53
An enhanced qPCR me hod o apid Ag ilus planipennis
de ec ion and moni o ing
Qui in Kuppe 1, Donnie L. Pe e son2, Leand a C. F i si1, Do is Hölling1, Anouchka Pe e -Gen il1,
F ancesco Peco i3, Denise Al enbach4, Ma co Giulio5, Helen Zbinden6, Salome Schneide 1,
Bea Ru ne 1
1 Fo es Heal h and Bio ic In e ac ions, Swiss Fede al Resea ch Ins i u e o Fo es , Snow and Landscape, WSL, Zü che s asse 111, 8903 Bi mensdo , Swi ze land
2 Sou he n Swedish Fo es Resea ch Cen e, Swedish Uni e si y o Ag icul u al Sciences, 230 53, Alna p, Sweden
3 Na ional Resea ch Council – Ins i u e o Sus ainable Plan P o ec ion (CNR – IPSP), Ses o Fio en ino, I aly
4 Diagnos ic moléculai e des o ganisms nuisibles églemen és des égé aux, Ag oscope, 1260 Nyon, Swi ze land
5 Depa men o Aqua ic Ecology, Swiss Fede al Ins i u e o Aqua ic Science and Technology (Eawag), Dübendo , Swi ze land
6 Depa men o Plan and Mic obial Biology, Uni e si y o Zu ich, Zu ich, Swi ze land
Co esponding au ho : Qui in Kuppe ([email p o ec ed])
Copy igh : This is an open access a icle
dis ibu ed unde he e ms o he CC0 Public
Domain Dedica ion.
Me hods
Abs ac
Eme ald ash bo e (EAB; Ag ilus planipennis) ep esen s a se ious h ea o No h Ame ican and
Eu opean ash species (F axinus spp.). Sp ead o EAB wes wa ds, om Eu opean Russia and Eas e n
Uk aine, could lead o d ama ic consequences o na i e Eu opean ash popula ions. Ea ly de ec ion
is essen ial o as and success ul e adica ion o new popula ions. In his s udy, we de eloped a new
TaqMan qPCR assay allowing o sensi i e and speci ic de ec ion o EAB. We es ed he speci ici y
o he assay agains 17 Eu opean Ag ilus spp., eigh bup es id species and nine species belonging o
o he wood-associa ed bee le axa. The qPCR assay p o ided eliable ampli ica ion om samples
wi h DNA concen a ions as low as 0.5 picog ams pe eac ion. Mo eo e , DNA could be ampli ied
om di e en sample ypes, such as egg casings, lea es, aeces and bo e dus om la al galle ies.
Robus ness o he assay was e i ied by pe o ming a blind es wi h ou di e en labo a o ies. He e
we p o ide a highly speci ic, obus and sensi i e assay which can be used o enhanced su eillance
o Ag ilus planipennis on he Eu opean con inen .
Key wo ds: Ag ilus planipennis, Eme ald Ash Bo e , EAB, in asi e o es insec s, TaqMan qPCR,
su eillance
In oduc ion
Na i e o Fa -Eas Asia, eme ald ash bo e Ag ilus planipennis (Fai mai e, 1888) is a
highly des uc i e insec species when in oduced in a non-na i e habi a . Ag ilus pla-
nipennis also known by he ac onym EAB, is a hos -specialized bup es id, ha a acks
p ima ily ash ees (F axinus spp.) (Ba anchiko e al. 2014; Jendek and Poláko á 2014;
He ms 2015). In es ed ees ypically succumb wi hin one o ou yea s; howe e , in
ou b eak si ua ions, mo ali y may occu wi hin one o wo yea s (Haack e al. 2002).
The li e cycle o EAB ypically spans one o wo yea s, wi h ligh ac i i y oc-
cu ing om mid-May o July. Females lay 70 o 100 eggs in ba k c acks and
c e ices on ash ees. Once ha ched, neona es pene a e he ou e ba k and unnel
Academic edi o : Na han Ha ill
Recei ed:
24 June 2025
Accep ed:
18 Sep embe 2025
Published:
9 Oc obe 2025
Ci a ion: Kuppe Q, Pe e son DL,
F i si LC, Hölling D, Pe e -Gen il
A, Peco i F, Al enbach D, Giulio M,
Zbinden H, Schneide S, Ru ne B
(2025) An enhanced qPCR me hod
o apid Ag ilus planipennis de ec ion
and moni o ing. NeoBio a 103:
53–67. h ps://doi.o g/10.3897/
neobio a.103.163040
NeoBio a 103: 53–67 (2025)
DOI: 10.3897/neobio a.103.163040
Ad ancing esea ch on alien species and biological in asions
A pee - e iewed open-access jou nal
NeoBio a
54
NeoBio a 103: 53–67 (2025), DOI: 10.3897/neobio a.103.163040
Qui in Kuppe e al.: Enhanced qPCR o apid Ag ilus planipennis de ec ion
be ween he phloem and cambium laye s. La ae hen o e win e in a p e-pupal
s age be o e eme ging as adul s om May o ea ly July (Cappae e al. 2005;
Wei e al. 2007; Valen a e al. 2017).
Since i s de ec ion in No h Ame ica in 2002, EAB has sp ead apidly, killing
hund eds o millions o ash ees ac oss he Uni ed S a es and Canada. E o s
o con ol EAB sp ead and mi iga e i s impac ha e been challenging and cos ly
(Cappae e al. 2005; He ms and McCullough 2014). In Eu ope, he bee le was
i s de ec ed in Moscow, Russia, in 2003 (EPPO 2007), epo ed in he Luhansk
Oblas p o ince, Uk aine, in 2019 (D og alenko e al. 2019; EPPO 2019) and
con i med in Kyi , Uk aine, in 2023 (EPPO 2023a). The pes con inues o sp ead
in bo h No h Ame ica, Eu opean Russia and Uk aine, main aining an a e age
annual sp ead a e o app oxima ely 50 km be ween 2002 and 2018, accele a ed
by human ac i i ies (Smi ley e al. 2008; Webb e al. 2021).
Eme ald ash bo e is ca ego ized as an A2 pes ecommended o egula ion as
qua an ine pes s by he Eu opean and Medi e anean Plan P o ec ion O ganiza ion
(EPPO) ha poses signi ican isks o Eu opean ash ees (EPPO 2013). Al hough i
has no ye been de ec ed wi hin he EU e i o y, i s wes wa d mig a ion om he
mos ecen indings in wes e n Russia and Uk aine is expec ed. The isk o in oduc-
ion inc eases h ough hi chhiking, anspo on wood packaging, and na u al adul
ligh dispe sal (O lo a-Bienkowskaja e al. 2020; Volko i sh e al. 2021; Meshko a
e al. 2023). Sys ema ic moni o ing and egula ion e o s a e he e o e c ucial o
allow an ea ly de ec ion o he pes which is essen ial o conse ing ash popula ions,
which hold ecological and economic signi icance (EPPO 2013).
Con en ional isk managemen s a egies ocus on in e cep ion and ea ly de-
ec ion o minimize acciden al in oduc ions and mi iga e pes damage. These
s a egies equi e eliable and cos -e ec i e iden i ica ion me hods. Mo phological
iden i ica ion o EAB equi es a high le el o expe ise and can lead o misiden i-
ica ion o o he na i e Bup es idae species. Mo eo e , mo phological iden i ica-
ion is limi ed o in ac specimens. On he o he hand, DNA-based iden i ica ion
allows he iden i ica ion o all li e s ages, including insec -de i ed en i onmen al
samples (Balak ishnan 2005; Sche e e al. 2006; Floyd e al. 2009; K ehenwinkel
e al. 2022; Roge e al. 2022; Kyle e al. 2024). Cu en ly, only a limi ed num-
be o molecula me hods, speci ically a Loop-media ed Iso he mal Ampli ica ion
(LAMP) assay de eloped by Kyei-Poku e al. (2020) and ecommended by EPPO,
a e a ailable o iden i y EAB. Al e na i ely, ba coding, in ol ing he ampli ica ion
o he mi ochond ial cy och ome oxidase subuni 1 (COI) (Folme e al. 1994;
Simon e al. 1994), was ex ensi ely applied by Kelna o a e al. (2019) o iden-
i y mo e han 100 Ag ilus species om he No he n Hemisphe e, ep esen ing
oughly 3% o he known Ag ilus di e si y. In a su eillance se ing, his app oach
may, howe e , encoun e challenges due o mixed DNA samples and a lack o
p ope assessmen ega ding inclusi i y and exclusi i y (EPPO 2023b; Kelna o a
e al. 2019). The LAMP assay, along wi h i s mo e ecen alida ion by Pe e son
e al. (2023a) on Eu opean Ag ilus species, can e ec i ely di e en ia e EAB om
na i e Ag ilus species. Al hough LAMP assays gene ally o e obus , apid, and
accu a e esul s, Real-Time PCR, also known as quan i a i e PCR (qPCR), o en
su passes hei sensi i i y in de ec ing genomic DNA wi h de ec ion limi s in he
o de o em og ams (Khan e al. 2018; Khodapa as e al. 2024). This has been
demons a ed in o he assays wi h a close congene o EAB, A. anxius (Pe e son e
al. 2023b). A key ad an age o qPCR is i s adap abili y. Mul iplex qPCRs can be
55
NeoBio a 103: 53–67 (2025), DOI: 10.3897/neobio a.103.163040
Qui in Kuppe e al.: Enhanced qPCR o apid Ag ilus planipennis de ec ion
de eloped o de ec mul iple species, a ask ha is mo e challenging wi h LAMP
assays (C ego-Vicen e e al. 2024). Mo e ecen ly, Kyle e al. (2024) ha e pub-
lished a qPCR assay wi h a de ec ion limi o 1.6 g gDNA pe eac ion. This
assay was es ed agains 10 bee les om he No h Ame ican auna and ocused on
eDNA o la ae om ascula issue.
The objec i e o he p esen s udy was o es ablish a TaqMan qPCR p o ocol
sui able o he de ec ion o A. planipennis, o use in molecula diagnos ics and
su eillance ac i i ies. To achie e his, a PCR based assay (Kyei-Poku e al. 2020)
was ailo ed o a TaqMan P obe assay, and a uni e sal endogenous ampli ica ion
con ol (Mi elbe ge e al. 2020) o euka yo ic DNA samples was inco po a -
ed. The assay was op imized and alida ed o speci ici y, diagnos ic sensi i i y,
accu acy and obus ness using a DNA es ing panel ocused on Eu opean Ag ilus
spp. Subsequen ly, i s pe o mance, and sui abili y o analysing insec -de i ed
en i onmen al samples, including eggs, egg casings, aeces and ass samples
om adul s and la ae we e e alua ed.
Ma e ials and me hods
Insec specimens, DNA ex ac ion and species e i ica ion
The assay was e alua ed by using DNA samples and bee les p o ided by Pe e son
e al. (2023a) and ha we e p e iously es ed wi h a LAMP-assay o EAB (Suppl.
ma e ial 1: able S1) and wi h a LAMP and a qPCR assay o A. anxius (Pe e son e
al. 2023b). In cases whe e DNA a ailabili y was limi ed o inhibi o y compounds
we e p esen in he elua e, new DNA was ex ac ed om he p o ided specimens
(Suppl. ma e ial 1: able S1). Specimens chosen o ex ac ion we e p elimina ily
washed in molecula g ade wa e (Me ck, Da ms ad , Ge many). A e wa ds, legs
o heads, used o DNA ex ac ion, we e emo ed using lame-s e ilized o ceps
and scalpels. These body pa s we e hen pu in o a 2 ml Eppendo ubes con ain-
ing wo s e ile glass beads (1 mm diame e ) and g ound using he MM400 bead
mill (Re sch) o 2 min a 30 Hz pe sec. Pos -g inding, DNA ex ac ions we e ca -
ied ou employing he DNeasy Blood and Tissue ki (Qiagen), s ic ly ollowing
he manu ac u e ’s ins uc ions. The DNA was elu ed in 100 µl elu ion bu e and
eapplied o he column o enhance DNA yield.
In addi ion, we complemen ed ou alida ion panel wi h DNA (Suppl. ma e-
ial 1: able S1) ob ained h ough ou molecula diagnos ics ac i i y a WSL con-
duc ed o moni o qua an ine pes s and pa hogens in Swiss o es s. Samples we e
sou ced om collec ions made in collabo a ion wi h Swiss o es e s and can ons
om 2012 o 2024. The ex ac ion p o ocol o hese samples in ol ed he use o
legs, ull bodies, o la ae, which we e c ushed using MM400 bead mills o mini
pes les. DNA ex ac ion was ca ied ou u ilizing ei he he DNeasy Blood and
Tissue ki (Qiagen) o he NucleoSpin Tissue XS ki (Mache ey-Nagel), ollowing
he espec i e manu ac u e ’s ecommenda ions.
To con i m species assignmen o used specimens, he COI ba code egion
was ampli ied using he uni e sal p ime s speci ic o a h opods LCO1490 and
HCO2198 (Folme e al. 1994) o LepF1 and LepR1 (Hebe e al. 2004) as
speci ied in Suppl. ma e ial 1: able S1. PCR eac ions we e ca ied ou wi h
he GoTaq® G2 Ho S a Mas e Mix (P omega) in acco dance wi h diagnos ic
guidelines (EPPO 2021). PCR p oduc s o he expec ed band size (709 bp and
56
NeoBio a 103: 53–67 (2025), DOI: 10.3897/neobio a.103.163040
Qui in Kuppe e al.: Enhanced qPCR o apid Ag ilus planipennis de ec ion
648 bp) we e pu i ied using he ExoSAP-IT™ Exp ess PCR P oduc Cleanup ki
(Applied Biosys ems). Cycle sequencing was pe o med using BigDye Te mina-
o 3.1 and pu i ied wi h he X e mina o Ki (Applied Biosys ems). Samples
we e hen sequenced in bo h o wa d and e e se di ec ions in-house on a 3500
Se ies Gene ic Analyze (Applied Biosys ems). Sequence ch oma og ams we e i-
sually inspec ed and edi ed using sequence analysis so wa e (CLC Main Wo k-
bench 24). Consensus sequences we e gene a ed by aligning o wa d and e e se
sequences and checked manually o po en ial e o s o ambigui ies. Consensus
sequences we e compa ed agains he all-nucleo ide da abase on BOLD (Ra nas-
ingham and Hebe 2007) using BLAST (Basic Local Alignmen Sea ch Tool) o
de e mine species iden i y. Sequence da a gene a ed in his s udy o specimens no
p o ided by Pe e son e al. 2023a ha e been deposi ed in Genbank (PV801658 –
PV801696) and a e summa ized in Suppl. ma e ial 1: able S1. A sequence align-
men and he co esponding phylogene ic ee a e a ailable in he supplemen
(Suppl. ma e ial 1: able S2, ig. S1). Unedi ed ch oma og ams a e a ailable upon
eques om he co esponding au ho .
Assay design, p ime s, and p obe syn hesis
To design his qPCR assay, we employed he EAB-speci ic p ime s EABFOT and
EABROT, o iginally de eloped by Kyei-Poku e al. (2020). We designed he TaqMan
p obe EAB-RC-P1 using alignmen s in CLC Main Wo kbench 7 (Qiagen) and
designed he p obe by applying OligoA chi ec TM Online (Sigma-Ald ich, h p://
www.oligoa chi ec .com/LoginSe le ). Addi ionally, o ensu e he p esence o am-
pli iable DNA, we inco po a ed he p ime s UNI28S- wd and UNI28S- e and he
p obe UNI28S-P as in e nal con ols in o he assay (Mi elbe ge e al. 2020).
HPLC-pu i ied P ime s (Table 1) we e o de ed om Mic osyn h AG (Balgach,
Swi ze land), while he TaqMan p obes EBA-RC-P1 and UNI28S-P (Table 1)
we e ob ained om The mo Fishe Scien i ic (Wal ham, Massachuse s, USA) and
Eu ogen ec (Se aing, Belgium), espec i ely.
qPCR eac ions we e p epa ed in a 20 µl olume using he Takyon No ROX
P obe Co e Ki , including he Takyon enzyme, a modi ied Taq DNA polyme ase
designed o as e PCR cycling (Eu ogen ec) (Table 2) and execu ed on he
Quan S udio 5 Real-Time PCR Sys em (The mo Fishe Scien i ic). The PCR p o-
ocol included an ini ial dena u a ion and enzyme ac i a ion s ep a 95 °C o 3
min, ollowed by 50 cycles a 95 °C o 10 sec and a 60 °C o 1 min. Resul s we e
analysed using he The mo Fishe Cloud pla o m wi h he Design and Analysis
New (DA2) and P ojec apps.
Plasmids (pUC57 de i a i es) con aining a 229 bp agmen o he mi o-
chond ial COI gene (Ag ilus planipennis, ouche EAB1; GenBank accession
PV801687.1) we e syn hesized by Eu ogen ec and used o gene a e he s anda d
cu e. The plasmids we e dilu ed in a en old dilu ion se ies om 5 × 107 copies/
µl o 0.5copies/µl. Fo he qPCR s anda d cu e, 5 µl om each dilu ion s ep was
u ilized, yielding s anda d concen a ions anging om 2.5 × 108 o 2.5 copies pe
eac ion (Fig. 1). To de e mine he limi o quan i ica ion, he dilu ion poin s o
10, 5, 1, and 0.5 copies we e added. A logis ic eg ession model, implemen ed in
RS udio ( e sion 2025.05.0+496), was used o es ima e he copy numbe co e-
sponding o a 95% de ec ion p obabili y. The ela ionship be ween copy numbe
and C alues was e alua ed using Spea man’s ank co ela ion coe icien .
57
NeoBio a 103: 53–67 (2025), DOI: 10.3897/neobio a.103.163040
Qui in Kuppe e al.: Enhanced qPCR o apid Ag ilus planipennis de ec ion
Speci ici y and sensi i i y
To ensu e DNA quali y and ule ou alse nega i es, DNA was conside ed ampli i-
able i he 28S C alue was ≤ 32 (Suppl. ma e ial 1: able S2). To es he speci ic-
i y o he main assay, p ime s we e e alua ed agains a alida ion panel consis ing
o Eu opean Ag ilus spp. and o he woodbo ing bee les (Suppl. ma e ial 1: able
S1). DNA om his panel was dilu ed 1:10 wi h molecula -g ade wa e (Me ck),
and 5 µl o dilu ed DNA was used pe qPCR eac ion. Samples we e conside ed
posi i e i hei C alues we e lowe han he lowes dilu ion poin o he s anda d
cu e (2.5 copies pe eac ion). To assess sensi i i y, DNA concen a ions o h ee
A. planipennis (EAB) samples (EAB1, EAB2, EAB3) we e quan i ied using he
Qubi dsDNA B oad Range Ki (In i ogen) on a Qubi 3.0 luo ome e . Each
sample was se ially dilu ed in en old s eps, anging om 1 ng/µl o 1 g/µl. T ip-
lica e qPCRs we e pe o med o each dilu ion o de e mine he limi o de ec ion
(LOD). A logis ic eg ession model implemen ed in RS udio was used o es ima e
he DNA concen a ion co esponding o a 95% de ec ion p obabili y.
F ass, egg and aeces samples
F esh EAB samples we e ob ained om an expe imen al se up wi hin he biosa e y
le el 3 acili ies o WSL (Gossne e al. 2023). EAB eggs we e sou ced om wo
colonies main ained a he G ea Lakes Fo es y Cen e, o iginally ini ia ed om
adul s lushed om g een ash (F axinus pennsyl anica) bol s collec ed in B igh on,
ON, Canada (Roe e al. 2018).
Table 1. qPCR p ime s and p obe o Ag ilus planipennis and in e nal 28S con ol. + p io o he nucleo ide code indica es ha he ol-
lowing nucleo ide is a locked nucleic acid (LNA).
Ta ge Oligo Sequence Gene Leng h
(bp)
F agmen
(bp) Re e ence
Ag ilus
planipennis
(EAB)
EABFOT TCAAAGAATGATGTATTTAAGTTTCGATC COI 29 229 Kyei-Poku e al. 2020
EABROT TAGCAATTTTTAGACTTCATTTAGCTGG COI 28 Kyei-Poku e al. 2020
EAB-RC-P1 FAM-TATGGTAATTGCTCCCGCAAGAACAGGT-QSY COI 28 This s udy
In e nal con ol
(UNI)
UNI28S- wd CTACTATCTAGCGAAACC 28S 18 84 Mi elbe ge e al. 2020
UNI28S- e AYTAGAGTCAAGCTCAAC 28S 18 Mi elbe ge e al. 2020
UNI28S-P JOE-AAA+G+A+AG+A+C+C+C+T-BHQ1 28S 12 Mi elbe ge e al. 2020
Table 2. Componen s, supplie s, concen a ions and olumes o qPCR eac ion.
Componen s Supplie s S ock conc. Reac ion conc. Volume pe eac ion (µl)
DNA empla e – – – 5.00
Molecula g ade wa e Me ck – – 6.96
Takyon co e ki bu e Eu ogen ec 10× 1× 2.00
Takyon co e ki MgCl2Eu ogen ec 50 mM 5.5 mM 2.20
dNTPs Eu ogen ec 5 mM 0.4 mM 1.60
ROX Re e ence Dye In i ogen 50× 0.1× 0.04
EABROT Mic osyn h 10 µM 0.3 µM 0.60
EABFOT Mic osyn h 10 µM 0.3 µM 0.60
EAB-RC-P1 Applied Biosys ems 10 µM 0.1 µM 0.20
UNI28S- wd Mic osyn h 10 µM 0.15 µM 0.30
UNI28S- e Mic osyn h 10 µM 0.15 µM 0.30
UNI28S-P Eu ogen ec 10 µM 0.05 µM 0.10
Takyon Enzyme Eu ogen ec 5 U/µl 0.5 U 0.10
Final eac ion olume 20.00
58
NeoBio a 103: 53–67 (2025), DOI: 10.3897/neobio a.103.163040
Qui in Kuppe e al.: Enhanced qPCR o apid Ag ilus planipennis de ec ion
La ae, eggs, egg casings, ass samples o la ae and adul s as well as aeces o adul
bee les we e used o alida e he usabili y o he assay o en i onmen al samples
(Table 3). Fo he la al woody ass samples, we collec ed ass om EAB la al gal-
le ies in po ed Eu opean ash ees (F axinus excelsio ). Fo adul EAB ass samples,
one F. excelsio lea was added o a closed cylinde con aining one o six adul bee les.
Lea es we e in con ac wi h bee les o 24, 48 o 72 hou s, a e which hey we e
immedia ely ozen a −20 °C in a s e ile 50 ml alcon ube. Eggs, eggshells and la ae
we e g ound in a bead mill (MM400, Re sch) using wo 1.4 mm ce amic beads o 1
min a 30 Hz and hen ex ac ed wi h he NucleoSpin Ki (Mache ey-Nagel) ollow-
ing manu ac u e s ecommenda ions and elu ed in 25 µl. La al ass and adul aeces
samples we e g ound using one 3 mm s eel bead o 1 min a 30 Hz, ex ac ed using
he DNeasy Blood & Tissue Ki (QIAGEN) ollowing manu ac u e s ecommenda-
ions and elu ed in 100 µl. Adul ass samples we e lyophilized o e nigh , g ound
in a bead mill (MM400) using wo 3 mm s eel beads o 2 min a 30 Hz, ex ac ed
using he DNeasy Plan Mini Ki (QIAGEN) ollowing he manu ac u e ’s ecom-
menda ions and elu ed in 100 µl. DNA ex ac s we e dilu ed 1:10, 1:20, 1:100 and
1:200 and qPCRs pe o med wi h 5 µl o each dilu ion as well as undilu ed DNA.
Blind es
A o al o 10 DNA samples suspec ed o con ain A. planipennis DNA we e sen on
d y ice o wo di e en diagnos ic labs (CNR – IPSP, IT & Ag oscope, CH) and
wo esea ch labs in Swi ze land un ela ed o o es heal h o diagnos ics (Aqua ic
Ecology, EAWAG & Plan and Mic obial Biology, UZH). P ime pai s and a p obe
Figu e 1. A S anda d cu e o he qPCR EAB assay, gene a ed using a pUC57-de i ed plasmid con aining a 229 bp agmen o he
mi ochond ial COI gene co esponding o he e e ence sequence EAB1 (PV801687). Ta ge copy numbe was plo ed agains C al-
ues, demons a ing s ong linea i y ac oss he dilu ion ange om 2.5 o 2.5 × 108 copies pe eac ion, wi h an R2 alue o 0.999. Copy
numbe s a e shown on a loga i hmic scale. The calcula ed assay e iciency was 99.73% B Ampli ica ion cu es om qPCR eac ions
pe o med in iplica e ac oss a en old dilu ion se ies anging om 2.5 × 108 o 2.5 copies. ΔRn alues a e plo ed on a loga i hmic scale.
The h eshold (0.229), indica ed by a dashed line, was au oma ically de e mined using Quan S udio’s de aul se ings. The lowes dilu ion,
con aining 2.5 copies and shown in blue, alls below he calcula ed de ec ion limi o 2.7 copies.
50
40
30
10
20
Cycle numbe
0
0.229
2.5 copies
1
10
-1
10
-2
ΔRn
R
2
= 0.99, p < 0.001, E = 99.73 %
Copy numbe
2.5
2.5 × 10
4
2.5 × 10
8
C
30
40
20
(A)
(B)
59
NeoBio a 103: 53–67 (2025), DOI: 10.3897/neobio a.103.163040
Qui in Kuppe e al.: Enhanced qPCR o apid Ag ilus planipennis de ec ion
o de ec A. planipennis (EAB), p ime pai s and a p obe a ge ing he 28S egion
as an ampli ica ion con ol, and he plasmid cons uc o es ablish he s anda d
cu e we e included. The samples and no- empla e con ols we e anonymized and
assigned andom codes o ensu e blinding o he es ing pe sonnel. The esea che s
conduc ing he blind es we e unawa e o he ue iden i ies o he samples du ing
he analysis. A lis o he samples can be ound in Fig. 3.
Each sample was p ocessed acco ding o he es ablished p o ocol o qPCR anal-
ysis. The qPCR eac ions we e pe o med in duplica e o iplica e o ensu e he
eliabili y and accu acy o he esul s. The qPCR eac ion ki and ins umen s we e
chosen acco ding o he speci ica ions o he espec i e labo a o ies.
Resul s
Molecula iden i ica ion o specimens
The iden i y o specimens used in he alida ion panel could be con i med by
sequencing he COI ba code (Suppl. ma e ial 1: able S1). Only o he species
Aegomo phus cla ipes (Ce ambycidae) no ba code sequence could be gene a ed.
Assay design and e iciency
The plasmid cons uc con aining he syn hesized COI amplicon om
A. planipennis was dilu ed in en old s eps. Fo he qPCR s anda d cu e, he
s anda d concen a ions anged om 2.5 × 108 o 2.5 copies pe eac ion. Plo s
o C alues e sus log10 copy numbe indica ed ha he eac ion e iciency o he
a ge amplicon was abo e 99%, wi h an R2 alue exceeding 0.99 (Fig. 1A). The
ampli ica ion plo showed cu es wi h a clea ly dis inguishable exponen ial phase
ollowed by a pla eau phase (Fig. 1B).
Speci ici y o mul iplex TaqMan PCR
The speci ici y o he qPCR assay was e alua ed using a alida ion panel comp is-
ing adul s om a ious geog aphic o igins and la ae (Table 1) o assess inclusi i y,
and ele an non- a ge species o e alua e exclusi i y. The assay was speci ic o
Ag ilus planipennis and no o he es ed species showed ampli ica ion (Suppl. ma-
e ial 1: able S2). Fo he species Ag ilus be ule i la e ampli ica ion o he in e nal
con ol (28S) was obse ed, likely due o bad DNA quali y.
Table 3. En i onmen al samples o assay alida ion.
Sample ype Ex ac ion ki Quan i y DNA dilu ions
La ae MN Tissue XS 1–4 indi iduals 1:10
Eggs MN Tissue XS 2 eggs 1:10
Egg casings MN Tissue XS 5 & 12 pieces 1:10
Faeces QIAGEN Blood&Tissue 5–50 mg 1–15 pieces undilu ed, 1:10, 1:20, 1:100,
1:200
La al ass (bo e dus ) QIAGEN Blood&Tissue 5–60 mg undilu ed, 1:10, 1:20, 1:100
Adul ass (lea es) QIAGEN Plan Mini 20 mg undilu ed, 1:10, 1:20, 1:100,
1:200
60
NeoBio a 103: 53–67 (2025), DOI: 10.3897/neobio a.103.163040
Qui in Kuppe e al.: Enhanced qPCR o apid Ag ilus planipennis de ec ion
Sensi i i y o mul iplex TaqMan PCR
The limi o quan i ica ion (LOQ) o he assay was e alua ed using se ial dilu-
ions o plasmid DNA. The LOQ was de e mined o be 2.7copies pe eac ion
a p obabili y o 95%. The limi o de ec ion (LOD) was assessed using se ial
dilu ions o A. planipennis genomic DNA ex ac ed om adul specimens, ang-
ing om 1 ng/µl o 1 g/µl. The assay consis en ly de ec ed as li le as 0.5 pg o
DNA pe eac ion o each specimen es ed. Ampli ica ion cu es showed dis-
inc sigmoidal pa e ns e en a hese minimal DNA concen a ions, indica ing
he assay’s sensi i i y o eliably de ec A. planipennis DNA a low le els (Fig. 2).
Based on a logis ic eg ession model applied o dilu ion se ies om h ee speci-
mens, he LOD was es ima ed a 0.403 pg (Fig. 2D).
Selec i i y
To gauge he pe o mance o he qPCR assay in de ec ing en i onmen al sam-
ples, an assessmen was conduc ed o analyse pe o mance a ia ions based on
he ma ix (Table 3). La ae, egg and egg casing samples p oduced s ong am-
pli ica ions o bo h he EAB speci ic p obe as well as he 28S in e nal con ol.
Faeces samples showed s ong inhibi ion du ing he PCR so a DNA-dilu ion o 1:20
was necessa y. In 5–20 mg o aeces, EAB DNA was eliably de ec able (C < 29). Fo
highe aeces amoun s (50 mg), a DNA-dilu ion o 1:200 was necessa y due o inhi-
bi ion. In a single aecal pelle EAB DNA could be de ec ed wi h a C alue o 35.7.
In la al ass samples om galle ies (bo e dus ), PCR inhibi ion was an issue, equi -
ing a DNA-dilu ion o 1:100. Wi h his dilu ion, EAB DNA could be eliably de ec -
ed in 20 mg o ass. In lowe amoun s de ec ion was possible bu no longe eliable.
Fo adul ass samples (lea es), EAB DNA could be de ec ed in 20 mg o lea pow-
de ha was in con ac wi h adul bee les (1–6) o 48 o 72 hou s. All he posi i e
ampli ica ions o hese adul ass samples had a highe C alue han he lowes
s anda d dilu ion (25 copies).
Blind es alida ion o he qPCR me hod o he de ec ion o Ag ilus
planipennis
To assess he obus ness and ep oducibili y o he de eloped qPCR me hod
o he de ec ion o Ag ilus planipennis, a blind es was conduc ed. All labs
pa icipa ing in he blind es we e able o accu a ely iden i y he samples con-
aining DNA o A. planipennis. The e we e no alse posi i e o alse nega i e
eac ions obse ed o EAB.
The implemen ed ampli ica ion con ol, a ge ing he 28S egion was in-
cluded in he blind es o alida e he de ec ion o ampli iable DNA. Lab #1
and #4 showed ampli iable DNA o all samples, Lab #3 had a single sample
wi h no in e nal con ol ampli ica ion, while Lab #2 was no able o ampli-
y any DNA using he 28S ampli ica ion con ol. Nega i e con ol samples,
de oid o A. planipennis DNA (NTC), we e also included o moni o o po-
en ial con amina ion. No ampli ica ion was obse ed in he no- empla e con-
ols (NTCs), con i ming he absence o con amina ion du ing he PCR se up.
The esul s o he blind es a e summa ised in Fig. 3.
61
NeoBio a 103: 53–67 (2025), DOI: 10.3897/neobio a.103.163040
Qui in Kuppe e al.: Enhanced qPCR o apid Ag ilus planipennis de ec ion
Discussion
Fo a co ec iden i ica ion o Ag ilus planipennis EPPO cu en ly ecommends
o use mo phological iden i ica ion, DNA-Ba coding and a LAMP assay (EPPO
2023b). The qPCR assay p esen ed he e complemen s hese me hods as an ad-
di ional accu a e, quick, and compa a i ely a o dable app oach. By con e ing
he exis ing LAMP assay (Kyei-Poku e al. 2020; Pe e son e al. 2023a) in o a
TaqMan P obe assay and inco po a ing a uni e sal in e nal ampli ica ion con ol
(28S DNA), he assay achie es a high de ec ion capabili y and eliabili y ac oss a
wide ange o sample ypes, including en i onmen al ma ices.
The assay demons a ed high speci ici y, success ully dis inguishing A. planipen-
nis om a b oad panel o Eu opean Ag ilus species and o he non- a ge axa ele-
an o o es y. The es ing panel included closely ela ed bup es id bee les, which
a e o en mo phologically simila and ha will co-occu wi h EAB in Eu opean
Figu e 2. Ampli ica ion cu es a e shown o en old dilu ion se ies o genomic DNA (0.5 ng o 0.5 pg pe eac ion; g een) om specimens
EAB1, EAB2, and EAB3 (A, B, and C). The h eshold o a ge de ec ion (0.273), indica ed by a ho izon al dashed line, was se au oma ically
in Quan S udio. Black dashed lines ep esen ampli ica ion o he in e nal 28S con ol. (D) A logis ic eg ession cu e was used o de e mine
he limi o de ec ion (LOD), wi h he in e cep co esponding o a 95% de ec ion p obabili y. The logis ic eg ession was applied o dilu ion
se ies anging om 5 ng o 5 g o genomic DNA om he same h ee specimens, wi h each dilu ion es ed in 3–6 eplica es.
0.273
50
40
30
10
20
Cycle numbe
0
1
10
10
-1
10
-2
ΔRn
10
-3
(A)
50
40
30
10
20
Cycle numbe
0
1
10
(B)
(D)
10
-1
10
-2
ΔRn
10
-3
50
40
30
10
20
Cycle numbe
0
1
10
10
-1
10
-2
ΔRn
10
-3
(C)
1
10
-2
DNA amoun (ng)
10
-4
1.00
0.75
In e cep : 0.403 pg
0.25
0.25
P obabili y o de ec ion
0.00
0.273
0.273
