppm.
334 31P NMR (120 MHz, CDCl3) HRMS (EI): calculated for C27H26NO4P [M]+ 459.1599; found 459.1606. Diisopropyl (6-(4-trifluoromethylphenyl)-5H-indeno[2,1-c]quinolin-4-yl)phosphonate (20g). The general procedure (MCR Povarov) was followed using diisopropyl (4aminophenyl)phosphonate 1c (1 mmol, 0.26 g), 4-trifluoromethylbenzaldehyde (0.16 mL, 1 mmol), indene (0.14 mL, 1.2 mmol) and BF3·Et2O. The reaction mixture was heated to reflux for 6 h to yield 0.33 g 62%) of a white solid identified as 20g. Melting point: 164-166oC (ethyl acetate/hexane). 1H RMN (400 MHz, CDCl3): = 1.17 (m, 6 H, 2 CH3), 1.38 (d, 3JHH= 6.2 Hz, 6 H, 2 CH3) 4.25 (s, 2 H, CH2), 4.98-5.06 (m, 2 H, 2 OCH), 7.48-7.57 (m, 2 H), 7.69-7.74 (m, 2 H), 7.81-7.83 (m, 2 H), 8.358.37 (m, 2 H), 8.39-8.45 (m, 2 H), 8.89-8.91 (m, 1 H) ppm. 13C RMN (100 MHz, CDCl3): = 23.8 (d, 3JCP = 4.4 Hz, 2 CH3), 24.3 (d, 3JCP = 2.9 Hz, 2 CH3), 38.1 (CH2), 70.7 (d, 2JCP = 5.5 Hz, 2 CH), 124.0 (d, 3JCP = 11.4 Hz, C), 124.2 (d, 1JCF = 272.5 Hz, CF3), 124.3 (HC), 125.2 (s, 3 HC), 126.1 (d, 2JCP = 16.1 Hz, HC), 127.5 (HC), 127.8 (HC), 128.6 (HC), 129.6 (s, 2 HC), 129.7-131.6 (m, 2 C), 134.0 (C), 135.7 (d, 3JCP = 6.4 Hz, HC), 140.1 (C), 143.3 (C), 144.6 (C), 146.3 (C), 147.9 (d, 3JCP = 6.6 Hz, C), 153.4 (C) ppm. 31P NMR (120 MHz, CDCl3) 19F NMR crude reaction mixture (282 MHz, CDCl3)-62.8. to -62.7 (m) ppm. HRMS (EI): calculated for C29H27F3NO3P [M]+ 525.1681; found 525.1678.
335 General procedures for the preparation of dialkyl 7H-indeno[2,1-c]quinolinyl phosphonates 20 and dialkyl 7-oxo-7H-indeno[2,1-c]quinolinyl phosphonates 21 A) Oxidation of compounds 19 with DDQ DDQ (0.45 g, 2 mmol, 2 equiv.) was added to a solution of the corresponding dialkyl tetrahydroindenoquinolinyl phosphonate 19 (1 mmol) in chloroform (5 mL) and the reaction mixture was stirred and heated to reflux until TLC, 31P NMR and 1H NMR spectroscopy analysis indicated the consumption of the starting material or until no further evolution was observed (2 h). The formed reaction brute was filtered off, dried in vacuo and purified by silica gel flash column chromatography (40% of ethyl acetate in hexane) and a further recrystallization in EtOAc/hexane to yield the corresponding 7H-indeno[2,1-c]quinolinyl phosphonate 20 or dialkyl 7-oxo-7H-indeno[2,1-c]quinolinyl phosphonate 21. B) Oxidation of compounds 19 with Mn(OAc)3 Mn(OAc)3 (2.15 g, 4 mmol, 4 equiv.) was added to a solution of the corresponding dialkyl tetrahydroindenoquinolinyl phosphonate 19 (1 mmol) in acetic acid (15 mL) and the reaction mixture was stirred and heated to reflux until TLC, 31P NMR and 1H NMR spectroscopy analysis indicated the consumption of the starting material or until the reaction does not progress any longer (36 h). The formed reaction brute was extracted with 25 mL of dichloromethane and 25 mL of water and then quenched with a aqueous saturated solution of NaHCO3 (2x 20 mL). The resultant crude oil was dried over MgSO4 and purified by silica gel flash column chromatography (25% of ethyl acetate in hexane) and a further recrystallization in EtOAc/hexane to yield the corresponding 7H-indeno[2,1-c]quinolinyl phosphonate 20 or dialkyl 7-oxo-7H-indeno[2,1c]quinolinyl phosphonate 21.
336 Diethyl (6-(4-trifluoromethylphenyl)- 5H-indeno[2,1-c]quinolin-4-yl)phosphonate (20c). The general procedure A (oxidation of compounds 19 with DDQ) was followed using the diethyl tetrahydro-5H-indeno[2,1-c]quinolin-4-yl phosphonate 19c (0.48 g, 1 mmol) to afford 0.05 g (11%) of a yellow solid identified as 20c. Melting point: 164-166oC (ethyl acetate/hexane). 1H RMN (400 MHz, CDCl3): 1.18-1.20 (m, 6H, 2CH3), 2.22 (dd, 2JHH = 12.5 Hz, 3JHH = 7.8 Hz, 1H, CH2), 3.00-3.07 (m, 2H, CH2 y HC-CH2), 3.91-4.09 (m, 4H, 2OCH2), 4.16 (s, 1H, NH), 4.46 (d, 3JHH = 6.6 Hz, 1H, CH), 4.77 (s, 1H, CH), 6.566.61 (m, 1H), 6.94-7.09 (m, 3H), 7.19-7.27 (m, 1H), 7.39-7.58 (m, 6H) ppm. 13C RMN (100 MHz, CDCl3): = 16.1 (CH3), 16.2 (CH3), 31.1 (CH2), 45.9 (d, 4JCP = 2.4 Hz, HC-C), 47.2 (HC-CH2), 56.0 (HC-N), 62.0 (OCH2), 62.1 (OCH2), 108.8 (d, 1JCP = 182.1 Hz, C), 117.0 (d, 3JCP = 14.9 Hz, HC), 123.8 (d, 3JCP = 12.1 Hz, C), 124.5 (q, 1JCF = 272.1 Hz, CF3), 124.8 (2HC), 125.55 (d, 4JCP = 3.6 Hz, HC), 126.4 (HC), 126.5 (2HC), 127.1 (HC), 129.5 (q, 2JCF = 32.4 Hz, CCF3), 129.6 (HC), 131.43 (d, 2JCP = 6.6 Hz, HC), 134.3 (HC), 142.5 (C), 145.8 (C), 146.4 (C), 149.0 (d, 2JCP = 9.5 Hz, C) ppm. 31P NMR (120 MHz, CDCl3): 19F NMR (282 MHz, CDCl3)-62.8 ppm. HRMS (EI): calculated for C27H23F3NO3P [M]+ 497,1368; found 497,1374.
337 Diethyl 6-(3-methoxyphenyl)-7-oxo-5H-indeno[2,1-c]quinolin-4-yl)phosphonate (21a). The general procedure B (oxidation of compounds 19 with Mn(OAc)3) was followed using the diethyl tetrahydro-5H-indeno[2,1-c]quinolin-4-yl phosphonate 19a (0.47 g, 1 mmol) to afford 0.16 g (33%) of a yellow solid identified as 21a. Melting point: 158-160oC (ethyl acetate/hexane). 1H RMN (400 MHz, CDCl3): = 1.22-1.26 (m, 6 H, 2 CH3), 3.91 (s, 3 H, OCH3), 4.22-4.39 (m, 4 H, 2 OCH2), 7.04-7.07 (m, 2 H), 7.39-7.47 (m, 2 H), 7.56-7.69 (m, 5 H), 8.08-8.10 (m, 1 H), 8.42-8.48 (m, 1 H), 8.65-8.67 (m, 1 H) ppm. 13C RMN (100 MHz, CDCl3): = 16.5 (d, 3JCP = 6.5 Hz, 2 CH3), 55.5 (OCH3), 62.9 (d, 2JCP = 5.9 Hz, 2 OCH2), 115.5 (HC), 116.2 (HC), 122.7 (C), 123.0 (d, 3JCP = 10.5 Hz, HC), 123.2 (HC), 124.5 (HC), 124.6 (HC), 127.0 (d, 2JCP = 15.7 Hz, HC), 128.6 (HC), 129.0 (d, 4JCP = 2.5 Hz, HC), 130.7 (d, 1JCP = 190.1 Hz, C), 131.4 (HC), 133.6 (C), 134.7 (HC), 138.4 (C), 139.1 (d, 3JCP = 6.8 Hz, HC), 141.4 (C), 151.6 (d, 3JCP = 6.6 Hz, C), 153.6 (d, 4JCP = 1.4 Hz,C), 156.3 (C), 159.1 (C), 191.8 (CO) ppm. 31P NMR (120 MHz, CDCl3) HRMS (EI): calculated for C27H24NO5P [M]+ 473,1392; found 473,1398. Diethyl (6-(4-methoxyphenyl)-7-oxo-5H-indeno[2,1-c]quinolin-4-yl)phosphonate (21b). The general procedure A (oxidation of compounds 19 with DDQ) was followed using the diethyl tetrahydro-5H-indeno[2,1-c]quinolin-4-yl phosphonate 19b (0.47 g, 1 mmol) to afford 0.07 g (14%) of a yellow solid identified as 21b.
344
345
346
347
348
349
350
351
352
353
360
361
362
363
364
365
366 VI-2.4. Cleavage-religation equilibrium assay The cleavage-religation equilibrium was investigated by incubating 200 nM of Cy3-labelled DNA -Cy3-ATTTGACCTCGAGAATTATACGAAGTTATTAC- -GTAATAACTTCGTATAATTCTCGAGGTCAAATcontrol), CPT or either compounds 16f, 13s or 19a (as indicated in Chapter II, Figure 49) in a reaction buffer containing 10 mM Tris HCl, 5 mM MgCl2, 5 mM CaCl2 (pH 7.5) for 10 min at 37oC. The reactions were stopped by the addition of SDS to a final concentration of 0.2%, EtOH precipitated and trypsinized following standard protocols as described in the literature95. The reaction products were analyzed in a 20% denaturing polyacrylamide gel and the product visualized by a Typhoon Scannner FLA 9500. VI-2.5. REEAD assay Reagents: all chemicals were purchased from Sigma Aldrich. Phi29 reaction buffer and dNTP were from Thermo Fisher Scientific. The recombinant enzymes Phi29 polimerase and T4 DNA ligase were kindly provided by Dr B.R. Knudsen (Department of Molecular Biology and Genetics, Aarhus University, Aarhus, Denmark). DNA oligonucleotides were purchased from Microsynth Seqlab (Germany). VI-2.5.1. REEAD-on-slide assay DNA oligonucleotides for the REEAD-on-a-slide assay: - - -amine-CCAACCAACCAACCAAATAAG CGATCTTCACAGT- - -AGAAAAATTTTTAAAAAAACTGTGAAGATCGCTTATTT TT TTAAA AATTTTTCTAAGTCTTTTAGATCCCTCAATGCTGCTGCTGTACTACGATCTAAAAGACTTAGA- -amine. - -FAMCCTCAATGCTGCTGCTGTACTACThe REEAD-on-a-slide procedure: The reactions were carried out onto primer-coupled high density (HD) glass slides (#DHD1-0023 Surmodics, Eden Prairie, MN, USA). Then, 25 mm2 squared hydrophobic areas were drawn on the glass surface using a fluorescent mini pap pen (#008877 -amine REEAD primer was coupled to the squares of the slides according to the Surmodics manufacturer descriptions. A total of 1 pmol of the REEAD substrate was hybridized to the primer-coupled squares of the slide for 60 min at 37oC. In total, 200 fmol of TOP1 was incubated with the REEAD dumbbell substrate, coupled to the squares of the slide, -HCl, 5 mM CaCl2, 5 mM MgCl2, and
367 150 mM (pH 7.5) or higher concentrations of NaCl as indicated, for 30 min at 37 oC. The circularization reactions were terminated by addition of 0.3% SDS. The slides were washed for one minute at room temperature in wash buffer 1 (0.1 M Tris-HCl, 150 mM NaCl, and 0.3% SDS, pH 7.5) followed by one minute at room temperature in wash buffer 2 (0.1 M Tris-HCl, 150 mM NaCl, and 0.05% Tween-20, pH 7.5). Finally, the slides were dehydrated in 99.9% ethanol for one minute and air-dried. The RCA was performed for 6 Tris-HCl, 10 mM MgCl2, 10 mM (NH4)2SO4 The RCA reaction was stopped by washing the slide for 10 min in wash buffer 1, followed by one minute in wash buffer 2 and one minute in 99.9% ethanol and the slide was then air-dried. The probe in a buffer containing 20% formamide, 2× SSC (300 mM NaCl, 30 mM sodium citrate) and 5% glycerol for 30 min at 37 oC. The slides were washed for one minute in wash buffer 1 followed by one minute in wash buffer 2, dehydrated with 99.9% ethanol, mounted with Vectashield (#H100 Vector laboratories, Burlingame, CA, USA), and visualized in a Olympus IX73/Olympus IX71 fluorescent microscope. Fifteen pictures for every square of the slide were taken using a 63x/60x objective and the TOP1 activity was quantified counting the fluorescent dots using the Image J software VI-2.5.2. (C/L) REEAD assay DNA oligonucleotides for the (C/L) REEAD assay: - - -amine-CCAACCAACCAACCAAGGAGCCAAACATGTGCATTGAGG- -Cleavage half- -phospho-AAAAATTTTTTCTAAGTCTTTTACCCTCAATGCACATGTTTG GCTCCGTAAAAGACTTAGA- -amine. -Ligator half- -AGAAAAAATTTTTAGCTCGAACTGTGAAGATCGCTTATTCGAGCT- - -FAM-ACTGTGAAGATCGCTTAT- (C/L) REEAD procedure: The reactions were carried out onto primer-coupled HD glass slides as described for the REEAD-on-a-slide. -amine REEAD (C/L) primer was coupled to the squares of the slides according to the Surmodics manufacturer descriptions. In total, 1 pmol of cleavage-half-dumbbell substrate was hybridized to the primer-coupled slides. To measure the effect of the studied compounds on the binding/cleavage step of TOP1 catalytic cycle, 200 fmol
368 of purified TOP1 was added to the cleavage half-dumbbellof a standard TOP1 reaction buffer containing 10 mM Tris-HCl, 5 mM CaCl2, 5 mM MgCl2, 100 mM NaCl (pH 7.5) for 30 min at 37o of the studied compounds. Note, the substrate was added in an approximate five-time surplus compared to enzyme. Since, the enzyme was consumed in this dead-end reaction this ensured sufficient surplus of substrate in the duration of the experiment for the potential inhibitory effect of the added compounds to be measured. The slides were then washed twice for three minutes with a buffer containing 10 mM Tris-HCL (pH 7.5) and 1 mM EDTA to remove all traces 200 pmol ligator-half dumbbell and 500 mM NaCl was added to the squares of the slide and incubated for 60 min at 37oC. The slides were then washed for one minute in wash buffer 1, one minute in wash buffer 2 and one minute in 99.9% ethanol as described in the REEAD-on slide. The circularization reactions w -ligase in a buffer containing 50 mM Tris-HCl, 10 mM MgCl2, 1mM ATP (pH 7.5) for 60 min at 25oC. The slides were washed in wash buffers 1 and 2 and dehydrated. RCA was performed as described in the REEAD-on-aREEAD (C/L) probe in a buffer containing 20% formamide, 2× SSC (300 mM NaCl, 30 mM Sodium citrate) and 5% glycerol for 30 min at 37oC. RCPs were visualized and quantified as described in the REEAD-on-a-slide the literature247. For the measurement of the inhibition of the ligation step of the TOP1 catalytic cycle, cleavage was performed as described above, but in the absence of any added inhibitor. -half dumbbell and 500 mM NaCl was added to the squares of the slide in the presence of 5% DMSO, oC. The circularization and rolling circle amplification were completed as described for the measurement of the inhibition of the REEAD-on-a-slide.
369 VI-3. Cell viability assays VI-3.1. Cell culture A-549 (CCL- -OV-3 (HTB- -5 (CCLwere purchased from the American Type Culture Collection (ATCC). HEK-293 human cell line was obtained from Cell Lines Service (CLS). RPMI-8402 and CPT-K5 human suspension cell lines were kindly gifted by Dr. B.R. Knudsen (Department of Molecular Biology and Genetics, Aarhus University, Aarhus, Denmark). Cells were cultured according to manufacturer´s guidelines in their respectives cell-culture media supplemented with 10% v/v heat- (InvivoGen) antimicrobial agent (*except when doing the siRNA transfection with HEK-293 cells, which were cultured without any antimicrobial agent). RPMI-8402 and CPT-K5 cell lines were cultured with 100 units/mL penicillin and 100 mg/mL streptomycin (Sigma Aldrich) instead of Normoc -culture media: -A-549 cells ere cultured in F12-K medium (Gibco). -SK-OV-3 cells were cultured in Mc Coy 5 a modified medium (Gibco). -MRC-5 cells were cultured in EMEM medium (Gibco). -HEK-293 and HEK 293 KD cells were cultured in DMEM medium (Gibco). -RPMI-8402 and CPT-K5 cells were cultured in RPMI 1640 medium (Gibco). The cell cultures were plated into 25/75/150 cm2 culture flasks for growth in a humidified incubator under standard mammalian cell-culture conditions (37oC, 5% CO2, 90% relative humidity). Monolayer adherent cell lines (A-549, SK-OV-3, HEK-293, HEK-293 KD and MRC-5) were grown attached to a solid support (the bottom of the culture flask) and the media was replaced every 3 days and/or were split to maintain ~70-75% of cell-confluence. The cells were harvested by trypsin treatment for 1 min at 37oC (0.25% trypsin-EDTA solution, Sigma Aldrich) upon two consecutive washes with PBS (phosphate buffered saline). Suspension cell lines (RPMI-8402 and CPT-K5) were grown as single cells. 0.5-0.7·106 cells/mL were seeded and a concentration of 0.3-1.5·106 cell/mL was maintained splitting by dilution or by replacement of the media (by centrifugation at 100 × g for 5 min to resuspend the resultant pellet into fresh media) when the colour indicator turned into yellow (every 4-5 days).
376 A-549 GI50: 1.20 ± 0.12 µM SK-OV-3 GI50: 50 µM HEK-293 GI50: 28.00 ± 2.26 µM MRC-5 GI50: 50 µM
377 A-549 GI50: 1.32 ± 0.15 µM SK-OV-3 GI50: 50 µM HEK-293 GI50: 38.34 ± 3.54 µM MRC-5 GI50: 50 µM
378 A-549 GI50: 1.35 ± 0.53 µM SK-OV-3 GI50: 17.79 ± 5.45 µM HEK-293 GI50: 23.88 ± 4.05 µM MRC-5 GI50: 50 µM
379 A-549 GI50: 1.32 ± 0.21 µM SK-OV-3 GI50: 50 µM HEK-293 GI50: 18.01 ± 3.37 µM MRC-5 GI50: 50 µM
380 A-549 GI50: 3.11 ± 0.65 µM SK-OV-3 GI50: 13.06 ± 1.80 µM HEK-293 GI50: 24.13 ± 1.76 µM MRC-5 GI50: 50 µM
381 A-549 GI50: 1.80 ± 0.41 µM SK-OV-3 GI50: 8.36 ± 0.38 µM HEK-293 GI50: 7.62 ± 0.38 µM MRC-5 GI50: 50 µM
382 A-549 GI50: 1.68 ± 0.39 µM SK-OV-3 GI50: 14.48 ± 1.55 µM HEK-293 GI50: 10.47 ± 0.47 µM MRC-5 GI50: 50 µM
383 A-549 GI50: 6.32 ± 1.09 µM SK-OV-3 GI50: 50 µM HEK-293 GI50: 50 µM MRC-5 GI50: 50 µM
384 A-549 GI50: 7.65 ± 0.90 µM SK-OV-3 GI50: 17.38 ± 1.58 µM HEK-293 GI50: 8.97 ± 0.54 µM MRC-5 GI50: 50 µM
385 A-549 GI50: 2.64 ± 0.43 µM SK-OV-3 GI50: 10.51 ± 2.20 µM HEK-293 GI50: 10.88 ± 0.78 µM MRC-5 GI50: 50 µM
392 A-549 GI50: 3.20 ± 0.35 µM SK-OV-3 GI50: 9.08 ± 0.27 µM HEK-293 GI50: 50 µM MRC-5 GI50: 50 µM
393 A-549 GI50: 12.59 ± 1.34 µM SK-OV-3 GI50: 25.04 ± 3.61 µM HEK-293 GI50: 38.29 ± 8.89 µM MRC-5 GI50: 50 µM
394 A-549 GI50: 26.15 ± 4.01 µM SK-OV-3 GI50: 7.04 ± 0.21 µM HEK-293 GI50: 10.84 ± 0.98 µM MRC-5 GI50: 35.11 ± 5.58 µM
395 A-549 GI50: 3.18 ± 0.27 µM SK-OV-3 GI50: 1.33 ± 0.76 µM HEK-293 GI50: 48.14 ± 6.39 µM MRC-5 GI50: 50 µM
396 A-549 GI50: 1.47 ± 0.12 µM SK-OV-3 GI50: 30.80 ± 2.82 µM HEK-293 GI50: 7.77 ± 0.22 µM MRC-5 GI50: 50 µM
397 A-549 GI50: 1.49 ± 0.10 µM SK-OV-3 GI50: 9.68 ± 0.75 µM HEK-293 GI50: 27.17 ± 3.45 µM MRC-5 GI50: 32.03 ± 13.51 µM
398 A-549 GI50: 1.61 ± 0.17 µM SK-OV-3 GI50: 10.24 ± 0.39 µM HEK-293 GI50: 50 µM MRC-5 GI50: 50 µM
399 A-549 GI50: 2.72 ± 0.37 µM SK-OV-3 GI50: 10.59 ± 1.13 µM HEK-293 GI50: 22.66 ± 1.36 µM MRC-5 GI50: 50 µM
400 A-549 GI50: 2.27 ± 0.33 µM SK-OV-3 GI50: 9.29 ± 1.79 µM HEK-293 GI50: 24.43 ± 3.46 µM MRC-5 GI50: 50 µM
401 A-549 GI50: 3.07 ± 0.22 µM SK-OV-3 GI50: 9.79 ± 0.59 µM HEK-293 GI50: 15.66 ± 1.74 µM MRC-5 GI50: 50 µM