421
F om sho o long eads: enhanced p o is di e si y p o iling ia
Nanopo e me aba coding
Małgo za a Chwalińska1, Michał Ka licki1, Sa ah Romac2, Fab ice No 2, Anna Ka nkowska1
1 Ins i u eo E olu iona yBiology,Facul yo Biology,Uni e si yo Wa saw,ul.Żwi kiiWigu y101,02-089Wa saw,Poland
2 CNRS,UMR7144Adap a ionandDi e si yinMa ineEn i onmen (AD2M)Labo a o y,Ecologyo Ma inePlank on eam,So bonneUni e si é,S a ion
BiologiquedeRosco ,PlaceGeo gesTeissie ,Rosco ,F ance
Co espondingau ho :AnnaKa nkowska(a.ka [email protected])
Copy igh : © Małgo za a Chwalińska e al.
This is an open access a icle dis ibu ed unde
e ms o he C ea i e Commons A ibu ion
License (A ibu ion 4.0 In e na ional – CC BY 4.0).
Resea ch A icle
Abs ac
In he las decades, en i onmen al me aba coding has e olu ionised biodi e si y e-
sea ch, pa icula ly o mic obial o ganisms such as p o is s, enabling la ge-scale as-
sessmen s o di e si y and ecological pa e ns ac oss ime and space. Wi h he ad en
o long- ead sequencing, Nanopo e-based me aba coding ep esen s a p omising al e -
na i e o sho - ead app oaches. Due o he limi ed numbe o a ailable s udies, he e -
ec i eness o Nanopo e sequencing - alone o in combina ion wi h sho - ead da a - o
assessing he biodi e si y and ecological pa e ns o p o is s in di e en ecosys ems
is no ye su icien ly explo ed. He e, we p esen BaNaNA (Ba coding Nanopo e Nea
Anno a o ), a pipeline designed o gene a e high-quali y OTUs and abundance es ima es
om Nanopo e sequencing da a. The pe o mance o he pipeline was e alua ed using a
mock communi y as well as on ma ine and eshwa e en i onmen al samples o demon-
s a e i s ele ance o p o is biodi e si y and ecological s udies. Ou esul s show ha
BaNaNA gene a es high-quali y ull-leng h 18S DNA OTUs om Nanopo e long eads
ha a e di ec ly compa able o sho - ead V4-18S DNA ASVs, suppo ing hei syne -
gis ic use in long- e m biodi e si y s udies. While bo h app oaches e eal simila o e all
communi y di e si y, long- ead OTUs p o ide g ea e axonomic esolu ion, iche phylo-
gene ic in o ma ion enabling he disco e y o new clades and yield ewe alse posi i es.
These ad an ages make long- ead Nanopo e me aba coding no only a powe ul cos
e ec i e complemen , bu also a eliable eplacemen o sho - ead me hods. By p o id-
ing a pipeline o p ocessing Nanopo e da a, BaNaNA pa es he way o a b oade appli-
ca ion o long- ead Nanopo e sequencing in p o is ecology and biodi e si y esea ch.
Key wo ds: Amplicon sequencing, eshwa e , ma ine, mic obial euka yo es, 18S DNA,
V4 egion
In oduc ion
Mic obial euka yo es (i.e. p o is s) a e e y di e se and ep esen a signi ican pa
o mic obial communi ies in he en i onmen s. Ye , hei small size and limi ed cul-
u ing success ha e hampe ed e o s o ully explo e hei di e si y so a . The ad-
en o High-Th oughpu Sequencing (HTS) echnologies applied o en i onmen-
al DNA (eDNA) has e olu ionised p o is di e si y s udies o bo h ecological and
Academic edi o : Tho s en S oeck
Recei ed:
4 July 2025
Accep ed:
26 Augus 2025
Published:
8 Oc obe 2025
Ci a ion: Chwalińska M, Ka licki M,
Romac S, No F, Ka nkowska A (2025)
F om sho o long eads: enhanced
p o is di e si y p o iling ia Nanopo e
me aba coding. Me aba coding and
Me agenomics 9: e163750. h ps://
doi.o g/10.3897/mbmg.9.163750
Me aba coding and Me agenomics 9: 421–447 (2025)
DOI: 10.3897/mbmg.9.163750
422
Me aba coding and Me agenomics 9: 421–447 (2025), DOI: 10.3897/mbmg.9.163750
Małgo za a Chwalińska e al.: P o is di e si y p o iling ia Nanopo e long eads
e olu iona y esea ch (Bu ki e al. 2021). Me aba coding, he mos widely used
app oach o s udy p o is di e si y in he en i onmen , ypically a ge s he a i-
able egions V4 and V9 o he 18S ibosomal RNA gene ( DNA), p o iding insigh s
in o he axonomic composi ion and dynamics o p o is s o e ime and space
(De Va gas e al. 2015; Mahé e al. 2017; Ka licki e al. 2024). The V9 egion was
ini ially p e e ed o p o is di e si y s udies because i is sho e and he e o e
easie o sequence (Ama al-Ze le e al. 2009). Howe e , wi h he de elopmen o
he Illumina sequencing echnology, he V4 egion which o e s a longe sequence
wi h a g ea e a iabili y and, hus, axonomic esolu ion, has become he egion
o choice and is cu en ly be e ep esen ed in e e ence da abases (Vaulo e al.
2022). The ecen ad en o long- ead sequencing echnologies, such as PacBio
o Ox o d Nanopo e Technology (ONT) p o ides longe amplicon (i.e. me aba -
codes) and a e being p oposed as a mo e e ec i e app oach o mic obial di e -
si y s udies (Jamy e al. 2020; Bludau e al. 2025). Fo p oka yo es, he use o ull-
leng h 16S DNA e e ence sequences and e en whole DNA ope ons is becoming
s anda d p ac ice (Callahan e al. 2019; Oli ie e al. 2023; Szoboszlay e al. 2023;
Lemoinne e al. 2024). Howe e , only a hand ul o s udies ha e applied such long
ead app oach o sequence he DNA ope on o p o is s om en i onmen al sam-
ples (Jamy e al. 2020; O e gaa d e al. 2024; Bludau e al. 2025).
Long amplicons sha e ce ain limi a ions wi h sho ones, such as p ime bias
(Vaulo e al. 2022). Mo eo e , as agmen leng h inc eases, ampli ica ion e i-
ciency o en declines, making he selec ion o p ime s o long- ead me aba cod-
ing di icul (La z e al. 2022; Sandin e al. 2022). Sequencing echnology-speci ic
limi a ions u he complica e long- ead applica ions: PacBio sequencing, while
highly accu a e, emains cos ly and is ypically limi ed o specialised acili ies,
while Nanopo e is mo e a o dable and widely accessible, bu has a highe e o
a e. Mo e speci ically, Nanopo e sequencing esul s in a high numbe o indels,
which impac s he gene a ion o high-quali y Molecula Ope a ional Taxonomic
Uni s (MOTUs). Depending on he bioin o ma ic p ocessing app oach applied
o high- h oughpu sequencing (HTS) da a, wo main ypes o MOTUs can be
p oduced: Ope a ional Taxonomic Uni s (OTUs) (Edga 2017) and Amplicon
Sequence Va ian s (ASVs) (Callahan e al. 2017). OTUs a e cons uc ed by clus-
e ing eads using simila i y h esholds and ASVs a e c ea ed in a p ocess in
which biological sequences a e di e en ia ed om sequencing e o s (Callahan
e al. 2017). Fo sho - ead sequencing, denoising app oaches a e commonly ap-
plied o gene a e ASVs, which p o ide a high axonomic esolu ion o he MOTUs
p esen in a sample. Simila denoising s a egies ha e also been adap ed o
PacBio amplicons, whe e low e o a es allow o eliable e o co ec ion and
ASV in e ence (Callahan e al. 2019). Howe e , his app oach is no adap ed o
Nanopo e da a due o i s highe e o a es and less p edic able e o p o iles
which hinde accu a e e o modelling. As a esul , clus e ing eads in o OTUs,
based on sequence simila i y, appea s as a mo e app op ia e s a egy o MOTUs
gene a ion om Nanopo e long eads (San os e al. 2020). To ensu e he eliabil-
i y and ep oducibili y o Nanopo e-based me aba coding, he e is a clea need
o a s anda dised pipeline o p ocess Nanopo e long eads. E o s in his di ec-
ion ha e al eady been made, pa icula ly o bac e ial communi ies. Pipelines,
such as he EPI2ME pla o m (Ox o d Nanopo e Technologies), Emu (Cu y e
al. 2022) and MeTaPONT (Amme -He menau e al. 2021), ha e been de eloped
o gene a e high-quali y amplicons om 16S DNA long eads. Howe e , hese
423
Me aba coding and Me agenomics 9: 421–447 (2025), DOI: 10.3897/mbmg.9.163750
Małgo za a Chwalińska e al.: P o is di e si y p o iling ia Nanopo e long eads
app oaches ely on high quali y e e ence-based alignmen s which demand mo e
comp ehensi e da abases han hose cu en ly a ailable o p o is s. In addi ion,
pipelines, based on clus e ing app oaches, a e being de eloped o analysing
bac e ial 16S DNA long- ead sequences (Rod íguez-Pé ez e al. 2021; Dubois
e al. 2024; Lemoinne e al. 2024; Schacksen e al. 2024). Mos s udies apply-
ing Nanopo e me aba coding o p o is s ha e ei he lacked speci ic pipelines o
clus e ing eads in o OTUs (Sandin e al. 2022; Hoope e al. 2023; Gaonka and
Campbell 2024) o ha e ocused on pipelines de eloped o samples wi h low
axonomic complexi y, such as clinical samples (Oh a e al. 2023; Huggins e al.
2024). NanoClus (Rod íguez-Pé ez e al. 2021) has been shown o be e ec i e
o low-complexi y p o is communi ies (Huggins e al. 2024), bu so a , only
Na ix2 (Deep e al. 2023) has been shown o p ope ly p ocess long- ead me-
aba coding da a o p o is s (Bludau e al. 2025). In addi ion o de eloping obus
me hods o gene a ing OTUs om Nanopo e long- ead amplicons (O e gaa d e
al. 2024), a majo challenge is o accu a ely es ima e OTUs abundances.
Longe me a-ba codes o e signi ican ad an ages as hey p o ide highe
axonomic esolu ion and, he e o e, allow a mo e de ailed unde s anding o
p o is communi ies, om de ailed biogeog aphy o e olu iona y s udies (Jamy
e al. 2020, 2022; Gaonka and Campbell 2024). Howe e , he ex ensi e da a-
se s gene a ed up o now om sho amplicons emain an in aluable esou ce,
especially o la ge-scale (e.g. De Va gas e al. (2015)) o long- e m s udies (e.g.
Yeh and Fuh man (2022)). I is he e o e impo an o e alua e how hese ap-
p oaches complemen each o he and can e en ually be combined. While some
a emp s ha e been made o g oups o o ganisms such as zooplank on (Chang
e al. 2024), li le is known abou he impac s on ecological analyses o he easi-
bili y o in eg a ing sho and long amplicons in compa a i e s udies o p o is s.
A ecen compa ison o Illumina V9-18S DNA and Nanopo e 18S DNA p o is
me aba codes om sedimen samples (Bludau e al. 2025) demons a ed ha
Nanopo e me aba codes p o ide highe axonomic esolu ion o p o is s, while
bo h me hods e ealed simila di e si y and basic communi y pa e ns.
He e, we u he add essed hese c i ical challenges by analysing bo h
Illumina and Nanopo e me aba coding da a om a p o is mock communi y,
as well as om dis inc en i onmen al sample se s ep esen ing ma ine and
eshwa e ecosys ems. To gene a e high-quali y OTUs om Nanopo e da a,
we in oduce he BaNaNA (Ba coding Nanopo e Nea Anno a o ) pipeline, p i-
ma ily designed o me aba coding analysis o mic obial euka yo es, bu sui -
able o o he axa as well. We e alua ed he e ec i eness o Nanopo e long-
ead 18S DNA and Illumina sho - ead V4-18S DNA me aba coding, p o iding
a de ailed assessmen o how each me hod in luences biodi e si y and ecolog-
ical in e p e a ions, ul ima ely emphasising he ad an ages o Nanopo e-based
me aba coding and he po en ial o combining bo h app oaches.
Ma e ials and me hods
Samples collec ion
F eshwa e samples (Suppl. ma e ial 2: able S1) we e collec ed a he end
o July o he beginning o Augus in yea 2020 om i e lakes in he G ea
Masu ian Lakeland Dis ic in no h-eas e n Poland. Samples we e collec ed
424
Me aba coding and Me agenomics 9: 421–447 (2025), DOI: 10.3897/mbmg.9.163750
Małgo za a Chwalińska e al.: P o is di e si y p o iling ia Nanopo e long eads
wi h a modi ied Be na owicz sample om pho ic and apho ic zones o each
lake, p e- il e ed h ough 150 µm mesh-size ne o emo e zooplank on and
la ge pa icles and hen il e ed unde p essu e h ough 0.2 µm memb ane
Nucleopo e il e s (Wha man, Maids one, UK). Fil e s we e ozen a -20 °C and
kep in a -80 °C eeze o long- ime s o age.
Ma ine samples (Suppl. ma e ial 2: able S2) we e collec ed du ing one
o he annual MOOSE-GE campaigns (h ps://campagnes. lo eoceano-
g aphique. /campagnes/17001500/) (Coppola e al. 2019) om 31 Augus
o 23 Sep embe 2017. A olume o 20 li es o seawa e om 2 × 12 li e
bo les was aken a he su ace, DCM and deep wa e s (ca. 2000 m dep h).
The wa e was p e- il e ed h ough 180 µm and il e ed h ough 0.2 and 3 μm,
47 mm Nucleopo e polyca bona e il e s (Wha man, Maids one, UK). A e il-
a ion, il e s om bo h size ac ions we e lash- ozen in liquid ni ogen and
s o ed independen ly a -80 °C un il DNA ex ac ion.
Mock communi y p epa a ion
The mock communi y was composed o se en species om cul u e collec ions
(Suppl. ma e ial 2: able S3). Species ep esen six g oups o p o is s: Hap ophy a,
Euglenozoa, Chlo ophy a, Ciliopho a, Dino lagella a and C yp ophy a (2 species).
Amongs hese, P ymnesium pa um (Hap ophy a), Euglena g acilis (Euglenozoa)
and Chlo ella a iabilis (Chlo ophy a) we e highly abundan , while Pa amecium
bu sa ia (Ciliopho a), Gymnodinium uscum (Dino lagella a), C yp omonas pa -
amecium (C yp ophy a) and C yp omonas gy opy enoidosa (C yp ophy a) we e
added a low concen a ion (Suppl. ma e ial 2: able S3). In addi ion o he axo-
nomic di e ences, he species wi hin he mock communi y di e ed conside ably
in cell size, mo phology and cell numbe designed o mimic na u al samples.
Cells abundances we e manually calcula ed using a Fuchs-Rosen hal cham-
be , all species being combined and il e ed unde p essu e h ough 0.2 μm mem-
b ane Nucleopo e il e s and ozen a -80 °C. Fo C yp omonas gy opy enoidosa
which did no ha e he 18S DNA e e ence sequence a ailable, we isola ed DNA
om he cul u e using NucleoSpin Tissue XS ki and ampli ied 18S RNA gene
using SA (5’ AACCTGGTTGATCCTGCCAGT 3’) (Medlin e al. 1988) and EukB
(5’ TGATCCTTCTGCAGGTTCACCTAC 3’) (Medlin e al. 1988) p ime s (Suppl. ma-
e ials 1, 2), pu i ied he DNA using PCR Mini Ki (Syngen) and sequenced using
Sange wi h addi ional p ime Euk528F (5’ CGGTAATTCCAGCTCC 3’) (Edgcomb
e al. 2011). F agmen s we e hen assembled using Lase gene Seqman P o.
DNA isola ion and ampli ica ion
DNA om eshwa e samples and mock communi y was ex ac ed om one qua -
e o he il e using he GeneMATRIX Soil DNA Pu i ica ion Ki (EURx), i s concen-
a ion being measu ed using NanoD op (The mo Scien i ic) and ozen a -80 °C.
DNA om ma ine samples we e ex ac ed using a modi ied p o ocol om he
NucleoSpin Plan II Mini o Midi ki s (Mache ey-Nagel), depending on he plank on-
ic size- ac ion. The de ailed DNA ex ac ion p o ocol is a ailable on he online p o-
ocol eposi o y p o ocols.io: dx.doi.o g/10.17504/p o ocols.io.kxygxy5xdl8j/ 1.
DNA ex ac s we e dilu ed o 5 ng/µl and ampli ied in h ee eplica es
o bo h sequencing me hodologies using Phusion High-Fideli y DNA
425
Me aba coding and Me agenomics 9: 421–447 (2025), DOI: 10.3897/mbmg.9.163750
Małgo za a Chwalińska e al.: P o is di e si y p o iling ia Nanopo e long eads
polyme ase (Finnzymes; The moFishe ). Fo Illumina s a egy, he V4 e-
gion o he 18S RNA gene (∼ 380 bp) was a ge ed using he p ime s
TAReuk454FWD1 (5’ CCAGCASCYGCGGTAATTCC 3’) and TAReukREV3
(5’ ACTTTCGTTCTTGATYRA 3’) (S oeck e al. 2010). Ampli ica ion o ma-
ine samples is de ailed on p o ocols.io: dx.doi.o g/10.17504/p o ocols.
io.bzucp6sw, while he eshwa e and mock communi y ampli ica ion p o-
ocol can be ound in he Suppl. ma e ials 1, 2 o his a icle. Fo Nanopo e
sequencing, a agmen om he beginning o 18S all he way o he D2 e-
gion o 28S DNA (amplicon size 3200 bp) was a ge ed using he SA (5’
TTTCTGTTGGTGCTGATATTGCAACCTGGTTGATCCTGCCAGT 3’) (Medlin e al.
1988) and D2C-R (5’ ACTTGCCTGTCGCTCTATCTTCCCTTGGTCCGTGTTTCAAGA
3’) (Scholin e al. 1994) p ime s ex ended by Nanopo e adap e s. The de ailed
p o ocol and he sequence o Nanopo e adap e s a e o be ound in he Suppl.
ma e ials 1, 2. A e PCRs, he eplica es we e me ged and pu i ied oge he
using a PCR Mini Ki (Syngen).
Illumina lib a y p epa a ion and sequencing
The lib a y o eshwa e samples and mock communi y was p epa ed and
sequenced in he Genomics Co e Facili y a he Cen e o New Technologies
(Uni e si y o Wa saw, Poland) using he Illumina MiSeq pla o m wi h 2 ×
250 bp. Rega ding ma ine samples, lib a y adap e liga ion and sequencing
we e pe o med in he same condi ions by Fas e is (www. as e is.com, Plan-
les-Oua es, Swi ze land) on a 2 × 250 bp MiSeq Illumina.
Nanopo e lib a y p epa a ion and sequencing
Nanopo e lib a ies we e p epa ed using PCR Ba coding Expansion 1-12 (EXP-
PBC001) and Liga ion Sequencing Ki (SQK-LSK114). Samples we e sequenced
on MinION Mk1B de ice using R10.4.1 low cells.
Illumina da a analysis
The quali y o aw sequences was checked using Fas QC .0.11.5 (And ews
2010). P ime s we e emo ed using he Cu adap plugin o QIIME2
2023.9.1 en i onmen (h ps://gi hub.com/qiime2/q2-cu adap ) (Bolyen e
al. 2019). Rep esen a i e sequences (ASVs – Amplicon Sequence Va ian s)
we e c ea ed using DADA2 (Callahan e al. 2016) in he QIIME2 en i on-
men using he DADA2 denoise-pai ed unc ion (h ps://gi hub.com/qiime2/
q2-dada2). Final ASVs had hei axonomy assigned using global alignmen
me hod o VSEARCH .2.7.1 (Rognes e al. 2016) o PR2 da abase .5.0.0
(Guillou e al. 2012) wi h minimum h eshold o 70% iden i y and minimum
que y co e age o 90%.
Nanopo e da a analysis
To o e come he high e o a e associa ed wi h Nanopo e sequencing ech-
nology, we ha e de eloped he BaNaNA (Ba coding Nanopo e Nea Anno a o )
(h ps://gi hub.com/ibe-uw/BaNaNA) - a Snakemake (Mölde e al. 2021)
426
Me aba coding and Me agenomics 9: 421–447 (2025), DOI: 10.3897/mbmg.9.163750
Małgo za a Chwalińska e al.: P o is di e si y p o iling ia Nanopo e long eads
pipeline o gene a e high-quali y ep esen a i e sequences, also known as
Ope a ional Taxonomic Uni s (OTUs), om long- eads amplicons (Fig. 1).
The pipeline includes mul iple s eps, which a e b ie ly ou lined he e. Fo a
de ailed desc ip ion, isi he Wiki page on Gi Hub (h ps://gi hub.com/ibe-
uw/BaNaNA/wiki). Fi s , aw eads we e basecalled and demul iplexed using
Do ado .0.5.1+a7 b3e3 (Ox o d Nanopo e Technologies h ps://gi hub.com/
nanopo e ech/do ado). Fo basecalling, he duplex op ion combined wi h he
supe -accu a e model was used. We hen il e ed he eads o leng h and qual-
i y using Fil long .0.2.1 (h ps://gi hub.com/ wick/Fil long) and ex ac ed
DNA agmen s using Ba nap 0.9 (h ps://gi hub.com/ seemann/ba nap). An
addi ional quali y check o he DNA agmen s was pe o med using he cus-
om Py hon 3.9.18 sc ip and Biopy hon ool (Cock e al. 2009) (h ps://gi hub.
com/ibe-uw/BaNaNA/blob/main/sc ip s/ex ac ing_ na.py), which checked
he p esence o he co ec DNA s uc u e (18S, 5.8S, 28S) and he leng h o
each egion. Fo u he analysis, we ocused exclusi ely on he 18S DNA gene,
al hough all agmen s o he ope on could po en ially be used. We hen calcu-
la ed he a e age ead quali y wi h NanoPlo 1.42.0 (De Cos e and Rademake s
2023) and FASTQ eads acco ding o Fil long and used his alue as he h esh-
old o he VSEARCH .2.7.1 (Rognes e al. 2016) clus e ing s ep. To ob ain
consensus sequences, we used he cus om sc ip (h ps://gi hub.com/ibe-uw/
BaNaNA/blob/main/sc ip s/ma _consensus.py) ha il e s ou clus e s con-
aining ewe han ou sequences and hen uses MAFFT .7.310 (Ka oh and
S andley 2013) o c ea e an alignmen wi hin clus e s and compa es each posi-
ion o c ea e inal sequences. In he nex s ep, we used Minimap2 2.24- 1122
(Li 2018) and Racon 1.5.0 (Vase e al. 2017) o polish he sequences. Nex , we
added he names o he samples o he sequence heade o make hem easie
o iden i y. A e me ging all p ocessed samples, we used VSEARCH o de ec
and emo e chime ic sequences, applying wo app oaches: (1) e e ence-based
chime a de ec ion using he PR2 5.0.0 da abase (Guillou e al. 2012) as a e e -
ence and (2) de no o chime a de ec ion using he uchime2_deno o algo i hm.
Final clus e ing a 99% iden i y wi h VSEARCH allowed us o emo e duplica e
sequences and c ea e inal Ope a ional Taxonomic Uni s (OTUs). Due o di e -
en leng hs o sequences wi hin clus e s du ing consensus building and polish-
ing, some OTUs accumula ed a la ge numbe o ambiguous bases ep esen ed
as Ns, which educes hei quali y; he cus om sc ip (h ps://gi hub.com/ibe-
uw/BaNaNA/blob/main/sc ip s/ emo e_Nseqs.py) was used o emo e hose
sequences. Subsequen ly, he ob ained OTUs we e axonomically anno a ed
agains he PR2 da abase using he global alignmen me hod implemen ed
Figu e 1. O e iew o he BaNaNA pipeline o ob aining OTUs om Nanopo e eads. The diag am illus a es he sequen-
ial s eps o he BaNaNA wo k low, along wi h in e g a ed ools and cus om sc ip s used a each s age o he analysis
(c ea ed wi h Bio ende .com).
427
Me aba coding and Me agenomics 9: 421–447 (2025), DOI: 10.3897/mbmg.9.163750
Małgo za a Chwalińska e al.: P o is di e si y p o iling ia Nanopo e long eads
in VSEARCH, using a minimum iden i y o 70% and a minimum que y co e -
age o 90% as pa ame e s. The abundances we e calcula ed by coun ing he
numbe o sequences in he clus e s om he i s clus e ing. A e calcula ing
he abundances, he OTU able is c ea ed wi h all samples. Addi ionally, he
BaNaNA pipeline allows he use o a ious da abases and modi ica ions wi h
espec o di e en p ime s and di e en agmen s o he DNA.
Ex ac ion o V4- ags om Nanopo e sequences
To assess he impac o sequence leng h on axonomic anno a ion and o in-
es iga e he possibili y o in eg a ing Nanopo e and Illumina da a, we ex ac ed
V4- ags om he Nanopo e OTUs. Fo his, we used he same p ime sequences
as o Illumina sequencing wi h h ee misma ches allowed as well as cus om-
ised R and Py hon sc ip s wi h he help o he Bios ings package (Pagès e al.
2021) and he Biopy hon ool (Cock e al. 2009), espec i ely. The ex ac ed V4
ags we e hen axonomically assigned agains he PR2 da abase independen -
ly o he Nanopo e OTUs using VSEARCH .2.7.1 (Rognes e al. 2016).
Species-le el classi ica ion and alse posi i es assessmen in he
mock communi y
To assess he ep esen a ion o ou mock communi y species in he PR2 da a-
base 5.0.0 (Guillou e al. 2012), we pe o med a global alignmen o he sequenc-
es o he e e ence s ains (Suppl. ma e ial 2: able S3) wi h he sequences o he
da abase using VSEARCH .2.7.1 (Rognes e al. 2016). A sequence was classi-
ied o species le el i he bes hi had a leas 99% simila i y wi h he e e ence
s ain sequence o i he bes hi was al eady classi ied as he same species. I
he bes hi was only classi ied o genus le el and had less han 99% simila i y
o he s ain e e ence, he sequence was assigned o genus le el. All o he hi s,
which we e classi ied o di e en gene a we e classi ied as alse posi i es.
Phylogene ic ee cons uc ion om Nanopo e OTUs
To cons uc he phylogene ic ee, we ex ac ed eshwa e and ma ine OTUs
whose pe cen iden i y wi h he closes PR2 5.0.0 (Guillou e al. 2012) e e ence
was be ween 80% and 97% and, he e o e, likely ep esen axa no ep esen -
ed in he da abase. Sequences we e aligned using MAFFT .7.310 (Ka oh and
S andley 2013) and he esul ing alignmen was immed wi h imAl .1.4. e 15
(Capella-Gu ié ez e al. 2009) using he -au oma ed1 op ion. Phylogene ic in e -
ence was pe o med using IQ-TREE 2.0.6 (Minh e al. 2020) wi h he -m MFP op-
ion o de e mine he op imal subs i u ion model. A e cons uc ing he ee, we
manually inspec ed he alignmen and ee o iden i y OTUs whose axonomy
was inconsis en wi h he clade in which hey we e placed. OTUs ha appea ed
on unusually long b anches we e emo ed. The emaining inconsis en OTUs
we e u he examined using BLAST sea ches (Al schul e al. 1990) agains he
NCBI n da abase (Wheele e al. 2007) o e ine hei axonomy (3 OTUs); hose
ha could no be eliably eclassi ied we e conside ed dubious and emo ed,
esul ing in a o al o 26 OTUs being excluded om he da ase . The sequences
we e hen ealigned, immed and he ee was ecalcula ed using he same
428
Me aba coding and Me agenomics 9: 421–447 (2025), DOI: 10.3897/mbmg.9.163750
Małgo za a Chwalińska e al.: P o is di e si y p o iling ia Nanopo e long eads
me hods as desc ibed abo e. The TIM2+F+R10 model was selec ed as he bes
i ing model o he inal ee. The esul ing ee was isualised using RS udio
(RS udio Team 2020) wi h he gg ee (Yu e al. 2017), eeio (Wang e al. 2020),
dply (Wickham e al. 2022) and eadxl (Wickham and B yan 2019) packages.
S a is ical analyses
Fu he analyses we e pe o med in RS udio (RS udio Team 2020) using lib a -
ies: phyloseq (McMu die and Holmes 2013), egan (Oksanen e al. 2022), i-
dy e se (Wickham e al. 2019), eshape2 (Wickham 2007), eadxl (Wickham
and B yan 2019) and ggplo 2 (Wickham 2016).
Sequences wi h low abundance we e emo ed om all da ase s p io o u -
he analyses, using di e en h esholds depending on he da ase . Fo en i-
onmen al samples, sequences occu ing ewe han i e imes in he en i e
da ase we e excluded, whe eas o he low-complexi y mock communi y, se-
quences wi h a ela i e abundance below 0.01% we e disca ded. We calcula ed
a e ac ion cu es by inspec ing how numbe o species changes depending
on he subsampling dep h. Fo be a-di e si y, we agg ega ed ASVs/OTUs a he
genus le el and calcula ed he B ay-Cu is dissimila i y index combined wi h
he NMDS o dina ion me hod.
Resul s
Compa ison o Illumina and Nanopo e me aba coding using a mock
communi y
We i s analysed a mock communi y o se en species ep esen ing majo
p o is lineages mixed a a de ined concen a ion (Suppl. ma e ial 2: able S3).
Illumina V4-18S RNA gene sequencing yielded 622,100 aw eads which, a e
p ocessing, gene a ed a o al o 268 ASVs wi h an a e age leng h o 379 bp
(Suppl. ma e ial 2: able S4). Nanopo e sequencing yielded 594,076 aw eads
encompassing he ull 18S RNA gene ITS1, 5.8S RNA gene, ITS2 and pa
o 28S RNA gene. A e in silico ex ac ion o he 18S RNA gene agmen s
and OTUs clus e ing using he BaNaNA pipeline, we iden i ied 147 OTUs wi h
an a e age sequence leng h o 1,843 bp (Suppl. ma e ial 2: able S5). Fu he
ex ac ion o he V4 egion o 18S RNA gene (V4- ags) om he OTUs yielded
145 sequences wi h an a e age leng h o 416.1 bp.
Illumina V4-18S DNA ASVs e ealed a axonomic composi ion ha di e ed
subs an ially om he o iginal communi y s uc u e o he mock communi y
(Fig. 2A). Dino lagella es we e he mos abundan g oup, ollowed by hap o-
phy es, cilia es and c yp ophy es, while euglenozoans we e nea ly absen om
he da ase . In addi ion, a conside able numbe o Illumina ASVs we e classi-
ied as “o he axa”, ep esen ing o ganisms ha we e no in en ionally included
in he mock communi y. The ull-leng h 18S DNA OTUs om Nanopo e se-
quencing mo e closely mi o ed he expec ed communi y composi ion, wi h
hap ophy es being he mos abundan , ollowed by euglenozoans.
Howe e , cilia es eplaced chlo ophy es as he hi d mos abundan g oup.
No signi ican di e ences we e obse ed be ween he V4- ags and he ull-
leng h 18S DNA OTUs. Nanopo e da ase s also con ained addi ional axa ha
429
Me aba coding and Me agenomics 9: 421–447 (2025), DOI: 10.3897/mbmg.9.163750
Małgo za a Chwalińska e al.: P o is di e si y p o iling ia Nanopo e long eads
we e absen om he o iginal mock communi y, bu hei numbe and di e si y
appea ed much la ge in he Illumina da a (Suppl. ma e ial 1: ig. S1). A de ailed
analysis o hese addi ional axa (mock_communi y_illumina_ axonomy_ able.
xlsx and mock_communi y_nanopo e_ axonomy_ able.xlsx; Zenodo eposi o y
DOI: 10.5281/zenodo.15673958) sugges s ha , al hough many o hem likely
ep esen biases in oduced du ing ASVs o OTU gene a ion, some migh co -
espond o genuine occu ences o o ganisms o mino con amina ions a he
han sequencing a e ac s (Suppl. ma e ial 1: ig. S2).
To assess he accu acy o he axonomic assignmen s ac oss di e en ap-
p oaches, compa isons we e made a he species le el, as all he mock commu-
ni y species a e ep esen ed in he e e ence da abase. Ul ima ely, nei he se-
quencing echnology was able o accu a ely iden i y all se en axa in he mock
communi y a he species le el o quan i y hem co ec ly (Table 1). Illumina
sequencing ailed o de ec Pa amecium bu sa ia a he species le el, while
Nanopo e did no iden i y C yp omonas gy opy enoidosa and Chlo ella a iabi-
lis. The Illumina da a exhibi ed signi ican biases in axon ela i e abundances,
wi h Euglena g acilis and Chlo ella a iabilis being subs an ially unde es ima ed
by h ee and wo o de s o magni ude, espec i ely, while Gymnodinium uscum
and bo h C yp omonas species we e o e es ima ed by h ee and wo o de s
o magni ude, espec i ely. Bo h Nanopo e-based ba codes (i.e. ull-leng h 18S
DNA OTUs and V4- ags) we e mos ly in ag eemen and accu a ely es ima -
ed he ela i e abundance o Euglena g acilis and C yp omonas pa amecium
and o e es ima ed Gymnodinium uscum by wo o de s o magni ude (Table
1). Howe e , o Pa amecium bu sa ia, he wo Nanopo e app oaches yielded
di e en esul s: he ull-leng h 18S DNA OTUs o e es ima ed abundance by
h ee o de s o magni ude, whe eas he V4- ags p o ided an es ima e much
close o he ac ual cell abundance. P ymnesium pa um was he only axon
o which ela i e abundance was consis en ly es ima ed o he same le el o
magni ude ac oss sequencing echnologies and ma ched i s p opo ion in he
mock communi y, based on cell coun s.
The p esence o addi ional axa and he poo ela i e abundance ob ained a
he species le el p omp ed us o in es iga e he impac o sequencing echnology
on he accu acy o axonomic anno a ion. The V4-18S DNA ASVs om Illumina
sequencing had he ewes ep esen a i e sequences classi ied o species-le el
Figu e 2. A. Rela i e abundance o species in he mock communi y a he subdi ision le el, as de e mined by cell coun s
and all sequencing app oaches. Taxa ha we e no in en ionally included in he mock communi y a e g ouped as ‘O he ’;
B. Accu acy o MOTUs iden i ica ion in he mock communi y. Ba plo s display he accu acy o axonomic assignmen o
ASVs and OTUs de i ed om he mock communi y, based on compa isons wi h known species composi ion.
436
Me aba coding and Me agenomics 9: 421–447 (2025), DOI: 10.3897/mbmg.9.163750
Małgo za a Chwalińska e al.: P o is di e si y p o iling ia Nanopo e long eads
gy opy enoidosa in he Nanopo e mock communi y da ase (Table 1) a e mos
likely due o he low DNA con en pe cell and he low numbe o cells p esen .
This is especially likely gi en ha he species had hei ep esen a i es p esen
in he e e ence da abase and bo h g oups (Chlo ophy a and C yp ophy a) we e
well ep esen ed in he en i onmen al da a (Fig. 4A).
Bo h Illumina and Nanopo e sequencing e ealed axa ha we e no o iginally
p esen in he mock communi y (Fig. 2A, Suppl. ma e ial 1: ig. S2), which we
belie e is due o he ac ual p esence o o ganisms and con aminan s, bu also
o a e ac s in amplicon gene a ion. This e ec is pa icula ly p onounced in
he Illumina ASVs gene a ed wi h DADA2, which yielded signi ican ly mo e axa
han he OTUs de i ed om Nanopo e da a using he BaNaNA pipeline (Suppl.
ma e ial 1: ig. S1, Fig. 2B). The high numbe o alse posi i es associa ed wi h
DADA2 was also obse ed in p e ious s udies (e.g. O e gaa d e al. (2024)). This
is also e lec ed in he almos exponen ial inc ease o axa a lowe axonomic
le els, which is p esen only in he Illumina da ase , indica ing a high le el o
backg ound noise (Suppl. ma e ial 1: ig. S1), possibly leading o in la ed di e si-
y es ima es in en i onmen al samples (Fig. 3). In con as , he Nanopo e-based
OTUs showed ewe alse posi i es, sugges ing a mo e accu a e ep esen a-
ion o ac ual p o is di e si y. Some non-mock axa we e sha ed ac oss bo h
pla o ms and may esul om inciden al p esence o hese axa in cul u es,
o example, Pe kinsea, a known pa asi e o dino lagella es and C yp omonas
pa amecium (= Chilomonas pa amecium) (B uge olle 2002; I oïz e al. 2022).
O he s could be caused by mino con amina ion du ing labo a o y p ocessing
o by c oss-con amina ion such as “ ag-jumping” (Schnell e al. 2015). These a e
known sou ces o e o s (San o e a a 2019), which howe e , had no signi ican
impac on he ecological in e p e a ion o ob ained esul s (Fig. 4A, B, D).
Recons uc ing ecological pa e ns om Nanopo e and Illumina-
based me aba coding
Bo h sequencing echnologies applied o en i onmen al samples yielded simila
axonomic composi ions (Fig. 4A, B) and success ully econs uc ed ecological
pa e ns (Fig. 4D). Such ag eemen has been p e iously demons a ed o long-
ead PacBio me aba coding s udies (Bu ki e al. 2021; Jamy e al. 2022) and
Nanopo e me aba coding on p o is communi ies (Bludau e al. 2025). Samples
as expec ed we e i s di e en ia ed, based on he salini y o he en i onmen
di iding hem in o ma ine and eshwa e ones (Fig. 4D). Fu he mo e, deep-
sea samples we e clea ly sepa a ed om he ones collec ed a he su ace and
DCM laye s o he wa e column. Sunli communi ies we e cha ac e ised wi h
pho osyn he ic axa such as chlo ophy es and hap ophy es, whe eas deep-sea
samples we e domina ed by he e o ophic adiola ians and diplonemids (Fig.
4B). The su ey o eshwa e dimic ic lakes om summe e ealed an expec -
ed pa e n wi h subs an ial p esence o dino lagella es and c yp ophy es in ox-
ygena ed laye s (Deb oas e al. 2017; Ka licki e al. 2024) (Fig. 4A). The unclea
dis inc ion be ween he pho ic and apho ic zones could be due o he s ong
in luence o sinking dead cells, as p e iously demons a ed (Ka licki e al.
2024). Tha is u he mo e suppo ed by highe ela i e abundance o pa asi ic
Pe kinsea in deepe ac ions which has been no iced by o he me aba coding
and mic oscopic su eys (Mango e al. 2009; Ka licki e al. 2024).
437
Me aba coding and Me agenomics 9: 421–447 (2025), DOI: 10.3897/mbmg.9.163750
Małgo za a Chwalińska e al.: P o is di e si y p o iling ia Nanopo e long eads
The impo ance o e e ence da abase in me aba coding s udies
The comp ehensi e na u e o e e ence sequence da abase is c ucial o p ope ly
desc ibe p o is di e si y (T agin e al. 2018). Howe e , exis ing p o is da abases
co e less di e si y compa ed o he bac e ial ones, hus making he axonomic
anno a ion less accu a e. Addi ionally, i appea s ha he numbe o a ailable
p o is e e ence sequences is disp opo iona e o ma ine and eshwa e en-
i onmen s. P o is s in ma ine ecosys ems a e be e s udied han eshwa e
ones wi h molecula me hods and cu en ly ha e much be e ep esen a ion o
species in he da abases. This dispa i y is well isible when looking a he pe -
cen age o iden i ies o ASVs and OTUs o he closes e e ence (Fig. 4C) whe e
gene ally lowe iden i ies o eshwa e en i onmen a e caused by a missing
close e e ence in he PR2 da abase. We also ob ained wice as many no el ull-
leng h 18S DNA OTUs om eshwa e da a han om ma ine (Fig. 5). Ou no -
el ull-leng h 18S DNA OTUs ep esen many g oups o p o is s (Fig. 5) clea ly
showing sys ema ic gaps in he e e ence da abases, bu also showing he po-
en ial o ill his gap and imp o e u u e classi ica ions wi h long Nanopo e me-
a-ba codes. The p ope classi ica ion o long eads equi es also da abases wi h
longe sequences; he p ime s es ed he e esul ed in he ull 18S DNA; howe e ,
Nanopo e sequencing allows us o gene a e amplicons co e ing he whole DNA
ope on, hough such da abases allowing app op ia e classi ica ion o he ull op-
e on a e s ill e y limi ed (Tede soo e al. 2024; K abbe ød e al. 2025).
Longe is be e : he bene i s o Nanopo e amplicons
The sho leng h o Illumina amplicons p e en s accu a e axonomy esolu ion
beyond he genus le el, limi ing e olu iona y and ine scale ecological s udies
(Huge h e al. 2014; Szoboszlay e al. 2023). Nanopo e echnology allows us o
sequence a once he whole 18S RNA gene and mo e, p o iding access o mo e
in o ma ion and, he e o e, a much be e species-le el esolu ion o axonomic an-
no a ion (La z e al. 2022; Oh a e al. 2023; Pe one e al. 2023; Szoboszlay e al.
2023; Zhang e al. 2023; Pascoal e al. 2024; Bludau e al. 2025). We ha e ocused
he e exclusi ely on he 18S DNA, as mo e comp ehensi e da abases a e cu en ly
a ailable only o his agmen . Howe e , longe agmen s spanning he en i e
ope on a e expec ed o p o ide e en highe esolu ion once su icien e e ence se-
quences a e a ailable — a p ocess ha is al eady unde way (K abbe ød e al. 2025).
The dec ease in anno a ion accu acy o sho e agmen s is pa icula ly
e iden when compa ing ull-leng h 18S DNA OTUs wi h V4- ags. O e all, he
ela i e abundance o ull-leng h 18S DNA OTUs, classi ied as Pa amecium
bu sa ia a he species le el, was g ea ly o e es ima ed and a simila case was
expec ed o V4- ags (Table 1). Howe e , due o he lowe accu acy o anno a-
ion o he V4- ag, many sequences we e assigned only o he genus le el (Fig.
2B), esul ing in much lowe ela i e abundances calcula ed a he species le el
(Table 1). In addi ion, he ela i e abundance alues in Table 1 a e in luenced
no only by he p ecision o axonomic anno a ion, bu also by ac o s such as
he amoun o DNA isola ed om each species (wi h la ge species gene ally
yielding mo e DNA) and he copy numbe o DNA.
On he o he hand, sho e sequences a e mo e likely o ma ch wi h 100% iden-
i y o a e e ence han longe sequences, as seen wi h V4- ags, which gene ally
438
Me aba coding and Me agenomics 9: 421–447 (2025), DOI: 10.3897/mbmg.9.163750
Małgo za a Chwalińska e al.: P o is di e si y p o iling ia Nanopo e long eads
exhibi highe iden i y pe cen ages wi h he same e e ence da abase compa ed
o ull-leng h 18S DNA OTUs (Fig. 4C), which may esul in o e es ima ion o
axa. In addi ion, unlike sho ASVs, long OTUs a e also sui able o phylogene ic
econs uc ion (Fig. 5) (O e gaa d e al. 2024), which allows hei axonomy o
be cu a ed and po en ially o disco e new lineages (La a e al. 2009).
Illumina amplicon sequencing is cu en ly he gold s anda d o me aba cod-
ing o p o is communi ies (De Va gas e al. 2015; Mahé e al. 2017; Pi edda
e al. 2017; Iba balz e al. 2023; Ka licki e al. 2024) and as amoun s o da a
ha e been collec ed and deposi ed in public da abases up ill now. S ill, he da a
a e he e ogeneous as hey we e o en gene a ed using di e en p ime s o co -
e ing di e en agmen s o he 18S RNA gene and, hus, p e en ing a p ope
da ase s in eg a ion o compa ison. Sequencing he whole 18S RNA gene by
Nanopo e o e s he possibili y o use any p ime pai o ex ac he needed
agmen o he gene and combine i wi h Illumina da ase s, as demons a -
ed by ou V4- ags analysis. Taxonomic assignmen o he ex ac ed agmen
gi es simila esul s, ye wi h a lowe accu acy compa ed o he ull-leng h 18S
DNA OTUs (Figs 2, 4A, B). The e o e, we ecommend o e ain he axonomic
assignmen om he whole ull-leng h 18S DNA o ully use he possibili ies o
long Nanopo e OTUs be o e ex ac ing any speci ic egion o in e es .
Conclusions
This s udy shows he e ec i eness o long- ead Nanopo e sequencing o p o-
is biodi e si y, ecology and e olu ion esea ch, pa icula ly in combina ion
wi h ou newly-de eloped BaNaNA pipeline. Ou esul s, based on high-quali y
OTUs, con i med ha Nanopo e sequencing is a powe ul and eliable ool o
di e si y s udies, p o iding compa able esul s o Illumina while educing he
noise o en associa ed wi h sho - ead echnologies and imp o ing axonomic
esolu ion. The abili y o use hose sequences o phylogene ic econs uc ions
and highe axonomic esolu ion u he highligh s he ad an ages o longe
amplicon da a o ecological analyses.
We ha e also demons a ed ha la ge amoun s o Illumina-based me aba -
coding da a can be e ec i ely combined wi h Nanopo e me a-ba codes. The
V4- ags ex ac ed om Nanopo e ull-leng h 18S DNA OTUs and Illumina V4-
18S DNA ASVs a e highly compa able. This compa ibili y enables he in eg a-
ion o da a gene a ed wi h di e en sequencing echnologies and p ime pai s
and acili a es long- e m s udies by inco po a ing exis ing da a.
Finally, ou analysis shows ha ma ine samples wi h mo e comple e e -
e ence da abases bene i om he highe esolu ion o long- ead sequenc-
ing. Howe e , challenges in axonomic anno a ion emain due o incomple e
e e ence da abases o eshwa e and o he en i onmen s, emphasising
he need o u he imp o e p o is e e ence da abases o ully exploi long-
eads me aba coding po en ial.
Acknowledgemen s
F eshwa e sampling was conduc ed using he acili ies o he KUMAK
Masu ian Cen e o Biodi e si y and Educa ion in U wi ał , Facul y o Biology,
Uni e si y o Wa saw. We would like o hank all he Mic oDi E eam membe s
439
Me aba coding and Me agenomics 9: 421–447 (2025), DOI: 10.3897/mbmg.9.163750
Małgo za a Chwalińska e al.: P o is di e si y p o iling ia Nanopo e long eads
who helped us wi h he sampling. We acknowledge he MOOSE p og amme
(Medi e anean Ocean Obse ing Sys em o he En i onmen ) coo dina ed by
CNRS-INSU and he Resea ch In as uc u e ILICO (CNRS-IFREMER).
Addi ional in o ma ion
Con lic o in e es
The au ho s ha e decla ed ha no compe ing in e es s exis .
E hical s a emen
No e hical s a emen was epo ed.
Use o AI
No use o AI was epo ed.
Funding
This wo k was suppo ed by he Na ional Science Cen e, Poland (OPUS g an
2020/37/B/NZ8/01456 o A.K.). The au ho (s) decla ed inancial suppo o esea ch
and publica ion o his a icle om he MOOSE p og amme (Medi e anean Ocean
Obse ing Sys em o he En i onmen ) suppo ed coo dina ed by CNRS-INSU and he
Resea ch In as uc u e ILICO (CNRS-IFREMER) and he F ench Oceanog aphic Flee in-
as uc u e (IFREMER).
Au ho con ibu ions
Concep ualiza ion: AK. Da a cu a ion: MC. Fo mal analysis: MC. Funding acquisi ion: AK.
In es iga ion: MK, SR, AK, MC. Me hodology: MC, SR, MK. P ojec adminis a ion: FN, AK.
Resou ces: AK. So wa e: MC, MK. Supe ision: AK, FN. Valida ion: MC. Visualiza ion:
MC. W i ing - o iginal d a : MC. W i ing - e iew and edi ing: MC, MK, FN, AK, SR.
Au ho ORCIDs
Małgo za a Chwalińska h ps://o cid.o g/0000-0002-5065-1608
Michał Ka licki h ps://o cid.o g/0000-0002-7952-6288
Sa ah Romac h ps://o cid.o g/0000-0003-3785-6972
Fab ice No h ps://o cid.o g/0000-0002-9342-195X
Anna Ka nkowska h ps://o cid.o g/0000-0003-3709-7873
Da a a ailabili y
The sequencing da a ha e been deposi ed in he EMBL-EBI Eu opean Nucleo ide A chi e
(ENA) unde he P ojec s IDs PRJEB89945, PRJEB90865 and PRJEB76575. All he es
o he supplemen a y ma e ials can be ound in Zenodo eposi o y unde DOI h ps://doi.
o g/10.5281/zenodo.15673958.
Re e ences
Al schul SF, Gish W, Mille W, Mye s EW, Lipman DJ (1990) Basic local alignmen sea ch
ool. Jou nal o Molecula Biology 215: 403–410. h ps://doi.o g/10.1016/S0022-
2836(05)80360-2
Ama al-Ze le LA, McClimen EA, Ducklow HW, Huse SM (2009) A Me hod o S udy-
ing P o is an Di e si y Using Massi ely Pa allel Sequencing o V9 Hype a iable
440
Me aba coding and Me agenomics 9: 421–447 (2025), DOI: 10.3897/mbmg.9.163750
Małgo za a Chwalińska e al.: P o is di e si y p o iling ia Nanopo e long eads
Regions o Small-Subuni Ribosomal RNA Genes. PLoS ONE 4: e6372. h ps://doi.
o g/10.1371/jou nal.pone.0006372
Amme -He menau C, P is e e N, Van Den Be g T, Ga ilo a I, Amanzada A, Singh SK,
Khalil A, Alili R, Belda E, Clemen K, Abd El Wahed A, Gady EE, Haub ock M, Beißba h
T, Ellen iede V, Neesse A (2021) Comp ehensi e We -Bench and Bioin o ma ics
Wo k low o Complex Mic obio a Using Ox o d Nanopo e Technologies. mSys ems
6(4): 10.1128/msys ems.00750-21. h ps://doi.o g/10.1128/msys ems.00750-21
And ews S (2010) Fas QC: A Quali y Con ol Tool o High Th oughpu Sequence Da a
[Online]. h p://www.bioin o ma ics.bab aham.ac.uk/p ojec s/ as qc/
A ezi B, Xing W, So ge JA, Hog e e HH (2003) Ampli ica ion e iciency o he mos able
DNA polyme ases. Analy ical Biochemis y 321: 226–235. h ps://doi.o g/10.1016/
S0003-2697(03)00465-2
Bia d T, Bigea d E, Audic S, Poulain J, Gu ie ez-Rod iguez A, Pesan S, S emmann L, No
F (2017) Biogeog aphy and di e si y o Colloda ia (Radiola ia) in he global ocean.
The ISME Jou nal 11: 1331–1344. h ps://doi.o g/10.1038/ismej.2017.12
Bludau D, Siebe G, Shah M, Deep A, Boenigk J, Beisse D (2025) B eaking he S an-
da d: Can Ox o d Nanopo e Technologies Sequencing Compe e Wi h Illumina in P o-
is an Amplicon S udies? En i onmen al DNA 7: e70084. h ps://doi.o g/10.1002/
edn3.70084
Bolyen E, Rideou JR, Dillon MR, Bokulich NA, Abne CC, Al-Ghali h GA, Alexande H, Alm
EJ, A umugam M, Asnica F, Bai Y, Bisanz JE, Bi inge K, B ejn od A, B islawn CJ,
B own CT, Callahan BJ, Ca aballo-Rod íguez AM, Chase J, Cope EK, Da Sil a R, Diene
C, Do es ein PC, Douglas GM, Du all DM, Du alle C, Edwa dson CF, E ns M, Es aki
M, Fouquie J, Gaugli z JM, Gibbons SM, Gibson DL, Gonzalez A, Go lick K, Guo J,
Hillmann B, Holmes S, Hols e H, Hu enhowe C, Hu ley GA, Janssen S, Ja musch
AK, Jiang L, Kaehle BD, Kang KB, Kee e CR, Keim P, Kelley ST, Knigh s D, Koes e I,
Kosciolek T, K eps J, Langille MGI, Lee J, Ley R, Liu Y-X, Lo ield E, Lozupone C, Ma-
he M, Ma o z C, Ma in BD, McDonald D, McI e LJ, Melnik AV, Me cal JL, Mo gan
SC, Mo on JT, Naimey AT, Na as-Molina JA, No hias LF, O chanian SB, Pea son T,
Peoples SL, Pe as D, P euss ML, P uesse E, Rasmussen LB, Ri e s A, Robeson MS,
Rosen hal P, Sega a N, Sha e M, Shi e A, Sinha R, Song SJ, Spea JR, Swa o d AD,
Thompson LR, To es PJ, T inh P, T ipa hi A, Tu nbaugh PJ, Ul-Hasan S, Van De Hoo
JJJ, Va gas F, Vázquez-Baeza Y, Vog mann E, Von Hippel M, Wal e s W, Wan Y, Wang
M, Wa en J, Webe KC, Williamson CHD, Willis AD, Xu ZZ, Zane eld JR, Zhang Y, Zhu
Q, Knigh R, Capo aso JG (2019) Rep oducible, in e ac i e, scalable and ex ensible
mic obiome da a science using QIIME 2. Na u e Bio echnology 37: 852–857. h ps://
doi.o g/10.1038/s41587-019-0209-9
B uge olle G (2002) C yp ophagus sub ilis: A new pa asi e o c yp ophy es a ilia ed wi h
he Pe kinsozoa lineage. Eu opean Jou nal o P o is ology 37: 379–390. h ps://doi.
o g/10.1078/0932-4739-00837
Bu ki F, Sandin MM, Jamy M (2021) Di e si y and ecology o p o is s e ealed by
me aba coding. Cu en Biology 31: R1267–R1280. h ps://doi.o g/10.1016/j.
cub.2021.07.066
Callahan BJ, McMu die PJ, Rosen MJ, Han AW, Johnson AJA, Holmes SP (2016) DADA2:
High- esolu ion sample in e ence om Illumina amplicon da a. Na u e Me hods 13:
581–583. h ps://doi.o g/10.1038/nme h.3869
Callahan BJ, McMu die PJ, Holmes SP (2017) Exac sequence a ian s should eplace
ope a ional axonomic uni s in ma ke -gene da a analysis. The ISME Jou nal 11:
2639–2643. h ps://doi.o g/10.1038/ismej.2017.119
441
Me aba coding and Me agenomics 9: 421–447 (2025), DOI: 10.3897/mbmg.9.163750
Małgo za a Chwalińska e al.: P o is di e si y p o iling ia Nanopo e long eads
Callahan BJ, Wong J, Heine C, Oh S, The io CM, Gula i AS, McGill SK, Doughe y MK
(2019) High- h oughpu amplicon sequencing o he ull-leng h 16S RNA gene wi h
single-nucleo ide esolu ion. Nucleic Acids Resea ch 47: e103–e103. h ps://doi.
o g/10.1093/na /gkz569
Capella-Gu ié ez S, Silla-Ma ínez JM, Gabaldón T (2009) imAl: A ool o au oma ed
alignmen imming in la ge-scale phylogene ic analyses. Bioin o ma ics 25: 1972–
1973. h ps://doi.o g/10.1093/bioin o ma ics/b p348
Ca on DA, Hu SK (2019) A e We O e es ima ing P o is an Di e si y in Na u e? T ends in
Mic obiology 27: 197–205. h ps://doi.o g/10.1016/j. im.2018.10.009
Chang JJM, Ip YCA, Neo WL, Mowe MAD, Jaa a Z, Huang D (2024) P imed and eady:
Nanopo e me aba coding can now eco e highly accu a e consensus ba codes ha
a e gene ally indel- ee. BMC Genomics 25: 842. h ps://doi.o g/10.1186/s12864-
024-10767-4
Choi J, Pa k JS (2020) Compa a i e analyses o he V4 and V9 egions o 18S DNA o
he ex an euka yo ic communi y using he Illumina pla o m. Scien i ic Repo s 10:
6519. h ps://doi.o g/10.1038/s41598-020-63561-z
Cock PJA, An ao T, Chang JT, Chapman BA, Cox CJ, Dalke A, F iedbe g I, Hamel yck T,
Kau F, Wilczynski B, De Hoon MJL (2009) Biopy hon: F eely a ailable Py hon ools
o compu a ional molecula biology and bioin o ma ics. Bioin o ma ics 25: 1422–
1423. h ps://doi.o g/10.1093/bioin o ma ics/b p163
Coppola L, Raimbaul P, Mo ie L, Tes o P (2019) Moni o ing he En i onmen in he
No hwes e n Medi e anean Sea. Eos 100. h ps://doi.o g/10.1029/2019EO125951
Cu y KD, Wang Q, Nu e MG, Tyshaie a A, Ree es E, So iano S, Wu Q, G aebe E, Finze
P, Mendling W, Sa idge T, Villapol S, Dil hey A, T eangen TJ (2022) Emu: Species-le el
mic obial communi y p o iling o ull-leng h 16S RNA Ox o d Nanopo e sequencing
da a. Na u e Me hods 19: 845–853. h ps://doi.o g/10.1038/s41592-022-01520-4
De Cos e W, Rademake s R (2023) NanoPack2: popula ion-scale e alua ion o long-
ead sequencing da a. Bioin o ma ics 39: b ad311. h ps://doi.o g/10.1093/bioin o -
ma ics/b ad311
De Va gas C, Audic S, Hen y N, Decelle J, Mahé F, Loga es R, La a E, Be ney C, Le Besco
N, P obe I, Ca michael M, Poulain J, Romac S, Colin S, Au y J-M, Bi ne L, Cha on
S, Dun ho n M, Engelen S, Flegon o a O, Guidi L, Ho ák A, Jaillon O, Lima-Mendez G,
Lukeš J, Mal iya S, Mo a d R, Mulo M, Scalco E, Siano R, Vincen F, Zingone A, Dimie
C, Piche al M, Sea son S, Kandels-Lewis S, Ta a Oceans Coo dina o s, Acinas SG,
Bo k P, Bowle C, Go sky G, G imsley N, Hingamp P, Iudicone D, No F, Oga a H, Pesan
S, Raes J, Sie acki ME, Speich S, S emmann L, Sunagawa S, Weissenbach J, Wincke
P, Ka sen i E, Boss E, Follows M, Ka p-Boss L, K zic U, Reynaud EG, Sa de C, Sulli an
MB, Velayoudon D (2015) Euka yo ic plank on di e si y in he sunli ocean. Science
348: 1261605. h ps://doi.o g/10.1126/science.1261605
Deb oas D, Domaizon I, Humbe J-F, Ja dillie L, Lepè e C, Ouda A, Taïb N (2017)
O e iew o eshwa e mic obial euka yo es di e si y: A i s analysis o publicly
a ailable me aba coding da a. FEMS Mic obiology Ecology 93(4): ix023. h ps://doi.
o g/10.1093/ emsec/ ix023
Decelle J, Romac S, Sasaki E, No F, Mahé F (2014) In acellula Di e si y o he V4
and V9 Regions o he 18S RNA in Ma ine P o is s (Radiola ians) Assessed by
High-Th oughpu Sequencing. PLoS ONE 9: e104297. h ps://doi.o g/10.1371/jou -
nal.pone.0104297
Deep A, Bludau D, Welzel M, Clemens S, Heide D, Boenigk J, Beisse D (2023) Na ix2 –
Imp o ed amplicon wo k low wi h no el Ox o d Nanopo e Technologies suppo and
442
Me aba coding and Me agenomics 9: 421–447 (2025), DOI: 10.3897/mbmg.9.163750
Małgo za a Chwalińska e al.: P o is di e si y p o iling ia Nanopo e long eads
enhancemen s in clus e ing, classi ica ion and axonomic da abases. Me aba cod-
ing and Me agenomics 7: e109389. h ps://doi.o g/10.3897/mbmg.7.109389
Dubois B, Deli e M, Leng and S, B aga d C, Leg è e A, Debode F (2024) PRONAME: A us-
e - iendly pipeline o p ocess long- ead nanopo e me aba coding da a by gene a ing
high-quali y consensus sequences. F on ie s in Bioin o ma ics 4: 1483255. h ps://
doi.o g/10.3389/ bin .2024.1483255
Edga RC (2017) Accu acy o mic obial communi y di e si y es ima ed by closed- and
open- e e ence OTUs. Pee J 5: e3889. h ps://doi.o g/10.7717/pee j.3889
Edgcomb V, O si W, Bunge J, Jeon S, Ch is en R, Leslin C, Holde M, Taylo GT, Sua ez P,
Va ela R, Eps ein S (2011) P o is an mic obial obse a o y in he Ca iaco Basin, Ca ib-
bean. I. Py osequencing s Sange insigh s in o species ichness. The ISME Jou nal
5: 1344–1356. h ps://doi.o g/10.1038/ismej.2011.6
Ege e B, Ve íssimo J, Lopes‐Lima M, Cha es C, Pin o J, Ricca di N, Beja P, Fonseca NA
(2022) Speeding up he de ec ion o in asi e bi al e species using en i onmen al
DNA: A Nanopo e and Illumina sequencing compa ison. Molecula Ecology Resou c-
es 22: 2232–2247. h ps://doi.o g/10.1111/1755-0998.13610
Gaonka CC, Campbell L (2024) A ull‐leng h 18S ibosomal DNA me aba coding ap-
p oach o de e mining p o is communi y di e si y using Nanopo e sequencing.
Ecology and E olu ion 14: e11232. h ps://doi.o g/10.1002/ece3.11232
Geisen S, La os I, Vizcaíno A, Bonkowski M, De G oo GA (2015) No all a e ee‐li ing:
High‐ h oughpu DNA me aba coding e eals a di e se communi y o p o is s pa -
asi izing soil me azoa. Molecula Ecology 24: 4556–4569. h ps://doi.o g/10.1111/
mec.13238
Gong W, Ma che i A (2019) Es ima ion o 18S Gene Copy Numbe in Ma ine Euka yo ic
Plank on Using a Nex -Gene a ion Sequencing App oach. F on ie s in Ma ine Science
6: 219. h ps://doi.o g/10.3389/ ma s.2019.00219
Gong J, Dong J, Liu X, Massana R (2013) Ex emely high copy numbe s and polymo -
phisms o he DNA ope on es ima ed om single cell analysis o oligo ich and pe -
i ich cilia es. P o is 164: 369–379. h ps://doi.o g/10.1016/j.p o is.2012.11.006
Guillou L, Bacha D, Audic S, Bass D, Be ney C, Bi ne L, Bou e C, Bu gaud G, De
Va gas C, Decelle J, Del Campo J, Dolan JR, Dun ho n M, Ed a dsen B, Holzmann
M, Koois a WHCF, La a E, Le Besco N, Loga es R, Mahé F, Massana R, Mon-
eso M, Mo a d R, No F, Pawlowski J, P obe I, Sau ade A-L, Siano R, S oeck
T, Vaulo D, Zimme mann P, Ch is en R (2012) The P o is Ribosomal Re e ence
da abase (PR2): A ca alog o unicellula euka yo e Small Sub-Uni RNA sequenc-
es wi h cu a ed axonomy. Nucleic Acids Resea ch 41: D597–D604. h ps://doi.
o g/10.1093/na /gks1160
Hoope C, Wa d GM, Fos e R, Skujina I, I onside JE, Be ney C, Bass D (2023) Long ampl-
icons as a ool o iden i y a iable egions o ibosomal RNA o imp o ed axonomic
esolu ion and diagnos ic assay design in mic oeuka yo es: Using asce ospo ea as a
case s udy. F on ie s in Ecology and E olu ion 11: 1266151. h ps://doi.o g/10.3389/
e o.2023.1266151
Huge h LW, Mulle EEL, Hu YOO, Leb un LAM, Roume H, Lundin D, Wilmes P, Ande sson
AF (2014) Sys ema ic Design o 18S RNA Gene P ime s o De e mining Euka yo ic
Di e si y in Mic obial Conso ia. PLoS ONE 9: e95567. h ps://doi.o g/10.1371/jou -
nal.pone.0095567
Huggins LG, Colella V, Young ND, T aub RJ (2024) Me aba coding using nanopo e long‐
ead sequencing o he unbiased cha ac e iza ion o apicomplexan haemopa asi es.
Molecula Ecology Resou ces 24: e13878. h ps://doi.o g/10.1111/1755-0998.13878
443
Me aba coding and Me agenomics 9: 421–447 (2025), DOI: 10.3897/mbmg.9.163750
Małgo za a Chwalińska e al.: P o is di e si y p o iling ia Nanopo e long eads
Iba balz FM, Hen y N, Mahé F, A dyna M, Zingone A, Scalco E, Lo ejoy C, Lomba d F,
Jaillon O, Iudicone D, Mal iya S, Ta a Oceans Coo dina o s, Sulli an MB, Cha on S,
Ka sen i E, Babin M, Boss E, Wincke P, Zinge L, De Va gas C, Bowle C, Ka p-Boss L
(2023) Pan-A c ic plank on communi y s uc u e and i s global connec i i y. Elemen-
a 11: 00060. h ps://doi.o g/10.1525/elemen a.2022.00060
I oïz S, Me z S, De elle E, Reñé A, Ga cés E, Bass D, Soudan P, Chambou e A (2022)
Eme ging Pa asi ic P o is s: The Case o Pe kinsea. F on ie s in Mic obiology 12:
735815. h ps://doi.o g/10.3389/ micb.2021.735815
Jamy M, Fos e R, Ba be a P, Czech L, Kozlo A, S ama akis A, Bending G, Hil on S, Bass
D, Bu ki F (2020) Long‐ ead me aba coding o he euka yo ic DNA ope on o phy-
logene ically and axonomically esol e en i onmen al di e si y. Molecula Ecology
Resou ces 20: 429–443. h ps://doi.o g/10.1111/1755-0998.13117
Jamy M, Biwe C, Vaulo D, Obiol A, Jing H, Peu a S, Massana R, Bu ki F (2022) Global
pa e ns and a es o habi a ansi ions ac oss he euka yo ic ee o li e. Na u e
Ecology & E olu ion 6: 1458–1470. h ps://doi.o g/10.1038/s41559-022-01838-4
Joba d M, Waw zyniak I, B onne G, Ma ie D, Velle A, Sime-Ngando T, Deb oas D, Lepè e
C (2020) F eshwa e Pe kinsea: di e si y, ecology and genomic in o ma ion. Jou nal
o Plank on Resea ch 42: 3–17. h ps://doi.o g/10.1093/plank / bz068
Ka licki M, Bedna ska A, Hałakuc P, Maciszewski K, Ka nkowska A (2024) Spa io- em-
po al changes o small p o is and ee-li ing bac e ial communi ies in a empe a e
dimic ic lake: Insigh s om me aba coding and machine lea ning. FEMS Mic obiolo-
gy Ecology 100: iae104. h ps://doi.o g/10.1093/ emsec/ iae104
Ka oh K, S andley DM (2013) MAFFT Mul iple sequence alignmen so wa e e sion
7: Imp o emen s in pe o mance and usabili y. Molecula Biology and E olu ion 30:
772–780. h ps://doi.o g/10.1093/molbe /ms 010
K abbe ød AK, S okke E, Thoen E, Sk ede I, Kause ud H (2025) The ibosomal ope on da-
abase: A ull‐leng h DNA ope on da abase de i ed om genome assemblies. Mo-
lecula Ecology Resou ces 25: e14031. h ps://doi.o g/10.1111/1755-0998.14031
La a E, Mo ei a D, Ve eshchaka A, López‐Ga cía P (2009) Pan‐oceanic dis ibu ion o
new highly di e se clades o deep‐sea diplonemids. En i onmen al Mic obiology 11:
47–55. h ps://doi.o g/10.1111/j.1462-2920.2008.01737.x
La z MAC, G ujcic V, B ugel S, Lycken J, John U, Ka lson B, Ande sson A, Ande sson AF
(2022) Sho ‐ and long‐ ead me aba coding o he euka yo ic RNA ope on: E alua-
ion o p ime s and compa ison o sho gun me agenomics sequencing. Molecula
Ecology Resou ces 22: 2304–2318. h ps://doi.o g/10.1111/1755-0998.13623
Lemoinne A, Di be g G, Geo ges M, Robine T (2024) E alua ion o a nanopo e sequenc-
ing s a egy on bac e ial communi ies om ma ine sedimen s. En i onmen al DNA 6:
e70009. h ps://doi.o g/10.1002/edn3.70009
Li H (2018) Minimap2: pai wise alignmen o nucleo ide sequences. Bioin o ma ics 34:
3094–3100. h ps://doi.o g/10.1093/bioin o ma ics/b y191
Mahé F, De Va gas C, Bass D, Czech L, S ama akis A, La a E, Singe D, Mayo J, Bunge J,
Se nake S, Siemensmeye T, T au mann I, Romac S, Be ney C, Kozlo A, Mi chell EAD,
Seppey CVW, Egge E, Len endu G, Wi h R, T ueba G, Dun ho n M (2017) Pa asi es
domina e hype di e se soil p o is communi ies in Neo opical ain o es s. Na u e
Ecology & E olu ion 1: 0091. h ps://doi.o g/10.1038/s41559-017-0091
Mango J-F, Lepè e C, Bou ie C, Deb oas D, Domaizon I (2009) Communi y S uc u e
and Dynamics o Small Euka yo es Ta ge ed by New Oligonucleo ide P obes: New
Insigh in o he Lacus ine Mic obial Food Web. Applied and En i onmen al Mic obi-
ology 75: 6373–6381. h ps://doi.o g/10.1128/AEM.00607-09
444
Me aba coding and Me agenomics 9: 421–447 (2025), DOI: 10.3897/mbmg.9.163750
Małgo za a Chwalińska e al.: P o is di e si y p o iling ia Nanopo e long eads
Ma in JL, San i I, Pi a P, John U, Gypens N (2022) Towa ds quan i a i e me aba coding
o euka yo ic plank on: An app oach o imp o e 18S RNA gene copy numbe bias. Me-
aba coding and Me agenomics 6: e85794. h ps://doi.o g/10.3897/mbmg.6.85794
McMu die PJ, Holmes S (2013) phyloseq: An R package o ep oducible in e ac i e
analysis and g aphics o mic obiome census da a. PLoS ONE 8: e61217. h ps://doi.
o g/10.1371/jou nal.pone.0061217
Medlin L, Elwood HJ, S ickel S, Sogin ML (1988) The cha ac e iza ion o enzyma ically
ampli ied euka yo ic 16S-like RNA-coding egions. Gene 71: 491–499. h ps://doi.
o g/10.1016/0378-1119(88)90066-2
Minh BQ, Schmid HA, Che nomo O, Sch emp D, Woodhams MD, Von Haesele A, Lan-
ea R (2020) IQ-TREE 2: New models and e icien me hods o phylogene ic in e -
ence in he genomic e a. Molecula Biology and E olu ion 37: 1530–1534. h ps://doi.
o g/10.1093/molbe /msaa015
Mölde F, Jablonski KP, Le che B, Hall MB, Tomkins-Tinch CH, Socha V, Fo s e J, Lee
S, Twa dziok SO, Kani z A, Wilm A, Hol g ewe M, Rahmann S, Nahnsen S, Kös e J
(2021) Sus ainable da a analysis wi h Snakemake. F1000Resea ch 10: 33. h ps://
doi.o g/10.12688/ 1000 esea ch.29032.2
Ni Y, Liu X, Simeneh ZM, Yang M, Li R (2023) Benchma king o Nanopo e R10.4 and
R9.4.1 low cells in single-cell whole-genome ampli ica ion and whole-genome sho -
gun sequencing. Compu a ional and S uc u al Bio echnology Jou nal 21: 2352–
2364. h ps://doi.o g/10.1016/j.csbj.2023.03.038
No ák J, T ei li SC, Füssy Z, Záhono á K, Hamplo á B, H dá Š, Hampl V (2024) V9 Hype -
a iable Region Me aba coding P ime s o Euglenozoa and Me amonada. En i on-
men al DNA 6: e70022. h ps://doi.o g/10.1002/edn3.70022
Obiol A, Gine CR, Sánchez P, Dua e CM, Acinas SG, Massana R (2020) A me agenomic
assessmen o mic obial euka yo ic di e si y in he global ocean. Molecula Ecology
Resou ces 20: 718–731. h ps://doi.o g/10.1111/1755-0998.13147
Oh a A, Nishi K, Hi o a K, Ma suo Y (2023) Using nanopo e sequencing o iden i y ungi
om clinical samples wi h high phylogene ic esolu ion. Scien i ic Repo s 13: 9785.
h ps://doi.o g/10.1038/s41598-023-37016-0
Oksanen J, Simpson GL, Blanche FG, Kind R, Legend e P, Minchin PR, O’Ha a RB, Soly-
mos P, S e ens MHH, Szoecs E, Wagne H, Ba bou M, Bedwa d M, Bolke B, Bo ca d
D, Ca alho G, Chi ico M, Cace es MD, Du and S, E angelis a HBA, Fi zJohn R, F iendly
M, Fu neaux B, Hannigan G, Hill MO, Lah i L, McGlinn D, Ouelle e M-H, Cunha ER,
Smi h T, S ie A, B aak CJFT, Weedon J (2022) egan: Communi y Ecology Package.
h ps://CRAN.R-p ojec .o g/package= egan
Oli ie SA, Bull MK, S ube ML, Mu phy R, Ross T, Bowman JP, Chapman B (2023) Long-
ead MinIONTM sequencing o 16S and 16S-ITS-23S RNA genes p o ides species-le -
el esolu ion o Lac obacillaceae in mixed communi ies. F on ie s in Mic obiology 14:
1290756. h ps://doi.o g/10.3389/ micb.2023.1290756
O e gaa d CK, Jamy M, Radu oiu S, Bu ki F, Dueholm MKD (2024) Benchma king long‐
ead sequencing s a egies o ob aining ASV ‐ esol ed NA ope ons om en i-
onmen al mic oeuka yo es. Molecula Ecology Resou ces 24: e13991. h ps://doi.
o g/10.1111/1755-0998.13991
Pagès H, Aboyoun P, Gen leman R, DebRoy S (2021) Bios ings: E icien manipula ion o
biological s ings. h ps://bioconduc o .o g/packages/Bios ings
Pascoal F, Dua e P, Assmy P, Cos a R, Magalhães C (2024) Full-leng h 16S RNA gene
sequencing combined wi h adequa e da abase selec ion imp o es he desc ip ion o
445
Me aba coding and Me agenomics 9: 421–447 (2025), DOI: 10.3897/mbmg.9.163750
Małgo za a Chwalińska e al.: P o is di e si y p o iling ia Nanopo e long eads
A c ic ma ine p oka yo ic communi ies. Annals o Mic obiology 74: 29. h ps://doi.
o g/10.1186/s13213-024-01767-6
Pe one JR, Rios Glusbe ge P, Geo ge CD, Mille ich PL, Ah ens AP, Roesch LFW, T iple
EW (2023) RESCUE: A alida ed Nanopo e pipeline o classi y bac e ia h ough long-
ead, 16S-ITS-23S RNA sequencing. F on ie s in Mic obiology 14: 1201064. h ps://
doi.o g/10.3389/ micb.2023.1201064
Pi edda R, Tomasino MP, D’E chia AM, Manza i C, Pesole G, Mon eso M, Koois a
WHCF, Sa no D, Zingone A (2017) Di e si y and empo al pa e ns o plank onic p o-
is assemblages a a Medi e anean Long Te m Ecological Resea ch si e. FEMS Mi-
c obiology Ecology 93: iw200. h ps://doi.o g/10.1093/ emsec/ iw200
Rod íguez-Pé ez H, Ciu eda L, Flo es C (2021) NanoCLUST: a species-le el analysis
o 16S RNA nanopo e sequencing da a. Bioin o ma ics 37: 1600–1601. h ps://doi.
o g/10.1093/bioin o ma ics/b aa900
Rognes T, Flou i T, Nichols B, Quince C, Mahé F (2016) VSEARCH: A e sa ile open
sou ce ool o me agenomics. Pee J 4: e2584. h ps://doi.o g/10.7717/pee j.2584
RS udio Team (2020) RS udio: In eg a ed De elopmen En i onmen o R. h p://www.
s udio.com/
Sandin MM, Romac S, No F (2022) In a‐genomic NA gene a iabili y o Nassel-
la ia and Spumella ia (Rhiza ia, Radiola ia) assessed by Sange , MiNiON and Il-
lumina sequencing. En i onmen al Mic obiology 24: 2979–2993. h ps://doi.
o g/10.1111/1462-2920.16081
San o e a a LF (2019) Cu en p ac ice in plank on me aba coding: Op imiza ion
and e o managemen . Jou nal o Plank on Resea ch 41: 571–582. h ps://doi.
o g/10.1093/plank / bz041
San os A, Van Ae le R, Ba ien os L, Ma inez-U aza J (2020) Compu a ional me hods
o 16S me aba coding s udies using Nanopo e sequencing da a. Compu a ion-
al and S uc u al Bio echnology Jou nal 18: 296–305. h ps://doi.o g/10.1016/j.
csbj.2020.01.005
Schacksen PS, Øs e gaa d SK, Eskildsen MH, Nielsen JL (2024) Comple e pipeline o
Ox o d Nanopo e Technology amplicon sequencing (ONT ‐ AMpSeq): F om p e‐p o-
cessing o c ea ing an ope a ional axonomic uni able. FEBS Open Bio 14: 1779–
1787. h ps://doi.o g/10.1002/2211-5463.13868
Schnell IB, Bohmann K, Gilbe MTP (2015) Tag jumps illumina ed – educing sequence‐
o‐sample misiden i ica ions in me aba coding s udies. Molecula Ecology Resou c-
es 15: 1289–1303. h ps://doi.o g/10.1111/1755-0998.12402
Scholin CA, He zog M, Sogin M, Ande son DM (1994) Iden i ica ion o g oup-and
s ain-speci ic gene ic ma ke s o globally dis ibu ed Alexand ium (Dinophyceae).
ii. sequence analysis o a agmen o he LSU RNA gene 1. Jou nal o Phycology 30:
999–1011. h ps://doi.o g/10.1111/j.0022-3646.1994.00999.x
Se eika M, Ki kegaa d RH, Ka s SM, Michaelsen TY, Sø ensen EA, Wollenbe g RD, Al-
be sen M (2022) Ox o d Nanopo e R10.4 long- ead sequencing enables he gen-
e a ion o nea - inished bac e ial genomes om pu e cul u es and me agenomes
wi hou sho - ead o e e ence polishing. Na u e Me hods 19: 823–826. h ps://doi.
o g/10.1038/s41592-022-01539-7
S oeck T, Bass D, Nebel M, Ch is en R, Jones MDM, B eine H, Richa ds TA (2010) Mul-
iple ma ke pa allel ag en i onmen al DNA sequencing e eals a highly complex
euka yo ic communi y in ma ine anoxic wa e . Molecula Ecology 19: 21–31. h ps://
doi.o g/10.1111/j.1365-294X.2009.04480.x
