Ci a ion: Suá ez, N.M.;
Jeba i-Benslaiman, S.;
Jiménez-Monzón, R.; Beni o-Vicen e,
A.; B i o-Casillas, Y.; Ga cés, L.;
González-Lleo, A.M.; Tugo es, A.;
Bo ona , M.; Ma in, C.; e al. Age,
O igin and Func ional S udy o he
P e alen LDLR Mu a ion Causing
Familial Hype choles e olaemia in
G an Cana ia. In . J. Mol. Sci. 2023,
24, 11319. h ps://doi.o g/10.3390/
ijms241411319
Academic Edi o s: Joan Ca les
Escolà-Gil and NoemíRo llan
Recei ed: 16 May 2023
Re ised: 13 June 2023
Accep ed: 5 July 2023
Published: 11 July 2023
Copy igh : © 2023 by he au ho s.
Licensee MDPI, Basel, Swi ze land.
This a icle is an open access a icle
dis ibu ed unde he e ms and
condi ions o he C ea i e Commons
A ibu ion (CC BY) license (h ps://
c ea i ecommons.o g/licenses/by/
4.0/).
In e na ional Jou nal o
Molecula Sciences
A icle
Age, O igin and Func ional S udy o he P e alen LDLR
Mu a ion Causing Familial Hype choles e olaemia in
G an Cana ia
Nicolás M. Suá ez 1,† , Shi a Jeba i-Benslaiman 2,† , Robe o Jiménez-Monzón1, Asie Beni o-Vicen e 2,
Ye ay B i o-Casillas 1, Laida Ga cés2, Ana M. González-Lleo 1,3 , An onio Tugo es 4, Mau o Bo ona 1,3 ,
Césa Ma in 2, Ana M. Wägne 1,3,* and Rosa M. Sánchez-He nández 1,3,*
1Ins i u o Uni e si a io de In es igaciones Biomédicas y Sani a ias, Uni e sidad de Las Palmas de
G an Cana ia, 35016 Las Palmas de G an Cana ia, Spain; [email p o ec ed] (N.M.S.);
[email p o ec ed] (R.J.-M.); ye ay[email p o ec ed] (Y.B.-C.); [email p o ec ed] (A.M.G.-L.);
[email p o ec ed] (M.B.)
2Depa amen o de Bioquímica y Biología Molecula , Ins i u o Bio isika (UPV/EHU, CSIC), Uni e sidad del
País Vasco UPV/EHU, Bilbao, 48940 Leioa, Spain; [email p o ec ed] (S.J.-B.); asie [email p o ec ed] (A.B.-V.);
[email p o ec ed] (L.G.); cesa [email p o ec ed] (C.M.)
3Sección de Endoc inología y Nu ición, Complejo Hospi ala io Uni e si a io Insula Ma e no-In an il de
G an Cana ia (CHUIMI), 35016 Las Palmas de G an Cana ia, Spain
4Unidad de In es igación, CHUIMI, 35016 Las Palmas de G an Cana ia, Spain; [email p o ec ed]
*Co espondence: [email p o ec ed] (A.M.W.); [email p o ec ed] (R.M.S.-H.)
†These au ho s con ibu ed equally o his wo k.
Abs ac :
The p.(Ty 400_Phe402del) mu a ion in he LDL ecep o (LDLR) gene is he mos equen
cause o amilial hype choles e olaemia (FH) in G an Cana ia. The aim o his s udy was o de e mine
he age and o igin o his p e alen ounde mu a ion and o explo e i s unc ional consequences.
Fo his pu pose, we ob ained he haplo ypic in o ma ion o 14 mic osa elli e loci su ounding he
mu a ion in one homozygous indi idual and 11 un ela ed he e ozygous amily ios. Eigh di e en
mu a ion ca ie haplo ypes we e iden i ied, which we e es ima ed o o igina e om a common
ances al haplo ype 387 (110–1572) yea s ago. This es ima ion sugges s ha his mu a ion happened
a e he Spanish colonisa ion o he Cana y Islands, which ook place du ing he i een h cen u y.
Comp ehensi e unc ional s udies o his mu a ion showed ha he exp essed LDL ecep o was
e ained in he endoplasmic e iculum, p e en ing i s mig a ion o he cell su ace, hus allowing us
o classi y his LDLR mu a ion as a class 2a, de ec i e, pa hogenic a ian .
Keywo ds:
amilial hype choles e olaemia; ounde e ec ; mu a ion; LDLR gene; o igin; G an Cana ia
1. In oduc ion
Familial hype choles e olaemia (FH, OMIM 144400) is an au osomal codominan
diso de ha a ec s 34 million people wo ldwide [
1
]. FH is cha ac e ised by inc eased
low-densi y lipop o ein choles e ol (LDL-C) concen a ions, which lead o p ema u e
a he oscle o ic ca dio ascula disease (ASCVD) and choles e ol deposi s in he co nea and
endons [2].
FH is caused by an a ay o pa hogenic a ian s a ec ing genes ha egula e choles-
e ol me abolism [
3
]. Mos o hese pa hogenic a ian s a e loca ed in he LDL ecep o
(LDLR) gene, esul ing in 80% o he cases o FH, wi h mo e han 4000 a ian s desc ibed
so a in he Human Gene Mu a ion Da abase. The he e ozygous o m o FH (HeFH) is
he mos common, wi h a p e alence o 1:200–250 people [
4
], whe eas he mo e se e e
homozygous o m (HoFH) occu s wi h a equency o 1:250,000 o 360,000 [5].
The gene ic isola ion o ce ain popula ions has led o an inc ease in he equencies o
some a ian s ia ounde e ec s. This phenomenon has been epo ed in A ikane s [
6
],
In . J. Mol. Sci. 2023,24, 11319. h ps://doi.o g/10.3390/ijms241411319 h ps://www.mdpi.com/jou nal/ijms
In . J. Mol. Sci. 2023,24, 11319 2 o 12
Ashkenazi Jews [
7
], F ench Canadians [
8
], Lebanese [
9
], Finns [
10
], and ecen ly in he
Cana y Islands popula ion [
11
]. Al hough FH displays b oad gene ic he e ogenei y in
gene al— he mos equen a ian in Spain ep esen s only 7% o FH cases [
12
]—almos
70% o FH cases wi h a posi i e gene ic diagnosis in he island o G an Cana ia a e due
o a single mu a ion (p.[Ty 400_Phe402del]) in LDLR, which is associa ed wi h se e e
hype choles e olaemia and inc eased ca dio ascula isk [
13
]. In e es ingly, his mu a ion
has only been epo ed in G an Cana ians [
14
], sugges ing i o igina ed in he popula ion
o his island.
Al hough he gene ic backg ound o Cana ian people is mainly Caucasian as a esul o
he Spanish conques du ing he 15 h cen u y [
15
], se e al s udies ha e demons a ed ha
a signi ican abo iginal con ibu ion om No h A ican popula ions s ill emains [
16
,
17
].
This abo iginal con ibu ion has been linked o he sp ead o inhe i able diso de s, as
demons a ed by he p esence o speci ic mu a ions causing a e, ecessi e diso de s, such
as Wilson’s disease [18] and ype 2 y osinemia [19].
Es ima ing he age o he p.(Ty 400_Phe402del) mu a ion would be ins umen al o
de e mine whe he his gene ic a ian a ose in G an Cana ia o has been in oduced
by con empo a y mig a ion. In addi ion, i can p o ide ele an in o ma ion abou he
e olu iona y p ocesses d i ing i s cu en equency in he popula ion o G an Cana ia.
Se e al me hods using geno yping da a ha e been de eloped in o de o es ima e he age
o he a ian o in e es o he mos ecen common ances o o i s ca ie s [20–22].
Fu he mo e, al hough amily s udies ha e been pe o med ha con i m he seg e-
ga ion o his a ian wi h hype choles e olaemia and ASCVD [
11
], an
in i o
unc ional
s udy o con i m pa hogenici y has no ye been pe o med.
The aim o his s udy is o es ima e he age o his ounde mu a ion o unde s and
he gene ic epidemiology o his a ian in he popula ion o G an Cana ia and o pe o m
a unc ional s udy in o de o p opose a mechanism by which he p.(Ty 400_Phe402del)
mu a ion gene a es he FH pheno ype.
2. Resul s
2.1. Demog aphic, Clinical and Gene ic Cha ac e isa ion
A o al o 11 un ela ed amily ios o p.(Ty 400_Phe402del)-mu a ion ca ie s and
a homozygous indi idual we e analysed. The clinical in o ma ion o mu a ion ca ie s
is desc ibed in Table 1. B ie ly, p.(Ty 400_Phe402del) ca ie s exhibi e y high le els o
LDL-c, and o e 42% o hem p esen endinous xan homas. In addi ion, he Du ch Lipid
Clinic Ne wo k (DLCN) sco e is highe han 8 in all he subjec s.
Table 1. Demog aphic and clinical in o ma ion o p.(Ty 400_Phe402del) ca ie s.
Gende (% emales) 42.3
Age (yea s) 45.1 ±18.4
BMI (Kg/m2)25.5 ±5.2
Tendinous xan homas (%) 42.3
ASCVD (%) 15.4
To al choles e ol (mg/dL) 385.1 ±69.2
HDL-c (mg/dL) 62.2 ±20.3
LDL-c (mg/dL) 299.2 ±60.7
T iglyce ides (mg/dL) 100.2 ±42
Lipop o ein (a) (mg/dL), median [IQR] 30 [13.5–85]
Values co espond o a e age
±
s anda d de ia ion unless o he wise speci ied. BMI, body mass index; ASCVD,
a he oscle o ic ca dio ascula disease; HDL-c, high-densi y lipop o ein choles e ol; LDL-c, low-densi y lipop o ein
choles e ol; IQR, in e qua ile ange.
In . J. Mol. Sci. 2023,24, 11319 3 o 12
Fou een au osomal mic osa elli e loci lanking he p.(Ty 400_Phe402del) mu a ion
we e analysed o all 82 indi iduals (34 mu a ion ca ie s and ela i es, and 48 con ols).
All bu one locus ( inucleo ide) con ained dinucleo ide epea s and p esen ed om 6
o
16 di e en alleles
(Table 2). Signi ican de ia ions om HWE due o he e ozygo e
de iciency we e de ec ed in wo loci (L5 and R1). As expec ed, conside ing hei genomic
p oximi y, se e al locus combina ions showed signi ican LD (Supplemen a y Table S1).
Table 2.
P ime sequences, desc ip ion, and cha ac e isa ion o he ou een mic osa elli e loci analysed.
Locus. P ime Sequence (50-30)
Fo wa d
P ime Sequence (50-30)
Re e se Label aRepea
Mo i Genomic Loca ion ‡NAHO* HE*
L10 GAGGCTGAGACGGGAGAATC TTCCCCAACACACAAAGCAG 6-FAM CA 8,284,611 8,284,940 13 0.833 0.825
L9 CATGCTCAGCTTCCCAAGAC AGGTGGAGGTTGCAGTGAG PET GT 8,518,249 8,518,442 6 0.712 0.680
L8 GACTTAGAATGGTGCCTGGC AAAATTAGCTGGGCACGGTG NED GT 8,622,652 8,622,894 9 0.551 0.592
L7 GTTTCTCACGGCTGACTTGG CACCTGGCCTCACTTGATGT VIC AG 8,694,731 8,695,961 12 0.897 0.889
L6 GGATGAGTGTGCTTTCTACCC GGCCCCATATGAACCGTTTC 6-FAM GT 8,928,205 8,928,445 7 0.645 0.745
L5 GCTATTTGGGGTCTCTATCAATG GAAATCGCACAGTATTTGTCTCAC VIC CA 9,067,697 9,067,918 13 0.667 0.821
L4 AGAAGCTAGGACCACAGACG ATGCACACCTGTAGTCCCAG NED TG 9,501,287 9,501,509 10 0.854 0.821
L3 GGGTCTGAGGATGTTTCTGC GCAAATATCCACTGCCCTTG NED GT 10,451,997 10,452,137 9 0.658 0.670
L2 GGGTGCTAGGATTTGGGACT CATTTGGTCTTGCTCCTCTGA PET GT 10,794,316 10,794,475 9 0.444 0.445
L1 AGTGTGGAAGGAAAAGGGAC CCAATTCTAGATGGGTCG 6-FAM ATA 11,092,150 11,092,197 6 0.256 0.246
R1 TCCAGCAATTGTTCCCATTCTC TACACAAACATTAGCCGGGC 6-FAM TA 11,609,282 11,609,694 16 0.274 0.646
R2 AGATCGCACCACTGTACTCC TTCCCGCCTAGTAACGGAC VIC CA 11,815,227 11,815,384 16 0.793 0.829
R3 TCTTCCCATTGCAGTTGTGG AACACCCTCCCCATGTACAC PET GT 12,988,231 12,988,486 9 0.778 0.708
R4 ATAGGCCAAGACTGTCTAAAACAA GCCCTAACTGCTGTAAGAGAACT 6-FAM CA 13,730,141 13,730,344 9 0.737 0.683
a
Labelled p ime s a e depic ed in bold on .
‡
Genomic loca ion based on Human Genome Assembly
(GRCh38.p13). N
A
, numbe o alleles. H
O
, obse ed he e ozygosi y. H
E
, expec ed he e ozygosi y. * Values
ob ained om con ols. Loci depa ing om Ha dy–Weinbe g equilib ium (p< 0.05) a e unde lined.
2.2. Age o he p.(Ty 400_Phe402del) Mu a ion
To es ima e he age o he p.(Ty 400_Phe402del) mu a ion, haplo ypic in o ma ion o
he 14 mic osa elli es analysed we e deduced in ca ie s using hei i s -deg ee ela i es. A
o al o eigh di e en haplo ypes we e iden i ied (Table 3).
Assuming a ‘co ela ed’ genealogy, which conside s he possibili y o he mu a ion
age being mo e ecen han he mos ecen common ances o o he analysed popula ion,
he mu a ion a ose 15.5 gene a ions ago, wi h a con idence in e al o 4.4–62.9.
In . J. Mol. Sci. 2023, 24, x FOR PEER REVIEW 4 o 12
.
Mic osa elli e Ma ke s (Dis ance (cM) om he Mu a ion)
L10
(4.69)
L9
(4.19)
L8
(4.04)
L7
(3.82)
L6
(3.20)
L5
(2.89)
L4
(1.85)
L3
(0.38)
L2
(0.05)
L1
(0.01)
p.(Ty 400_Phe402del)
R1
(0.99)
R2
(1.31)
R3
(2.16)
R4
(4.17)
Haplo ypes ( equency)
1 (54.8%) 327 193 241 225 245 225 226 143 163 119 374 159 256 205
2 (3.2%) 329 193 243 225 245 225 226 143 163 119 374 159 256 205
3 (16.1%) 327 193 241 225 245 225 226 143 163 119 374 159 260 205
4 (12.9%) 335 203 241 225 245 225 226 143 163 119 374 159 256 205
5 (3.2%) 335 203 241 225 245 225 226 143 163 119 374 159 256 207
6 (3.2%) 327 193 241 225 245 225 224 143 163 119 374 159 260 205
7 (3.2%) 335 193 241 225 245 225 226 143 163 119 374 159 256 205
8 (3.2%) 339 203 241 239 245 225 226 143 163 119 388 159 260 205
Gene a ions (yea s) CI-lowe CI-uppe
Assuming a
‘co ela ed’
genealogy
15.5 [387] 4.4 [110] 62.9 (1,572)
Cells in o ange indica e he loca ion o he mu a ion (see Figu e 1, Panel B). Cells in blue indica e
he di e en alleles ha de ine a speci ic haplo ype. Comple e geno yping in o ma ion is desc ibed
in Supplemen a y Table S2.
.
Figu e 1. Schema ic ep esen a ion o (i) he genomic loca ion o he analysed egion (in blue) wi hin
ch omosome 19 (A); (ii) he genomic loca ion o he analysed mic osa elli es (L, le side o he mu-
a ion; R, igh side o he mu a ion) and he LDLR gene (in ed) wi hin he analysed egion (B); (iii)
he s uc u e o he LDLR gene (C); and (i ) he p.(Ty 400_Phe402del) mu a ion (in ed), wi h he
co esponding amino acid changes ( op and bo om sequences) (D). Numbe s below panels A–C
indica e he loca ion in base pai s co esponding o he Human Genome Assembly (GRCh38.p13).
2.3. Exp ession o he p.(Ty 400_Phe402del) LDLR Va ian in CHO-ldlA7 Cells
Exp ession o he p.(Ty 400_Phe402del) LDLR a ian was analysed by Wes e n blo
and low cy ome y in CHO-ldlA7- ans ec ed cells, as desc ibed in Sec ion 4 (Ma e ials
and Me hods). Fo su ace exp ession analysis by low cy ome y, wo a ian s we e used
as in e nal me hod con ols, p.(T p87)* (a null allele mu an ) and he Ex3_4del LDLR a -
ian ha is exp essed o a simila ex en as w LDLR bu is a class 3 a ian wi h 100%
impai ed binding ac i i y [23]. As shown in Figu e 2A, he p.(Ty 400_Phe402del) LDL
a ian is no exp essed a he memb ane su ace compa ed o w - ans ec ed cells (w :
100 ± 2.0; p.[Ty 400Phe402del]: 14.8 ± 4.5).
To con i m whe he p.(Ty 400_Phe402del) is no exp essed in i s ma u e o m, LDLR
exp ession was assessed 48 h pos - ans ec ion. As shown in Figu e 2B, only he exp es-
sion o imma u e p.(Ty 400_Phe402del) was de ec ed by Wes e n blo , con i ming he
low cy ome y esul s.
Ch omosome 19
19p13.2
LDLR
(~ 44.5Kb)
Mic osa elli es L1L2L3 R1 R2L4L5 R3 R4
Analyzed egion
(~ 5.5Mb)
p.(Ty 400_Phe402del)
8,284,611
13,730,344
S I A Y L F F T N R H E V R K M T L D
GC TCC ATC GCC TAC CTC TTC TTC ACC AAC CGG CAC GAG GTC AGG AAG ATG ACG CTG GAC
GC TCC ATC GCC T-- --- --- -TC ACC AAC CGG CAC GAG GTC AGG AAG ATG ACG CTG GAC
S I A F T N R H E V R K M T L D
L9 L8 L6L7
11,089,463
11,133,820
Exons
12345678910111214151816 1713
L10
1
58,617,616
A
B
C
D
Figu e 1.
Schema ic ep esen a ion o (i) he genomic loca ion o he analysed egion (in blue) wi hin
ch omosome 19 (
A
); (ii) he genomic loca ion o he analysed mic osa elli es (L, le side o he mu a-
ion; R, igh side o he mu a ion) and he LDLR gene (in ed) wi hin he analysed egion (
B
); (iii) he
s uc u e o he LDLR gene (
C
); and (i ) he p.(Ty 400_Phe402del) mu a ion (in ed), wi h he co e-
sponding amino acid changes ( op and bo om sequences) (
D
). Numbe s below
panels A–C indica e
he loca ion in base pai s co esponding o he Human Genome Assembly (GRCh38.p13).
In . J. Mol. Sci. 2023,24, 11319 4 o 12
Table 3.
Haplo ypes (cons ella ion o alleles (size in base pai s) o he ou een mic osa elli es
analysed) ca ying he p.(Ty 400_Phe402del) mu a ion, and es ima ion o i s age in gene a ions (and
yea s, assuming 25 yea s pe gene a ion) wi h a 95% con idence in e al (CI).
Mic osa elli e Ma ke s (Dis ance (cM) om he Mu a ion)
L10
(4.69)
L9
(4.19)
L8
(4.04)
L7
(3.82)
L6
(3.20)
L5
(2.89)
L4
(1.85)
L3
(0.38)
L2
(0.05)
L1
(0.01)
R1
(0.99)
R2
(1.31)
R3
(2.16)
R4
(4.17)
Haplo ypes ( equency)
1
(54.8%) 327 193 241 225 245 225 226 143 163 119 374 159 256 205
2
(3.2%) 329 193 243 225 245 225 226 143 163 119 374 159 256 205
3
(16.1%) 327 193 241 225 245 225 226 143 163 119 374 159 260 205
4
(12.9%) 335 203 241 225 245 225 226 143 163 119 374 159 256 205
5
(3.2%) 335 203 241 225 245 225 226 143 163 119 374 159 256 207
6
(3.2%) 327 193 241 225 245 225 224 143 163 119 374 159 260 205
7
(3.2%) 335 193 241 225 245 225 226 143 163 119 374 159 256 205
8
(3.2%) 339 203 241 239 245 225 226 143 163 119
p.(Ty 400_Phe402del)
388 159 260 205
Gene a ions (yea s) CI-lowe CI-uppe
Assuming a
‘co ela ed’
genealogy
15.5 [387] 4.4 [110] 62.9 (1572)
Cells in o ange indica e he loca ion o he mu a ion (see Figu e 1, Panel B). Cells in blue indica e he di e en
alleles ha de ine a speci ic haplo ype. Comple e geno yping in o ma ion is desc ibed in
Supplemen a y Table S2.
2.3. Exp ession o he p.(Ty 400_Phe402del) LDLR Va ian in CHO-ldlA7 Cells
Exp ession o he p.(Ty 400_Phe402del) LDLR a ian was analysed by Wes e n blo
and low cy ome y in CHO-ldlA7- ans ec ed cells, as desc ibed in Sec ion 4(Ma e ials and
Me hods). Fo su ace exp ession analysis by low cy ome y, wo a ian s we e used as
in e nal me hod con ols, p.(T p87)* (a null allele mu an ) and he Ex3_4del LDLR a ian
ha is exp essed o a simila ex en as w LDLR bu is a class 3 a ian wi h 100% impai ed
binding ac i i y [
23
]. As shown in Figu e 2A, he p.(Ty 400_Phe402del) LDL a ian is
no exp essed a he memb ane su ace compa ed o w - ans ec ed cells (w : 100
±
2.0;
p.[Ty 400Phe402del]: 14.8 ±4.5).
To con i m whe he p.(Ty 400_Phe402del) is no exp essed in i s ma u e o m, LDLR
exp ession was assessed 48 h pos - ans ec ion. As shown in Figu e 2B, only he exp ession
o imma u e p.(Ty 400_Phe402del) was de ec ed by Wes e n blo , con i ming he low
cy ome y esul s.
2.4. LDL Up ake Ac i i y o he p.(Ty 400_Phe402del) LDLR Va ian in CHO-ldlA7 Cells
Ac i i y o he p.(Ty 400 Phe402del) LDLR a ian was also assessed in CHO-ldlA7-
ans ec ed cells as desc ibed in Sec ion 4(Ma e ials and Me hods). As shown in Figu e 3,
LDL up ake by p.(Ty 400 Phe402del) showed only esidual LDLR ac i i y (w : 100
±
3;
p.[Ty 400 Phe402del]: 17 ±5).
In . J. Mol. Sci. 2023,24, 11319 5 o 12
In . J. Mol. Sci. 2023, 24, x FOR PEER REVIEW 5 o 12
Figu e 2. Exp ession o he p.(Ty 400_Phe402del) LDLR a ian de e mined by (A) low cy ome y
and (B) Wes e n blo . Exp ession o LDLR a ian s was assessed in CHO-ldlA7- ans ec ed cells as
desc ibed in Sec ion 4 (Ma e ials and Me hods). LDLR exp ession was assessed, by low cy ome y
and Wes e n blo 48 h pos - ans ec ion wi h he plasmids ca ying he di e en LDLR a ian s. The
alues in A ep esen s he mean o iplica es (n = 3). A ep esen a i e blo is shown in panel B. E o
ba s in A ep esen ± SD. * p < 0.001 compa ed o w using S uden ’s - es .
2.4. LDL Up ake Ac i i y o he p.(Ty 400_Phe402del) LDLR Va ian in CHO-ldlA7 Cells
Ac i i y o he p.(Ty 400 Phe402del) LDLR a ian was also assessed in CHO-ldlA7-
ans ec ed cells as desc ibed in Sec ion 4 (Ma e ials and Me hods). As shown in Figu e 3,
LDL up ake by p.(Ty 400 Phe402del) showed only esidual LDLR ac i i y (w : 100 ± 3;
p.[Ty 400 Phe402del]: 17 ± 5).
Figu e 3. LDL up ake by he p.(Ty 400_Phe402del) LDLR a ian de e mined by low cy ome y.
LDL up ake by he LDLR a ian s was assessed in CHO-ldlA7- ans ec ed cells as desc ibed in Sec-
ion 4 (Ma e ials and Me hods). LDL up ake was assessed, using low cy ome y, 48 h pos -
Figu e 2.
Exp ession o he p.(Ty 400_Phe402del) LDLR a ian de e mined by (
A
) low cy ome y
and (
B
) Wes e n blo . Exp ession o LDLR a ian s was assessed in CHO-ldlA7- ans ec ed cells as
desc ibed in Sec ion 4(Ma e ials and Me hods). LDLR exp ession was assessed, by low cy ome y
and Wes e n blo 48 h pos - ans ec ion wi h he plasmids ca ying he di e en LDLR a ian s. The
alues in A ep esen s he mean o iplica es (n= 3). A ep esen a i e blo is shown in panel B. E o
ba s in A ep esen ±SD. * p< 0.001 compa ed o w using S uden ’s - es .
In . J. Mol. Sci. 2023, 24, x FOR PEER REVIEW 5 o 12
Figu e 2. Exp ession o he p.(Ty 400_Phe402del) LDLR a ian de e mined by (A) low cy ome y
and (B) Wes e n blo . Exp ession o LDLR a ian s was assessed in CHO-ldlA7- ans ec ed cells as
desc ibed in Sec ion 4 (Ma e ials and Me hods). LDLR exp ession was assessed, by low cy ome y
and Wes e n blo 48 h pos - ans ec ion wi h he plasmids ca ying he di e en LDLR a ian s. The
alues in A ep esen s he mean o iplica es (n = 3). A ep esen a i e blo is shown in panel B. E o
ba s in A ep esen ± SD. * p < 0.001 compa ed o w using S uden ’s - es .
2.4. LDL Up ake Ac i i y o he p.(Ty 400_Phe402del) LDLR Va ian in CHO-ldlA7 Cells
Ac i i y o he p.(Ty 400 Phe402del) LDLR a ian was also assessed in CHO-ldlA7-
ans ec ed cells as desc ibed in Sec ion 4 (Ma e ials and Me hods). As shown in Figu e 3,
LDL up ake by p.(Ty 400 Phe402del) showed only esidual LDLR ac i i y (w : 100 ± 3;
p.[Ty 400 Phe402del]: 17 ± 5).
Figu e 3. LDL up ake by he p.(Ty 400_Phe402del) LDLR a ian de e mined by low cy ome y.
LDL up ake by he LDLR a ian s was assessed in CHO-ldlA7- ans ec ed cells as desc ibed in Sec-
ion 4 (Ma e ials and Me hods). LDL up ake was assessed, using low cy ome y, 48 h pos -
Figu e 3.
LDL up ake by he p.(Ty 400_Phe402del) LDLR a ian de e mined by low cy ome y. LDL
up ake by he LDLR a ian s was assessed in CHO-ldlA7- ans ec ed cells as desc ibed in Sec ion 4
(Ma e ials and Me hods). LDL up ake was assessed, using low cy ome y, 48 h pos - ans ec ion
wi h he plasmids ca ying he di e en LDLR a ian s. The alues ep esen he mean o iplica es
(n= 3) ±SD. * p< 0.001 compa ed o w using S uden ’s - es .
In . J. Mol. Sci. 2023,24, 11319 6 o 12
2.5. p.(Ty 400_Phe402del) LDLR Va ian Classi ica ion by Con ocal Mic oscopy
To u he analyse he ype o de ec p oduced by he in- ame dele ion o Ty 400_Phe402
esidues, we s udied whe he he imma u e exp essed o m o he p.(Ty 400_Phe402del)
LDLR a ian colocalised wi h cal egulin, an endoplasmic e iculum (ER) ma ke , using a
con ocal mic oscope. Con ocal images show ha he a ian is exp essed in ans ec ed
cells, bu emains clea ly e ained in he ER, as indica ed by he high colocalisa ion wi h
cal egulin (Figu e 4), which co obo a es he expe imen al da a ob ained by low cy ome y
and Wes e n blo . Acco dingly, he p.(Ty 400_Phe402del) LDLR a ian should be classi ied
as a class 2a, de ec i e, pa hogenic a ian .
In . J. Mol. Sci. 2023, 24, x FOR PEER REVIEW 6 o 12
ans ec ion wi h he plasmids ca ying he di e en LDLR a ian s. The alues ep esen he mean
o iplica es (n = 3) ± SD. * p < 0.001 compa ed o w using S uden ’s - es .
2.5. p.(Ty 400_Phe402del) LDLR Va ian Classi ica ion by Con ocal Mic oscopy
To u he analyse he ype o de ec p oduced by he in- ame dele ion o
Ty 400_Phe402 esidues, we s udied whe he he imma u e exp essed o m o he
p.(Ty 400_Phe402del) LDLR a ian colocalised wi h cal egulin, an endoplasmic e icu-
lum (ER) ma ke , using a con ocal mic oscope. Con ocal images show ha he a ian is
exp essed in ans ec ed cells, bu emains clea ly e ained in he ER, as indica ed by he
high colocalisa ion wi h cal egulin (Figu e 4), which co obo a es he expe imen al da a
ob ained by low cy ome y and Wes e n blo . Acco dingly, he p.(Ty 400_Phe402del)
LDLR a ian should be classi ied as a class 2a, de ec i e, pa hogenic a ian .
Figu e 4. The p.(Ty 400_Phe402del) LDLR a ian colocalised wi h cal egulin in he ER. Con ocal
analysis o LDLR colocalisa ion wi h he ER was pe o med in w and p.(Ty 400_Phe402del) LDLR
a ian wi h he ER-speci ic ma ke cal egulin. T ans ec ed cells we e immunos ained, as desc ibed
in Sec ion 4 (Ma e ials and Me hods). The images show a ep esen a i e indi idual cell (magni ica-
ion 60×).
3. Discussion
In his s udy we aimed o e eal he age and o igin o he p.(Ty 400_Phe402del) LDLR
mu a ion and he unc ional consequences on he exp essed LDLR a ian . To his end,
we selec ed an op imally dis anced [24] se o 14 mic osa elli es spanning 8.86 cM a ound
he a ian (p.[Ty 400_Phe402del]), and applied a me hod based on ances al segmen
leng hs [22] using ine mapping wi h LD. In he analysed coho , we iden i ied eigh di -
e en haplo ypes. Conside ing a ecu en 9 bp dele ion is ex emely a e, we assumed
he di e en a ian ca ie haplo ypes de ec ed in he G an Cana ia popula ion de i e
om a common ances al haplo ype (i.e., co ela ed genealogy). The e o e, his scena io
i s wi h a gene ic signa u e o a ounde e ec , in which all he mu a ion ca ie s ha e
inhe i ed he a ian om a common ances o a ising in he popula ion abou 387 yea s
ago. Al hough he con idence in e al ob ained was a he wide (110 o 1572 yea s), his
es ima ion pos da es he one-cen u y-long Spanish colonisa ion o he Cana y Islands,
which ended in 1496 wi h he su ende o Tene i e [15]. A e his d ama ic episode, he
Eu opean colonisa ion o he Cana y Islands in ol ed a mix o Spanish, Po uguese, I al-
ian and Flemish colonise s, who, in addi ion o he sub-Saha an A icans and Moo ish
sla es’ con ibu ion [25], ha e p o ided he gene ic backg ound o he con empo a y Ca-
na ian popula ion.
Figu e 4.
The p.(Ty 400_Phe402del) LDLR a ian colocalised wi h cal egulin in he ER. Con ocal
analysis o LDLR colocalisa ion wi h he ER was pe o med in w and p.(Ty 400_Phe402del) LDLR
a ian wi h he ER-speci ic ma ke cal egulin. T ans ec ed cells we e immunos ained, as desc ibed in
Sec ion 4(Ma e ials and Me hods). The images show a ep esen a i e indi idual cell (magni ica ion
60×).
3. Discussion
In his s udy we aimed o e eal he age and o igin o he p.(Ty 400_Phe402del) LDLR
mu a ion and he unc ional consequences on he exp essed LDLR a ian . To his end,
we selec ed an op imally dis anced [
24
] se o 14 mic osa elli es spanning 8.86 cM a ound
he a ian (p.[Ty 400_Phe402del]), and applied a me hod based on ances al segmen
leng hs [
22
] using ine mapping wi h LD. In he analysed coho , we iden i ied eigh
di e en haplo ypes. Conside ing a ecu en 9 bp dele ion is ex emely a e, we assumed
he di e en a ian ca ie haplo ypes de ec ed in he G an Cana ia popula ion de i e
om a common ances al haplo ype (i.e., co ela ed genealogy). The e o e, his scena io
i s wi h a gene ic signa u e o a ounde e ec , in which all he mu a ion ca ie s ha e
inhe i ed he a ian om a common ances o a ising in he popula ion abou 387 yea s
ago. Al hough he con idence in e al ob ained was a he wide (110 o 1572 yea s), his
es ima ion pos da es he one-cen u y-long Spanish colonisa ion o he Cana y Islands,
which ended in 1496 wi h he su ende o Tene i e [
15
]. A e his d ama ic episode,
he Eu opean colonisa ion o he Cana y Islands in ol ed a mix o Spanish, Po uguese,
I alian and Flemish colonise s, who, in addi ion o he sub-Saha an A icans and Moo ish
sla es’ con ibu ion [
25
], ha e p o ided he gene ic backg ound o he con empo a y
Cana ian popula ion.
The mos plausible scena ios suppo ing he high equency o his a ian in he
G an Cana ian popula ion is ei he he esul o gene low om any o he pos colonisa ion
In . J. Mol. Sci. 2023,24, 11319 7 o 12
sou ces, o an isola ed mu a ional e en in he se led G an Cana ian popula ion. Al hough
gene low has been p oposed as he e olu iona y p ocess o in oducing a di e en LDLR
mu a ion (G197del) in Is ael and Li huania [
26
], in he case o G an Cana ia, se e al
ac s poin o a mu a ional e en in he popula ion inhabi ing he island a e he Spanish
colonisa ion: (i) he i s e e ence o his mu a ion in he li e a u e e e s o pa icipan s om
a local hospi al (Hospi al Uni e si a io D . Neg ín de G an Cana ia) [
14
]; (ii) he mu a ion
has no been ound in mainland Spain no elsewhe e; and (iii) he gene ic cha ac e is ics
and he geog aphic isola ion o he popula ion ha e been p e iously shown o acili a e he
expansion o gene ic a ian s, causing bo h ecessi e [18,19] and dominan diso de s [27].
An addi ional e olu iona y p ocess ha can acili a e he p edominance o speci ic
a ian s in a popula ion is posi i e selec ion. Al hough a he e ozygo e ad an age has
been p oposed in o he disease-associa ed a ian s [
28
] and HeFH is he mos common
o m o FH in G an Cana ia, his mechanism does no seem o ha e in luenced he cu en
incidence o he a ian (p.[Ty 400_Phe402del]). Indeed, ca ie s o his a ian p esen
a highe han expec ed p e alence o ype 2 diabe es [
11
], as opposed o he iew o FH
being p o ec i e agains his disease [
29
,
30
]. In addi ion, as we demons a e in his s udy,
he p.(Ty 400Phe402del) LDLR a ian leads o a de ec i e p o ein. Speci ically, he in-
ame dele ion occu ing in he p.(Ty 400Phe402del) LDLR a ian causes he emo al
o a y osine esidue om a highly conse ed mo i in he i s YWTD domain o he
LDLR polypep ide. This cons i u es one o he six ou -s anded be a-shee s (“blades”)
ha main ain he domain s uc u e, which is de e minan o he co ec olding o he
β
-p opelle domain [
31
]. As a esul , his in- ame dele ion o h ee esidues may igge he
“quali y con ol” machine y o he ER ha blocks he a icking o mis olded p o eins [
32
],
hus p e en ing he mig a ion o he exp essed p o ein o he cell su ace and leading o a
e y se e e FH pheno ype. Consequen ly, we can classi y he p.(Ty 400Phe402del) LDLR
mu a ion as a class 2a, de ec i e, pa hogenic LDLR a ian .
Conside ing he high p e alence o his class 2a LDLR a ian in he popula ion o
G an Cana ia, he es ablishmen o a apid diagnos ic es o sc een he popula ion o he
p esence o his pa icula a ian is pa amoun . This will clea ly assis clinicians in he
diagnosis o his impo an disease and will allow o he ini ia ion o imely he apeu ic
in e en ions. Indeed, his popula ion-based diagnos ic s a egy is he cu en ou ine, no
only a ou cen e, which p o ides assis ance o he Sou he n and Eas e n egions o he
island, bu also in he o he main hospi al o G an Cana ia, hus p o iding ull co e age o
he island popula ion.
We acknowledge ha ou s udy has some limi a ions. Fi s , he geog aphic egion
o he coho is es ic ed. Howe e , he sample size su passes ha o o he s udies on
dominan diseases. In addi ion, un ela ed a ian -ca ie s we e selec ed, in o de o max-
imise he ep esen a ion o he popula ion a ec ed wi h HF in G an Cana ia. Second, we
op ed o a geno ype-based me hod, which canno assu e he sequence o he analysed
egion is iden ical among subjec s sha ing he haplo ypes iden i ied in his s udy. Howe e ,
his me hod has been widely applied in o he s udies da ing mu a ions. Fu he mo e, he
mic osa elli e ma ke s we e ca e ully selec ed o be op imally dis anced and in o ma i e,
as demons a ed by he iden i ica ion o ecombina ion poin s a bo h sides o he mu a ion.
Thi d, he me hodology applied may ha e unde es ima ed he age o he a ian unde in-
es iga ion, an a e ac ha is mo e e iden in g owing popula ions [
33
]. In his ega d, we
a e cu en ly conduc ing whole genome sequencing in a selec ed g oup o a ian -ca ie s,
which will no only help us co obo a e o e ine ou es ima ion bu also will p o ide an
oppo uni y o iden i y po en ial modi ie genes ha may explain he pheno ypic di e si y
obse ed in indi iduals a ec ed wi h HF in G an Cana ia.
4. Ma e ials and Me hods
4.1. Subjec s
The s udy popula ion included amilies a ending he Lipids Uni o he Complejo
Hospi ala io Uni e si a io Insula Ma e no-In an il de G an Cana ia. This coho ecei ed
In . J. Mol. Sci. 2023,24, 11319 8 o 12
a gene ic diagnosis o FH, ca ied he p.(Ty 400_Phe402del) a ian in LDLR and had bo h
pa en s bo n on he island. We selec ed 11 un ela ed amily ios o p.(Ty 400_Phe402del)-
mu a ion ca ie s and a homozygous indi idual. The ios we e ei he mo he – a he –
p oband, o pa en –p oband–sibling.
In addi ion, 48 un ela ed Cana y Islande s no bea ing he p.(Ty 400_Phe402del)
mu a ion, who sel -decla ed as ha ing wo gene a ions o ances o s bo n in he Cana y
Islands, we e included as con ols.
4.2. Mic osa elli e Geno yping
Genomic DNA was ex ac ed om whole blood samples p ese ed in EDTA using a
sal p ecipi a ion p o ocol [
34
]. Fou een mic osa elli e ma ke s co e ing 5.4 Mbp (8.86 cM)
lanking he p.(Ty 400_Phe402del) mu a ion (Table 2and Figu e 4) we e geno yped in he
cases and con ols.
Ampli ica ions we e ca ied ou in 10
µ
L olume PCRs con aining 1
×
colou less
GoTaq
®
Flexi Bu e (P omega, Madison, WI, USA), 1.5 mm o MgCl
2
, 0.2 mm o each
dNTP, 0.12 mm o each p ime (see Table 2), and 0.1 U o Taq polyme ase (P omega). The
PCR p og amme consis ed o 95
◦
C o 3 min, ollowed by 28 cycles (95
◦
C o 30 s,
58 ◦C
o
15 s and 72
◦
C o 1 min) wi h a inal ex ension a 72
◦
C o 10 min. Fluo escen ly labelled
agmen s we e un on an ABI PRISM 3100 DNA sequence (Applied Biosys ems, Fos e
Ci y, CA, USA) wi h he GeneScan-500 (LIZ) size s anda d. Alleles we e sco ed using Peak
Scanne ™ So wa e 1.0 (Applied Biosys ems).
4.3. Gene ic Cha ac e isa ion
Measu es o gene ic di e si y, such as he o al numbe o alleles pe locus, mean
obse ed (H
O
) and mean expec ed (H
E
) he e ozygosi ies, we e calcula ed using AR-
LEQUIN e sion 3.5.2.2 [
35
]. The same esou ce was used o es o depa u es om
he
Ha dy–Weinbe g
equilib ium (HWE) and de ia ions om he linkage equilib ium (LD)
o all pai wise locus combina ions. A sequen ial Bon e oni co ec ion [
36
] was applied o
he HWE and LD esul s.
4.4. Es ima ion o he Age o he Va ian
To es ima e he age o he p.(Ty 400_Phe402del) mu a ion we used he Gamma link-
age disequilib ium me hod (wi h co ela ed genealogy) implemen ed in he R Shiny app
Gene ic Mu a ion Age Es ima o (h ps://shiny.wehi.edu.au/ a ehi.h/mu a ion-da ing/
(accessed on 8 May 2023)), which is ully desc ibed by Gandol o e al. in 2014 [
22
]. This
me hod es ima es he age o a gene ic mu a ion based on he gene ic leng h o ances al
haplo ypes common o indi iduals who sha e he mu a ion. Fu he mo e, his me hod has
he ad an age o using he in o ma ion o he genomic dis ances and ecombina ion a es o
he mic osa elli e ma ke s used o geno yping he s udy coho . In his s udy, haplo ypes
we e econs uc ed based on geno ypic in o ma ion om ela i es o mu a ion ca ie s.
4.5. Func ional Cha ac e isa ion o he Va ian
4.5.1. Cloning o LDLR Va ian
A DNA agmen ep esen ing LDLR cDNA (NM_000527.4) con aining he
p.(Ty 400_Phe402del) a ian was syn hesized and cloned in o he mammalian exp ession
ec o pcDNA3 (Genesc ip , Pisca away, NJ, USA). The esul ing clones we e Sange -
sequenced o e i y accu acy.
4.5.2. CHO-ldlA7 Cell Cul u e and T ans ec ion
CHO-ldlA7 cells no exp essing LDL (kindly p o ided by P o esso M. K iege , MIT,
MA, USA) we e main ained in Ham’s F-12 medium con aining 10% e al bo ine se um
(FBS), 0.29 mg/mL o L-glu amine and an ibio ics (0.75 mg/mL o penicillin; 100
µ
g/mL
o s ep omycin). Cells a 80% con luency we e ans ec ed wi h Lipo ec amine
TM
LTX
In . J. Mol. Sci. 2023,24, 11319 9 o 12
using PLUS
TM
Reagen (In i ogen) ollowing he manu ac u e ’s ecommenda ions. LDL
unc ionali y was assessed 48 h a e ans ec ion.
4.5.3. Immunode ec ion o LDL by Wes e n Blo
Cells we e lysed in ice cold 50 mM o T is-HCl bu e con aining 125 mM o NaCl,
1% Nonide P-40, 5.3 mM o NaF, 1.5 mM o Na
4
P
2
O
7
decahyd a e, 1 mM o o ho anada e,
1 mg/mL o comple e EDTA- ee p o ease inhibi o cock ail (Roche, Basel, Swi ze land),
0.25 mg/mL o Pe abloc and 4-(2-aminoe hyl)-benzenesul onyl luo ide hyd ochlo ide
(AEBSF; Roche), a pH 7.5. Cells we e o a ed a 4
◦
C o an hou , sonica ed and cen-
i uged a 12,000
×
g o 15 min o emo e insoluble ma e ial. P o eins we e esol ed
by elec opho esis on non educing 8.5% SDS-PAGE and ans e ed o a ni ocellulose
memb ane o LDLR de ec ion. Rabbi polyclonal an i-LDLR an ibody (1:500) (P ogen
Bio echnik GimbH, Heidelbe g, Ge many) and mouse monoclonal an i-GAPDH an ibody
(1:1000) (No dic Biosi e, Li le Chal on , UK) p ima y an ibodies we e incuba ed o e nigh
a
4◦C,
while IRDye 680RD Goa an i-Mouse IgG and IRDye 800CW Donkey an i-Rabbi
IgG (LI-COR) seconda y an ibodies we e incuba ed a oom empe a u e o 1 h.
Signals we e de eloped using Supe Signal Wes Du a Ex ended Subs a e (Pie ce
Bio echnology, Rock o d, IL, USA) in a ChemiDoc XRS (Bio-Rad, He cules, CA, USA).
4.5.4. Analysis o LDLR Exp ession by Fluo escen Ac i a ed Cell So e (FACS)
LDL exp ession a he cell memb ane was assessed in a Cy oFLEX Flow Cy ome e
(Beckman Coul e , B ea, CA, USA) using a mouse monoclonal an ihuman-LDLR (C7) (1:100;
2.5 mg/L; O igene, Rock ille, MD, USA) and an Alexa Fluo 488-conjuga ed goa an imouse
IgG (1:200; Molecula P obes, Eugene, OR, USA) as p ima y and seconda y an ibodies,
espec i ely, as p e iously desc ibed [
37
]. Each sample was pe o med in iplica e, and
10,000 e en s we e acqui ed o da a analysis.
4.5.5. Analysis o LDL Up ake by FACS
Fo y-eigh hou s pos - ans ec ion, cells we e incuba ed wi h FITC-LDL (20
µ
g/mL)
o 4 h a 37
◦
C o de e mine LDL up ake, as p e iously desc ibed [
37
]. Fo de e mining
LDLR exp ession, cells we e washed ou wi h PBS-1% BSA, ixed in 4% pa a o maldehyde
o 10 min a oom empe a u e and washed again o emo e esidual ixa i e. To de e mine
he amoun o in e nalized LDL, T ypan blue solu ion (Sigma-Ald ich, S einheim, Ge many)
was added di ec ly o he samples o a inal concen a ion o 0.2%. Each sample was
pe o med in iplica e, and 10,000 e en s we e acqui ed o da a analysis.
4.5.6. Con ocal Lase Scanning Mic oscopy
Con ocal lase scanning mic oscopy was used o analyse LDLR exp ession and colocal-
iza ion wi h he endoplasmic e iculum (ER)-speci ic ma ke cal egulin. Cells ans ec ed
wi h he LDLR-con aining plasmids we e cul u ed o 48 h a 37
◦
C in 5% CO
2
. Then, he
cells we e washed wice wi h PBS-1% BSA, ixed wi h 4% pa a o maldehyde o 10 min,
washed and pe meabilised wi h 1% T i onX-100 o 30 min a oom empe a u e. Samples
we e blocked in PBS-10% FBS o 1h and incuba ed wi h he app op ia e p ima y an ibod-
ies o 16 h a 4
◦
C, ollowed by incuba ion wi h he app op ia e luo escen seconda y
an ibodies. Co e slips we e moun ed on a glass slide, and samples we e isualised using a
con ocal mic oscope (Olympus IX 81, Tokyo, Japan) wi h sequen ial exci a ion and cap u e
image acquisi ion wi h a digi al came a (Axiocam NRc5; Zeiss, Jena, Ge many). Images
we e p ocessed using Fluo iew 50 so wa e (Olympus, Miami, FL, USA).
4.5.7. S a is ical Analysis
All measu emen s we e pe o med a leas 3 imes unless o he wise speci ied, and
esul s ep esen he mean
±
s anda d de ia ion (SD). The di e ences be ween LDLR
a ian s and wild- ype (w ) LDLR we e es ed by a wo- ailed S uden ’s - es wi h a
signi icance le el o 0.05.
