scieee Science in your language
[en] (orig)

Development of an improved method for the detection of Rhodococcus erythropolis based on specific viral proteins

Abstract

Rhodococcus erythropolis (R. erythropolis) is a Gram-positive bacterium that can be found widely in nature, especially in polluted areas. It is well-known for its ability to degrade both organic and inorganic pollutants. This makes it an important member of the biological consortium in biological wastewater treatment systems, including activated sludge (AS) systems. However, due to its hydrophobic nature, its overabundance can contribute to AS foaming, which is one of the most significant solid-liquid separation issues in AS systems. AS foaming incidents often lead to foam being discharged with treated effluent, which lowers effluent quality, poses safety risks, and raises concerns about surface water quality and water scarcity. Identifying R. erythropolis is crucial for developing strategies to manage its excessive growth. Current identification methods have limitations, including low sensitivity, modest specificity, and being resource-intensive and time-consuming. A promising solution to this challenge is the utilization of bacteriophage-encoded proteins, particularly endolysins, as innovative bacterial detection systems. The cell binding domain (CBD) of endolysins imparts high affinity and specificity, guiding the endolysin catalytic domain (CD) to its peptidoglycan substrate. Exogenously added, recombinant endolysins can effectively control bacterial growth, and when fused with a reporter as the Green Fluorescent Protein (GFP), they become a reliable detection method. In this study, two endolysin-encoding genes, g114 and g74, from two different phages, were identified and expressed as recombinant proteins (Gp114 and Gp74) in E. coli. However, they were insoluble, showing no lytic activity. To assess the binding efficiency of the CBD and the contribution of the CD, truncations (g114@568, g74@388, and g74@1048) and full-length g114 were expressed in E. coli fused with GFP. All four GFP-fusion proteins exhibited binding to R. erythropolis cells. Enhanced binding was achieved by pre-treating the cells with 1% Triton X-100 for 1 hour at 28°C and 250 rpm before binding. This optimized condition highlighted GFP-gp74@388 as a promising candidate for a novel R. erythropolis detection method in AS foam samples. Nevertheless, additional optimization is imperative to enhance the yield of soluble recombinant endolysins and their binding to bacterial cells, ensuring their suitability for large-scale applications

Read accessible full text

Development of an improved method for the detection of Rhodococcus erythropolis based on specific viral proteins

Author: Ferreira, Alda de Jesus Gonçalves
Year: 2023
Source: https://repositorium.uminho.pt/bitstreams/2440bb92-59ff-4729-823a-787a7c9a9695/download
Alda de Jesus Gonçal es Fe ei a
De elopmen o an imp o ed me hod o he
de ec ion o
Rhodococcus e y h opolis
based
on speci ic i al p o eins
Oc obe 2023
Alda de Jesus Gonçal es Fe ei a
De elopmen o an imp o ed me hod o he
de ec ion o
Rhodococcus e y h opolis
based
on speci ic i al p o eins
Mas e Disse a ion
Mas e ’s in Bio echnology
Supe iso s:
Doc o Ana Paula Mesqui a Rod igues da Cunha Nicolau
and
Doc o Síl io Robe o B anco dos San os
Oc obe 2023
ii
DIREITOS DE AUTOR E CONDIÇÕES DE UTILIZAÇÃO DO TRABALHO POR TERCEIROS
Es e é um abalho académico que pode se u ilizado po e cei os desde que espei adas as
eg as e boas p á icas in e nacionalmen e acei es, no que conce ne aos di ei os de au o e di ei os
conexos.
Assim, o p esen e abalho pode se u ilizado nos e mos p e is os na licença abaixo indicada.
Caso o u ilizado necessi e de pe missão pa a pode aze um uso do abalho em condições não
p e is as no licenciamen o indicado, de e á con ac a o au o , a a és do Reposi ó iUM da Uni e sidade
do Minho.
A ibuição-Não Come cial-Sem De i ações
CC BY-NC-ND
h ps://c ea i ecommons.o g/licenses/by-nc-nd/4.0/
iii
ACKNOWLEDGMENTS
This Mas e 's disse a ion ma ks he end o a challenging chap e ha has ansla ed in o
emendous in ellec ual and pe sonal g ow h. Howe e , his jou ney would no ha e been possible wi hou
he help o e e yone who, di ec ly o indi ec ly, con ibu ed o i s success, o whom I am g a e ul.
Fi s and o emos , I would like o hank my supe iso s, D . Sil io San os and D . Ana Nicolau,
o he oppo uni y o wo k on his challenging p ojec .
To my dea iends Ba ba a and Bea iz, hank you o you consis en iendship in e e y
momen . I am g a e ul o he coun less con e sa ions, he laugh e , he help in o e coming di icul ies,
and you unwa e ing suppo du ing his jou ney.
Sil é io, my ellow mas e 's s uden and iend, dese es special hanks o his in aluable
collabo a ion, wi hou which my esea ch would no ha e eached i s ull po en ial on ime.
Finally, because he bes is sa ed o las , I would like o exp ess my deep g a i ude o my
husband, Rui, my child en, Raquel and And é, my pa en s, and my sis e o hei s ead as p esence.
They ha e always encou aged me o s i e o wha I wan , and hei consis en belie in me has been my
g ea es sou ce o s eng h. No hing would ha e been possible wi hou hei lo e.

i
STATEMENT OF INTEGRITY
I he eby decla e ha ing conduc ed his academic wo k wi h in eg i y. I con i m ha I ha e no
used plagia ism o any o m o undue use o in o ma ion o alsi ica ion o esul s along he p ocess
leading o i s elabo a ion.
I u he decla e ha I ha e ully acknowledged he Code o E hical Conduc o he Uni e si y o
Minho.
ABSTRACT
Rhodococcus e y h opolis
(
R. e y h opolis
)
is a G am-posi i e bac e ium ha can be ound widely
in na u e, especially in pollu ed a eas. I is well-known o i s abili y o deg ade bo h o ganic and ino ganic
pollu an s. This makes i an impo an membe o he biological conso ium in biological was ewa e
ea men sys ems, including ac i a ed sludge (AS) sys ems. Howe e , due o i s hyd ophobic na u e, i s
o e abundance can con ibu e o AS oaming, which is one o he mos signi ican solid-liquid sepa a ion
issues in AS sys ems. AS oaming inciden s o en lead o oam being discha ged wi h ea ed e luen ,
which lowe s e luen quali y, poses sa e y isks, and aises conce ns abou su ace wa e quali y and
wa e sca ci y.
Iden i ying
R. e y h opolis
is c ucial o de eloping s a egies o manage i s excessi e g ow h.
Cu en iden i ica ion me hods ha e limi a ions, including low sensi i i y, modes speci ici y, and being
esou ce-in ensi e and ime-consuming. A p omising solu ion o his challenge is he u iliza ion o
bac e iophage-encoded p o eins, pa icula ly endolysins, as inno a i e bac e ial de ec ion sys ems. The
cell binding domain (CBD) o endolysins impa s high a ini y and speci ici y, guiding he endolysin
ca aly ic domain (CD) o i s pep idoglycan subs a e. Exogenously added, ecombinan endolysins can
e ec i ely con ol bac e ial g ow h, and when used wi h a epo e as he G een Fluo escen P o ein
(GFP), hey become a eliable de ec ion me hod.
In his s udy, wo endolysin-encoding genes,
g114
and
g74,
om wo di e en phages, we e
iden i ied and exp essed as ecombinan p o eins (Gp114 and Gp74) in
E. coli.
Howe e , hey we e
insoluble, showing no ly ic ac i i y. To assess he binding e iciency o he CBD and he con ibu ion o
he CD, unca ions (
g114@568
,
g74@388
, and
g74@1048
) and ull-leng h
g114
we e exp essed in
E.
coli
used wi h GFP. All ou GFP- usion p o eins exhibi ed binding o
R. e y h opolis
cells
.
Enhanced
binding was achie ed by p e- ea ing he cells wi h 1% T i on X-100 o 1 hou a 28°C and 250 pm
be o e binding. This op imized condi ion highligh ed GFP-gp74@388 as a p omising candida e o a no el
R. e y h opolis
de ec ion me hod in AS oam samples. Ne e heless, addi ional op imiza ion is impe a i e
o enhance he yield o soluble ecombinan endolysins and hei binding o bac e ial cells, ensu ing hei
sui abili y o la ge-scale applica ions
Key wo ds:
Rhodococcus e y h opolis
; ac i a ed sludge (AS); ac i a ed sludge oaming; endolysins;
G een Fluo escen P o ein (GFP); i on X-100.
i
RESUMO
Rhodococcus e y h opolis
(
R. e y h opolis
)
é uma bac é ia G am-posi i a amplamen e dis ibuída
na na u eza, especialmen e em á eas poluídas. É conhecida pela sua capacidade de deg ada an o
poluen es o gânicos como ino gânicos, o que a o na um memb o impo an e do consó cio biológico nos
sis emas de a amen o biológico de águas esiduais po lamas a i adas. No en an o, de ido à sua
na u eza hid o óbica, a sua p oli e ação excessi a pode con ibui pa a a o mação de espuma, um dos
p oblemas mais signi ica i os na sepa ação sólido-líquido nes es sis emas. Inciden es de espuma em
lamas a i adas le am à libe ação de espuma com o e luen e a ado, o que eduz a qualidade do
e luen e, coloca em isco a saúde pública e susci a p eocupações quan o à qualidade da água supe icial
e à escassez de água. A iden i icação do
R. e y h opolis
é c ucial pa a o desen ol imen o de es a égias
que pe mi am con ola o seu c escimen o excessi o. Os mé odos de iden i icação a uais êm limi ações,
incluindo baixa sensibilidade, especi icidade mode ada e o consumo de ecu sos e empo. Uma solução
p omisso a pa a es e desa io passa pela u ilização de p o eínas codi icadas po bac e ió agos,
pa icula men e endolisinas, como sis emas ino ado es de de eção de bac é ias. O domínio de ligação à
pa ede celula (CBD) nas endolisinas con e e al a a inidade e especi icidade, di ecionando o domínio
ca alí ico da endolisina (CD) pa a o seu subs a o, o pep idoglicano. A adição exógena de endolisinas
ecombinan es pode e icazmen e con ola o c escimen o bac e iano e, quando undidas com a p o eína
e de luo escen e (G een Fluo escen P o ein; GFP), o nam-se um mé odo de de eção iá el.
Nes e es udo, duas endolisinas,
g114
e
g74
, de dois agos di e en es, o am exp essas como
p o eínas ecombinan es (Gp114 e Gp74) em
E. coli
. No en an o, es as p o eínas e am insolú eis e não
ap esen a am a i idade lí ica. Pa a a alia a e iciência de ligação do CBD e a con ibuição do CD, o am
exp essos genes uncados (
g114@568
,
g74@388
e
g74@1048
), assim como o gene comple o
g114
,
em
E. coli
com GFP. Todas as qua o p o eínas de usão com GFP mos a am capacidade de ligação às
células de
R. e y h opolis
. A ligação oi melho ada pelo p é- a amen o das células de
R. e y h opolis
com
T i on X-100 a 1% du an e 1 ho a a 28 °C e 250 pm an es da eação de ligação. Es a condição o imizada
des acou o GFP-gp74@388 como um candida o p omisso pa a um no o mé odo de de eção de
R.
e y h opolis
em amos as de espuma em sis emas de a amen o de águas esiduais po lamas a i adas.
No en an o, pa a se em u ilizadas em aplicações em la ga escala, são necessá ias o imizações que
aumen em o endimen o da exp essão de endolisinas ecombinan es de o ma solú el e que melho em
a ligação das p o eínas às células bac e ianas. Pala as-cha es:
Rhodococcus e y h opolis
; lamas
a i adas; espuma em lamas a i adas; endolisinas; G een Fluo escen P o ein (GFP); i on X-100.
ii
TABLE OF CONTENTS
ABSTRACT .................................................................................................................................
RESUMO .................................................................................................................................. i
TABLE OF CONTENTS ................................................................................................................. ii
Lis o Figu es ........................................................................................................................ ix
LIST OF TABLES .......................................................................................................................... x
Lis o Abb e ia ions ............................................................................................................... xi
1 Li e a u e Re iew ............................................................................................................. 1
1.1 Was ewa e T ea men ............................................................................................. 2
1.2 Ac i a ed sludge sys em ........................................................................................... 3
1.3 E iology o Ac i a ed Sludge Foaming........................................................................ 6
1.4 De ec ion o oam- o ming bac e ia ........................................................................... 7
1.5
Rhodococcus e y h opolis
........................................................................................ 9
1.6 Bac e iophages and endolysins .............................................................................. 11
1.6.1 Bac e iophages ................................................................................................ 11
1.6.2 Endolysins ....................................................................................................... 12
2 Aim and s a egy ........................................................................................................... 15
3 Ma e ials and Me hods .................................................................................................. 16
3.1 Bioin o ma ic analysis and cha ac e iza ion o phage endolysins ............................. 16
3.2 Phages, bac e ia, and plasmids .............................................................................. 16
3.3 P epa a ion o DNA agmen ................................................................................. 20
3.3.1 P ime design and DNA ampli ica ion ............................................................... 20
3.3.2 DNA agmen pu i ica ion and analysis ............................................................ 22
3.4 P epa a ion o Plasmid ec o ................................................................................. 23
3.5 Cloning .................................................................................................................. 23
3.5.1 Diges ion ......................................................................................................... 23
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
3
(2000/60/EEC) (Eu opean Pa liamen and Council o he Eu opean Union 2000). Collec i ely hese
di ec i es ha e signi ican ly d i en p og ess in was ewa e managemen ac oss he Eu opean Union, wi h
imp essi e collec ion and success ul ea men a es o 98% and 92% espec i ely, as o 2022 (Eu opean
Economic and Social Commi ee 2023).
U ban was ewa e , in acco dance wi h he UWWTD, mus unde go seconda y ea men o mee
he minimum was ewa e discha ge s anda ds o eshwa e bodies (Eu opean Commission 2022).
Seconda y ea men is usually a sequen ial p ocess o biological ea men ollowed by a se ling o
suspended solids (Council o he Eu opean Union 2014). The main objec i e o his sequence is o emo e
o ganic ma e and po en ially nu ien s, as well as suspended solids, om he was ewa e ( on Spe ling
2007). Among he a ious seconda y was ewa e ea men me hods, he Ac i a ed Sludge (AS) sys em
s ands ou . Due o i s simplici y, cos -e ec i eness, and e iciency, i is one o he mos used me hods o
ea ing u ban was ewa e (D. Jenkins and Wanne 2014; Loosd ech , Ma in, and Ekama 2020; J.
Wanne 2017; Tandoi, Majone, and Rosse i 2017).
Howe e , like many o he WWTPs, AS WWTPs ace challenges in mee ing inc easingly s ingen
Eu opean Union discha ge s anda ds, which can lead o egula o y iola ions ha equi e apid esolu ion
(Rosse i, Le an esi, and Tandoi 2017). In AS WWTPs, hese challenges ypically o igina e om p oblems
ela ed o solid-liquid sepa a ion caused by he excessi e p oli e a ion o ce ain bac e ia (D. Jenkins,
Richa d, and Daigge 2004; J Wanne 1998). De ec ion and subsequen managemen o hese bac e ia
a e c i ical s eps in e ec i ely esol ing solid-liquid sepa a ion issues wi hin he AS sys em. This, in u n,
plays a pi o al ole in ensu ing he con inuous a ailabili y o high-quali y wa e esou ces, he eby
add essing he c i ical global conce ns o wa e sca ci y and wa e quali y.
1.2 Ac i a ed sludge sys em
A con en ional AS sys em (Figu e 1) consis s o se e al key componen s, including an ae a ion
ank o biological ea men , a se lemen ank o solid-liquid sepa a ion, and a ecycling sys em o
ea men con inui y (Tchobanoglous, Bu on, and S ensel 2003; on Spe ling 2007). In luen was ewa e ,
ypically ollowing p ima y ea men (Mi al 2011), is di ec ed in o an ae a ion ank con aining a mixed
mic obial biomass, known as AS, which is kep suspended and igo ously mixed wi h incoming
was ewa e ia an ae a ion de ice (G ay 2004). The AS comp ises loc- o ming bac e ia, ilamen ous
bac e ia (G ay 2004), and o he mic oo ganisms. These mic oo ganisms wo k oge he o biodeg ade

De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
4
and emo e o ganic ma e om he was ewa e , along wi h achie ing pa ial nu ien emo al (Mesqui a,
Ama al, and Fe ei a 2013; Loosd ech , Ma in, and Ekama 2020; Se iou and Blackall 1999; on
Spe ling 2007). As he AS biomass p oli e a e, he cells agg ega e in o dis inc loc s uc u es by clumping
oge he and a aching o ilamen ous bac e ia (Russell J Da enpo e al. 1998; G ay 2004). The esul ing
locculen suspension in he ae a ion ank, commonly e med mixed liquo (G ay 2010), hen lows in o
he se lemen ank, which p o ides a quiescen en i onmen ha enables he se ling and sepa a ion o
AS loc om he ea ed e luen h ough g a i y sedimen a ion (D. Jenkins, Richa d, and Daigge 2004;
Russell J Da enpo e al. 1998). The ea ed e luen can hen be eleased in o eshwa e bodies, o i
may unde go addi ional ea men o mee mo e s ingen discha ge s anda ds. In his p ocess, pa o
he sepa a ed AS is e u ned o he ae a ion ank o ea incoming was ewa e . Excess AS is emo ed
om he p ocess and subjec ed o u he ea men o ensu e compliance wi h egula ions be o e disposal
(G ay 2004).
Figu e 1| Ac i a ed Sludge Sys em. AS: ac i a ed sludge.
The e icien sepa a ion o AS in he se lemen ank is a c i ical aspec o AS sys em pe o mance.
The se ling cha ac e is ics o AS loc pa icles play a pi o al ole in he solid-liquid sepa a ion p ocess,
exe ing a signi ican impac on bo h inal e luen quali y and he o e all WWTP e iciency (Go o eanu e
In luen
Ae a ion Tank
Mixed Liquo
AS Recycling Sys em
Se lemen
Tank
Ae a ion de ice
E luen
Pu ge o excess AS
AS sedimen a ion
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
5
al. 2003; D. Jenkins, Richa d, and Daigge 2004; Jiří Wanne 2021; Ji i Wanne and Jobbágy 2014; J
Wanne 1998; G ay 2010).
High-quali y se ling locs possess dis inc i e cha ac e is ics, such as being ela i ely la ge,
compac , and app oxima ely sphe ical, as depic ed in Figu e 2a (J. Wanne 2017). The o ma ion o
hese locs begins wi h he ac ion o loc- o ming bac e ia (D. Jenkins, Richa d, and Daigge 2004; Ge a di
2006). Addi ionally, op imal loc quali y depends p ima ily upon he p esence o ilamen ous bac e ia
(Ge a di 2006; Rosse i, Le an esi, and Tandoi 2017). These play a pi o al ole by se ing as a sca old
o he a achmen o loc- o ming bac e ia (D. Jenkins, Richa d, and Daigge 2004). As he loc- o ming
bac e ia p oli e a e along he leng h o ilamen ous bac e ia, he loc pa icle g adually inc eases in size,
enhancing he o e all e ec i eness o he se ling p ocess (Ge a di 2006).
Figu e 2| Mic oscopy image o AS loc wi h dis inc le els o ilamen ous bac e ia abundance. (a) High-quali y loc, cha ac e ized by he
p esence o one o i e ilamen ous bac e ia. (b) Poo -quali y loc cha ac e ized by an abundance o ilamen ous bac e ia, leading o b idging
among adjacen locs. Adap ed om (J. Wanne 2017; Tandoi, Majone, and Rosse i 2017).
Good se ling p ope ies a e obse ed when one o i e ilamen ous bac e ia a e p esen in mos
AS loc pa icles, and hese ilamen ous bac e ia o en ex end ou wa d om he loc in o he su ounding
mixed liquo (J. Wanne 2017). Howe e , an excess o ilamen ous bac e ia, whe e mo e han i e
ilamen ous bac e ia a e p esen in mos locs, as depic ed in Figu e 2b, can lead o he o ma ion o
b idges be ween locs (J. Wanne 2017; Ge a di 2006), o lead o he de elopmen o la ge, loose, and
di use loc. The biomass hus exhibi s inadequa e se ling p ope ies consequen ly leading o a
phenomenon known as AS bulking. AS bulking can dis up he e ec i e compac ion o AS locs in he
se lemen ank, po en ially comp omising he quali y o he e luen (Loosd ech , Ma in, and Ekama
2020; J Wanne 1998; J. Wanne 2017; Soddell and Se iou 1990).
(a)
(b)
9
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
6
Addi ionally, he excessi e p oli e a ion o hyd ophobic bac e ia in he mixed liquo can also
ad e sely a ec loc se ling p ope ies, po en ially leading o ano he common solid-liquid sepa a ion
p oblem wi hin he AS sys em, known as AS oaming. This, oo, has he po en ial o comp omise e luen
quali y (G ay 2004; J Wanne 1998; J. Wanne 2017).
1.3 E iology o Ac i a ed Sludge Foaming
Foaming in AS WWTPs can ake a ious o ms. Chemical oams, usually whi e in colo , a e caused
by poo ly biodeg adable su ac an s p esen in he was ewa e . Howe e , when e e ing o "AS oaming,"
he e m ypically means biological oaming. This ype o oaming is one o he p incipal solid-liquid
challenges encoun e ed in AS WWTPs. I is cha ac e ized by he de elopmen o dense and s able oam,
dis inguished by i s chocola e-b own colo , which accumula es on he su ace o he ae a ion ank (Figu e
3) (D. Jenkins, Richa d, and Daigge 2004; Guo e al. 2015; de los Reyes III 2010).
Figu e 3| Image o a was ewa e ea men plan expe iencing biological oaming. Re ie ed om (Eks e e al. 2010).
Al hough AS oaming inciden s depend on he p esence o hyd ophobic bac e ia, i is no
de e mined by his ac o alone, bu in ol es h ee c ucial componen s: hyd ophobic cells, ai bubbles,
and su ac an s (de los Reyes III 2010; S e e Pe o ski e al. 2011). As hese bac e ia p oli e a e in he
mixed liquo , hey impa hyd ophobic cha ac e is ics o he locs, enabling hem o a ach o ai bubbles
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
7
p o ided by he ae a ion de ice. When he ai bubble– loc agg ega e is combined wi h su ac an s
(o igina ing om esidual con en in he was ewa e o p oduced by he hyd ophobic mic oo ganisms
hemsel es), a s able and dense chocola e-b own oam on he su ace o he ae a ion ank is o med. The
oam has he capaci y o en ap a signi ican amoun o AS biomass, ende ing hese mic oo ganisms
inac i e in he ea men p ocesses (J. Wanne 2017; J Wanne 1998; D. Jenkins, Richa d, and Daigge
2004). Subsequen ly, he oam may be anspo ed o he se lemen ank and is o en discha ged wi h
he ea ed e luen (D. Jenkins, Richa d, and Daigge 2004).
AS oaming no only comp omises WWTP e iciency and e luen quali y bu also poses po en ial
heal h and sa e y isks. Foam can con ain pa hogenic bac e ia ha , when he oam b eaks, may become
ai bo ne, posing a isk o ansmission, i he ank is no co e ed. Mo eo e , pa hogenic bac e ia in he
oam can be discha ged wi h he e luen (Russell J Da enpo e al. 1998; de los Reyes III 2010; Guo e
al. 2015).
Once oam is de ec ed, modi ica ions o key ope a ing condi ions (
e.g
., lowe ing sludge age o
lush ou oublesome bac e ia o changing ae a ion a es), wa e sp aying (
i.e.
, dilu ing oam), chemical
ea men s (
e.g.
, chlo ina ion) and skimming (
i.e.
, mechanical oam emo al) a e employed. These
nonspeci ic s a egies, howe e , only p o ide sho - e m solu ions (S. Pe o ski e al. 2022; S e e
Pe o ski and Se iou 2018). Since s able oam o ma ion equi es ai bubbles, su ac an s, and
hyd ophobic bac e ial cells, any success ul con ol me hod mus a ge one o hese ac o s. Ae a ion, an
essen ial componen o was e ea men by ae obic o ganisms, canno be s opped. Regula ing
su ac an s, bo h in e ms o hei le els and ypes, p o es challenging as hey en e he WWTP as in luen s
and a e p oduced by he AS biomass. As a esul , in heo y, he p ima y con ol poin is o educe he
le els o oam- o ming bac e ia o a h eshold whe e s able oam o ma ion is p e en ed. The iden i ica ion
o oam- o ming bac e ia is c ucial, as his h eshold a ies depending on he plan design and he speci ic
bac e ial s ain p esen (Rosse i e al. 2005; de los Reyes III 2010; S e e Pe o ski e al. 2011; S.
Pe o ski e al. 2022; Guo e al. 2015).
1.4 De ec ion o oam- o ming bac e ia
The adi ional me hod o iden i ying oam- o ming bac e ia in AS samples in ol es he use o
con en ional ligh mic oscopy and cul u e-based echniques. Ligh mic oscopy is u ilized o assess he
mo phological and s aining cha ac e is ics o bac e ia (de los Reyes III 2010). This me hod p ima ily
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
8
iden i ies wo dis inc ypes o ilamen ous hyd ophobic bac e ia, di e en ia ed by he p esence o igh -
angled b anching ilamen s, o en associa ed wi h he Mycola a axon (mycolic acid-p oducing
ac inomyce es), and unb anched ilamen s, ypically indica i e o
Mic o h ix pa icella
(R J Da enpo and
Cu is 2002; Russell J Da enpo e al. 2000). Howe e , some ilamen ous bac e ia can change hei
mo phologies in esponse o di e en en i onmen al condi ions, and he same mo pho ype may be
sha ed by bac e ia wi h qui e di e en phylogenies, posing a challenge (Mülle , Schade, and Lemme
2007; Ni ami and Ba ino ic 2022). Cul u e-based me hods, acili a ed by mic omanipula ion echniques,
hen allow he isola ion o Mycola a in pu e cul u es and hei di e en ia ion in o gene a (Russell J
Da enpo e al. 1998; de los Reyes III 2010; K agelund e al. 2007).
Howe e , ligh mic oscopy has inhe en limi a ions as i is p ima ily es ic ed o iden i ying
ilamen ous bac e ia, s uggles o isualize bac e ia wi hin he complex AS loc and he esul depends on
he obse e 's expe ise (R J Da enpo and Cu is 2002; Ni ami and Ba ino ic 2022). Cul u e-based
me hods a e also limi ed because hey a e ime-consuming and end o a o bac e ia ha h i e unde
con olled labo a o y condi ions, which can lead o an unde es ima ion o he p e alence o less cul u able
oam- o ming bac e ia (Russell J Da enpo e al. 2000).
To add ess he limi a ions o adi ional me hods, molecula echniques ha e been adop ed o
iden i ying bac e ia in AS samples. These me hods equen ly ely on he 16S ibosomal RNA ( RNA) gene
as a ma ke . Two commonly used me hods a e PCR, which employs ei he uni e sal 16S RNA gene
p ime s o speci ic p ime s, and luo escence in si u hyb idiza ion (FISH), which uses nucleic acid p obes
a ge ing he 16S RNA gene (de los Reyes III 2010).
When compa ing PCR and FISH, FISH is a o ed, pa ly due o PCR's suscep ibili y o inhibi o y
subs ances wi hin he complex AS loc, impac ing ampli ica ion e iciency (S. Zhang e al. 2021). Ano he
subs an ial challenge lies in pu i ying bac e ial DNA om AS loc, a necessa y s ep be o e employing PCR-
based echniques. This s ep becomes he a e-limi ing ac o in he PCR wo k low. The challenge s ems
om he AS loc ma ix, which includes no only AS biomass bu also i s p oduc s (ex acellula polyme ic
subs ances) and adso bed o ganic o ino ganic subs ances, making i di icul o sepa a e hem om DNA
du ing ex ac ion. A cell lysis s ep by mechanical homogeniza ion (bead-bea ing s ep) has been shown o
be necessa y be o e he DNA ex ac ion p ocedu e o yield be e esul s. Howe e , s anda dized p o ocols
a e lacking, leading o he unde es ima ion o all popula ions in he sample (Guo and Zhang 2013).

De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
9
FISH o e s dis inc ad an ages in accu a ely iden i ying bac e ial popula ions and indi idual
species, ega dless o hei loca ion o mo phology. Howe e , i s e icacy depends on he a ailabili y o
speci ic p obes o he a ge o ganism, sui able p o ocols o pe meabilizing hese bac e ia, and he
p esence o me abolically ac i e cells (R J Da enpo and Cu is 2002; Domańska e al. 2014; Ca e al.
2005).
Mycola a, which a e equen ly ound in AS oam, pose a challenge o con en ional FISH me hods
because hey canno be easily pe meabilized. The e is no uni e sal p o ocol o pe meabiliza ion o all
Mycola a gene a associa ed wi h oam (Macnaugh on, O’Donnelll, and Embley 1994; Russell J Da enpo
e al. 2000). Inadequa e pe meabiliza ion can lead o unde es ima ion o he a ge o ganism, esul ing
in alse nega i e esul s wi h he FISH me hod (Domańska e al. 2014; Mülle , Schade, and Lemme
2007).
The de ec ion o oam- o ming bac e ia h ough FISH elies on nucleic acid p obes a ge ing he
16S RNA o iable cells. False nega i e esul s may occu when cells exhibi low me abolic ac i i y
(mo ibund cells) o no ac i i y (dead cells), a ibu able o educed ibosomal con en . Mo ibund o dead
cells can e ain hei hyd ophobici y and oam-s abilizing p ope ies and po en ially escape de ec ion o
display educed signal in ensi y in FISH-based assays (S e e Pe o ski e al. 2011; de los Reyes III 2010).
A p omising bac e ial de ec ion me hod in ol es using bac e iophage-de i ed p o eins as speci ic
p obes, coupled wi h an app op ia e measu emen echnique (Yu e al. 2016; Ha, Son, and Ryu 2018;
Gómez-To es e al. 2018; San os e al. 2019; S. P. Cos a e al. 2020). The conside a ion ha his me hod
migh e ec i ely de ec AS oam- o ming bac e ia a ose om s udies on isola ed bac e iophages ly ic o
Mycola a, demons a ing hei po en ial in educing bac e ial numbe s a he labo a o y scale (Tandoi,
Majone, and Rosse i 2017; Thomas, Soddell, and Ku böke 2002). In a 2022 s udy, wo isola ed
bac e iophages (Rho1Es om was ewa e and Rho2Lm om mixed liquo ) signi ican ly educed he le els
o a membe o he Mycola a,
Rhodococcus e y h opolis
, showcasing hei po en ial o he de ec ion o
hese bac e ia.
1.5
Rhodococcus e y h opolis
Rhodococcus e y h opolis
(
R. e y h opolis
) is a G am-posi i e, pa ially acid- as , nonmo ile,
ae obic bac e ium known o i s highly hyd ophobic cell su ace and he abili y o deg ade a wide ange
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
10
o en i onmen al pollu an s (Ma akchi, Lanéelle, and Da é 2014; Jones and Good ellow 2015; de los
Reyes III 2010).
Rhodococci a e widely dis ibu ed in aqua ic and e es ial ecosys ems, h i ing in e en ex eme
en i onmen s such as he A c ic, An a c ic, and dese s. While some can unc ion as oppo unis ic
pa hogens in plan s (
e.g
.,
Rhodococcus ascians
) and pose isks o animals and humans (e.g.,
Rhodococcus equi
), mos hodococci ha e low pa hogenici y. Membe s o he genus
Rhodococcus
a e
known o hei ema kable p o iciency a deg ading a wide ange o bo h o ganic and ino ganic pollu an s,
e en hose ha a e highly ecalci an and oxic. This abili y highligh s hei impo ance in con amina ed
en i onmen s, including indus ial and u ban was ewa e whe e in addi ion o hei biodeg ada ion
capabili ies, hodococci p oduce su ac an s (Cappelle i e al. 2019; Jones and Good ellow 2015; Baba
e al. 2009; De Ca alho and Da Fonseca 2005; I shina, Bazhu in, and Tyumina 2022; Naza i e al.
2022; La kin, Kulako , and Allen 2005; Bell e al. 1998).
Taxonomically, he genus
Rhodococcus
belongs o he phylum
Ac inobac e ia
, class
Ac inomyce es
, o de
Co ynebac e iales
, and amily
Noca diaceae
(Jones and Good ellow 2015).
Mo eo e , hodococci a e membe s o he Mycola a axon. Mycola a is one o he mos equen ly
obse ed axa in oaming inciden s in AS WWTPs wo ldwide (de los Reyes III 2010). Mycola a, which also
includes membe s o he gene a
Mycobac e ium,
Co ynebac e ium
,
Die zia,
Noca dia
,
Go donia
,
Williamsia
,
Ske mania
,
Selgnilipa us
,
Millisia
, and
Tsukamu ella
, a e cha ac e ized by a complex cell
en elope s uc u e, a dis inc i eness a ibu ed o he p esence o mycolic acids. The mycolic acid con en
in Mycola a cell walls enhances cell su ace hyd ophobici y and impe meabili y (Ma akchi, Lanéelle, and
Da é 2014; Mi ani e al. 2005; Su cli e 1998; de Ca alho e al. 2016).
While
Rhodococcus
sp. is no he p edominan Mycola a ound in AS oaming occu ences, i s
p esence has been documen ed o se e al decades.
Rhodococcus
sp. was obse ed in AS oam as ea ly
as 1984 by Lemme and K oppens ed (1984) (Lemme and K oppens ed 1984). Addi ionally, Sezgin e
al. isola ed
R. e y h opolis
in AS oam du ing hei s udy conduc ed in 1988 (Sezgin, Leche alie , and
Ka 1988).
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
11
1.6 Bac e iophages and endolysins
1.6.1 Bac e iophages
Phages a e i uses ha possess he unique abili y o speci ically in ec and a ge bac e ia wi hou
ad e sely a ec ing he su ounding mic obio a (Chan, Abedon, and Loc-Ca illo 2013). Thei disco e y
occu ed independen ly by wo esea che s, Hen y Two and Felix d’He elle, making b eak h oughs in
1915 and 1917, espec i ely. Following his disco e y, phages we e swi ly employed o comba bac e ial
in ec ions in animals and in humans (Mu ay e al. 2021; Kashani e al. 2018). These applica ions
subsequen ly ex ended o he con ol o pa hogenic bac e ial in ec ions ac oss a ious na u al
en i onmen s, encompassing soil, ai , wa e sys ems, including was ewa e ea men sys ems (Ye e al.
2019; Jassim, Limoges, and El-Cheikh 2016; Reisoglu and Aydin 2023). Howe e , he success ul
applica ion o phage he apy o was ewa e ea men equi es a deepe unde s anding o mic obial
communi y in e ac ions, unbiased phage en ichmen , phage pene a ion o locs,
in si u
in ec i i y
main enance, and he de elopmen o s a egies o coun e hos cell esis ance o phages (Vesga-Ba on,
Chamy, and Vande Wouwe 2022).
Phages a e he mos widesp ead and abundan biological en i ies on Ea h. Thei dis ibu ion is
in ica ely linked o ha o hei hos o ganisms, upon which hey ely o eplica ion and ep oduc ion
(Salmond and Fine an 2015; Clokie e al. 2011). Despi e he wide ange o mo phological and genomic
di e si y obse ed among phages, mos possess a double-s anded DNA (dsDNA) genome su ounded by
an icosahed al p o ein capsid a ached o a ail o a ying leng hs. In addi ion, he majo i y exhibi a
sipho i us mo phology cha ac e ized by long, lexible, and noncon ac ile ail (Hans W. Acke mann 2009;
H. W. Acke mann 2007; Auza e al. 2008; Chan, Abedon, and Loc-Ca illo 2013).
The e a e wo majo ypes o phages: i ulen (o ly ic) and empe a e (Aze edo and Su he land
2008). The eplica ion o hese phages ypically unde goes one o wo li e cycles: ly ic o lysogenic (Figu e
4). The i s s ep is phage adso p ion, du ing which bo h i ulen and empe a e phages bind o speci ic
ecep o s on hos cells (S one e al. 2019). This is ollowed by he injec ion o he phage genome h ough
he bac e ial cell en elope. Subsequen ly, he phage injec s i s genome h ough he bac e ial cell
en elope. Following his, in he ly ic cycle, he phage akes con ol o he hos cell machine y o p oduce
i s i al p ogeny, which a e hen eleased in o he immedia e en i onmen (Oechslin e al. 2022; Young
2014).
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
12
Howe e , empe a e phages o m a mo e long- e m ela ionship wi h he bac e ial hos . A e
injec ing hei genome, hese phages can en e he lysogenic cycle, whe e he i al genome in eg a es
in o he bac e ial ch omosome as a p ophage. Only a a speci ic s age, ypically when he bac e ium is
unde s ess, can he p ophage exi lysogeny and unde go eplica ion, ollowing he ly ic cycle, esul ing
in he elease o p ogeny (Salmond and Fine an 2015; Baya , Dida , and Hosseinidous 2021).
Fo mos dsDNA phages, he ly ic sys em o elease is usually accomplished by he collec i e ac ion
o wo p o eins: endolysins and holins. Endolysins a e pep idoglycan-deg ading enzymes ha accumula e
in he hos cell cy oplasm in he la e s ages o he ly ic cycle un il holins, small memb ane-dis up ing
p o eins, o m po es in he cell memb ane ha allow endolysin access o deg ade he cell wall
pep idoglycan and cause cell lysis (Loessne e al. 2002; Wang, Smi h, and Young 2000; Loessne 2005;
Fische i 2010).
Figu e 4| Bac e iophage Li ecycle. Ly ic phages a ach and in ec a bac e ial cell which esul s in he ep oduc ion o phages and hei
elease om he hos cell. The lysogenic cycle usually esul s in he in eg a ion o a phage genome in o he bac e ial genome. Re ie ed om
(Ba ino ic e al. 2019).
1.6.2 Endolysins
Endolysins o G am-nega i e bac e ia-in ec ing phages ypically ha e a globula a chi ec u e
consis ing o one ca aly ic domain (CD). Endolysins o G am-posi i e bac e ia-in ec ing phages ha e a
modula con igu a ion and a e o en cha ac e ized by he p esence o one o wo N- e minal CD connec ed
by a linke sequence o a C- e minal cell wall-binding domain (CBD) (Loessne 2005; H. Oli ei a e al.
2013; Abdel ahman e al. 2021). The N- e minal CD o modula endolysins unc ions o clea e a ious
speci ic pep idoglycan bonds in he hos cell wall. The CBD, on he o he hand, has no ca aly ic ac i i y
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
19
Table 5| Recombinan p o eins used in his s udy
Recombinan p o ein
Molecula
weigh (kDa)
Desc ip ion
Gp114
37
Phage Rho2 LM endolysin con aining one ca aly ic domain
and a C- e minal cell binding domain
GFP-gp114
64
GFP used o Phage Rho2 LM endolysin con aining one
ca aly ic domain and a C- e minal cell binding domain
GFP-gp114@568
43
GFP used o Rho2LM endolysin con aining. only he
possible C- e minal cell binding domain
Gp74
50
Phage Rho1Es endolysin con aining wo ca aly ic domains
and a possible C- e minal cell binding domain
GFP-gp74@388
63
GFP used o Phage Rho1Es endolysin con aining he
cen al ca aly ic domain and a possible C- e minal cell
binding domain
GFP-gp74@1048
39
GFP used o Phage Rho1Es endolysin con aining a ew
nucleo ides ups eam he possible C- e minal cell binding
domain
All ecombinan p o eins con ain N- e minal (His)6- ag sequences. GFP has a molecula weigh o
app oxima ely 27 kDa. EXPASY P o Pa am ool (h ps://web.expasy.o g/p o pa am/) was used o calcula e
he p edic ed molecula weigh .

De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
20
3.3 P epa a ion o DNA agmen
3.3.1 P ime design and DNA ampli ica ion
P ime s con aining speci ic es ic ion cloning si es (Table 6) we e designed o isola e and
ampli y he a ious endolysin DNA agmen s (Table 3) equi ed o cons uc he ecombinan p o eins.
The nucleo ide and amino acidic sequences o he selec ed genes can be ound in Annex I.
Table 6| P ime s used o he isola ion and ampli ica ion o he DNA agmen s om phage hos genome
F agmen
P ime pai
Nucleo ide sequence (5´→ 3´)
Tm (°C)
g114
Rho2LMgp114Fw1
CCG CCG CAT ATG GAG CTC ATG GCG TTC ATC AAC GCG GTA
C
56.7
Rho2LMgp114R 981
CCG CCG CTC GAG TCA TTT CTT GCC TTC CCT GAT TGC
55.7
g114@568
Rho2LMgp114Fw568
GCC GCC GAG CTC GTG ATC GCC AGT CCC GGT G
57.6
Rho2LMgp114R 981
CCG CCG CTC GAG TCA TTT CTT GCC TTC CCT GAT TGC
55.7
g74
Rho1Esgp74Fw1
CCG CCG CAT ATG ATG GTT ACT TCA CCG TAC GGT C
54.8
Rho1Esgp74R 1380
CCG CCG CTC GAG TTA CTT CCC CAT TTC CCG AAG G
54.8
g74@388
Rho1Esgp74Fw388
GCC GCC GAG CTC CGT TCG CCT GGC GGC AAT G
57.6
Rho1Esgp74R 1380
CCG CCG CTC GAG TTA CTT CCC CAT TTC CCG AAG G
54.8
g74@1048
Rho1Esgp74Fw1048
GCC GCC GAG CTC CGT GGA ACA TTC GCA GAA CTA G
54.8
Rho1Esgp74R 1380
CCG CCG CTC GAG TTA CTT CCC CAT TTC CCG AAG G
54.8
The es ic ion enzyme sequences a e isually dis inguished by colo -coded highligh s:
Nde
I in g ay,
Xho
I in g ay, and
Sac
I in black,
ollowed by he annealing sequence. Nucleo ides s a egically in oduced o enhance enzyme ac i i y a e unde lined. Mel ing empe a u es
(Tm) we e calcula ed using OligoCalc and conside ing only he annealing sequence.
The design adhe ed o es ablished guidelines and was op imized using he online ool OligoCalc,
accessible a h p://bio ools.nubic.no hwes e n.edu/OligoCalc.h ml. Key conside a ions du ing he
design p ocess included a sequence leng h ypically wi hin he ange o 18 o 30 base pai s, a mel ing
empe a u e (Tm) ideally alling be ween 52 °C and 62 °C, wi h no mo e han a 5 °C Tm a ia ion be ween
each p ime pai , and a minimal p edic ed occu ence o complemen a y egions o o ma ion o
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
21
seconda y s uc u es (C. Oli ei a, Aguia , and Domingues 2017). Recogni ion si es o es ic ion enzymes
we e added o he 5´ ends o each p ime , ensu ing compa ibili y wi h he mul iple cloning si es o he
plasmids used. These sho nucleo ide sequences a e no complemen a y o he DNA empla e, bu a e
a ew PCR cycles hey a e inco po a ed in o he newly ampli ied agmen s. Fo cloning g74 in o
pET28a(+), he p ime s included
Nde
I and
Xho
I ecogni ion sequences. The cloning o
g114@568
,
g74@388
, and
g74@1048
in o pGFP equi ed
Sac
I and
Xho
I ecogni ion sequences. As
g114
was
cloned in o bo h pET28a(+) and pGFP ( o e e ence e e o Table 4 and Annex II), he p ime s we e
designed o include
Nde
I,
Sac
I, and
Xho
I ecogni ion sequences, ensu ing compa ibili y wi h bo h
plasmids. To enhance he e iciency o es ic ion diges ion, a small numbe o ex a nucleo ides, ypically
six, we e added ups eam o he ecogni ion sequence si e. This modi ica ion conside s ha endonuclease
ac i i y ends o be less e ec i e when he ecogni ion si e is loca ed a one end o he DNA agmen .
The p ime s we e syn hesized by STAB VIDA (Po ugal). Upon ecep ion a mas e s ock solu ion
was p epa ed a a concen a ion o 100 µM which was hen dilu ed 1:10 o c ea e a wo king s ock (10
µM) o be used o PCR. Bo h mas e s ock and wo king s ock we e s o ed a - 20 °C o long- e m s o age.
Ampli ica ion o he DNA agmen s was pe o med by PCR using he Phusion High-Fideli y DNA
Polyme ase Ki (The mo Scien i ic™, Ca # F630S), he p ime se lis ed in he Table 7 and phage s ock
solu ion as empla e. The Phusion™ Plus DNA Polyme ase was chosen o i s abili y o enhance he
speci ici y o ampli ied agmen s by educing he chances o inco ec nucleo ide inse ion du ing
ampli ica ion.
The PCR eac ion mix u e and he mocycling condi ions we e based on he manu ac u e 's
ins uc ions. In summa y, a 50 µL eac ion mix u e was p epa ed o each agmen o be isola ed. The
eac ion mix u e consis ed o 10 µL o DNA empla e (phage s ock suspension), 2.5 µL o each Fo wa d
and Re e se p ime s (10 μM wo king s ock), 1 µL o dNTP Mix (10 mM, The mo Scien i ic™), 10 µL o
5X Phusion™ Plus Bu e (The mo Scien i ic™), 0.5 µL o Phusion™ Plus DNA Polyme ase (The mo
Scien i ic™), and 23.5 µL o nuclease- ee wa e (Cy i a, Ca # SH30538.03).
The mal cycling was conduc ed wi h a T100™ The mal Cycle (Bio-Rad), ollowing he
empe a u e and ime condi ions speci ied in Table 7. Two p ime annealing empe a u es we e es ed
o each DNA agmen and he p ime annealing ime was subsequen ly adjus ed based on hese esul s.
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
22
Table 7| PCR The mal Cycling Condi ions using Phusion™ Plus DNA Polyme ase
Cycle S ep
Cycles
Tempe a u e (°C)
Time
Ini ial dena u a ion
1
98
3 min
Dena u a ion
35
98
15 s
Annealing
55 o 60
15 s o 20 s
Ex ension
72
45 s
Final ex ension
1
72
5 min
hold
12
In ini e
3.3.2 DNA agmen pu i ica ion and analysis
Following DNA ampli ica ion, aga ose gel elec opho esis was conduc ed o isualize he ampli ied
agmen s and con i m hei expec ed size. A 1% aga ose gel was p epa ed by dissol ing aga ose (GeneON
GmbH, Ca # 604-005) in 1x T is base-ace a e-EDTA (TAE) bu e (40 mM T is base, 1 mM EDTA). To
enable nucleic acid isualiza ion, G eenSa e P emium s ain (NZYTech, Ca # MB13201) was added a a
olume o 1.75 μL pe 40 mL o aga ose gel. Fo gel loading, a mix u e was p epa ed using 1 olume o
6x NZYDNA loading dye (NZYTech) and 5 olumes o he PCR p oduc . In addi ion o he PCR p oduc s,
a size ma ke , GeneRule 1 kb DNA ladde (The mo Scien i ic™, Ca # SM0311), was included in he gel.
This size ma ke se ed he dual pu pose o de e mining DNA agmen sizes and p o iding a ough
es ima e o hei quan i y. Gel elec opho esis was pe o med in 1× TAE bu e a 90 V o 40 min, using
a Pe ec Blue Mini Gel Sys em (VWR®). Subsequen ly, he gels we e isualized unde UV ligh wi h a
ChemiDoc™ XRS+ ansillumina o equipped wi h Image Lab™ 5.1 So wa e (Bio-Rad).
A e con i ming he p esence o bands o he expec ed size, PCR p oduc s we e pu i ied using
he DNA Clean & Concen a o ® ki (Zymo Resea ch, Ca # D4014) and he concen a ion o pu i ied DNA
agmen s was de e mined using a NanoD op™ One Mic o olume UV-Vis Spec opho ome e (The mo
Scien i ic™). The pu i ied ampli ied DNA agmen s we e hen s o ed a – 20 °C un il he diges ion
p ocedu e.
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
23
3.4 P epa a ion o Plasmid ec o
The cloning ec o s pET-28a and pGFP we e ou inely s o ed in glyce ol s ocks
o E. coli
op 10
cells and equi ed ex ac ion om he hos o ganism o u he use. To ex ac he plasmids, he bac e ial
hos had o be e i ed. A small po ion o he ozen bac e ia om he c yo ial was sp ead on o LB aga
pla es con aining kanamycin and incuba ed o e nigh a 37 °C o allow bac e ial g ow h. On he ollowing
day, he g own biomass was sc aped and used o plasmid isola ion and pu i ica ion, using he
NucleoSpin® Plasmid Ki (Mache ey-Nagel, Ca # 740588.250) and ollowing he manu ac u e 's
ins uc ions. The DNA concen a ion o he ex ac ed plasmids was de e mined using a NanoD op™ One
Mic o olume UV-Vis Spec opho ome e (The mo Scien i ic™). The pu i ied plasmid was s o ed a – 20
°C un il he diges ion p ocedu e.
3.5 Cloning
3.5.1 Diges ion
The pu i ied DNA agmen s (sec ion 3.3.2) and he pu i ied plasmid (sec ion 3.4) we e
simul aneously diges ed wi h wo di e en es ic ion enzymes ha do no gene a e compa ible ends. This
me hod aims o ensu e he di ec ional inse ion o he DNA agmen in o he hos plasmid in he liga ion
eac ion and p e en he ec o 's e-ci cula iza ion (C. Oli ei a, Aguia , and Domingues 2017). Table 8
lis s he pai o Fas Diges enzymes (The mo Scien i ic™) used o diges each sample. Diges ion was
pe o med acco ding o he manu ac u e 's ins uc ions (wi h mino adjus men s) and conside ing he
DNA concen a ions de e mined in sec ion 3.3.2 and sec ion 3.4. In summa y, a 20 μL diges ion
eac ion mix u e was p epa ed o each sample. The eac ion mix u e consis ed o 1500 ng o plasmid
DNA o 500 ng o PCR p oduc , 1 µL o Fas Diges enzyme #1, 1 µL o Fas Diges enzyme #2, 2 µL o
10X Fas Diges bu e (The mo Scien i ic™), and nuclease- ee wa e up o 20 µL. The mix u e was
incuba ed (37 °C, 60 min), ollowed by enzyme inac i a ion (80 °C, 5 min) using he Hea Block (VWR).
To p e en eci cula iza ion o he diges ed plasmids in he subsequen liga ion eac ion, he
plasmids we e addi ionally ea ed wi h alkaline phospha ase. The enzyme alkaline phospha ase emo es
he phospha e g oups om he 5´- ends, so ha he enzyme ligase is no able o join he end agmen s
o he plasmid, since no phospha e g oups a e a ailable o he phosphodies e bond (C. Oli ei a, Aguia ,
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
24
and Domingues 2017). In summa y, 1 μL Alkaline Phospha ase (
E. coli
) (The mo Scien i ic™, Ca #
MB01801) and 2.3 μL o he eac ion bu e we e added o 20 μL plasmid sample. The mix u e was
incuba ed (37 °C, 30 min) and hen cleaned using he DNA Clean & Concen a o ®-5 ki as pe he
manu ac u e 's ins uc ions. Co ec plasmid diges ion was con i med by aga ose gel elec opho esis (as
desc ibed sec ion 3.3.2) and he inal plasmid DNA concen a ion was de e mined using a NanoD op™
One Mic o olume UV-Vis Spec opho ome e (The mo Scien i ic™). Bo h diges ed p oduc s (DNA agmen
and plasmid) we e s o ed a - 4 °C un il he liga ion p ocedu e.
Table 8| Double diges ion scheme
Sample
Fas Diges
enzyme #1
Fas Diges
enzyme #2
PCR p oduc
g114
Nde
I
Xho
I
g114
Sac
I
Xho
I
g114@568
Sac
I
Xho
I
g74
Nde
I
Xho
I
g74@388
Sac
I
Xho
I
g74@1048
Sac
I
Xho
I
Plasmid DNA
pET28a(+)
Nde
I
Xho
I
pGFP
Sac
I
Xho
I
Fas Diges
Sac
I (Ca # FD1133), Fas Diges
Nde
I (Ca # FD0583), and Fas Diges
Xho
I (Ca #
FD0694).
3.5.2 Liga ion
Following he diges ion s ep, plasmid and inse we e liga ed using T4 DNA Ligase (The mo
Scien i ic™, Ca # EL0011) acco ding o he scheme p o ided in Table 9 and ollowing he manu ac u e 's
ins uc ions. A 1:7 mola a io (plasmid o inse ) was employed, exceeding he manu ac u e 's sugges ed
a io due o he ample a ailabili y o inse DNA and o ensu e mo e han adequa e quan i y. In summa y,
A 20 μL eac ion mix u e was p epa ed o each inse - ec o o be liga ed. The mix u e included 0.2 µL

De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
25
o T4 DNA Ligase (5 Weiss U/uL), 2 µL o T4 DNA Ligase Bu e (10x) (The mo Scien i ic™, Ca # B69),
and nuclease- ee wa e o achie e a inal olume o 20 µL. The liga ion mix u e was incuba ed o e nigh
a oom empe a u e, ollowed by enzyme inac i a ion (70 °C, 7 min). Finally, he liga ion p oduc s we e
s o ed a - 4 °C un il he ans o ma ion p ocedu e.
Table 9| Liga ion eac ion scheme
Linea plasmid
F agmen
pET28a(+)
g114
pGFP
g114
pGFP
g114@568
pET28a(+)
g74
pGFP
g74@388
pGFP
g74@1048
3.5.3 T ans o ma ion in o cloning hos
The liga ion p oduc was in oduced in o compe en
E. coli
DH5α cells using he hea shock
ans o ma ion me hod.
Hea shock ans o ma ion me hod
Chemically compe en cells we e hawed on ice o 2-5 min a e emo al om s o age a - 80
°C. Once hawed, 5 µL o he liga ion p oduc was ca e ully added o 50 µL o cells in a p e-chilled
mic ocen i uge ube and mixed gen ly (wi hou pipe ing up and down). The mix u e was hen incuba ed
on ice o 20 min. Hea shock was pe o med by subsequen ly placing he mix u e in a 42 °C wa e ba h
o 50 s, and hen again on ice o ano he 2 min. Following hea shock ans o ma ion, 300 μL oom
empe a u e SOC (Supe Op imal B o h wi h Ca aboli e Rep ession) medium (30.2 g/L, NZYTech, Ca #
MB28001) was immedia ely added o he cells and he mix u e incuba ed (37 °C, 120 pm ) o
app oxima ely 1 h o 1.5 h, on an O bi al Shake -Incuba o E-20/60 (BioSan) o allow cells o eco e .
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
26
A e his exp ession pe iod, a 10 μL sample was pla ed on an LB -kanamycin aga pla e ( oom
empe a u e) and incuba ed o e nigh a 37 °C o selec o ans o med cells unde an ibio ic selec i e
p essu e. The emaining olume (app oxima ely 320 µL) was also pla ed on a sepa a e aga pla e,
esul ing in s ock pla es o s o age o ans o med cul u es o u u e use.
A e he ans o ma ion p ocedu e, he esul ing posi i e ans o man s we e sc eened o he
inco po a ion o he co ec ecombinan plasmid cons uc h ough Colony PCR. Fo his pu pose, i e
colonies we e andomly selec ed, esuspended in 25 µL o LB wi h kanamycin, and incuba ed ( 37 °C,
1 h), o hen be used as DNA empla es. The PCR eac ion was pe o med using Xpe Fas Mas e mix
(2x) wi h dye (G isp, Ca # GE15.0001) and he p ime se lis ed in Table 10.
Table 10| P ime s used o colony PCR and Sange sequencing
P ime
Nucleo ide sequence (5´→3´)
T7 Fo wa d
GATCCCGCGAAATTAATACGACTCACTATAG
T7 Re e se
CAAGGGGTTATGCTAGTTATTGCTCAGCGG
SeqGFP Fo wa d
TGATCTACTTCGGCTTCGTG
The PCR mix u e and he mocycling condi ions we e based on he manu ac u e 's ins uc ions
and, in acco dance wi h hei sugges ion, he mix u e was p epa ed in bulk and s o ed a - 20 °C un il
needed. The mix u e included 125 µL o Xpe Fas Mas e mix (2x) dye (G isp, Ca # GE15.0001), 10 µL
T7 Fo wa d p ime (10 µM s ock solu ion), 10 μL T7 Re e se p ime (10 µM s ock solu ion), and 63.4
µL o ul apu e wa e .
On he day o he assay, he PCR mix u e was hawed, and 1 µL o he colony suspension was
added o 5 µL o he PCR mix u e. The mal cycling was conduc ed wi h a T100™ The mal Cycle (Bio-
Rad), ollowing he empe a u e and ime condi ions speci ied in Table 11.
Following PCR, aga ose gel elec opho esis was pe o med as desc ibed in sec ion 3.3.2, o
con i m he leng h o he ampli ied PCR p oduc s. The SnapGene so wa e (h p://www.snapgene.com/)
was used o
in silico
plasmid cons uc ions, o p edic DNA size and sequence. Thei expec ed sizes a e
lis ed in Table 12.
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
27
Table 11| PCR The mal Cycling Condi ions using Xpe Fas DNA polyme ase
Cycle S ep
Cycles
Tempe a u e (°C)
Time
Ini ial dena u a ion
1
95
3 min
Dena u a ion
35
95
20 s
Annealing
49
20 s
Ex ension
72
1 h 30 s
Final ex ension
1
72
3 min
hold
12
In ini e
Table 12| Expec ed band size o ecombinan plasmids a e Colony PCR wi h T7 o wa d and e e se p ime s
Recombinan plasmid
Expec ed band size (bp)
pET28a(+)_
g114
1275
pGFP_
g114
1998
pGFP_
g114@568
1431
pET28a(+)_
g74
1668
pGFP_
g74@388
2010
pGFP_
g74@1048
1350
Clones wi h ecombinan plasmids o he co ec DNA size we e sp ead on o LB aga pla es
supplemen ed wi h kanamycin and incuba ed o e nigh a 37 °C. On he ollowing day, he ecombinan
plasmids we e ex ac ed using he NucleoSpin® Plasmid Ki (Mache ey-Nagel), hei DNA concen a ion
de e mined using a NanoD op™ One Mic o olume UV-Vis Spec opho ome e (The mo Scien i ic™) and
sen o sequencing.
Sange sequencing was used o con i m he co ec inse ion o he desi ed sequence in o he
plasmid and o check o e o s in he plasmid sequence due o unwan ed mu a ions. The sequencing
se ice was p o ided by Eu o ins Genomics (Ge many). The p ime T7 o wa d (Table 10) was used o
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
28
con i m genes inse ed in o pET28a(+), while he SeqGFP o wa d p ime (Table 10) was used o genes
inse ed in o pGFP. I needed, he T7 e e se p ime (Table 10) was also used. Samples o be sen we e
p epa ed ollowing he company's p o ocols, whe e a inal olume o 10 µL was ob ained by combining 7
µL (a leas 500 ng) plasmid and 3 µL (3 µM) p ime . Upon ecei ing he sequencing esul s, hese we e
aligned pai wise and compa ed wi h he p edic ed sequences (as de e mined h ough SnapGene) o ule
ou a ia ions o disc epancies. The alignmen was conduc ed using he EMBL-EBI local sequence
alignmen se e EMBOSS Wa e (h ps://www.ebi.ac.uk/Tools/psa/emboss_wa e /) (Talukde e
(Talukde , Rahman, and Masum 2022; Madei a e al. 2019).
Once con i med,
E. coli
DH5α cells ha bo ing he co ec ecombinan plasmids we e sp ead
on o LB aga pla es supplemen ed wi h kanamycin and incuba ed o e nigh a 37 °C. On he ollowing
day, hese cells we e c yop ese ed o long e m s o age. Pu i ied ecombinan plasmids we e used o
he ollowing s ep.
3.5.4 T ans o ma ion in o exp ession hos
The ecombinan plasmids we e in oduced in o elec ocompe en
E. coli BL21
(DE3) cells by
elec opo a ion. This equi ed p io p epa a ion o elec ocompe en cells.
Elec ocompe en cell p epa a ion p ocedu e
A s a e cul u e p epa ed by inocula ing 10 mL o LB medium wi h app oxima ely 2 cm2 o
E. coli
BL21
(DE3) cells om a eshly g own o e nigh LB-aga pla e. A e an o e nigh incuba ion a 37 °C and 120
pm, a 1 % dilu ion in esh LB medium was made by adding 1250 µL o 125 mL, esul ing in a seconda y
cul u e. The seconda y cul u e was incuba ed (37 °C, 120 pm) un il i eached an op ical OD600nm o
app oxima ely 0.400, indica ing ea ly o mid-exponen ial g ow h and a o able condi ions o
E. coli
ans o ma ion (Eskanda i 2020). The cul u e was chilled on ice o abou 30 min o hal he g ow h
p ocess. The cells we e subsequen ly collec ed by cen i uga ion (5,000 ×
g
, 5 min, 4 °C) using a
e ige a ed cen i uge (Sigma 3-16k). To main ain he quali y o he elec ocompe en cells, hey we e
kep on ice h oughou he emaining s eps o he p epa a ion p ocedu e. The pelle was hen washed
h ee imes by ca e ully esuspending in dec easing olumes o ice-cold 10 % glyce ol (125 mL, 65 mL,
and 3.75 mL), wi h cen i uga ion (5,000 ×
g
, 5 min, 4 °C) be ween each esuspension s ep. A e he
las cen i uga ion, he pelle was esuspended in 750 μl o ice-cold 10 % glyce ol. The esul ing
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
35
In e P o analysis o gp74 p edic ed wo ca aly ic domains: an N- e minal domain o pep idase
( amily M23) and a cen al domain o glycoside hyd olase ( amily 25) (Figu e 7). This con i med he
BLASTp p edic ion ha gp74 deg ades he pep idoglycan be ween suga uni s (Figu e 5, posi ion #1)
and added ha gp74 also has pep idase ac i i y (Figu e 5, posi ion #6).
Figu e 7| In e P o analysis o gp74 and C- e minal unca ion s a egies. aa: amino acid; bp: base pai .
4.2 Cons uc ion o ecombinan p o eins
To de e mine he exis ence o a CBD and he con ibu ion o he CD o he o e all e ec i eness
o he CBD, di e en unca ions o
g114
and
g74
main aining i s C- e minus we e made, e e ed o
he ein as
g114@568
,
g74
,
g74@388
, and
g74@1048
( he numbe a e @ deno es he nucleo ide
whe e he agmen s a s). The agmen ´s ends (C- e minus) we e chosen o ensu e ha he CBD
hypo hesis could be accommoda ed by all agmen s (binding is usually loca ed a he C- e minus). Since
g114
only encodes one CD, i was also included o his pu pose. Addi ionally,
g114
and
g74
agmen s
we e cloned o es o ly ic ac i i y agains
R. e y h opolis
. DNA agmen s used in his s udy a e lis ed in
Table 3 and we e ampli ied acco ding o he p ocedu e desc ibed in sec ion 3.3.1. The esul s a e
depic ed in Figu e 8, whe e he op imiza ions o he PCR p ocedu e we e assessed. The gel
elec opho esis esul s e eal a single band o he expec ed size o each agmen , indica ing speci ic
ampli ica ion. No seconda y bands we e obse ed, uling ou nonspeci ic ampli ica ion du ing he PCR.
Two dis inc annealing empe a u es (55 °C and 60 °C) we e e alua ed, and he annealing ime was ine-
uned based on he esul s, while all o he PCR pa ame e s emained consis en .

De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
36
Figu e 8| Aga ose gel elec opho esis o he i e DNA agmen s equi ed o he cloning s a egies. PCR ampli ica ion e iciency is es ed
a wo annealing empe a u es (60 °C and 55 °C) and wo annealing imes (15 s and 20 s). (a) Annealing ime o 15 s and annealing
empe a u e o 60 °C: Lane 1)
g114
, lane 2)
g114@568
, lane 3)
g74
, lane 4) g
74@388
, and lane 5)
g74@1048
. Ampli ica ions wi h an
annealing empe a u e o 55 °C: Lane 6)
g114
, lane 7)
g114@568
, lane 8)
g74
, lane 9) g
74@388
, and lane 10)
g74@1048
. (b) Annealing
empe a u e 55 °C and annealing ime o 20 s: Lane 1)
g74
and lane 2)
g74@388
. Lane L: GeneRule 1kb DNA Ladde .
Figu e 8a shows ha he e iciency o ampli ica ion a ies depending on he annealing
empe a u e. The mo e in ense bands obse ed a 55 °C indica e ha he e iciency was highe a his
empe a u e. Ne e heless, no band was de ec ed in lane 9, which could be due o a pipe ing e o ,
such as an insu icien DNA sample. Howe e , i could also indica e ha he bes combina ion o annealing
empe a u e and ime o his agmen has ye o be de e mined. When compa ing lane 8, agmen
g74
(1380 bp), wi h he o he agmen s unde he same condi ions, he analysis also shows a smalle
inc ease in ela i e in ensi y when swi ching om 60 °C o 55 °C. This indica es ha adjus ing he
annealing ime could also imp o e he e iciency o ampli ica ion o his agmen
Figu e 8b shows a posi i e esul o he hypo hesis es ed, wi h bo h agmen s showing mo e
in ense bands compa ed o he condi ions in Figu e 8a. No non-speci ic bands we e obse ed ha could
be due o a lowe annealing empe a u e. The e o e, he PCR he mocycling condi ions we e changed as
ollows: The annealing empe a u e o all agmen s is 55 °C and he annealing ime o agmen s
g114
,
g114@568
, and
g74@1048
is 15 s and o agmen s
g74
and
g74@388
is 20 s.
The ampli ied and pu i ied DNA agmen s, along wi h he pu i ied plasmid DNA, we e diges ed,
liga ed (as desc ibed in sec ion 3.5), and subsequen ly used o ans o ming
E. coli
DH5α compe en
cells. The plasmid ec o s employed included pET28a(+) and pGFP. The pGFP ec o sha es ea u es
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
37
wi h pET28a(+) and includes he GFP gene o luo escence mic oscopy isualiza ion (see Table 4 and
Annex II).
E. coli
DH5α was chosen as cloning hos due o i s high ans o ma ion e iciency and i s
abili y o main ain he in eg i y o cloned DNA.
E. coli
DH5α is equipped wi h
ecA1
and
endA
mu a ions,
which es ain he clea age and deg ada ion o DNA, he eby gua an eeing he s abili y o he cloned DNA
.
(Teng e al. 2023). The esul ing colonies we e andomly selec ed and subjec ed o colony PCR using he
T7 uni e sal p ime s. The PCR p oduc s om each colony we e isualized h ough aga ose gel
elec opho esis, and he posi i e esul s we e sen o Sange sequencing.
Howe e , be o e achie ing success, some colony PCR p oduc s exhibi ed bands a app oxima ely
1039 bp, indica ing ampli ica ion o he emp y pGFP ec o . This issue o en a ises om ine icien
diges ion, plasmid eci cula iza ion, o ine ec i e liga ion. To add ess his, a ious op imiza ions we e
implemen ed du ing he cloning s eps o minimize backg ound noise om ans o man s ca ying emp y
plasmids. These op imiza ions included ex ended incuba ion imes o diges ion and liga ion, he addi ion
o alkaline phospha ase o p e en plasmid eci cula iza ion and an inc eased mola a io o inse o
ec o . Despi e hese e o s, a ou h op imiza ion was pe o med. I in ol ed a second diges ion s ep
wi h a es ic ion enzyme,
Sal
I, ha was chosen o selec i ely a ge he emp y plasmid ec o and no
he a ge sequences. In b ie , he liga ion p oduc was incuba ed wi h 1 µL o
Sal
I and 2 µL o Fas Diges
bu e a 37 °C o 45 min ollowed by enzyme inac i a ion (67 °C, 12 min). This s ep e ec i ely emo ed
he backg ound noise, ensu ing ha only ans o man s wi h he co ec ecombinan plasmid we e
e ained a e he ans o ma ion, leading o success ul esul s. The co ec ecombinan plasmid was
hen ans o med in o
E. coli
BL21 (DE3) cells, a s ain op imized o high-le el p o ein p oduc ion and
commonly used o he o e exp ession o he e ologous p o ein.
4.3 Exp ession o ecombinan p o eins
E. coli
BL21 (DE3) cells ha bo ing he co ec ecombinan plasmids we e induced wi h 1 mM
IPTG o o e exp ess (His)6- agged ecombinan p o eins a 16 °C, 160 pm, o e nigh . The pET28a(+)
ec o (and pGFP) con ain he T7 p omo e sequence, a well-es ablished egula o y elemen , which
enabled he p ecise con ol o e he exp ession o a ge genes downs eam. Ac i a ion o he T7 p omo e
was induced by 1 mM IPTG which bound o he Lac ep esso p o ein, allowing he T7 RNA polyme ase
o ansc ibe om he T7 p omo e he eby ansc ibing he ull-leng h and unca ed endolysin
downs eam genes (Teng e al. 2023). Following exp ession, because he a ge p o ein is co-p oduced
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
38
wi h se e al o he hos cell p o eins, i was necessa y o isola e and pu i y i om he complex mix u e.
To aid in his p ocess, he pET28a(+) ec o (and pGFP) con ains polyhis idine ag sequences consis ing
o six consecu i e his idine esidues. The (His)6- agged ecombinan p o ein was isola ed using Ni-cha ged
MagBeads and inc easing concen a ions o imidazole bu e s. Low imidazole concen a ions p e en ed
con amina ing p o eins om binding o he nickel-cha ged beads. A highe concen a ions, imidazole
compe ed wi h His ag his idine imidazole side chains, dis up ing hei binding o nickel ions, and allowing
he (His)6- agged ecombinan p o ein o be elu ed.
The success o o e exp ession, including he exp ession o soluble o insoluble p o ein, and he
pu i y o he elu ed ecombinan p o eins we e e alua ed using SDS-PAGE. Figu e 9 p esen s he esul s
o he SDS-PAGE analysis o he pu i ied ecombinan Gp114 and Gp74.
Figu e 9| SDS-PAGE o pu i ied ecombinan Gp114 and Gp74, o e exp essed in
E.coli
BL21(DE3).Gp114: Lane 1) exp ession ac ion,
lane 2) pelle ac ion, lane 3) suspension ac ion a e incuba ion and eco e y wi h Ni-MagBeads, and lane 4) pu i ied p o ein ac ion.
Gp74: Lane 5) exp ession ac ion, lane 6) pelle ac ion, lane 7) suspension ac ion a e incuba ion and eco e y wi h Ni-MagBeads, and
lane 8) pu i ied p o ein ac ion. Lane L) PageRule ™ Uns ained B oad Range P o ein Ladde (The mo Scien i ic™).
A compa ison o he di e en ac ions shows a p ominen band o high in ensi y in he pelle
ac ion, whe eas no band is seen in he pu i ied p o ein ac ion. This obse a ion sugges s ha he
o e exp essed Gp114 wi h a p edic ed molecula weigh o app oxima ely 37 kDa (lane 2) and Gp74
wi h a p edic ed molecula weigh o app oxima ely 50 kDa (lane 6) we e exp essed only in an insoluble
o m.
Figu e 10 displays he esul s o he SDS-PAGE analysis o he pu i ied ecombinan GFP- usion
p o eins. GFP-gp114 was ound o be exclusi ely exp essed in an insoluble o m, e idenced by he
absence o a band in he lane ep esen ing he pu i ied p o ein ac ion. Ins ead, he e is a p ominen
band in he pelle ac ion wi h he co ec p edic ed molecula weigh o app oxima ely 64 kDa (lane
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
39
a2). In con as , GFP-gp114@568 (app oxima ely 43 kDa), GFP-gp74@388 (app oxima ely 63 kDa), and
GFP-gp74@1048 (app oxima ely 39 kDa) we e success ully pu i ied a hei expec ed molecula weigh s,
as indica ed by single bands o high in ensi y. Howe e , ecombinan p o eins we e exp essed mos ly in
an insoluble o m, as indica ed by he no ably highe band in ensi y in he pelle ac ion (lane b2, lane
c2, and lane c6) compa ed o he co esponding pu i ied p o ein ac ion (lane b4, lane c4, and lane
c8).
Figu e 10| SDS-PAGE o pu i ied ecombinan GFP- usion p o eins o e exp essed in
E.coli
BL21(D3). (a) GFP-gp114: Lane 1) exp ession
ac ion, lane 2) pelle ac ion, lane 3) suspension ac ion a e incuba ion and eco e y wi h Ni-MagBeads, and lane 4) pu i ied p o ein
ac ion). (b) GFP-gp114@568: Lane 1) exp ession ac ion, lane 2) pelle ac ion, lane 3) suspension ac ion a e incuba ion and
eco e y wi h Ni-MagBeads, and lane 4) pu i ied p o ein ac ion. (c) GFP-gp74@388: Lane 1) exp ession ac ion, lane 2) pelle ac ion,
lane 3) suspension ac ion a e incuba ion and eco e y wi h Ni-MagBeads, and lane 4) pu i ied p o ein ac ion. GFP-gp74@1048: Lane
5) exp ession ac ion, lane 6) pelle ac ion, lane 7) suspension ac ion a e incuba ion and eco e y wi h Ni-MagBeads, and lane 8)
pu i ied p o ein ac ion. Lane L PageRule ™ Uns ained B oad Range P o ein Ladde (The mo Scien i ic™).
A p ima y challenge in he ecombinan p oduc ion o endolysins is hei ypically low eco e y in
he soluble o m (Balaban e al. 2022; Tham e al. 2020). While
E. coli
ecombinan p o ein p oduc ion
sys ems a e in en ionally designed o p omo e he accumula ion o a signi ican quan i y o soluble p o ein
p oduc s wi hin he bac e ial cell, he apid and hea y p o ein p oduc ion p ocess can place conside able
s ess on he hos cell. This s ess may lead o
in i o
p o ein mis olding, esul ing in he loss o biological
ac i i y and subsequen agg ega ion in o inclusion bodies. In cases whe e he p o ein is exp essed in an
insoluble o m, he e a e se e al po en ial app oaches. One op ion is o acknowledge he o ma ion o
inclusion bodies and hen de elop s a egies o solubilizing and e olding he p o ein, wi h he aim o
es o ing i s biological ac i i y. Al e na i ely, e o s can be di ec ed owa ds op imizing he exp ession
p ocess o achie e maximum solubili y, o e en ee alua ing cloning s a egies (S. Cos a e al. 2014;
Tham e al. 2020; Balaban e al. 2022).
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
40
To eco e he insoluble p o ein, Zhang
e al.
(2019) p opose dissol ing he inclusion bodies wi h
a dena u an consis ing o 20 mM T is-HCl bu e pH 8.0 wi h 8 M u ea, ollowed by g adual emo al o
he dena u an by dialysis o allow p o ein e olding o occu (Z. Zhang e al. 2019; Aze edo and Ai es-
Ba os 2017). Howe e , al hough s ong chao opic agen s like 8M u ea solubilize mos insoluble p o ein
agg ega es, i esul s in low eco e y o biologically ac i e p o eins (Singh i e al. 2021). To add ess his
issue, Singh i
e al.
(2021) desc ibe a no el o mula ion o mild solubiliza ion bu e s consis ing o 20%
i luo oe hanol, 20% n-p opanol, and 2M u ea a a pH o 12.5, accoun ing o bo h solubiliza ion and
e olding e iciency (Singh i e al. 2021).
S a egies o op imizing exp ession o maximum soluble p o ein p oduc ion ypically in ol e ial-
and-e o adjus men s o a ious condi ions, such as lowe ing induc ion empe a u e, IPTG concen a ion,
and exp ession empe a u e (Balaban e al. 2022; Tham e al. 2020; F ancis and Page 2010; Shen e al.
2022). In he con ex o his s udy, a low induc ion empe a u e was ensu ed by cooling he cul u e on
ice be o e induc ion. Lowe ing he IPTG concen a ion and exp ession empe a u e a e known o educe
he ansc ip ion a e, p omo ing he p oduc ion o co ec ly olded, soluble p o eins (F ancis and Page
2010). Howe e , as highligh ed by Tu ne
e al
. (2005), when using a lowe exp ession empe a u e, an
inc ease in he induce concen a ion migh be necessa y o achie e he highes possible ac i i y (P.
Tu ne , Hols , and Ka lsson 2005). Addi ionally, Balaban
e al.
(2022), obse ed no signi ican impac on
he eco e y o soluble endolysin wi hin he IPTG concen a ion ange o 0.1 o 1 mM. This is consis en
wi h he esul s o Shen
e al.
(2022), who epo ed no signi ican di e ences when using IPTG
concen a ions anging om 0.2 o 1 mM in hei s udy (F ancis and Page 2010; P. Tu ne , Hols , and
Ka lsson 2005). The e o e, in his s udy, a low exp ession empe a u e o 16 °C and an IPTG
concen a ion o 1 mM we e deemed app op ia e and well-jus i ied choices
Fu he mo e, econside ing he cloning s a egy could po en ially in luence endolysin exp ession
in a soluble o m. Fo example, he posi ion o he (His)6 ag sequence. While he p ima y ole o he (His)6
ag is no o enhance soluble exp ession (F ancis and Page 2010), s udies ha e sugges ed ha i s
posi ion, whe he a he N- o C- e minus ela i e o he a ge p o ein, migh ha e a nega i e impac on
he p oduc ion o soluble p o ein (Woes enenk e al. 2004; Tham e al. 2020; Balaban e al. 2022). In
his s udy, he cloning s a egy included he N- e minus (His)6 ag sequence and excluded he C- e minus
(His)6 ag sequence. Al e na i ely, di e en cloning s a egies, such as co-exp essing endolysins wi h
molecula chape ones o olding modula o s and u ilizing solubili y ags used o he a ge gene sequence

De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
41
ha e been p oposed (S. Cos a e al. 2014). Howe e , hese al e na i e app oaches we e no explo ed due
o ime cons ain s.
4.4 Func ional analysis o ecombinan p o eins
4.4.1 Ly ic ac i i y by u bidi y educ ion
While SDS-PAGE esul s indica ed he absence o Gp114 and Gp74 ecombinan p o eins in he
pu i ied p o ein ac ions (Figu e 9), hey we e assessed o ly ic ac i i y as o iginally planned o ule ou
he possibili y o esidual p o eins being p esen and po en ially exhibi ing unc ional ac i i y bu a
concen a ions no de ec ed by SDS-PAGE. A u bidi y educ ion assay was pe o med as ou lined in
sec ion 3.8. Op ical densi y eadings we e aken o he mix u e a 10-minu e in e als. No educ ion in
u bidi y was obse ed unde he es ed condi ions. Plausible explana ions include he po en ial absence
o he ecombinan endolysin in he sample o , i p esen , i s lack o biological ac i i y o inabili y o each
i s subs a e o demons a e unc ional ac i i y.
4.4.2 P o ein binding by luo escence mic oscopy
Following SDS-PAGE analysis, he pu i ied GFP- usion p o eins we e subjec ed o a binding assay
o assess hei abili y o bind o
R. e y h opolis
. The aim o his p ocedu e was o in es iga e he cell
binding cha ac e is ics o a ious endolysin unca ions: CBD alone (GFP-gp114@568 and GFP-
gp74@1048) and CBD linked o a CD (GFP-gp114 and GFP-gp74@388). Each unca ion was indi idually
incuba ed wi h
R. e y h opolis
cells, ollowing he p o ocols ou lined in sec ion 3.7. The p esence o
bound p o eins was hen con i med by he de ec ion o deco a ed g een, luo escen
R. e y h opolis
cells
unde a luo escence mic oscope.
While SDS-PAGE analysis did no e eal he p esence o GFP-gp114 in he pu i ied p o ein
ac ion, a ain g een luo escence was obse ed in he sample. As a esul , i was included in he binding
assay. Subsequen ly, he concen a ions o he ou GFP- usion p o eins we e de e mined: GFP-gp114 (8
µM), GFP-gp114@568 (28 µM), GFP-gp74@388 (23 µM), and GFP-gp74@1048 (22 µM).
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
42
An expe imen al design was se up o es ablish he op imal binding assay p o ocol. The i s
p o ocol es ed in ol ed esuspending he cell pelle in 20 µL o pu i ied GFP- used p o ein and incuba ing
i o 30 minu es a oom empe a u e, ollowing he p ocedu e desc ibed by San os
e al.
(2019). Since
GFP-gp114 had he lowes concen a ion, 100 µL o i was used o ensu e an ample amoun o usion
p o ein.
Figu e 11 shows he luo escence mic oscopy images o
R. e y h opolis
a e incuba ing wi h
he GFP- usion p o eins using his p o ocol. The images clea ly show ha only some
R. e y h opolis
cells
wi h cocci mo phology a e labeled. Occasionally, a cell wi h a di e en mo phology is labeled, bu he
labeling is limi ed o he pole o he cell (Figu e 11, GFP-gp114@568). I is also e iden ha he
binding abili y o each unca ion a ied wi hin he same mic oscopic ield, wi h some cells appea ing
b igh e han o he s. No ably, GFP-gp114 labeled ewe cells compa ed o he o he h ee unca ions, a
di e ence ha migh be a ibu ed o ei he i s lowe binding e iciency o , mo e likely, i s lowe
concen a ion ela i e o he o he p o eins, despi e he excess added. The e o e, no u he es ing was
conduc ed on GFP-gp114.
The limi ed cell deco a ion obse ed can be a ibu ed o he composi ion o he hodococci cell
en elope (Figu e 12), which may pose limi a ions on he endolysins' abili y o access he pep idoglycan.
R. e y h opolis
,
like
Mycobac e ium
, and o he membe s o he Mycola a, ha e a complex cell en elope
s uc u e. Con a y o ypical G am-posi i e bac e ia, he hodococci cell wall is also su ounded by an
ou e memb ane, a ea u e no mally ound in G am-nega i e bac e ia. In addi ion, unlike ypical G am-
posi i e bac e ia, he hodococci cell wall is composed o a hin laye o pep idoglycan co alen ly linked
o an a abinogalac an polyme es e i ied wi h mycolic acids in he ou e memb ane (Su cli e 1998;
Fe nandes and São-José 2018). Mycolic acids a e he p edominan lipid cons i uen s o he hodococci
ou e memb ane. This ea u e dis inguishes he hodococci ou e memb ane om ha o G am-nega i e
bac e ia, which is p ima ily composed o lipopolysaccha ides (Whi ield e al. 2022).
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
43
B igh ield
FITC il e
GFP-gp114
GFP-gp114@568
GFP-gp74@388
GFP-gp74@1048
Figu e 11| Fluo escence mic oscopy images o
R. e y h opolis
binding wi h GFP- used endolysin unca ions (GFP-gp114, GFP-
gp114@568, GFP-gp74@388, GFP-gp74@1048) a e a 30-minu e incuba ion a oom empe a u e. The obse a ions we e made using
bo h b igh - ield (BF) and luo escein iso hiocyana e (FITC) il e mic oscopy. The images we e cap u ed wi h a DP71 digi al came a
(Olympus), sha ing a consis en exposu e ime. GFP: G een luo escen p o ein. Scale ba : 10 µm.
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
44
Figu e 12| Schema ic compa ison o he cell en elopes o mycobac e ia
(a model o he hodococci cell en elope) and G am-posi i e
bac e ia. Di e ences a e no able in he cell wall composi ion and ou e memb ane. Re ie ed om (Whi ield e al. 2022).
The impe meable na u e o he Mycola a ou e memb ane, due o he high mycolic acid con en ,
poses a signi ican challenge o Mycola a phage endolysins a emp ing o access he pep idoglycan
subs a e (Ca alão e al. 2011; Ca alão and Pimen el 2018). Howe e , Ca alão
e al.
(2011) demons a ed
ha mycobac e iophage Ms6 endolysins could inhibi he g ow h o speci ic mycobac e ial species,
despi e he p esence o he mycolic acid ou e memb ane. The hypo hesis o endolysins accessing he
pep idoglycan h ough he ou e memb ane's po ins is unlikely because o hei es ic ed po e size,
gene ally pe mi ing only molecules weighing up o 600 Da (Nikaido 1992). Addi ionally, he endolysins
used in his s udy ha e p edic ed molecula weigh s anging om 39 o 64 kDa, u he uling ou po ins
as a po en ial ou e. Ins ead, Ca alão
e al
. (2011) hypo hesize ha he endolysins migh access he
pep idoglycan du ing cell di ision and sep al pep idoglycan syn hesis (Ca alão and Pimen el 2018).
An addi ional plausible explana ion is ha he mycola e laye is likely no a s a ic ba ie , and i s
pe meabili y may be subjec o egula ion (Su cli e, B own, and Do e 2010). This no ion aligns wi h
s udies indica ing ha he mycolic acid composi ion can a y wi h changing g ow h condi ions, including
ac o s such as empe a u e and media composi ion, as well as g ow h s age (Beaman, Mo ing, and
Ioneda 1988; S a on e al. 2003). Fu he mo e, Beaman, Mo ing, and Ioneda (1988) conduc ed
esea ch suppo ing his concep by e ealing ha Mycola a exhibi s longe chain mycolic acids du ing
he exponen ial g ow h phase compa ed o s a iona y phase cells. S udies also show ha la ge mycolic
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
51
6 Fu u e Pe spec i es
Mycola a a e among he mos common oam- o ming bac e ia in AS oaming inciden s. Howe e ,
he applica ion o endolysins speci ic o Mycola a is limi ed due o hei ou e memb ane, which hinde s
he access o ex e nally added endolysins o he pep idoglycan. No single pe meabiliza ion me hod is
uni e sally e ec i e o all Mycola a. The p o ocol by Nai and Jones (2020), used as a e e ence he e,
se es as a good s a ing poin o
R. e y h opolis
ou e memb ane pe meabiliza ion. Fu he op imiza ion
op ions can include di e en concen a ions o T i on X-100, o he de e gen s such as Tween-20, o mild
acid hyd olysis o pene a e he ou e memb ane.
A majo bo leneck in he ecombinan p oduc ion o endolysins is hei ypically low yield in he
soluble o m. Fu u e esea ch can conside explo ing he po en ial bene i s o ee alua ing he cloning
s a egy o lowe ing he exp ession empe a u e wi h he possibili y o using enginee ed
E. coli
s ains like
E. coli
A c ic Exp ess s ains.
Conce ning he eco e y o ecombinan endolysins om he cell ex ac , one po en ial a enue
o imp o emen is he op imiza ion o he ex ac ion bu e composi ion. Balaban
e al.
(2022) ha e
p oposed inco po a ing he de e gen N-lau oylsa cosine in o he lysis bu e be o e cell dis up ion. Thei
esea ch showed ha his me hod yielded a highe amoun o soluble endolysin wi hou comp omising
enzyma ic ac i i y.
In es iga ing he binding ange o he endolysin unca ion GFP-gp74@388 is ano he aluable
pa h o explo e. GFP-gp74@388 can be incuba ed wi h o he
Rhodococcus
species and, con e sely, wi h
o he
Rhodococcus e y h opolis
s ains, ollowing he same p ocedu e de ailed ea lie . Subsequen ly, he
samples can be obse ed unde a luo escence mic oscope o assess bo h he speci ici y and sensi i i y
o binding.
Gi en ha his s udy ocuses on de eloping an inno a i e me hod o de ec ing
R. e y h opolis
using i al p o eins, i is also wo h explo ing he po en ial o u ilizing phage ail ibe RBPs. These p o eins
a e esponsible o he speci ici y o he phage o i s hos bac e ium du ing he ini ial con ac . Addi ionally,
ail ibe s ha e been p e iously explo ed as biosenso s o whole cell de ec ion and can be a aluable
op ion o de ec ing
R. e y h opolis
as well, especially when coupled o GFP.

De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
52
7 Re e ences
Abdel ahman, Fa ma, Maheswa an Easwa an, Oluwasegun I. Da amola, Sama Ragab, S ephanie Lynch, Tolulope J. Oduselu,
Fazal Mehmood Khan, e al. 2021. “Phage-Encoded Endolysins.”
An ibio ics
. MDPI AG.
h ps://doi.o g/10.3390/an ibio ics10020124.
Acke mann, H. W. 2007. “5500 Phages Examined in he Elec on Mic oscope.”
A chi es o Vi ology
152 (Feb ua y): 227–43.
h ps://doi.o g/10.1007/s00705-006-0849-1.
Acke mann, Hans W. 2009. “Phage Classi ica ion and Cha ac e iza ion.” In
Bac e iophages: Me hods and P o ocols
, edi ed
by Ma ha R.J. Clokie and And ew M. K opinski, 501:127–40. Me hods in Molecula Biology. To owa, NJ: Humana
P ess. h ps://doi.o g/10.1007/978-1-60327-164-6.
Al schup, S ephen F, Wa en Gish, Webb Mille , Eugene W Mye s, and Da id J Lipman. 1990. “Basic Local Alignmen Sea ch
Tool.”
J. Mol. Biol
. Vol. 215.
Auza , Isabelle, Anja D öge, F ank Weise, Rudi Lu z, and Paulo Ta a es. 2008. “O igin and Func ion o he Two Majo Tail
P o eins o Bac e iophage SPP1.”
Molecula Mic obiology
70 (3): 557–69. h ps://doi.o g/10.1111/j.1365-
2958.2008.06435.x.
Aze edo, Joana, and I. W. Su he land. 2008. “The Use o Phages o he Remo al o In ec ious Bio ilms.”
Cu en
Pha maceu ical Bio echnology
9: 261–66.
Aze edo, A.M., and M.R. Ai es-Ba os. 2017. “Fundamen als o Biological P ocesses.” In
Cu en De elopmen s in
Bio echnology and Bioenginee ing
: Founda ions o Bio echnology and Bioenginee ing
, edi ed by Ashok Pandey and Jose
An onio Cou o Teixei a, 187–237. Else ie .
Baba, Hisashi, Toshi Nada, Kiyo umi Ohkusu, Takayuki Ezaki, Yoshino i Hasegawa, and Da id L. Pa e son. 2009. “Fi s Case
o Bloods eam In ec ion Caused by Rhodococcus E y h opolis.”
Jou nal o Clinical Mic obiology
47 (8): 2667–69.
h ps://doi.o g/10.1128/JCM.00294-09.
Balaban, Cecilia Lucía, C is ian Alejand o Suá ez, Ca ina And ea Boncompain, Na alia Pe essu i-Bacci, Edua do Augus o
Cecca elli, and Héc o Rica do Mo bidoni. 2022. “E alua ion o Fac o s In luencing Exp ession and Ex ac ion o
Recombinan Bac e iophage Endolysins in Esche ichia Coli.”
Mic obial Cell Fac o ies
21 (1).
h ps://doi.o g/10.1186/s12934-022-01766-9.
Ba eman, Alex, Ewan Bi ney, Lo enzo Ce u i, Richa d Du bin, Lau ence E wille , Sean R Eddy, Sam G i i hs-Jones, Ke in L
Howe, Mhai i Ma shall, and E ik L L Sonnhamme . 2002. “The P am P o ein Families Da abase.”
Nucleic Acids
Resea ch
30 (1): 276–80. h ps://pubmed.ncbi.nlm.nih.go /11752314/.
Ba eman, Alex, Ewan Bi ney, Richa d Du bin, Sean R Eddy, Ke in L Howe, and E ik L L Sonnhamme . 2000. “The P am
P o ein Families Da abase.”
Nucleic Acids Resea ch
28 (1): 263–66.
h ps://www. esea chga e.ne /publica ion/38095937_The_P am_p o ein_ amily’s_da abase.
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
53
Ba ino ic, S e en, Fla ia Wasse , Sa ah A. Knowle , Daniel T.F. Rice, Cassand a R. S an on, Jayson Rose, Joseph Tucci, e al.
2019. “Bac e iophages in Na u al and A i icial En i onmen s.”
Pa hogens
. MDPI AG.
h ps://doi.o g/10.3390/pa hogens8030100.
Baya , Fe esh eh, Tohid F. Dida , and Zeinab Hosseinidous . 2021. “Eme ging In es iga o Se ies: Bac e iophages as Nano
Enginee ing Tools o Quali y Moni o ing and Pa hogen De ec ion in Wa e and Was ewa e .”
En i onmen al Science:
Nano
. Royal Socie y o Chemis y. h ps://doi.o g/10.1039/d0en00962h.
Beaman, Blaine, S ephen Mo ing, and Thuioshi Ioneda. 1988. “E ec o G ow h S age on Mycolic Acid S uc u e in Cell Walls
o Noca dia As e oides GUH-2.”
JOURNAL OF BACTERIOLOGY
170 (3): 1137–42. h ps://jou nals.asm.o g/jou nal/jb.
Bell, K S, J C Philp, D W J Aw, and N Ch is o i. 1998. “The Genus Rhodococcus.”
Jou nal o Applied Mic obiology
85: 195–
210.
Bocano a, Lucia, Michal Psenko, Im ich Ba ák, No a Halgaso a, Hana D aho ska, and Gab iela Buko ska. 2022. “A No el
Phage-Encoded Endolysin EN534-C Ac i e agains Clinical S ain S ep ococcus Agalac iae GBS.”
Jou nal o
Bio echnology
359 (No embe ): 48–58. h ps://doi.o g/10.1016/j.jbio ec.2022.09.016.
B ie s, Y., M. Walmagh, and R. La igne. 2011. “Use o Bac e iophage Endolysin EL188 and Ou e Memb ane Pe meabilize s
agains Pseudomonas Ae uginosa.”
Jou nal o Applied Mic obiology
110 (3): 778–85. h ps://doi.o g/10.1111/j.1365-
2672.2010.04931.x.
Cappelle i, Ma ina, Jessica Zampolli, Pa izia Di Genna o, and Da ide Zannoni. 2019. “Genomics o Rhodococcus.” In
Biology
o Rhodococcus
, edi ed by Héc o M. Al a ez, 2nd ed., 16:23–60. Sp inge Na u e Swi ze land AG.
h ps://doi.o g/10.1007/978-3-030-11461-9_2.
Ca , Emma L., Ka h yn Eales, Jacques Soddell, and Robe J. Se iou . 2005. “Imp o ed Pe meabiliza ion P o ocols o
Fluo escence in Si u Hyb idiza ion (FISH) o Mycolic-Acid-Con aining Bac e ia Found in Foams.”
Jou nal o
Mic obiological Me hods
61 (1): 47–54. h ps://doi.o g/10.1016/j.mime .2004.10.023.
Ca alho, Ca la C.C.R. de, Ma in A. Fische , Sand a Ki s en, Bi gi Wü z, Lukas Y. Wick, and He mann J. Heipiepe . 2016.
“Adap i e Response o Rhodococcus Opacus PWD4 o Sal and Phenolic S ess on he Le el o Mycolic Acids.”
AMB
Exp ess
6 (1). h ps://doi.o g/10.1186/s13568-016-0241-9.
Ca alho, Ca la C.C.R. De and M. Manuela R. Da Fonseca. 2005. “The Rema kable Rhodococcus E y h opolis.”
Applied
Mic obiology and Bio echnology
67 (6): 715–26. h ps://doi.o g/10.1007/s00253-005-1932-3.
Ca alão, Ma ia João, Ca a ina Milho, Filipa Gil, José Moniz-Pe ei a, and Madalena Pimen el. 2011. “A Second Endolysin Gene
Is Fully Embedded In-F ame wi h he LysA Gene o Mycobac e iophage Ms6.”
PLoS ONE
6 (6).
h ps://doi.o g/10.1371/jou nal.pone.0020515.
Ca alão, Ma ia João, and Madalena Pimen el. 2018. “Mycobac e iophage Lysis Enzymes: Ta ge ing he Mycobac e ial Cell
En elope.”
Vi uses
10 (8). h ps://doi.o g/10.3390/ 10080428.
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
54
Chan, Benjamin K., S ephen T. Abedon, and Ca he ine Loc-Ca illo. 2013. “Phage Cock ails and he Fu u e o Phage The apy.”
Fu u e Mic obiology
8 (6): 769–83. h ps://doi.o g/10.2217/ mb.13.47.
Chang, Yoonjee, Minsik Kim, and Sang yeol Ryu. 2017. “Cha ac e iza ion o a No el Endolysin LysSA11 and I s U ili y as a
Po en Biocon ol Agen agains S aphylococcus Au eus on Food and U ensils.”
Food Mic obiology
68 (Decembe ): 112–
20. h ps://doi.o g/10.1016/j. m.2017.07.004.
Clokie, Ma ha R.J., And ew D. Milla d, And ey V. Le a o , and Shaun Heaphy. 2011. “Phages in Na u e.”
Bac e iophage
1
(1): 31–45. h ps://doi.o g/10.4161/bac .1.1.14942.
Cos a, So ia, And é Almeida, An ónio Cas o, and Lucília Domingues. 2014. “Fusion Tags o P o ein Solubili y, Pu i ica ion,
and Immunogenici y in Esche ichia Coli: The No el Fh8 Sys em.”
F on ie s in Mic obiology
. F on ie s Resea ch
Founda ion. h ps://doi.o g/10.3389/ micb.2014.00063.
Cos a, Susana P., Nicolina M. Dias, Luís D.R. Melo, Joana Aze edo, Síl io B. San os, and Ca la M. Ca alho. 2020. “A No el
Flow Cy ome y Assay Based on Bac e iophage-De i ed P o eins o S aphylococcus De ec ion in Blood.”
Scien i ic
Repo s
10 (1). h ps://doi.o g/10.1038/s41598-020-62533-7.
Council o he Eu opean Communi ies. 1991. “Council Di ec i e 91/271/EEC o 21 May 1991 Conce ning U ban Was ewa e
T ea men .”
O icial Jou nal o he Eu opean Communi ies
, 1–13.
Council o he Eu opean Union. 2014. “Council Di ec i e 91/271/EEC o 21 May 1991 Conce ning U ban Was ewa e
T ea men (Consolida ed Ve sion),” Janua y, 1–18. h ps://eu -lex.eu opa.eu/legal-
con en /EN/TXT/?u i=CELEX%3A01991L0271-20140101.
Da enpo , R J, and T P Cu is. 2002. “A e Filamen ous Mycola a Impo an in Foaming?”
Wa e Science and Technology
46:
529–33. h ps://iwaponline.com/ws /a icle-pd /46/1-2/529/476876/529.pd .
Da enpo , Russell J, Thomas P Cu is, Michael Good ellow, Fiona M S ainsby, and Ma c Bingley. 2000. “Quan i a i e Use o
Fluo escen in Si u Hyb idiza ion o Examine Rela ionships be ween Mycolic Acid-Con aining Ac inomyce es and
Foaming in Ac i a ed Sludge Plan s.”
Applied and En i onmen al Mic obiology
66 (3): 1158–66.
h ps://jou nals.asm.o g/jou nal/aem.
Da enpo , Russell J, James N Ellio , Tom P Cu is, and John Up on. 1998. “In Si u De ec ion o Rhodococci Associa ed wi h
Ac i a ed Sludge Foams.”
An onie an Leeuwenhoek Jou nal o Mic obiology
74: 41–48.
Denyes, Jenna M, Ma hew Dunne, S anisla a S eine , Maximilian Mi el ie haus, Agnes Weiss, He be Schmid , Jochen
Klumpp, Ma in J Loessne , and Johanna Bjö k o h. 2017. “Modi ied Bac e iophage S16 Long Tail Fibe P o eins o
Rapid and Speci ic Immobiliza ion and De ec ion o Salmonella Cells.”
Applied and En i onmen al Mic obiology
.
h ps://doi.o g/10.1128/AEM.
Domańska, Magdalena, Ramona Riedel, Ramona Kuhn, Janusz Łomo owski, and Ewa S ańczyk. 2014. “FISH Me hod o
Iden i ica ion o Mic obes in Was ewa e Dis ibu ion Sys ems.”
En i onmen P o ec ion Enginee ing
, 1–13.
h ps://doi.o g/10.5277//epel40312.
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
55
D ulis-Kawa, Zuzanna, G azyna Majkowska-Sk obek, and Ba ba a Maciejewska. 2015. “Bac e iophages and Phage-De i ed
P o eins-Applica ion App oaches.”
Cu en Medicinal Chemis y
22: 1757–73.
Eks e , Alex, Issayas T Lemma, Dale Ih ke, Kingsley Okeke, San Jose, and San a Cla a. 2010. “Polyme Addi ion Combined
wi h Rapid Dec ease in Solids Re en ion Time Is an E ec i e Noca dia Foam Con ol Me hod.” In
Wa e En i onmen
Fede a ion
, 1101–9. h ps://www. esea chga e.ne /publica ion/341598609.
Eliaz, Noam, Elio a Z. Ron, Michael Gozin, Sa a Younge , D o a Bi an, and Noam Tal. 2018. “Mic obial Deg ada ion o Epoxy.”
Ma e ials
11 (11). h ps://doi.o g/10.3390/ma11112123.
Engelha -S aub, Selina, Philipp Ca elius, Fabian Hölzl, Ma ina Haack, Dania Awad, Thomas B ueck, and No be Mehlme .
2022. “E ec s o Ligh on G ow h and Me abolism o Rhodococcus E y h opolis.”
Mic oo ganisms
10 (8).
h ps://doi.o g/10.3390/mic oo ganisms10081680.
Engelha -S aub, Selina, Ma ina Haack, Dania Awad, Thomas B ueck, and No be Mehlme . 2023. “Op imiza ion o
Rhodococcus E y h opolis JCM3201T Nu ien Media o Imp o e Biomass, Lipid, and Ca o enoid Yield Using Response
Su ace Me hodology.”
Mic oo ganisms
11 (9): 2147. h ps://doi.o g/10.3390/mic oo ganisms11092147.
Eskanda i, Vajiheh. 2020. “An Imp o ed Me hod o Induc ion o Compe ency in Esche ichia Coli DH5α.”
A chi es o
Pha macy P ac ice
11 (3): 23–26.
h ps://a chi epp.com/s o age/models/a icle/Bcem7M3nV4V4OGYo0 3M3AQqO2kG03yZmwClObdo6dGpaud15Gq
9Z4MuCBu/an-imp o ed-me hod- o -induc ion-o -compe ency-in-esche ichia-coli-dh5.pd .
Eu opean Commission. 2022. “P oposal o a Di ec i e o he Eu opean Pa liamen and o he Council Conce ning U ban
Was ewa e T ea men (Recas ).” B ussels: Eu opean Pa liamen and Council o he Eu opean Union. h ps://eu -
lex.eu opa.eu/legal-con en /EN/TXT/?u i=CELEX:52022PC0541.
Eu opean Economic and Social Commi ee. 2023. “Opinion o he Eu opean Economic and Social Commi ee on he P oposal
o a Di ec i e o he Eu opean Pa liamen and o he Council Conce ning U ban Was ewa e T ea men .”
O icial Jou nal
o he Eu opean Union
, Ap il, 1–6. h ps://eu -lex.eu opa.eu/legal-con en /EN/TXT/PDF/?u i=CELEX:52022AE5433.
Eu opean Pa liamen , and Council o he Eu opean Union. 2000. “Di ec i e 2000/60/EC o 23 Oc obe 2000 Es ablishing a
F amewo k o Communi y Ac ion in he Field o Wa e Policy.”
O icial Jou nal o he Eu opean Communi ies
, 1–72.
Fe nandes, So ia, and Ca los São-José. 2018. “Enzymes and Mechanisms Employed by Tailed Bac e iophages o B each he
Bac e ial Cell Ba ie s.”
Vi uses
10 (8). h ps://doi.o g/10.3390/ 10080396.
Fische i, Vincen A. 2010. “Bac e iophage Endolysins: A No el An i-In ec i e o Con ol G am-Posi i e Pa hogens.”
In e na ional Jou nal o Medical Mic obiology
300 (6): 357–62. h ps://doi.o g/10.1016/j.ijmm.2010.04.002.
F ancis, Dana M., and Rebecca Page. 2010. “S a egies o Op imize P o ein Exp ession in E. Coli.”
Cu en P o ocols in P o ein
Science
. h ps://doi.o g/10.1002/0471140864.ps0524s61.
Ge a di, Michael H. 2006.
Was ewa e Bac e ia
. Edi ed by Michael H. Ge a di. Hoboken, New Je sey: John Wiley & Sons.
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
56
Gómez-To es, Na alia, Ma hew Dunne, Sonia Ga de, Rob Meije s, A jan Na bad, Ma a Á ila, and Melinda J. Maye . 2018.
“De elopmen o a Speci ic Fluo escen Phage Endolysin o in Si u De ec ion o Clos idium Species Associa ed wi h
Cheese Spoilage.”
Mic obial Bio echnology
11 (2): 332–45. h ps://doi.o g/10.1111/1751-7915.12883.
Go o eanu, R, D Seghe s, I Nopens, B De Cle cq, H Sa eyn, C Capalozza, P Van De Mee en, W Ve s ae e, E Top, and P A
Van olleghem. 2003. “Linking Floc S uc u e and Se ling P ope ies o Ac i a ed Sludge Popula ion Dynamics in an
SBR.”
Wa e Science and Technology
47 (12): 9–18. h ps://iwaponline.com/ws /a icle-
pd /47/12/9/422366/9.pd .
G ay, N. F. 2004.
Biology o Was ewa e T ea men
. 2nd ed. London: Impe ial College P ess.
G ay, N.F. 2010.
Wa e Technology: An In oduc ion o En i onmen al Scien is s and Enginee s
. 3 d ed. Else ie L d.
h ps://www.sciencedi ec .com/science/a icle/pii/B9781856177054000307.
Guo, Feng, Zhi Ping Wang, Ke Yu, and T. Zhang. 2015. “De ailed In es iga ion o he Mic obial Communi y in Foaming Ac i a ed
Sludge Re eals No el Foam Fo me s.”
Scien i ic Repo s
5 (Janua y). h ps://doi.o g/10.1038/s ep07637.
Guo, Feng, and Tong Zhang. 2013. “Biases du ing DNA Ex ac ion o Ac i a ed Sludge Samples Re ealed by High Th oughpu
Sequencing.”
Applied Mic obiology and Bio echnology
97 (10): 4607–16. h ps://doi.o g/10.1007/s00253-012-4244-
4.
Ha, Eunsu, Bokyung Son, and Sang yeol Ryu. 2018. “Clos idium Pe ingens Vi ulen Bac e iophage CPS2 and I s
The mos able Endolysin LysCPS2.”
Vi uses
10 (5). h ps://doi.o g/10.3390/ 10050251.
I shina, I ina, G igo y Bazhu in, and Elena Tyumina. 2022. “Rhodococcus S ains as a Good Bio ool o Neu alizing
Pha maceu ical Pollu an s and Ob aining The apeu ically Valuable P oduc s: Th ough he Pas in o he Fu u e.”
F on ie s
in Mic obiology
13 (Sep embe ). h ps://doi.o g/10.3389/ micb.2022.967127.
Jassim, Sabah A.A., Richa d G. Limoges, and Hassan El-Cheikh. 2016. “Bac e iophage Biocon ol in Was ewa e T ea men .”
Wo ld Jou nal o Mic obiology and Bio echnology
32 (4). h ps://doi.o g/10.1007/s11274-016-2028-1.
Jenkins, Da id, Michael G. Richa d, and Glen T. Daigge . 2004.
Manual on he Causes and Con ol o Ac i a ed Sludge Bulking,
Foaming, and O he Solids Sepa a ion P oblems
. 3 d ed. Lewis Publishe s.
Jenkins, Da id, and Ji i Wanne , eds. 2014.
Ac i a ed Sludge - 100 Yea s and Coun ing
. IWA Publishing.
Jones, Amanda L., and Michael Good ellow. 2015. “Rhodococcus.” In
Be gey’s Manual o Sys ema ics o A chaea and
Bac e ia
, 1–50. Wiley. h ps://doi.o g/10.1002/9781118960608.gbm00033.
Kashani, Hamed Haddad, Ma hias Schmelche , Hamed Sabzalipoo , Elahe Seyed Hosseini, and Rez an Moni i. 2018.
“Recombinan Endolysins as Po en ial The apeu ics agains An ibio ic-Resis an S aphylococcus Au eus: Cu en S a us
o Resea ch and No el Deli e y S a egies.”
Clinical Mic obiology Re iews
31 (1): 1–26. h ps://doi.o g/10.
K agelund, Ca oline, Zane a Remeso a, Jeppe Lund Nielsen, T ine Rolighed Thomsen, Ka h yn Eales, Robe Se iou , Ji i
Wanne , and Pe Halkjæ Nielsen. 2007. “Ecophysiology o Mycolic Acid-Con aining Ac inobac e ia (Mycola a) in

De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
57
Ac i a ed Sludge Foams.”
FEMS Mic obiology Ecology
61 (1): 174–84. h ps://doi.o g/10.1111/j.1574-
6941.2007.00324.x.
Kubo a, Kengo. 2013. “CARD-FISH o En i onmen al Mic oo ganisms: Technical Ad ancemen and Fu u e Applica ions.”
Mic obes and En i onmen s
. h ps://doi.o g/10.1264/jsme2.ME12107.
La kin, Michael J., Leonid A. Kulako , and Ch is ophe C.R. Allen. 2005. “Biodeg ada ion and Rhodococcus - Mas e s o
Ca abolic Ve sa ili y.”
Cu en Opinion in Bio echnology
16 (3 SPEC. ISS.): 282–90.
h ps://doi.o g/10.1016/j.copbio.2005.04.007.
La kin, Michael J, René De Mo , Leonid A Kulako , and Is án Nagy. 1998. “Applied Aspec s o Rhodococcus Gene ics.”
An onie an Leeuwenhoek
74: 133–53.
Lemme , Hilde, and Raine M. K oppens ed. 1984. “Chemo axonomy and Physiology o Some Ac inomyce es Isola ed om
Scumming Ac i a ed Sludge.”
Sys ema ic and Applied Mic obiology
5 (1): 124–35. h ps://doi.o g/10.1016/S0723-
2020(84)80057-0.
Liu, He, Zhen Hu, Mengyang Li, Yi Yang, Shuguang Lu, and Xiancai Rao. 2023. “The apeu ic Po en ial o Bac e iophage
Endolysins o In ec ions Caused by G am-Posi i e Bac e ia.”
Jou nal o Biomedical Science
. NLM (Medline).
h ps://doi.o g/10.1186/s12929-023-00919-1.
Loessne , Ma in J. 2005. “Bac e iophage Endolysins - Cu en S a e o Resea ch and Applica ions.”
Cu en Opinion in
Mic obiology
8 (4): 480–87. h ps://doi.o g/10.1016/j.mib.2005.06.002.
Loessne , Ma in J., Ka l K ame , F ank Ebel, and Sieg ied Sche e . 2002. “C-Te minal Domains o Lis e ia Monocy ogenes
Bac e iophage Mu ein Hyd olases De e mine Speci ic Recogni ion and High-A ini y Binding o Bac e ial Cell Wall
Ca bohyd a es.”
Molecula Mic obiology
44 (2): 335–49. h ps://doi.o g/10.1046/j.1365-2958.2002.02889.x.
Loosd ech , Ma k C.M., An onio M. Ma in, and G. Ekama. 2020. “Bulking Sludge.” In
Biological Was ewa e T ea men
P inciples, Modelling and Design
, edi ed by G. Chen, M. Loosd ech , G. Ekama, and D. B djano ic, 2nd ed., 475–96.
IWA Publishing.
los Reyes III, F ancis de. 2010. “Foam in Was ewa e T ea men Facili ies.” In
Handbook o Hyd oca bon and Lipid
Mic obiology
, edi ed by Kenne h N. Timmis, 2401–11. Sp inge ‐Ve lag Be lin Heidelbe g. www.sp inge link.com.
Macnaugh on, S.J., A.G. O’Donnelll, and T.M. Embley. 1994. “Pe meabiIiza ion o Mycolic Acid-Con aining Ac inomyce es o
in Si u Hyb idiza ion wi h Luo escen ly Labelled Oligonucleo ide P obes.”
Mic obiology
140: 2859–65.
Madei a, Fábio, Young Mi Pa k, Joon Lee, Nicola Buso, Tame Gu , Nandana Madhusoodanan, P asad Basu ka , e al. 2019.
“The EMBL-EBI Sea ch and Sequence Analysis Tools APIs in 2019.”
Nucleic Acids Resea ch
47 (W1): W636–41.
h ps://doi.o g/10.1093/na /gkz268.
Ma akchi, Hedia, Ma ie An oine e Lanéelle, and Mamadou Da é. 2014. “Mycolic Acids: S uc u es, Biosyn hesis, and
Beyond.”
Chemis y and Biology
21 (1): 67–85. h ps://doi.o g/10.1016/j.chembiol.2013.11.011.
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
58
Mesqui a, Daniela P., A. Luís Ama al, and Eugénio C. Fe ei a. 2013. “Ac i a ed Sludge Cha ac e iza ion h ough Mic oscopy:
A Re iew on Quan i a i e Image Analysis and Chemome ic Techniques.”
Analy ica Chimica Ac a
802 (No embe ): 14–
28. h ps://doi.o g/10.1016/j.aca.2013.09.016.
Mi ani, Yasuo, Xian Ying Meng, Yoichi Kamaga a, and Tomohi o Tamu a. 2005. “Cha ac e iza ion o L sA om Rhodococcus
E y h opolis, an Enzyme wi h Glu amine Amido ans e ase Ac i i y.”
Jou nal o Bac e iology
187 (8): 2582–91.
h ps://doi.o g/10.1128/JB.187.8.2582-2591.2005.
Mi al, A un. 2011. “Biology Was ewa e T ea men .”
Wa e Today
, Augus , 32–44.
Mülle , Elisabe h, Ma gi Schade, and Hilde Lemme . 2007. “Filamen ous Scum Bac e ia in Ac i a ed Sludge Plan s: De ec ion
and Iden i ica ion Quali y by Con en ional Ac i a ed Sludge Mic oscopy e sus Fluo escence In Si u Hyb idiza ion.”
Wa e En i onmen Resea ch
79 (11): 2274–86. h ps://doi.o g/10.2175/106143007x183943.
Mu ay, Ellen, Lo aine A. D ape , R. Paul Ross, and Colin Hill. 2021. “The Ad an ages and Challenges o Using Endolysins in
a Clinical Se ing.”
Vi uses
13 (4). h ps://doi.o g/10.3390/ 13040680.
Nai , Gokul, and Vikas Jain. 2020. “Sepa a ion o Mycobac e ium Smegma is F om a Mixed Cul u e Using he Cell Wall Binding
Domain o D29 Mycobac e iophage Endolysin.”
F on ie s in Mic obiology
11 (June).
h ps://doi.o g/10.3389/ micb.2020.01119.
Naza i, Ma eus To es, Vi iane Simon, B una S iede Machado, La issa C es ani, Gio ana Ma chezi, Gus a o Concola o,
Valdeci Fe a i, Luciane Ma ia Colla, and Je e son S e anello Piccin. 2022. “Rhodococcus: A P omising Genus o
Ac inomyce es o he Bio emedia ion o O ganic and Ino ganic Con aminan s.”
Jou nal o En i onmen al Managemen
323 (Decembe ). h ps://doi.o g/10.1016/j.jen man.2022.116220.
Nikaido, H. 1992. “Po ins and Speci ic Channels o Bac e ial Ou e Memb anes.”
Molecula Mic obiology
6 (4): 435–42.
h ps://doi.o g/10.1111/j.1365-2958.1992. b01487.x.
Ni ami, T., and S. Ba ino ic. 2022. “Recen Ad ances in Unde s anding he Ecology o he Filamen ous Bac e ia Responsible
o Ac i a ed Sludge Bulking.”
Le e s in Applied Mic obiology
. John Wiley and Sons Inc.
h ps://doi.o g/10.1111/lam.13634.
Oechslin, F ank, Xiaojun Zhu, Moi a B. Dion, Rong Shi, and Syl ain Moineau. 2022. “Phage Endolysins A e Adap ed o Speci ic
Hos s and A e E olu iona ily Dynamic.”
PLoS Biology
20 (8). h ps://doi.o g/10.1371/jou nal.pbio.3001740.
Oli ei a, Ana, Ma a Lei e, Leon D. Kluskens, Síl io B. San os, Luís D.R. Melo, Joana Aze edo, and Raymond Schuch. 2015.
“The Fi s Paenibacillus La ae Bac e iophage Endolysin (PlyPl23) wi h High Po en ial o Con ol Ame ican Foulb ood.”
PLoS ONE
10 (7). h ps://doi.o g/10.1371/jou nal.pone.0132095.
Oli ei a, C., T.Q. Aguia , and Lucilia Domingues. 2017. “P inciples o Gene ic Enginee ing.” In
Cu en De elopmen s In
Bio echnology and Bioenginee ing: Founda ions o Bio echnology and Bioenginee ing
, edi ed by Ashok Pandey and Jose
An onio Cou o Teixei a, 1–283. Ams e dam: Else ie .
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
59
Oli ei a, Hugo, Luís D. R. Melo, Síl io B. San os, F anklin L. Nób ega, Eugénio C. Fe ei a, Nuno Ce ca, Joana Aze edo, and
Leon D. Kluskens. 2013. “Molecula Aspec s and Compa a i e Genomics o Bac e iophage Endolysins.”
Jou nal o
Vi ology
87 (8): 4558–70. h ps://doi.o g/10.1128/j i.03277-12.
Payne, Kimbe ly M., and G aham F. Ha ull. 2012. “Mycobac e iophage Endolysins: Di e se and Modula Enzymes wi h
Mul iple Ca aly ic Ac i i ies.”
PLoS ONE
7 (3). h ps://doi.o g/10.1371/jou nal.pone.0034052.
Pe o ski, S., S. Ba ino ic, J. J.A. Rose, and R. J. Se iou . 2022. “Biological Con ol o P oblema ic Bac e ial Popula ions
Causing Foaming in Ac i a ed Sludge Was ewa e T ea men Plan s—Phage The apy and Beyond.”
Le e s in Applied
Mic obiology
75 (4): 776–84. h ps://doi.o g/10.1111/lam.13742.
Pe o ski, S e e, Zoe A. Dyson, Eben S. Quill, Simon J. McIl oy, Daniel Tille , and Robe J. Se iou . 2011. “An Examina ion
o he Mechanisms o S able Foam Fo ma ion in Ac i a ed Sludge Sys ems.”
Wa e Resea ch
45 (5): 2146–54.
h ps://doi.o g/10.1016/j.wa es.2010.12.026.
Pe o ski, S e e, and Robe Se iou . 2018. “Ac i a ed Sludge Foaming: Can Phage The apy P o ide a Con ol S a egy?”
Mic obiology Aus alia
39 (3): 162–64. h ps://doi.o g/10.1071/MA18048.
Reisoglu, Şuheda, and Se can Aydin. 2023. “Bac e iophages as a P omising App oach o he Biocon ol o An ibio ic Resis an
Pa hogens and he Recons uc ion o Mic obial In e ac ion Ne wo ks in Was ewa e T ea men Sys ems: A Re iew.”
Science o he To al En i onmen
. Else ie B.V. h ps://doi.o g/10.1016/j.sci o en .2023.164291.
Rocha, Rui, Ca ina Almeida, and Nuno F. Aze edo. 2018. “In luence o he Fixa ion/Pe meabiliza ion S ep on Pep ide Nucleic
Acid Fluo escence in Si u Hyb idiza ion (PNA-FISH) o he De ec ion o Bac e ia.”
PLoS ONE
13 (5).
h ps://doi.o g/10.1371/jou nal.pone.0196522.
Rosse i, Simona, C. Le an esi, and Val e Tandoi. 2017. “The Mic obiology o he Ac i a ed Sludge P ocess.” In
Ac i a ed
Sludge Sepa a ion P oblems Theo y, Con ol Measu es, P ac ical Expe iences
, edi ed by Simona Rosse i, Val e Tandoi,
and Ji i Wanne , 2nd ed., 21–51. London: IWA Publishing.
Rosse i, Simona, Ma ia C. Tomei, Pe H. Nielsen, and Val e Tandoi. 2005. “‘Mic o h ix Pa icella’, a Filamen ous Bac e ium
Causing Bulking and Foaming in Ac i a ed Sludge Sys ems: A Re iew o Cu en Knowledge.”
FEMS Mic obiology
Re iews
. h ps://doi.o g/10.1016/j. ems e.2004.09.005.
Salmond, Geo ge P.C., and Pe e C. Fine an. 2015. “A Cen u y o he Phage: Pas , P esen and Fu u e.”
Na u e Re iews
Mic obiology
. Na u e Publishing G oup. h ps://doi.o g/10.1038/n mic o3564.
San os, Síl io B., Ana Ri a Cos a, Ca la Ca alho, F anklin L. Nób ega, and Joana Aze edo. 2018. “Exploi ing Bac e iophage
P o eomes: The Hidden Bio echnological Po en ial.”
T ends in Bio echnology
36 (9): 966–84.
h ps://doi.o g/10.1016/j. ib ech.2018.04.006.
San os, Síl io B., Ana Oli ei a, Luís D.R. Melo, and Joana Aze edo. 2019. “Iden i ica ion o he Fi s Endolysin Cell Binding
Domain (CBD) Ta ge ing Paenibacillus La ae.”
Scien i ic Repo s
9 (1). h ps://doi.o g/10.1038/s41598-019-39097-
2.
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
60
Schmelche , Ma hias, Da id M. Dono an, and Ma in J. Loessne . 2012. “Bac e iophage Endolysins as No el An imic obials.”
Fu u e Mic obiology
7 (10): 1147–71. h ps://doi.o g/10.2217/ mb.12.97.
Se iou , R.J., and L.L. Blackall. 1999. “In oduc ion o he Mic oo ganisms in Ac i a ed Sludge P ocesses.” In
The Mic obiology
o Ac i a ed Sludge
, edi ed by R. J. Se iou and L. L. Blackall, 1–44. Do d ech : Sp inge Ne he lands.
h ps://doi.o g/10.1007/978-94-011-3951-9.
Sezgin, Mesu , Ma y P Leche alie , and Philip R Ka . 1988. “Isola ion and Iden i ica ion o Ac inomyce es P esen in Ac i a ed
Sludge Scum.”
Wa . Sci. Tech
20 (11): 257–63. h ps://iwaponline.com/ws /a icle-pd /20/11-
12/257/99326/257.pd .
Shen, Kai Sheng, Mei Shu, Meng Xuan Tang, Wen Yu Yang, Shu Chao Wang, Chan Zhong, and Guo Ping Wu. 2022. “Molecula
Cloning, Exp ession and Cha ac e iza ion o a Bac e iophage JN01 Endolysin and I s An ibac e ial Ac i i y agains E.
Coli O157:H7.”
LWT - Food Science and Technology
165 (Augus ). h ps://doi.o g/10.1016/j.lw .2022.113705.
Singhi, Di ya, Aayushi Jain, and P ee i S i as a a. 2016. “Localiza ion o Low Copy Numbe Plasmid PRC4 in Replica ing Rod
and Non-Replica ing Cocci Cells o Rhodococcus E y h opolis PR4.”
PLoS ONE
11 (12).
h ps://doi.o g/10.1371/jou nal.pone.0166491.
Singh i, P iyank, Anki Saneja, Rahul Ahuja, and Amulya K. Panda. 2021. “Solubiliza ion and Re olding o Va ie y o Inclusion
Body P o eins Using a No el Fo mula ion.”
In e na ional Jou nal o Biological Mac omolecules
193 (Decembe ): 2352–
64. h ps://doi.o g/10.1016/j.ijbiomac.2021.11.068.
Soddell, J A, and R J Se iou . 1990. “Mic obiology o Foaming in Ac i a ed Sludge Plan s.”
Jou nal o Applied Bac e iology
69:
145–76.
Son, Bokyung, Minsuk Kong, and Sang yeol Ryu. 2018. “The Auxilia y Role o he Amidase Domain in Cell Wall Binding and
Exoly ic Ac i i y o S aphylococcal Phage Endolysins.”
Vi uses
10 (6). h ps://doi.o g/10.3390/ 10060284.
Spe ling, Ma cos on. 2007.
Was ewa e Cha ac e is ics, T ea men and Disposal
. Vol. 1. London, UK: IWA Publishing.
S one, Edel, Ka ina Campbell, I ene G an , and Oli ia McAuli e. 2019. “Unde s anding and Exploi ing Phage–Hos
In e ac ions.”
Vi uses
. MDPI AG. h ps://doi.o g/10.3390/ 11060567.
S a on, H M, P R B ooks, E L Ca , and R J Se iou . 2003. “E ec s o Cul u e Condi ions on he Mycolic Acid Composi ion
o Isola es o Rhodococcus Spp. om Ac i a ed Sludge Foams.”
Sys ema ic and Applied Mic obiology
, no. 26: 165–71.
h p://www.u ban ische .de/jou nals/sam.
Summe , E. J., M. Liu, J. J. Gill, M. G an , T. N. Chan-Co es, L. Fe guson, C. Janes, e al. 2011. “Genomic and Func ional
Analyses o Rhodococcus Equi Phages ReqiPepy6, ReqiPoco6, ReqiPine5, and ReqiDocB7.”
Applied and En i onmen al
Mic obiology
77 (2): 669–83. h ps://doi.o g/10.1128/AEM.01952-10.
Su cli e, Iain C. 1998. “Cell En elope Composi ion and O ganisa ion in he Genus Rhodococcus *.”
An onie an Leeuwenhoek
74: 49–58.
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
67
Annex III. Bo ine Se um Albumin S anda d Cu e
A p o ein s anda d cu e was es ablished by using he Pie ce™ BCA P o ein Assay Ki (The mo
Scien i ic™, Ca # 23225), bo ine se um albumin s anda ds (500 µg/mL, 1000 µg/mL, and 1500
µg/mL), and plo ing he abso bance alues a 562 nm agains he concen a ions o he p o ein s anda d.
The BSA s anda d cu e was desc ibed by he linea eg ession equa ion: Y = 0.0008 X + 0.0844.
Figu e A 3| Bo ine Se um Albumin (BSA) s anda d calib a ion cu e de e mined using he Pie ce™ BCA P o ein Assay Ki .

De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
68
Annex IV. BLASTp anno a ion o phage Rho1Es genome
Gene
P oduc
P edic ed p o ein [sou ce
o ganism]
Accession
Que y
Co e age
E- alue
Iden i y
gp1
No signi ican simila i y ound
gp2
HNH endonuclease [Rhodococcus
e y h opolis]
UJC80074.1
87%
3.00E-29
55.86%
gp3
No signi ican simila i y ound
gp4
No signi ican simila i y ound
gp5
No signi ican simila i y ound
gp6
No signi ican simila i y ound
gp7
hypo he ical p o ein IX27_18540
[S ep omyces sp. JS01]
KFK87886.1
95%
2.30E-02
27.27%
gp8
No signi ican simila i y ound
gp9
No signi ican simila i y ound
gp10
hypo he ical p o ein, pa ial
[Rhodococcus sp. T9N]
WP_261949514.1
73%
2.00E-05
31.87%
gp11
No signi ican simila i y ound
gp12
No signi ican simila i y ound
gp13
hypo he ical p o ein [Rhodococcus
ascians]
WP_155289245.1
38%
1.00E-08
48.61%
gp14
No signi ican simila i y ound
gp15
No signi ican simila i y ound
gp16
No signi ican simila i y ound
gp17
hypo he ical p o ein [Rhodococcus
qingshengii]
WP_209447659.1
87%
4.00E-08
29.21%
gp18
glucosyl ans e ase [Mycobac e ium
phage Spa ky]
YP_009125468.1
92%
9.00E-41
43.40%
gp19
No signi ican simila i y ound
gp20
glycosyl ans e ase [Mycobac e ium
phage BobaPhe ]
YP_009954892.1
100%
7.00E-159
51.02%
gp21
No signi ican simila i y ound
gp22
hypo he ical p o ein [Rhodococcus
e y h opolis]
WP_214885508.1
100%
0.00E+00
67.07%
gp23
hypo he ical p o ein C8K36_102460
[Rhodococcus sp. OK519]
PTR30608.1
84%
8.00E-04
40.68%
gp24
glu a edoxin-like p o ein N dH
[Zhihengliuella salsuginis]
WP_189351546.1
93%
6.00E-10
39.53%
gp25
hypo he ical p o ein
PBI_PEREGRIN_249 [Rhodococcus
phage Pe eg in]
AWN04074.1
0%
2.00E-06
47.06%
gp26
helix- u n-helix domain-con aining p o ein
[Rhodococcus qingshengii]/helix- u n-
helix domain-con aining p o ein
[Rhodococcus e y h opolis]
QTR98375.1
67%
4.00E-09
48.28%
gp27
me allophosphoes e ase amily p o ein
[Rhodococcus e y h opolis]
MBT2266426.1
91%
7.00E-44
43.15%
gp28
hypo he ical p o ein [Rhodococcus]
WP_210377318.1
96%
1.00E-44
53.61%
gp29
R cB amily p o ein [Rhodococcus
e y h opolis]
WP_214885482.
100%
0.00E+00
68.67%
gp30
No signi ican simila i y ound
gp31
No signi ican simila i y ound
gp32
hypo he ical p o ein I5G95_gp44
[Mycobac e ium phage Bella96]
YP_009952850.1
71%
1.00E-04
39.47%
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
69
gp33
endonuclease VII domain-con aining
p o ein [Rhodococcus sp. AG1013]
WP_114724452.1
96%
5.00E-57
64.29%
gp34
DUF3310 domain-con aining p o ein
[Noca dia a h i idis]
WP_167478534.1
33%
4.00E-07
45.57%
gp35
No signi ican simila i y ound
gp36
single-s anded DNA-binding p o ein
[Rhodococcus sp. P1Y]
WP_121111213.1
88%
1.00E-66
83.61%
gp37
hypo he ical p o ein [Noca dia
xishanensis]
WP_084501476.1
95%
3.00E-12
32.23%
gp38
DnaB-like helicase C- e minal domain-
con aining p o ein [Rhodococcus
qingshengii]
WP_168798870.1
96%
0.00E+00
57.79%
gp39
hypo he ical p o ein hbim_05345
[Mycolicibac e ium mage i ense]
BDY31393.1
93%
6.00E-36
42.21%
gp40
hypo he ical p o ein [De mabac e
hominis]
WP_259899593.1
93%
8.00E-82
51.91%
gp41
HNH endonuclease [P esco ella equi]
NKZ90486.1
87%
3.00E-30
50.00%
gp42
WhiB amily ansc ip ional egula o
[Rhodococcus e y h opolis]
MBT2266402.1
90%
5.00E-07
37.97%
gp43
No signi ican simila i y ound
gp44
hypo he ical p o ein [P esco ella equi]
NKV87456.1
100%
2.00E-10
51.22%
gp45
hypo he ical p o ein [Rhodococcus
e y h opolis]
WP_214885446.1
95%
3.00E-37
54.17%
gp46
hypo he ical p o ein [Glu amicibac e
mish ai]
WP_255165578.1
70%
4.00E-72
55.86%
gp47
hypo he ical p o ein [Noca dia
gipuzkoensis]
WP_233068933.1
96%
6.00E-81
44.44%
gp48
No signi ican simila i y ound
gp49
No signi ican simila i y ound
gp50
No signi ican simila i y ound
gp51
No signi ican simila i y ound
gp52
No signi ican simila i y ound
gp53
hypo he ical p o ein [Rhodococcus
ca e nicola]
WP_155293658.1
74%
6.00E-04
51.02%
gp54
hypo he ical p o ein [Rhodococcus]
WP_210377358.1
74%
9.00E-11
37.37%
gp55
No signi ican simila i y ound
gp56
No signi ican simila i y ound
gp57
No signi ican simila i y ound
gp58
No signi ican simila i y ound
gp59
hypo he ical p o ein [Rhodococcus sp.
T2V]
WP_276141054.1
45%
2.00E-05
37.31%
gp60
hypo he ical p o ein [Rhodococcus
py idini o ans]
WP_269572338.1
95%
9.00E-49
53.12%
gp61
hypo he ical p o ein [Rhodococcus
qingshengii]/hypo he ical p o ein
[Rhodococcus e y h opolis]
WP_209447669.1
38%
8.00E-07
52.17%
gp62
No signi ican simila i y ound
gp63
No signi ican simila i y ound
gp64
No signi ican simila i y ound
gp65
hypo he ical p o ein [Rhodococcus sp.
06-156-3C]
WP_094623469.1
53%
6.00E-05
31.31%
gp66
hypo he ical p o ein RER_22470
[Rhodococcus e y h opolis PR4]
BAH32955.1
78%
5.00E-07
27.61%
gp67
hypo he ical p o ein [Rhodococcus]
WP_076948341.1
87%
1.00E-142
53.60%
gp68
hypo he ical p o ein [Rhodococcus
e y h opolis]
WP_214885563.1
100%
3.00E-34
55.26%
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
70
gp69
ansla ion ini ia ion ac o IF-2 N-
e minal domain-con aining p o ein
[Rhodococcus sp. RCBS9]/hypo he ical
p o ein [Rhodococcus qingshengii]
WP_277377251.1
87%
2.00E-80
79.19%
gp70
hypo he ical p o ein [Rhodococcus
qingshengii]
WP_265154993.1
99%
2.00E-19
42.67%
gp71
hypo he ical p o ein [Rhodococcus sp.
RCBS9]
WP_277377317.1
88%
2.00E-132
89.94%
gp72
hypo he ical p o ein [Rhodococcus
e y h opolis]
WP_214885555.1
100%
1.00E-25
42.55%
gp73
hypo he ical p o ein [Rhodococcus sp.
RCBS9]
WP_277377253.1
82%
7.00E-24
61.04%
gp74
GH25 amily lysozyme [Rhodococcus sp.
BH5]
WP_270009165.1
99%
2.00E-176
59.39%
gp75
DUF2744 domain-con aining p o ein
[Rhodococcus e y h opolis]
MBT2266460.1
94%
9.00E-53
50.84%
gp76
phage ail p o ein [Rhodococcus
e y h opolis]
WP_214885758.1
100%
0.00E+00
65.32%
gp77
phage ail p o ein [Rhodococcus sp.
BH5]
WP_270009162.1
99%
1.00E-83
43.14%
gp78
ape measu e p o ein [unclassi ied
Rhodococcus (in: high G+C G am-
posi i e bac e ia)]
WP_209909395.1
96%
0.00E+00
43.63%
gp79
hypo he ical p o ein BK799_21295
[Rhodococcus sp. D-1]
OMQ31598.1
56%
4.00E-16
47.78%
gp80
hypo he ical p o ein [Rhodococcus sp. D-
1]
WP_076948755.1
80%
3.00E-14
38.46%
gp81
hypo he ical p o ein [Rhodococcus
ca e nicola]
WP_149431171.1
96%
4.00E-80
63.40%
gp82
hypo he ical p o ein [Noca dia e penica]
WP_167488557.1
94%
5.00E-22
35.92%
gp83
hypo he ical p o ein [Rhodococcus
e y h opolis]
WP_214885533.1
88%
5.00E-12
42.50%
gp84
No signi ican simila i y ound
gp85
No signi ican simila i y ound
gp86
hypo he ical p o ein CBI33_22680
[Rhodococcus e y h opolis]
OXM19359.1
88%
8.00E-24
43.70%
gp87
MAG TPA: majo capsid p o ein
[Caudo i ice es sp.]
DAP03051.1
94%
6.00E-111
56.51%
gp88
hypo he ical p o ein [Bi idobac e ium
pseudolongum]
WP_118239788.1
95%
2.00E-15
42.31%
gp89
hypo he ical p o ein [Rhodococcus sp.
BH5]
WP_270009422.1
89%
3.00E-62
44.54%
gp90
Po al p o ein [uncul u ed Caudo i ales
phage]
CAB4152616.1
89%
8.00E-162
56.09%
gp91
e minase [Noca dia pu is]
WP_195124975.1
100%
0.00E+00
56.50%
gp92
hypo he ical p o ein [unclassi ied
Rhodococcus (in: high G+C G am-
posi i e bac e ia)]
WP_209909446.1
93%
1.00E-24
40.87%
gp93
No signi ican simila i y ound
gp94
No signi ican simila i y ound
gp95
No signi ican simila i y ound
gp96
No signi ican simila i y ound
gp97
No signi ican simila i y ound
gp98
No signi ican simila i y ound
gp99
No signi ican simila i y ound
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
71
gp100
hypo he ical p o ein [Mycobac e oides
abscessus]
WP_165701903.1
35%
3.00E-24
62.16%
gp101
No signi ican simila i y ound
gp102
No signi ican simila i y ound
gp103
No signi ican simila i y ound
gp104
No signi ican simila i y ound
gp105
HNH endonuclease [Rhodococcus
e y h opolis]
UJC80074.1
87%
3.00E-29
55.86%
gp106
No signi ican simila i y ound
Annex V. BLASTp anno a ion o phage Rho2Lm genome
Gene
P oduc
P edic ed p o ein [sou ce o ganism]
Accession
Que y
Co e age
E- alue
Iden i y
gp1
hypo he ical p o ein [bac e ium]
NCP67281.1
51%
3E-23
46.86%
gp2
No signi ican simila i y
gp3
hypo he ical p o ein [Rhodococcus
qingshengii]
WP_136472004.1
88%
1E-13
48.15%
gp4
No signi ican simila i y
gp5
ail ibe p o ein [Rhodococcus phage
ReqiPoco6]
YP_009012582.1
82%
2E-77
40.2%
gp6
No signi ican simila i y
gp7
No signi ican simila i y
gp8
No signi ican simila i y
gp9
nuclease [Rhodococcus phage Mbo2]
URG17406.1
99%
4E-126
49%
gp10
hypo he ical p o ein [Mycolicibac e ium
mucogenicum]
WP_082981797.1
83%
6E-05
37.50%
gp11
WhiB amily ansc ip ional egula o
[Acidimic obiaceae bac e ium]
MBT4677385.1
48%
2E-10
44.29%
gp12
holliday junc ion esol ase [Rhodococcus
phage Mbo2]
URG17412.1
92%
5E-34
42.53%
gp13
hypo he ical p o ein [Paludisphae a
hizosphae eae]
WP_165063973.1
75%
3E-03
54.55%
gp14
No signi ican simila i y
gp15
DNA polyme ase III be a subuni
[Rhodococcus phage Mbo2]
URG17414.1
95%
1E-109
43.55%
gp16
No signi ican simila i y
gp17
hypo he ical p o ein [Alcani o ax]
WP_011588931.1
96%
1E-3
38.30%
gp18
RNase H [Rhodococcus phage Mbo2]
URG17419.1
95%
1E-64
52.94%
gp19
hypo he ical p o ein BJD55_gp129
[Go donia phage Y onne as ic]
YP_009301147.1
91%
2E-18
51.22%%
gp20
No signi ican simila i y
gp21
HTH DNA binding p o ein [Go donia phage
O chid]
YP_009274283.1
82%
1E-07
36.67%
gp22
DEAD/DEAH box helicase [Blau ia
massiliensis]
WP_278604158.1
92%
6E-54
31.56%
gp23
No signi ican simila i y ound.
gp24
hypo he ical p o ein
SEA_ROBINSPARKLES_66 [Go donia
phage RobinSpa kles]
AXH46514.1
68%
3E-5
27.4%
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
72
gp25
hypo he ical p o ein Mbo2_055
[Rhodococcus phage Mbo2]
URG17425.1
81%
3E-18
29.21%
gp26
hypo he ical p o ein SEA_CAMERICO_71
[Go donia phage Came ico]
USH45067.1
95%
4E-32
48.57%
gp27
hymidyla e syn hase [Go donia phage
Puppe ]
YP_010058851.1
94%
3E-73
48.5%
gp28
No signi ican simila i y.
gp29
hypo he ical p o ein [P esco ella equi]
NKR30680.1
92%
2E-46
42.86%
gp30
hypo he ical p o ein Mbo2_068
[Rhodococcus phage Mbo2]
URG17438.1
94%
4E-24
31.25%%
gp31
hypo he ical p o ein [Rhodococcus sp.
YH1]
NCL73773.1
79%
1.50E-02
33.33%
gp32
No signi ican simila i y
gp33
No signi ican simila i y.
gp34
No signi ican simila i y
gp35
Xe C-like y osine ecombinase
[Rhodococcus phage Mbo2]
URG17442.1
98%
8E-63
47.21%
gp36
hypo he ical p o ein Mbo2_073
[Rhodococcus phage Mbo2]
URG17443.1
65%
2E-12
31.28%
gp37
No signi ican simila i y.
gp38
No signi ican simila i y
gp39
hypo he ical p o ein DRO61_04915
[Candida us Ba hya chaeo a a chaeon]
RLI49565.1
82%
1E-26
45.54%
gp40
hypo he ical p o ein Mbo2_076
[Rhodococcus phage Mbo2]
URG17446.1
46%
1E-13
33.77%
gp41
hypo he ical p o ein Mbo2_080
[Rhodococcus phage Mbo2]
URG17450.1
95%
2E-10
44.44%
gp42
hypo he ical p o ein [Cellulomonas gil us]
WP_013883356.1
89%
8E-12
67.44%
gp43
No signi ican simila i y .
gp44
Te R/Ac R amily ansc ip ional egula o ,
pa ial [Rhodococcus e y h opolis]
WP_151531283.1
67%
6E-25
35.33%
gp45
No signi ican simila i y
gp46
No signi ican simila i y
gp47
CobT-like cobalamin biosyn hesis p o ein
[Go donia phage Came ico]
USH45088.1
97%
3E-115
32.82%
gp48
No signi ican simila i y.
gp49
No signi ican simila i y
gp50
No signi ican simila i y
gp51
SLOG amily p o ein [Kineospo ia
babensis]
WP_266319667.1
84%
3E-23
45.53%
gp52
No signi ican simila i y.
gp53
No signi ican simila i y
gp54
No signi ican simila i y.
gp55
AAA ATPase [Rhodococcus phage Mbo2]
URG17459.1
98%
2E-169
48.87%
gp56
hypo he ical p o ein Mbo2_090
[Rhodococcus phage Mbo2]
URG17460.1
86%
7E-16
33.77%
gp57
No signi ican simila i y
gp58
hypo he ical p o ein Mbo2_091
[Rhodococcus phage Mbo2]
URG17461.1
90%
1E-21
37.14%
gp59
No signi ican simila i y.
gp60
No signi ican simila i y
gp61
hypo he ical p o ein [Rhodococcus
e y h opolis]
WP_092765820.1
65%
7E-24
51.72%
gp62
No signi ican simila i y.
gp63
hypo he ical p o ein [Mycolicibac e ium
aubagnense]
WP_138233544.1
94%
2E-12
39.39%

De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
73
gp64
hypo he ical p o ein [Mic omonospo a sp.
CB01531]
WP_143194398.1
36%
6E-05
55.81%
gp65
hypo he ical p o ein SEA_DALILPOP_93
[Go donia phage Dalilpop]
WAA19719.1
47%
6E-08
52.38%
gp66
hypo he ical p o ein [Edwa dsiella phage
B_E aM_ET-ABTNL-9]
QFP93539.1
67%
1.80E-02
35.82%
gp67
No signi ican simila i y ound
gp68
hypo he ical p o ein BEN61_gp014
[Go donia phage Rosalind]
YP_009269018.1
48%
3E-28
50.44%
gp69
hypo he ical p o ein [Mycobac e oides
abscessus]
WP_100459412.1
58%
3E-05
44.62%
gp70
hypo he ical p o ein [Mic omonospo a sp.
CB01531]
WP_143194190.1
72%
8E-16
39.06%
gp71
hypo he ical p o ein A5747_13445
[Mycobac e ium sp. IS-836]
OMC55392.1
93%
8E-14
27.85%
gp72
No signi ican simila i y
gp73
No signi ican simila i y
gp74
No signi ican simila i y
gp75
No signi ican simila i y
gp76
No signi ican simila i y.
gp77
No signi ican simila i y
gp78
No signi ican simila i y
gp79
helicase [Go donia phage O chid]
YP_009274228.1
98%
5E-96
32.85%
gp80
No signi ican simila i y
gp81
hypo he ical p o ein BIZ69_gp002
[Go donia phage Jumbo]
YP_009290967.1
92%
1E-03
43.75%
gp82
No signi ican simila i y
gp83
No signi ican simila i y
gp84
No signi ican simila i y
gp85
hypo he ical p o ein [The moca ellispo a
engchongensis]
WP_185054496.1
53%
4E-06
34.15%
gp86
No signi ican simila i y.
gp87
DNA p imase [Rhodococcus phage
ReqiDocB7]
YP_009013895.1
95%
1E-73
43.42%
gp88
No signi ican simila i y
gp89
e minase small subuni [Rhodococcus
phage Mbo2]
URG17371.1
96%
2E-58
30.89%
gp90
e minase la ge subuni [Rhodococcus
phage Mbo2]
URG17372.1
97%
0
61.03%
gp91
No signi ican simila i y
gp92
No signi ican simila i y.
gp93
No signi ican simila i y
gp94
po al p o ein [Rhodococcus phage Mbo2]
URG17378.1
98%
0
59.15%
gp95
hypo he ical p o ein BH761_gp012
[Go donia phage O chid]
YP_009274239.1
68%
2E-05
40.68%
gp96
capsid ma u a ion p o ease [Rhodococcus
phage Mbo2]
URG17380.1
99%
2E-76
39.12%
gp97
capsid deco a ion p o ein [Go donia phage
RobinSpa kles]
AXH46466.1
97%
1E-36
50%
gp98
majo capsid p o ein [Rhodococcus phage
Mbo2]
URG17382.1
95%
3E-126
47.67%
gp99
No signi ican simila i y
gp100
No signi ican simila i y
gp101
head- o- ail connec o p o ein
[Rhodococcus phage Mbo2]
URG17385.1
85%
5E-28
49.32%
De elopmen o an imp o ed me hod o he de ec ion o
Rhodococcus e y h opolis
based on
speci ic i al p o eins
74
gp102
ail comple ion o Neck1 p o ein
[Tsukamu ella phage TIN2]
YP_009204447.1
77%
4E-13
37.12%
gp103
hypo he ical p o ein AU105_gp011
[Go donia phage GMA3]
YP_009188579.1
93%
2E-40
42.94%
gp104
No signi ican simila i y
gp105
majo ail p o ein [Rhodococcus phage
Mbo2]
URG17389.1
99%
3E-143
60.83%
gp106
ail assembly chape one [Rhodococcus
phage ReqiDocB7]
YP_009013811.1
90%
7E-25
37.10%
gp107
TMP chape one [Rhodococcus phage
Mbo2]
URG17391.1
67%
4E-07
57.45%
gp108
ape measu e p o ein [Rhodococcus phage
Mbo2]
URG17392.1
93%
0
41.18%
gp109
mino ail p o ein [Rhodococcus phage
Mbo2]
URG17393.1
97%
0
58.40%
gp110
ail p o ein [Rhodococcus phage
ReqiDocB7]
YP_009013814.1
100%
0
54%
gp111
mino ail p o ein [Go donia phage
Gibbles]
QDK01985.1
32%
1E-19
55%
gp112
DUF1906 domain-con aining p o ein
[unclassi ied Noca dia]
WP_225732396.1
83%
3E-42
41%
gp113
hypo he ical p o ein [Rhodococcus
ascians]
WP_037184836.1
78%
3E-08
36%
gp114
endolysin [Go donia phage Jumbo]
YP_009290995.1
61%
7E-93
68%
gp115
holin [Go donia phage Ghobes]
YP_009281124.1
63%
3E-20
44%
gp116
hypo he ical p o ein [Noca dia a cinica]
WP_195041921.1
89%
5E-10
33%
gp117
hypo he ical p o ein [Ske mania pini o mis]
WP_157079980.1
70%
2E-09
33%
gp118
No signi ican simila i y
gp119
hypo he ical p o ein Mbo2_030
[Rhodococcus phage Mbo2]
URG17400.1
94%
4E-59
37%