scieee Science in your language
[en] (orig)

Adipose tissue-derived ECM hydrogels as a 3D platform for neural differentiation and brain diseases

Author: Stampouli, Kyriaki; Papadimitriou, Lina; García Lizarribar, Andrea; MADARIETA-PARDO, IRATXE; Olalde, Dr Beatriz; RANELLA, ANTHI
Publisher: Zenodo
DOI: 10.1039/d5ma00310e
Source: https://zenodo.org/records/17293345/files/Stampouli_etal.pdf
© 2025 The Au ho (s). Published by he Royal Socie y o Chemis y Ma e . Ad .
Ci e his: DOI: 10.1039/d5ma00310e
Adipose issue-de i ed ECM hyd ogels as a 3D
pla o m o neu al diffe en ia ion and b ain
diseases
Ky iaki S ampouli,
ab
Lina Papadimi iou,
a
And ea Ga cı
´a-Liza iba ,
c
I a xe Mada ie a,
c
Bea iz Olalde
c
and An hi Ranella *
a
The in e play be ween he ex acellula ma ix and cells signi ican ly impac s cellula su i al,
p oli e a ion, and diffe en ia ion. Cell g ow h wi hin 3D scaffolds, pa icula ly hyd ogels ha mimic
cellula mic oen i onmen s, offe s mo e ele an insigh s in o issue de elopmen compa ed o
adi ional 2D sys ems. This s udy explo es he beha io o neu al s em cells and hei diffe en ia ion
wi hin 3D pu e adipose issue de i ed-ECM (adECM) hyd ogels. These hyd ogels p o ide bo h physical
and biochemical cues ha closely esemble he 3D mic oa chi ec u e o na i e issues. Encapsula ing
neu oec ode mal NE-4C cells in adECM hyd ogels a diffe en concen a ions e ealed in iguing
di e gen cellula esponses. While a ia ions in he ibe s uc u e and po e o ma ion be ween
hyd ogels did no signi ican ly affec cell su i al, hey no ably in luenced he diffe en ia ion p ocess.
Analysis o neu al-lineage-speci ic ma ke s, such as ubulinbIII and GFAP, demons a ed di e gen
diffe en ia ion ou comes. This biologically de i ed, issue-speci ic 3D pla o m enables in i o s udy o
neu al diffe en ia ion and lays he g oundwo k o u u e neu al models ele an o egene a i e
medicine and neu odegene a i e esea ch.
1. In oduc ion
O e he pas decades, o e 92% o he apies om animal ials
ha e ailed o ansla e in o human he apy, pa icula ly o
neu ological diseases,
1
highligh ing he need o imp o ed
esea ch me hods in his a ea. Combining his wi h he 3R
policy ( e ine, educe, and eplace he use o animals as
expe imen al models), i is e iden ha he e is a need o
mo e inno a i e and ealis ic in i o models.
2
These models
should p ecisely ecapi ula e he in i o condi ions in o de o
b idge he gap be ween p eclinical esea ch ou comes and
human ea men s. Neu odegene a i e diseases (NDDs), like
Alzheime ’s disease and ela ed demen ia, we e anked he 7 h
mos common cause o dea h in 2019, acco ding o WHO
3
wi h
a high economic, social, and psychological bu den. Al hough
he mechanisms o NDDs ha e been ex ensi ely s udied, many
pa hways emain unclea and esea ch is ongoing o be e
unde s and hese diseases and disco e no el he apies.
Ad ances in ma e ials science ha e d i en he de elopmen
o 3-dimensional (3D) models ha can mimic he na u al
cellula mic oen i onmen . T adi ional 2D models ail o ep o-
duce he physical, gene ic, and biochemical a ibu es o he
na i e issue ha a e needed du ing he neu ode elopmen .
4
The scien i ic communi y has de eloped 3D bioma e ial models
o enhance he ex acellula en i onmen p o iding p ecise
cellula mic oen i onmen ep esen a ion and gene a ing
esponses ha a e mo e physiologically ele an so ha cells
can adhe e, p oli e a e, mig a e, and diffe en ia e p ope ly.
5
The ne ous sys em’s complexi y
4,6
necessi a es ca e ul selec-
ion o bioma e ials, cell ypes, and g ow h ac o s o ep oduce
ne ous sys em and neu o- ela ed diso de s in i o. Bo h solid
ma e ials like poly(e-cap olac one) (PCL),
4,6,7
poly(lac ic-co-glycolic
acid) (PLGA),
8–10
e c. and hyd ogels c ea ed using he syn he ic
and/o na u al p ecu so sou ce ha e been applied. Among hem,
hyd ogels s and ou as p omising ma e ials o eplica ing neu-
onal de elopmen in i o due o hei high-wa e con en ,
mechanical and s uc u al p ope ies and abili y o mimic he
biological milieu o he b ain and he spinal co d.
11–15
A key p ecu so ma e ial o p oduce hyd ogels is he na i e
ex acellula ma ix (ECM), a non-cellula 3D ne wo k o mac o-
molecules in ne ous issue, which consis s mainly o p o eo-
glycans (PGs) and glycosaminoglycans (GAGs) and less ib ous
p o eins like collagens, elas in, ib onec in, laminins, and
a
Ins i u e o Elec onic S uc u e and Lase , Founda ion o Resea ch and
Technology-Hellas (FORTH), He aklion, 71003, G eece.
E-mail: an hi@iesl. o h.g
b
Depa men o Biology, Uni e si y o C e e, He aklion, 70013, C e e, G eece
c
TECNALIA, Basque Resea ch and Technology Alliance (BRTA), E20009, Donos ia-
San Sebas ian, Spain
Recei ed 2nd Ap il 2025,
Accep ed 6 h Sep embe 2025
DOI: 10.1039/d5ma00310e
sc.li/ma e ials-ad ances
Ma e ials
Ad ances
PAPER
Open Access A icle. Published on 08 Sep embe 2025. Downloaded on 10/8/2025 9:40:49 AM.
This a icle is licensed unde a
C ea i e Commons A ibu ion 3.0 Unpo ed Licence.
View A icle Online
View Jou nal
Ma e . Ad . © 2025 The Au ho (s). Published by he Royal Socie y o Chemis y
se e al o he glycop o eins.
16
GAG p o eins like hyalu onic acid
(HA), chond oi in sul a e, hepa in, e c., and p o eoglycans a e
ex emely hyd ophilic, p o iding hyd a ion o he b ain
issue.
17,18
Decellula ized ECMs de i ed om na u al issue
p o ide mechanical and biochemical cues ha suppo issue
s uc u e and componen s ha acili a e cell–cell and cell–
ma ix in e ac ions which a e essen ial o c ea ing he ideal
milieu o neu al cell adhesion, su i al, di e en ia ion, and
axon ou g ow h h oughou he p ocess owa ds b ain de elop-
men and egene a ion.
14,19
3D hyd ogels can be gene a ed om decellula ized ECMs o
issues such as he hea , lung, skin, and adipose issue.
20
The
decellula iza ion p ocess emo es componen s ha igge an
immune esponse om issues using a ious physical, enzy-
ma ic, and chemical me hods,
21,22
while p ese ing s uc u al
ECM p o eins ha p o ide signi ican signalling cues o s em
cell mig a ion, p oli e a ion, su i al, and diffe en ia ion.
23,24
Compa ed wi h subs a es such as Ma igel o indi idual ECM
componen s like collagen hyd ogels, dECM hyd ogels seem o
enhance cell su i al and diffe en ia ion, making hem effec-
i e models o s udying ECM unc ions in s em cell beha io
and diffe en ia ion.
25,26
Decellula ized adipose issue, i s desc ibed by Flynn in
2010,
27
is an accessible sou ce due o i s abundance in he
human o animal body and easy ha es ing h ough p ocedu es
such as liposuc ion o abdominoplas y.
28
Rich in collagens,
glycosaminoglycans, laminin, e c.,
22
and se e al bioac i e mole-
cules (g ow h ac o s and cy okines), i con ols a ious biolo-
gical p ocesses such as in lamma ion, cell p oli e a ion, and
diffe en ia ion.
29
Impo an ly, he adipose-de i ed ECM main-
ains mac ophage plas ici y, p omo ing epa a i e pheno ypes
unde heal hy condi ions while allowing p oin lamma o y
esponses du ing in ec ion.
14,22
Va ious s udies ha e used ECM-de i ed o modi ied compo-
nen s o ECM hyd ogels o c ea e neu al 3D in i o models. Fo
example, HA based 3D hyd ogels ha e been p e e ed o
p omo ing he diffe en ia ion o neu al s em/p ogeni o cells
in o oligodend oglia and neu onal lineages while supp essing
as oglia diffe en ia ion.
30
Umbilical co d dECM hyd ogels
ha e been explo ed o neu al issue epai ,
23
and 3D ECM-
de i ed ma ices can c ea e ully de eloped, in e connec ed
dopamine gic neu on ne wo ks wi h imp o ed diffe en ia ion
and unc ionali y.
31
In ou p e ious s udy, adECM was combined wi h educed
g aphene oxide ( GO) o o m d y, po ous scaffolds aimed a
enhancing neu onal diffe en ia ion ia conduc i i y and s iff-
ness modula ion.
32
In con as , he cu en wo k in es iga es
he in insic bioac i i y o solubilized, ully hyd a ed adECM
hyd ogels, ee om any syn he ic addi i es o exogenous
ma e ials. This allows us o explo e how na i e opog aphical
and biochemical p ope ies o adipose-de i ed ECM alone
in luence neu al s em cell a e wi hin a mo e physiologically
ele an 3D mic oen i onmen .
This s udy ocuses on he abili y o neu al s em cells (NSCs)
o diffe en ia e wi hin 3D hyd ogels de i ed om pu e decel-
lula ized ECMs o po cine adipose issue, a issue-speci ic and
unde explo ed sou ce o neu al applica ions. By encapsula ing
NSCs in o hyd ogels wi h wo diffe en ECM concen a ions,
he esea ch aims o assess how na i e opog aphical and
biochemical cha ac e is ics in luence cellula beha io and
diffe en ia ion pa hways. While his s udy cen e s on unda-
men al aspec s o NSC diffe en ia ion, he use o a ully
biologically de i ed pla o m ha closely mimics he na u al
mic oen i onmen p o ides a p omising basis o u u e de el-
opmen o physiologically ele an 3D neu al in i o models,
wi h po en ial applica ions in neu o egene a ion and neu ode-
gene a ion esea ch.
2. Ma e ials and me hods
2.1. adECM p e-gel p oduc ion
Adipose issue was decellula ised and delipidised as desc ibed in
p e ious wo k.
14,22
These s udies p o ide comp ehensi e cha ac-
e iza ion o he decellula ized ma ices, including esidual DNA
quan i ica ion and p o eomic analysis o ECM componen s (e.g.,
laminins, ype IV collagen). No ably, he decellula ized po cine-
de i ed adipose ma ix (pDAM) used in he p esen s udy mee s
he accep ed decellula iza ion c i e ion o o50 ng DNA/mg d y
weigh , wi h a esidual DNA con en o 24.8 2.05 ng mg
1
,as
epo ed by Cicue
´ndez e al. (2021).
22
B ie ly, po cine adipose
issue was mechanically homogenised and cen i uged. Pelle s
we e ea ed wi h isop opanol and T i on X-100, cleaned and
lyophilised o ob ain d y p o ein concen a es. The d ied p o ein
was milled o ob ain adipose decellula ised ex acellula ma ix
(adECM) ine-g ain powde . A e he decellula isa ion p ocess,
hyd ogels we e ob ained om acid-enzyma ic diges ion o he
powde . adECM was diges ed o 48 hou s a RT a a concen-
a iono 15mgml
1
. Then, he acid solu ion was neu alised
and equilib a ed o physiologic pH and sal concen a ion.
2.2. Neu oec ode mal s em cells (NE-4C cell line)
The NE-4C cell line was de i ed om mu ine neu oec ode mal
issue, speci ically he ce eb al esicles o 9-day-old mouse
emb yos lacking unc ional p53 genes.
33,34
The NE-4C cell line
was pu chased om ATTC (#CRL-2925) and main ained in he
comple e medium con aining Eagle’s minimum essen ial
(EMEM, M4655, Sigma) supplemen ed wi h 10% ( / ) e al
bo ine se um (FBS), 1% ( / ) penicillin–s ep omycin mix u e
(P/S P4333, Sigma). Cul u e lasks had been coa ed wi h poly-L-
lysine (PLL) (Sigma, P9155). Cell cul u es we e incuba ed in a
con olled en i onmen wi h 5% CO
2
a 95% humidi y and a a
cons an empe a u e o 37 1C. Sub-con luen NE-4C cul u es
we e egula ly subcul u ed ia ypsiniza ion and he comple e
medium was e eshed e e y wo days. Low passage NE-4C cells
(3–8) we e employed o all he expe imen s in his s udy.
2.3. Cha ac e iza ion o mechanical p ope ies
The iscoelas ic p ope ies o adECM hyd ogels we e examined
on a pa allel-pla e geome y (200-mm-diame e s eel wi h a gap
o 1 mm) using a Disco e y Hyb id Rheome e HR 20 (TA
ins umen s, New Cas le, DE, USA). Dynamic equency sweep
Pape Ma e ials Ad ances
Open Access A icle. Published on 08 Sep embe 2025. Downloaded on 10/8/2025 9:40:49 AM.
This a icle is licensed unde a
C ea i e Commons A ibu ion 3.0 Unpo ed Licence.
View A icle Online
© 2025 The Au ho (s). Published by he Royal Socie y o Chemis y Ma e . Ad .
analysis was conduc ed in duplica e o measu e he equency-
dependen s o age (G0) and loss (G00) moduli o he hyd ogels.
All he measu emen s we e made in cons an de o ma ion
con ol mode o e a equency ange o 0.01 o 10 Hz. All he
measu emen s we e ca ied ou a 37 1C. The me hod was
pe o med as p e iously desc ibed by Cicue
´ndez e al. (2024).
14
2.4. Cell iabili y and me abolic ac i i y
2.4.1 Li e/dead iabili y assay. The iabili y o NSCs encap-
sula ed in he 3D hyd ogels was de e mined using he LIVE/
DEAD iabili y/cy o oxici y Ki o mammalian cells (The mo-
ishe Scien i ic). The assay was pe o med on day 6 o cul u e
o assess mid- e m cell iabili y du ing he 10-day in i o
diffe en ia ion p o ocol. This ime poin was selec ed o de e -
mine whe he he hyd ogel en i onmen could sus ain cell
iabili y beyond he acu e esponse phase and in o he diffe -
en ia ion pe iod. B ie ly, a e 6 days o cul u e, he hyd ogel
con aining he cells was emo ed om he cul u e medium
and washed wice wi h Dulbecco’s phospha e-buffe ed saline
(D-PBS). In acco dance wi h he manu ac u e ’s ecommenda-
ions, Calcein AM (exci a ion/emission: 494/517 nm) and E hi-
dium homodime -1 (E hD-1) (exci a ion/emission: 528/617 nm)
(s ains dead cells) we e dilu ed in Dulbecco’s phospha e-
buffe ed saline (D-PBS) o inal concen a ions o 2 mM and
4mM, espec i ely, and applied o he cells. The s aining eac ion
was incuba ed a 37 1C o 15 minu es. Dead cells we e isualized
using a 530 nm exci a ion wa eleng h, while li e cells we e
obse ed unde a 485 nm exci a ion wa eleng h using a Leica
TCS SP8 in e ed con ocal mic oscope. To complemen his
assessmen , cell me abolic ac i i y a ea lie ime poin s (2 and
4 days) was e alua ed using he P es oBlue assay (see Sec ion
2.4.2), p o iding addi ional insigh in o ea ly-s age iabili y and
con i ming he absence o acu e cy o oxic esponses.
2.4.2 P es oBlue iabili y assay. To in es iga e he me a-
bolic ac i i y, P es oBlue Cell Viabili y Reagen assay (In i o-
gen) was ca ied ou in 24-well pla es. The pla e con ained 2D
cul u e (10
4
cells pe well), 3D cell-encapsula ed hyd ogels
(25 10
4
cells pe well), cell- ee hyd ogels wi h medium and
only cul u e medium wi hou cells as 2D and 3D backg ound
o co ec ion o he samples, espec i ely. The a ia ion in cell
concen a ion is due o he diffe ing dimensionali y o he
cul u es. T ea men wi h P es oBlue was conduc ed a 2, 4,
and 6 days o e alua e he cy ocompa ibili y. Fo he es , he
cul u ed medium was emo ed and 600 ml o P es oBlue
solu ion (10% / in comple e medium) was added o each well
and he pla e was incuba ed a 37 1C o 3 h. La e , 200 ml o he
P es oBlue solu ion om each well o he assay pla es was
ans e ed o a new 96-well pla e, and he abso bance due o
colo change in he luo escence o he eagen ( esazu in o
eso u in) was measu ed using an ELISA luo escence mul i-
well pla e eade (Bio ek-Syne gy HT) wi h he exci a ion/emis-
sion wa eleng hs se a 570 nm/600 nm. A e he ea men , he
hyd ogels we e washed wi h 1PBS wi h calcium and magne-
sium o main ain cell in eg i y and hen used o u he
incuba ion. The pe cen age o ela i e me abolic ac i i y o
cells (a e sub ac ing he backg ound) compa ed o he 2D
con ols was calcula ed using eqn (1):
%Rela i e me abolic ac i i y
¼ODð570600 nmÞsample co ec ed ODð570600 nmÞbackg ound
ODð570600 nmÞa e age 2D con ol ODð570600 nmÞbackg ound
100%
(1)
2.5. In i o diffe en ia ion o NE-4C cells
In he 2D cul u e expe imen s, NE-4C cells we e seeded on poly-
L-lysine-coa ed 24-well pla es (10
4
cells pe well). Following 4
days o p oli e a ion, he cells unde wen a 48-hou ea men
wi h 10
6
M all- ans e inoic acid (RA) dilu ed in he comple e
medium. A e RA induc ion, he medium was eplaced wi h a
se um- ee neu onal diffe en ia ion medium composed o Dul-
becco’s modi ied Eagle’s medium DMEM/F12 wi h HEPES
nu ien medium (Sigma), supplemen ed wi h 1% / ITS;
(I3146, Sigma) and 1% / B27 (17504044, Gibco) and 1% /
P/S solu ion. The cells we e kep in his medium o an
addi ional 8 days, wi h he medium changed e e y wo days.
In he 3D cul u es, NE-4C cells we e suspended in he
comple e medium and we e mixed ho oughly wi h app op ia e
olumes o he p e-gel (15 mg ml
1
) o achie e inal hyd ogel
concen a ions o 7.5 and 10 mg ml
1
. P elimina y es s wi h
5mgmL
1
adECM hyd ogels showed poo gela ion and s uc-
u al ins abili y, which p e en ed consis en 3D cul u e o NSC
neu osphe es (see SI Fig. S1). The e o e, 7.5 and 10 mg ml
1
we e selec ed o u he expe imen s. The encapsula ed cell
densi y in he hyd ogel was 2.5 10
6
cells ml
1
. A olume o
100 ml o hese encapsula ed cells in hyd ogels was hen pu in a
24-well pla e (25 10
4
cells pe well), and incuba ed a 37 1C
and 5% CO
2
o 30 minu es o comple e he gela ion p ocess,
o ming hyd ogel domes. The diffe en ia ion ea men o
hese 3D cul u es was consis en wi h ha o he 2D cul u es.
As con ol g oups, we included bo h un ea ed and RA- ea ed
cells o acili a e a compa a i e analysis ela i e o he expe i-
men al objec i es.
2.6. An ibodies and eagen s
The ollowing an ibodies and eagen s we e used: chicken an i-
nes in 1/1000 (NB100-1604, No us Biologicals), abbi an i-ki67
1/1000 (ab15580, Abcam), chicken an i-GFAP 1/400 (AB5541,
Sigma), mouse an i- ubulin b3 1/1000 (801 213, Biolegend), goa
an i-mouse IgG-CF488 1/500 (20 010, Bio ium), goa an i- abbi
IgG-CF555 1/500 (20 033, Bio ium), goa an i-chicken IgG-Alexa
Fluo -546 1/1000 (A-11040, The moScien i ic LSG), poly-L-lysine
15 mgml
1
(P9155, Sigma), all- ans e inoic acid (R2625,
Sigma-Ald ich), and DAPI (In i ogen , SlowFade Diamond
An i ade Moun an ).
2.7. Immunocy ochemis y assays
Undiffe en ia ed NE-4C cells we e ixed wi h 4% pa a o malde-
hyde (PFA) solu ion in PBS o 15 min and ea ed wi h 0.1% /
T i on-X in PBS o 5 min o acili a e pe meabiliza ion. A e
blocking o 30 min wi h 2% w/ BSA in PBS, p ima y and
seconda y an ibodies we e added subsequen ly and incuba ed
Ma e ials Ad ances Pape
Open Access A icle. Published on 08 Sep embe 2025. Downloaded on 10/8/2025 9:40:49 AM.
This a icle is licensed unde a
C ea i e Commons A ibu ion 3.0 Unpo ed Licence.
View A icle Online
Ma e . Ad . © 2025 The Au ho (s). Published by he Royal Socie y o Chemis y
o 1 h a RT. A e each incuba ion, 3 washes wi h PBS we e
pe o med. Finally, he samples we e moun ed on glass mic o-
scope slides wi h a moun ing medium con aining DAPI and
examined unde a con ocal mic oscope.
Diffe en ia ed NE-4C cells we e p ocessed ollowing a simila
p o ocol. They we e ixed wi h 1Fixa ion Buffe (F1797, Sigma) in
PBS o 15 min. This Fixa ion buffe , a a 10concen a ion,
con ained 20% / o maldehyde, 2% / glu a aldehyde, 70.4 mM
Na
2
HPO
4
, 14.7 mM KH
2
PO
4
,1.37MNaCl,and26.8mMKCl.A e
ixa ion, he s aining p ocedu e ollowed he same s eps as
desc ibed abo e o he undiffe en ia ed cells.
2.8. Con ocal and scanning elec on mic oscopy (SEM)
Cell-encapsula ed and cell- ee hyd ogel imaging was conduc ed
using con ocal mic oscopy and scanning elec on mic oscopy
(SEM), espec i ely. Neu al s em cells we e imaged using a Leica
TCS SP8 in e ed con ocal mic oscope wi h ei he a 20o 40
oil imme sion objec i e lens. Con ocal images we e u ilized o
assess he quali y o p oli e a ion and diffe en ia ion p ocesses,
ocusing on he exp ession o speci ic bioma ke s. Each expe i-
men was epea ed a leas h ee imes, using mo e han h ee
hyd ogels om each adECM concen a ion. All images we e
p ocessed using Fiji Image J so wa e ( e sion 2.14.0/1.53 ).
35
Fo SEM obse a ion, cell- ee hyd ogels we e ixed wi h a
solu ion consis ing o 2.5% w/ glu a aldehyde (GDA) and 2.5%
w/ PFA dilu ed in 0.1 M sodium cacodyla e buffe (SCB) o
30 min a 4 1C. A e wa d, 3 washes wi h 0.1 M SCB a 4 1C we e
pe o med and specimens we e dehyd a ed in a g aded se ies
o e hanol–wa e solu ions, ul ima ely eaching 100% e hanol
(30, 50, 60, 70, 80, 90, and 100%), wi h each s ep las ing 10–
15 minu es. Ins ead o c i ical poin d ying, samples we e d ied
wi h hexame hyldisilazane (HMDS), in an e hanol : HDMS a io
o 2 : 1 o 10 min, 1:1 o 5 min, and 100% HDMS o a quick
wash and le o ai d y o e nigh unde a ume hood. Finally, a
15 nm laye o gold was spu e -coa ed on o he samples using a
Bal ec SCD 050 ins umen (BAL-TEC AG, Balze s, Liech ens ein)
and hey we e obse ed using SEM (JEOL JSM-6390 LV, Jeol USA
Inc., Peabody, MA, USA) wi h an accele a ion ol age o 15 kV.
To cha ac e ise he 3D hyd ogel s uc u e, SEM images a
20 000magni ica ion we e p ocessed using Fiji ImageJ so -
wa e ( e sion 2.14.0/1.53 ).
35
Pa ame e s such as a e age po e
size, po e a ea dis ibu ion (% a ea), numbe o po es, and ibe
diame e we e quan i ied om h ee independen se s o
images o each adECM concen a ion hyd ogel. The analysis
in ol ed h ee s eps: (1) image enhancemen o ensu e suffi-
cien esolu ion and con as o accu a e analysis, (2) calcula-
ion o po osi y pe cen age based on he a eas o black
( ep esen ing po es) and whi e ( ep esen ing ibe s) pixels
using he ‘Analyze Pa icles’ unc ion, ollowing he me hod
desc ibed by Anguiano M. e al.,
37
and (3) measu emen and
analysis o andomly selec ed ibe hickness o ibe diame e
assessmen .
2.9. Neu onal-lineage-speci ic gene exp ession
P io o conduc ing quan i a i e PCR, o al RNA was ex ac ed
and isola ed om cell-encapsula ed hyd ogel cons uc s using
TRIzol eagen (In i ogen) ollowing he manu ac u e ’s
ins uc ions. Subsequen ly, RNA was con e ed in o i s -s and
complemen a y DNA (cDNA) in a 20 mL eac ion using a Supe -
Sc ip
s
III Fi s -S and Syn hesis Sys em o RT-PCR (In i o-
gen). Quan i a i e RT-PCR was ca ied ou using he SYBR
g een mas e mix (SYBR Selec Mas e Mix, Applied Biosys-
ems ) wi h a 0.2 mM p ime wo king solu ion. Genes o in e es
we e ampli ied by he CFX96 ouch eal- ime PCR de ec ion
sys em (Bio-Rad). To quan i y he ela i e gene exp ession, we
employed he DDC me hod. Ac in be a (ACTB) was chosen as he
e e ence gene o no malisa ion. To de e mine he old change
in he exp ession o each gene o in e es ollowing in i o
diffe en ia ion, DC o he con ol g oup (un ea ed cells) was
sub ac ed om DC o each sample g oup o ob ain DDC . Then,
he 2
DDC
me hod was used o calcula e he ela i e gene
exp ession.
38
The p ime lis is ou lined in Table 1.
2.10. S a is ics
All expe imen s we e ca ied ou a leas h ee imes. The
esul s a e p esen ed as means s anda d de ia ion (SD) o
hese independen expe imen s. Fo he diffe en expe imen s,
unpai ed - es s we e pe o med o hyd ogel cha ac e iza ion,
wo-way ANOVA o me abolic ac i i y assay, and one-way
ANOVA o qPCR analysis ollowed by he Tukey mul iple
compa ison pos -hoc - es in o de o d aw compa isons
be ween g oups. All s a is ical analyses we e pe o med in
G aphPad P ism 8.0.2 so wa e. Con idence in e als o 95%
we e adjus ed wi h a Bon e oni co ec ion and p- alues o0.05
we e conside ed s a is ically diffe en , ma ked by *po0.05,
**po0.01, o ***po0.001.
3. Resul s and discussion
3.1. Mo phological and mechanical cha ac e iza ion o 3D
adECM hyd ogels
An ideal cell cul u e scaffold should allow space o cell seed-
ing, g ow h, and p oli e a ion while acili a ing he diffusion o
nu ien s and he emo al o me abolic was e p oduc s.
39,40
A comp ehensi e examina ion o he s uc u al and opog a-
phical ea u es o 3D ma ices, pa icula ly a he in e ace
be ween he cell and hyd ogel, p o ides aluable insigh s in o
he adap a ions ha occu as a esul o cellula beha io .
Table 1 Genes and oligonucleo ide p ime s used in qPCR analysis
a
Genes P ime sequence (50 o 30)
ACTB F: CGCCATGGATGACGATACG
R: CGAAGCCGGCTTTGCACATG
NES F: AAGTTCCCAGGCTTCTCTTG
R: GTCTCAAGGGTATTAGGCAAGG
TUBB3 F: CCTCACGCAGCAGATGTTCG
R: GGATGTCACACACGGCTACC
SYP F: TTGGCTTCGTGAAGGTGCTGCA
R: ACTCTCCGTCTTGTTGGCACAC
GFAP F: CTGATGTCTACCAGGCGGAGC
R: CCAGGTTGTTCTCTGCCTCCAG
a
Sang H. Yoon, e al.
36
Pape Ma e ials Ad ances
Open Access A icle. Published on 08 Sep embe 2025. Downloaded on 10/8/2025 9:40:49 AM.
This a icle is licensed unde a
C ea i e Commons A ibu ion 3.0 Unpo ed Licence.
View A icle Online
© 2025 The Au ho (s). Published by he Royal Socie y o Chemis y Ma e . Ad .
The decellula ized adECM used in his s udy has been p e-
iously alida ed in e ms o DNA emo al and ECM p o ein
composi ion.
14,22
Gi en he ocus o he cu en wo k on
hyd ogel mic os uc u e and neu al s em cell beha io , he
cha ac e iza ion was no epea ed he e bu is e e enced o
ensu e ep oducibili y and p o ocol anspa ency.
SEM images e ealed ha adECM hyd ogels exhibi impo -
an cha ac e is ics ha mimic he issue mic oen i onmen .
Speci ically, a a concen a ion o 10 mg ml
1
, 3D adECM
hyd ogels o m hicke and mo e densely g ouped ibe s com-
pa ed o hose a 7.5 mg ml
1
3D adECM hyd ogels, ye bo h
hyd ogels c ea e a wide ange o po e size dis ibu ion ne wo k.
SEM igu es (Fig. 1A–D) depic he di e ences in ibe diame e
be ween he wo concen a ions o hyd ogels. By measu ing he
leng h o andom ibe s i was con i med ha 10 mg ml
1
hyd ogels had hicke ibe s han 7.5 mg ml
1
hyd ogels (po
0.001) (Fig. 1E and F). These hicke ibe s anged in diame e
om 65.2 o 177.7 nm, wi h a mean diame e o 110.3 nm, and
equen ly o med bundles o ibe s (Fig. 1E and F and Table 2). In
con as , 7.5 mg ml
1
hyd ogels o med ibe s wi h diame e s
anging om 33.4 o 166.6 nm, wi h a mean o 86.6 nm (Fig. 1E
and F and Table 2). As expec ed, a highe ibe densi y was
obse ed in he 10 mg ml
1
compa ed o he 7.5 mg ml
1
, due
o he highe concen a ion used in he 10 mg ml
1
p e-gel. This
esul is consis en wi h p e ious s udies.
14
The SEM images o
he wo dis inc concen a ions o adECM hyd ogels (7.5 mg ml
1
and 10 mg ml
1
) e eal con as ing ibe a chi ec u e ha could
play a pi o al ole in neu al di e en ia ion, pa icula ly in he
con ex o he neu on o as oglia o ma ion, as sugges ed in
p e ious li e a u e.
41,42
A e conduc ing a comp ehensi e mo phology cha ac e iza-
ion o 3D adECM hyd ogels, quan i ied diag ams we e used o
highligh s a is ically signi ican diffe ences (p 0.05) in
a ious s uc u al pa ame e s be ween he wo hyd ogel con-
cen a ions. Speci ically, he analysis e ealed ha 7.5 mg ml
1
3D adECM hyd ogels exhibi ed app oxima ely 1401 244 po es,
wi h an a e age po e size o 6116 1484 nm
2
co e ing an a ea o
a ound 24 4.8% (Fig. 1G–I and Table 2). In con as , 10 mg ml
1
3D adECM hyd ogels displayed a highe po e coun , wi h app oxi-
ma ely 1708 230 po es obse ed in SEM images. The po es had
an a e age size o app oxima ely 3001 1021 nm
2
and he
co e ed a ea comp ised a ound 16 4.9% po osi y (Fig. 1G–I
and Table 2).
Al hough in e - ibe spacing was no di ec ly measu ed,
po osi y se es as a obus s uc u al pa ame e ha e lec s
he o e all oid ne wo k. I cap u es ea u es ele an o diffu-
sion, cell in il a ion, and encapsula ion efficiency. P io s u-
dies ha e es ablished po osi y as a key ac o in luencing neu al
cell mig a ion and diffe en ia ion, o en wi h g ea e p edic i e
alue han isola ed ibe spacing.
43,44
These esul s indica e ha 7.5 mg ml
1
3D adECM hyd ogels
possess a s uc u al con igu a ion cha ac e ized by ewe and
la ge po es compa ed o hei 10 mg ml
1
coun e pa s, which
c ea e a dense ne wo k o mo e and smalle po es. In o he
wo ds, he 7.5 mg ml
1
3D adECM hyd ogels ha e a highe
o e all po osi y a ea han he 10 mg ml
1
, as expec ed, because
o he highe concen a ion o ECM componen s in he la e .
These indings align wi h p e ious obse a ions in hyd ogels
composed o ei he na u al ma e ials like collagen
45,46
o syn he ic
ma e ials like aga ose,
47
whe e inc easing he concen a ions o
Fig. 1 Mo phology and s uc u e analysis o 3D adECM hyd ogels based on SEM da a. SEM images o cell- ee (A) and (C) 7.5 mg mL
1
and (B) and (D)
10 mg mL
1
3D adECM hyd ogels a (A) and (B) 10.000and (C) and (D) 20.000magni ica ion. Hyd ogel c oss-sec ion (scale ba s 1 mm). (E) and (F)
Quan i ica ion o hyd ogel’s ibe diame e om SEM images. (E) The sca e g aph ep esen s he ibe s’ diame e dis ibu ion o he 7.5 and 10 mg mL
1
adECM hyd ogels (***po0.01). (F) His og am depic s he equency dis ibu ion o ibe s’ diame e a e he c oss-sec ion o each hyd ogel. (G)–(I)
Quan i ica ion o adECM hyd ogel mo phological cha ac e is ics om SEM images. (G) Numbe o po es, (H) a e age o po e size, (I) po osi y as % o po e
a ea (s uden - es , as e isks *, **, *** deno e s a is ical di e ence po0.05, po0.01, and po0.001, espec i ely).
Ma e ials Ad ances Pape
Open Access A icle. Published on 08 Sep embe 2025. Downloaded on 10/8/2025 9:40:49 AM.
This a icle is licensed unde a
C ea i e Commons A ibu ion 3.0 Unpo ed Licence.
View A icle Online

Ma e . Ad . © 2025 The Au ho (s). Published by he Royal Socie y o Chemis y
he p ecu so ma e ial esul sina educ iono po osi yand
po e size.
The mo phological cha ac e is ics we e combined wi h and
alida ed by he mechanical p ope ies o he hyd ogels. A
highe polyme concen a ion has also been associa ed wi h
inc eased mechanical p ope ies. The dense ex acellula
ma ix ne wo k shown in 10 mg ml
1
o mula ion esul ed in
a highe s o age and loss modulus han a 7.5 mg ml
1
(Fig. 2).
Ne e heless, he G0 o G00 a io is simila , which con i med ha
bo h o mula ions had a s onge solid han liquid beha iou
due o he success ul c osslinking p ocess. The a e age s o age
modulus o 10 mg ml
1
and 7.5 mg ml
1
was 393 30 Pa and
45 5 espec i ely, meaning ha adECM hyd ogels wi h highe
concen a ion equi ed mo e ene gy o achie e he same de o -
ma ion. The densely packed ECM ibe ne wo k enhanced
in e molecula in e ac ions, leading o a s iffe ma e ial.
3.2. Cell iabili y and me abolic ac i i y
The Li e/Dead assay esul s, as depic ed in Fig. 3, e ealed a
ema kably high iabili y o NE-4C cells wi hin he 3D adECM
hyd ogels. E iden ly, he majo i y o encapsula ed cells exhib-
i ed a ib an g een luo escence a e 6 days in i o, indica ing
hei con inued su i al. This ou come emphasizes he obus
and suppo i e en i onmen c ea ed by he hyd ogels o sus ain
he iabili y o he enclosed NE-4C cells. This, in u n, alida es
he po en ial use o hese hyd ogels o a ious applica ions in
cell-based esea ch and issue enginee ing.
Simul aneously, he me abolic ac i i y o encapsula ed NE-
4C cells in 3D adECM hyd ogels was quan i ied by he P es o-
Blue Cell Viabili y Reagen assay. Cell encapsula ion was pe -
o med a concen a ions o 7.5 and 10 mg ml
1
3D adECM
hyd ogels, and his assay was conduc ed o e a 6-day in i o
(DIV) pe iod. No ably, he P es oBlue assay demons a ed s able
me abolic ac i i y h oughou he 6-day du a ion (Fig. 4). A
6 days, bo h hyd ogels exhibi ed signi ican ly lowe me abolic
ac i i y (o0.05) compa ed o 2D, hough hey main ained o e
90% ac i i y, which can be a ibu ed o he spa ial cons ain s
wi hin he hyd ogels o limi a ions in nu ien diffusion. Ne e -
heless, bo h 2D and 3D cul u e sys ems e ained me abolic
ac i i y beyond 4 and 6 DIV, indica ing ha he hyd ogels a e
sui able o suppo ing he g ow h and diffe en ia ion o NSCs
wi hou inducing a cy o oxic effec .
3.3. S emness and p oli e a ion o encapsula ed cells
To in es iga e cellula s emness and p oli e a ion, NE-4C cells
we e encapsula ed wi hin 3D adECM hyd ogels and cul u ed
o 4 and 6 days. Subsequen ly, he cellula p oli e a ion was
assessed by examining he exp ession o Ki67, a nuclea p o ein
Table 2 Mo phological cha ac e is ics o adECM hyd ogels based on
SEM da a
Po osi y
7.5 mg ml
1
10 mg ml
1
A e age SD
a
A e age SD
a
Po e numbe 1401 244 1708 230
A ea (%) 24 4.8 16 4.9
A e age size (nm
2
) 6116 1486 3001 1021
Fibe diame e
Fibe diame e (nm) 86.6 24.5 110.3 25.8
a
SD: s anda d de ia ion.
Fig. 2 Viscoelas ic modulus o adECM hyd ogels a 7.5 and mg ml
1
concen a ion. S o age (G0, black) and loss (G00, g ey) modulus a e shown
as a unc ion o oscilla o y angula equency.
Fig. 3 Cell iabili y assay o encapsula ed NE-4C cells in (A) 7.5 mg mL
1
and (B) 10 mg mL
1
3D adECM hyd ogel o 6 days in i o (DIV). Li e cells
(Calcein, g een) and dead cells (p opidium iodide (PI), ed) we e s ained.
(scale ba 200 mm).
Fig. 4 Cellula me abolic ac i i y was assessed using P es oBlue cell
iabili y eagen a 2, 4, and 6 days in i o (DIV). Me abolic ac i i y is
exp essed as a % ela i e me abolic ac i i y a e sub ac ing he 2D and 3D
backg ounds ( wo-way ANOVA, * deno e po0.05).
Pape Ma e ials Ad ances
Open Access A icle. Published on 08 Sep embe 2025. Downloaded on 10/8/2025 9:40:49 AM.
This a icle is licensed unde a
C ea i e Commons A ibu ion 3.0 Unpo ed Licence.
View A icle Online
© 2025 The Au ho (s). Published by he Royal Socie y o Chemis y Ma e . Ad .
p esen du ing he G1, S, G2, and M phases o he cell cycle,
48
using con ocal mic oscopy. Ki67 along wi h Nes in (NES) as a
s emness indica o demons a ed obus cell g ow h, no mal
p oli e a ion, and he p ese a ion o s emness cha ac e is ics
a e 6 days. No ably, NE-4C cells ypically equi e an ex e nal
coa ing o acili a e su i al, g ow h, and diffe en ia ion due o
hei challenging adhesion equi emen s. Howe e , wi hin 3D
adECM hyd ogels, hey exhibi ed s ong adhesion and sus-
ained s emness and p oli e a ion capabili y, indica ing ha
hyd ogels se e as a mimicking pla o m o he na u al neu al
issue mic oen i onmen and elimina e he need o supple-
men a y coa ing. The con ocal images in Fig. 5 illus a e he
s emness p ope ies and sus ained p oli e a ion o encapsu-
la ed NE-4C cells, as e idenced by con inued exp ession o
Ki67
+
a e 6 days in i o. An indica i e quan i ica ion o
Ki67-posi i e cells is p o ided in SI Fig. S2, al hough in e p e a-
ion is limi ed by neu osphe e-like clus e ing and o e lapping
nuclei in he 3D en i onmen . Impo an ly, hese indings a e
consis en wi h li e/dead s aining and u he suppo ed by
P es oBlue me abolic assays, which p o ide quan i a i e e i-
dence o sus ained p oli e a ion wi hin he hyd ogels.
3.4. Diffe en ia ion o encapsula ed neu al s em cells in 3D
adECM hyd ogels
To s udy he po en ial use o 3D adECM hyd ogels as an in i o
sys em designed o ecapi ula e he b ain mic oen i onmen ,
NSCs we e encapsula ed in 3D adECM hyd ogels and he
diffe en ia ion abili y, neu i e ou g ow h abili y, and neu al
ne wo k o ma ion we e examined. In pa icula , o de e mine
he effec on neu onal a e decisions, NE-4C cells we e encap-
sula ed in wo diffe en concen a ions o 3D adECM hyd ogels,
p oli e a ed o 4 days, and hen ea ed wi h e inoic acid (RA)
o 2 days o induce diffe en ia ion. A e ha , hey we e
cul u ed o an addi ional 8-day pe iod in a diffe en ia ion
medium con aining a ious neu onal supplemen s. This ea -
men esul s in a di e se popula ion o undiffe en ia ed cells
(s oma cells), neu ons, and as ocy es in he same cul u e.
A e he incuba ion pe iod, he p esence o neu onal and
as ocy e popula ions was e alua ed wi h con ocal mic oscopy
and RT-qPCR using he ollowing chosen bioma ke s. Nes in
(NES), a neu oepi helial s em cell p o ein ha o ms cy oskele-
al in e media e ilamen s, is empo ally exp essed in adul
neu al s em cells (NSCs) and imma u e neu al p ogeni o cells,
and i s exp ession educes as cells diffe en ia e. Nes in has
equen ly been used as an NSC ma ke in bo h emb yonic and
adul b ain issue. Nes in is he e o e widely accep ed as a
ma ke p o ein o undiffe en ia ed CNS and PNS p ogeni o s
ha gi e ise o neu ons and glia.
49,50
Tubulin be a 3 class III (TUBB3), ano he cy oskele al p o ein
exp essed speci ically in neu ons, plays a key ole in no mal
neu i e elonga ion, axon guidance, and main enance.
51
I has
been demons a ed ha he exp ession o TUBB3 is a use ul ool
o s udying he ea ly s ages o neu onal diffe en ia ion in
human and mouse emb yonic de elopmen .
51,52
Synap ophysin
(SYP), a glycop o ein ound on he memb ane o synap ic
esicles and widely exp essed in he b ain, con ibu es o synap-
ic de elopmen and plas ici y (synap ogenesis). While i is
p ima ily known o i s ole in neu o ansmission and synapse
o ma ion, i also plays a ole in neu onal egene a ion, pa icu-
la ly in axonal g ow h and synap ic emodelling.
53
Rega ding he
as ocy e popula ion, GFAP (glial ib illa y acidic p o ein) is an
in e media e ilamen p o ein and a ecognized as ocy e ma ke
in he cen al ne ous sys em (CNS), wi h i s inc eased exp es-
sion iden i ied as an indica o o gliosis ela ed o b ain inju y o
disease.
54,55
The diffe en ia ion efficiency was e alua ed com-
pa ed o diffe en ia ed cells g own on PLL-coa ed 2D glass and
undiffe en ia ed cells. The la e se ed as he con ol g oup o
RT-qPCR analysis o he ela i e exp ession o he men ioned
neu onal lineage-speci ic genes.
The con ocal imaging esul s e ealed ha 3D adECM
hyd ogels unc ion as suppo i e scaffolds, p omo ing neu al
and as ocy e diffe en ia ion ollowing RA induc ion. Cells ha
g ew inwa ds and nea neu osphe es we e la and la ge
esembling as ocy es wi h GFAP p o ein exp ession, while
hose ha g ew ou wa ds om he sphe es wi h small bodies
and elonga ed ine p ocesses we e iden i ied as neu ons exp es-
sing TUBB3. In he hyd ogels, a well-o ganized neu al ne wo k
was obse ed, cha ac e ized by dense axon bundles and close
communica ion be ween nume ous neu osphe es (Fig. 6D–I).
In con as , he 2D cul u e sys em displayed hinne axons and
a less obus neu al ne wo k (Fig. 6A–C). This ansi ion om a
2D o a 3D cul u e sys em in luenced cellula beha io in e ms
o di e en ia ion, esul ing in a mo e complex neu al ne wo k
wi h g ea e and hicke axons ex ending ou wa ds om he
neu osphe es in he 3D hyd ogels.
Fig. 5 P oli e a ion o NE-4C cells encapsula ed in (A) 7.5 mg mL
1
and
(B) 10 mg mL
1
3D adECM hyd ogels. Rep esen a i e con ocal images o
NE-4C cells a e 4 (A) and (B) and 6 (C) and (D) days in i o (DIV). Cells
we e s ained wi h DAPI (blue), Ki67 (g een), and NES ( ed). In all images, he
o e lay is shown (scale ba 50 mm).
Ma e ials Ad ances Pape
Open Access A icle. Published on 08 Sep embe 2025. Downloaded on 10/8/2025 9:40:49 AM.
This a icle is licensed unde a
C ea i e Commons A ibu ion 3.0 Unpo ed Licence.
View A icle Online
Ma e . Ad . © 2025 The Au ho (s). Published by he Royal Socie y o Chemis y
RT-qPCR analysis a 10 days o diffe en ia ion complemen-
ed hese obse a ions. The quan i ied esul s e ealed a sig-
ni ican dec ease (po0001) in NES exp ession (Fig. 6J)
ega dless o he adECM concen a ion in he hyd ogels, indi-
ca ing a a o able en i onmen o NE-4C cell diffe en ia ion
in o ma u e neu onal lineages.
Mo eo e , he exp ession o TUBB3 was signi ican ly highe
in he 10 mg ml
1
3D adECM hyd ogel g oup han in all o he
g oups (Fig. 6K). In pa icula , TUBB3 exp ession was 120- old,
2- old, and 2,7- old highe compa ed o un ea ed NE-4C, 2D,
and 7.5 mg ml
1
adECM hyd ogel g oups, espec i ely. SYP
exp ession ollowed he same endency as TUBB3 in he
10 mg ml
1
3D adECM hyd ogel g oup wi h 300- old mo e
han he un ea ed g oup and 3- old mo e han he 7.5 mg ml
1
g oup (Fig. 6L). The 2D g oup appea ed o exp ess he same
le els o SYP as he 10 mg ml
1
3D adECM hyd ogel g oup.
Addi ionally, GFAP showed no able up egula ion in he
7.5 mg ml
1
3D adECM hyd ogel g oup, sugges ing enhanced
as ocy e diffe en ia ion (Fig. 6M). In pa icula , i s exp ession
was 7- old highe whe eas, in 2D and 10 mg ml
1
3D adECM
hyd ogel g oups, GFAP exp ession was less han 2- old com-
pa ed o he un ea ed con ol g oup.
Toge he , ou indings demons a e ha 3D adipose issue-
de i ed ECM (adECM) hyd ogels se e as s uc u ally sui able
scaffolds suppo ing neu onal iabili y and diffe en ia ion
showing ha adipose ECM may offe unique diffe en ia ion
cues. No ably, NE-4C cells encapsula ed in 10 mg ml
1
adECM
hyd ogels exhibi ed a p onounced inc ease owa ds neu ons, as
e idenced by he high exp ession le els o he TUBB3 and SYP
genes. Con e sely, he 7.5 mg ml
1
adECM hyd ogel indica ed
an appa en enhancemen o as ocy e o ma ion, cha ac e ized
by ele a ed exp ession o he GFAP gene. These esul s suppo
he assump ion ha biomechanical cues like opog aphy could
in luence cell adhesion and diffe en ia ion a e decisions.
Namely, he diame e and dis ibu ion o ibe s inside hyd o-
gels c ea ed a 3D en i onmen ha led o diffe en le els o
neu onal-lineage gene exp ession o NSCs cul u ed unde di -
e en ia ion condi ions. Based on he analysis o adECM hyd o-
gel opog aphy, con ocal and qPCR indings and compa ing
li e a u e epo s,
41,56,57
i has been shown ha when ibe
diame e s a e smalle han he dimensions o he cell, he cell
a aches o mul iple ibe s and expe iences o ces pulling in
diffe en di ec ions, leading o a well sp ead cell shape a o ing
as oglia o ma ion (GFAP up egula ion, po0.01). In con as ,
when he ibe s a e hicke , he cell a aches o a single ibe ,
and he ac ion o ce ac s in only one di ec ion leading o
neu on de elopmen (TUBB3 and SYP up egula ion, po0.05).
These diffe ences in ibe hickness and ma ix s iffness, based
on ou iscoelas ic esul s, likely modula e in eg in-media ed
mechano ansduc ion pa hways, including FAK, RhoA/ROCK,
and YAP/TAZ signaling, which egula e cy oskele al ension and
ul ima ely in luence lineage commi men . S iffe ma ices wi h
hicke ibe s enhance ocal adhesion o ma ion and cy oske-
le al con ac ili y, p omo ing neu onal diffe en ia ion, whe eas
so e ma ices wi h hinne ibe s educe cy oskele al ension,
a o ing as ocy ic a e. Al hough ou s udy cha ac e ized
Fig. 6 Rep esen a i e con ocal images (A)–(I) and RT-qPCR quan i ica ion da a (J)–(M) o he e inoic acid-induced di e en ia ion o he encapsula ed
NE-4C cells in 3D adECM hyd ogels a e 10 days. Cells we e s ained wi h DAPI (blue), TUBB3 (g een), and GFAP ( ed) (F1) and (F2) show zoomed-in
egions o panel (F); panels (I1) and (I2) show zoomed-in egions o panel (I) (scale ba 50 mm). The g aphs show he ela i e gene exp ession o (J): NES,
(K): TUBB3, (L): SYP, and (M): GFAP. Rela i e gene exp ession is p esen ed as no malized o Ac in b ( e e ence gene). E o ba s ep esen he means SD.
S a is ical signi icance was de e mined wi h one-way ANOVA and Tukey pos -hoc es ing, as e isks *, **, and *** deno e s a is ical di e ences po0.05,
po0.01, and po0.001 espec i ely.
Pape Ma e ials Ad ances
Open Access A icle. Published on 08 Sep embe 2025. Downloaded on 10/8/2025 9:40:49 AM.
This a icle is licensed unde a
C ea i e Commons A ibu ion 3.0 Unpo ed Licence.
View A icle Online
© 2025 The Au ho (s). Published by he Royal Socie y o Chemis y Ma e . Ad .
hyd ogel s uc u es using SEM and heology, mo e comp ehensi e
quan i a i e analyses o mic os uc u al ea u es such as po e size
dis ibu ion and ibe o ien a ion will be aluable in u u e wo k o
be e co ela e ma ix p ope ies wi h neu al s em cell diffe en ia-
ion ou comes. Unlike ou p e ious s udy employing educed
g aphene oxide ( GO)- ein o ced adECM oamed scaffolds,
32
which
we e igid and d y, he cu en hyd ogels a e ully hyd a ed and
composed solely o na i e adECM wi hou conduc i e addi i es o
c osslinke s. This allows a cleane in es iga ion o he in insic
biochemical and mechanical cues o adipose-de i ed ECMs in a
so , 3D mic oen i onmen , ee om ex e nal s imuli like GO-
induced conduc i i y o s iffness.
Thus, his model p o ides a mo e educ ionis and mechan-
is ically de ined app oach o s udying ECM–NSC in e ac ions in
neu al di e en ia ion.
Howe e , se e al limi a ions o ou model mus be acknowl-
edged. The NE-4C cell line used in his s udy was de i ed om p53-
de icien mouse emb yos.
33
Since p53 loss has been shown o
p omo e neu onal diffe en ia ion,
58,59
his cha ac e is ic may ha e
in luenced he diffe en ia ion pa e ns we obse ed. The ole o p53
in neu al de elopmen is s ill no ully unde s ood and appea s o
be complex and con ex -dependen . The e o e, hese esul s should
be in e p e ed wi h cau ion, and u he s udies using models wi h
in ac p53 unc ion a e needed o ully unde s and he unde lying
mechanisms. Addi ionally, while Nes in and Ki67 we e used o
assess s em/p ogeni o s a us and p oli e a ion, he inclusion o
o he key s emness ma ke s such as SOX2 would p o ide a mo e
comp ehensi e analysis. Fu u e wo k will inco po a e SOX2 immu-
nos aining and/o gene exp ession p o iling o s eng hen he
cha ac e iza ion o NSC iden i y wi hin he 3D hyd ogel en i on-
men . In summa y, hese indings no only alida e he abili y o
pu e adipose-de i ed ECM hyd ogels o suppo NSC iabili y and
diffe en ia ion bu also e eal how modes a ia ions in ECM
concen a ion and mic oa chi ec u e can di ec lineage ou comes.
Unlike p e ious s udies ha ely on b ain-de i ed ECM o syn he ic
ma ices, his wo k pionee s he use o he adipose issue-de i ed
ECM as a ully biological and accessible scaffold o neu al
applica ions. This inno a i e in eg a ion o a na i e ECM-based
hyd ogel wi h a 3D neu osphe e model offe s a mechanis ically
in o med and ansla ionally ele an pla o m ad ancing ou
abili y o model neu ode elopmen and neu odegene a ion
in i o and laying he ounda ion o scalable, animal- ee al e -
na i e o neu al issue enginee ing and p eclinical esea ch. Ou
esul s highligh he po en ial o adECM hyd ogels as biomime ic
in i o ools; howe e , in i o s udies a e essen ial o e alua e hei
in eg a ion, immunocompa ibili y, and unc ional ele ance.
While he cu en s udy ocused on ea ly- o-mid diffe en ia-
ion s ages, u u e wo k will in ol e ex ended cul u e pe iods
and longi udinal analyses o assess how he hyd ogel suppo s
sus ained cell iabili y, p og essi e diffe en ia ion, and unc-
ional ma u a ion o e ime.
4. Conclusions
This s udy demons a es he effec i eness o 3D hyd ogels
de i ed om adipose issue ECMs in p omo ing he
diffe en ia ion o neu al s em cells (NSCs). By encapsula ing
NSCs in hese hyd ogels, which closely mimic he in i o 3D
b ain en i onmen , he esea ch e ealed how a ying ECM
concen a ions in luence cellula beha io , especially in diffe -
en ia ion p ocesses. While diffe ences in ibe s uc u e and
po e o ma ion had minimal impac on cellula p oli e a ion,
hey did in luence diffe en ia ion in o neu onal lineages, as
shown by dis inc gene exp ession. Addi ionally, a ia ions in
ECM concen a ion al e ed he mechanical s iffness o he
hyd ogels, hough bo h o mula ions exhibi ed simila iscoe-
las ic beha io . These biomechanical and mic os uc u al cues
likely modula e in eg in-media ed mechano ansduc ion pa h-
ways, which in u n egula e lineage commi men and neu al
cell a e decisions. These indings emphasize he po en ial o
3D adECM hyd ogels as mo e accu a e and effec i e in i o
models o neu al issue enginee ing, in oducing an inno a-
i e app oach ha combines na i e ECM-de i ed ma e ials wi h
a neu osphe e-based 3D cul u e sys em. This in eg a ed s a -
egy offe s a no el pe spec i e on how scaffold a chi ec u e can
be enginee ed o guide neu al cell a e. Wi h hei abili y o
closely eplica e key ea u es o he b ain mic oen i onmen ,
hese models ep esen a signi ican ad ancemen o e adi-
ional 2D sys ems and syn he ic scaffolds. Addi ionally, by
offe ing a mo e physiologically ealis ic pla o m ha be e
p edic s cellula beha io s, hese models add ess he majo gap
in p eclinical s udies and a e in line wi h he global demand o
al e na i es o animal es ing. Al hough ou indings es ablish a
s ong ounda ion o using adECM hyd ogels as in i o pla -
o ms, in i o models emain essen ial o ully cap u e he
complex ascula , immunological, and mul icellula in e ac-
ions o he na i e neu al niche. Fu u e s udies inco po a ing
in i o alida ion, de ailed mic os uc u al quan i ica ion, and
assessmen s o unc ional ma u a ion will u he s eng hen
he ansla ional ele ance o his pla o m. These ad ance-
men s could lead o he de elopmen o mo e p edic i e 3D
b ain models o s udying neu al de elopmen and neu ode-
gene a i e diso de s, and iden i ying new he apeu ic
s a egies.
Au ho con ibu ions
Ky iaki S ampouli: w i ing – o iginal d a , me hodology, da a
cu a ion, and in es iga ion. Lina Papadimi iou: w i ing –
e iew & edi ing, me hodology, and concep ualiza ion. And ea
Ga cı
´a-Liza iba : w i ing – e iew & edi ing, me hodology, and
in es iga ion. I a xe Mada ie a: w i ing – e iew & edi ing and
me hodology. Bea iz Olalde: w i ing – e iew & edi ing, con-
cep ualiza ion, esou ces, and unding acquisi ion. An hi
Ranella: w i ing – e iew & edi ing, supe ision, concep ualiza-
ion, isualiza ion, and unding acquisi ion.
Con lic s o in e es
The e a e no con lic s o decla e.
Ma e ials Ad ances Pape
Open Access A icle. Published on 08 Sep embe 2025. Downloaded on 10/8/2025 9:40:49 AM.
This a icle is licensed unde a
C ea i e Commons A ibu ion 3.0 Unpo ed Licence.
View A icle Online