Imp o ed bac e ial RNA-seq by Cas9-based deple ion
o ibosomal RNA eads
GIANLUCA PREZZA,
1
TOBIAS HECKEL,
2
SASCHA DIETRICH,
2
CHRISTINA HOMBERGER,
1
ALEXANDER J. WESTERMANN,
1,3,4
and JÖRG VOGEL
1,3,4
1
Helmhol z Ins i u e o RNA-based In ec ion Resea ch (HIRI), Helmhol z Cen e o In ec ion Resea ch (HZI), Wü zbu g, 97080, Ge many
2
Co e Uni Sys ems Medicine, Uni e si y o Wü zbu g, Wü zbu g, 97080, Ge many
3
Ins i u e o Molecula In ec ion Biology (IMIB), Uni e si y o Wü zbu g, Wü zbu g, 97080, Ge many
ABSTRACT
A majo challenge o RNA-seq analysis o gene exp ession is o achie e su icien co e age o in o ma i e non ibosomal
ansc ip s. In euka yo ic samples, his is ypically achie ed by selec i e oligo(dT)-p iming o messenge RNAs o exclude
ibosomal RNA ( RNA) du ing cDNA syn hesis. Howe e , his s a egy is no compa ible wi h p oka yo es in which unc ion-
al ansc ip s a egene ally no polyadenyla ed. Too e come his, we adop ed DASH (deple ion o abundan sequences by
hyb idiza ion), ini ially de eloped o euka yo ic cells, o imp o e bo h he sensi i i y and dep h o bac e ial RNA-seq.
DASH uses he Cas9 nuclease o emo e unwan ed cDNA sequences p io o lib a y ampli ica ion. We epo he design,
e alua ion, and op imiza ion o DASH expe imen s o s anda d bac e ial sho - ead sequencing app oaches, including
so wa e o au oma ed guide RNA (gRNA) design o Cas9-media ed clea age in bac e ial DNA sequences. Using hese
gRNA pools, we e ec i ely emo ed RNA eads (56%–86%) in RNA-seq lib a ies om wo di e en model bac e ia, he
G am-nega i e pa hogen Salmonella en e ica and he anae obic gu commensal Bac e oides he aio aomic on. DASH
wo ks obus ly, e en wi h subnanog am amoun s o inpu RNA. I s e iciency, high sensi i i y, ease o implemen a ion,
and low cos (∼$5 pe sample) ende DASH an a ac i e al e na i e o RNA emo al p o ocols, in pa icula o ma e i-
al-cons ained s udies whe e con en ional ibodeple ion echniques ail.
Keywo ds: bac e ial RNA-seq; DASH; ibosomal RNA; Cas9; CRISPR; Salmonella;Bac e oides
INTRODUCTION
The ad en o high- h oughpu RNA sequencing (RNA-
seq) has e olu ionized he ield o bac e ial RNA biology
(C ouche and Thomson 2010; Hö e al. 2018). RNA-seq
has shown ha bac e ial ansc ip omes, once belie ed
o be simple in e ms o s uc u e and egula ion, can be
almos as complex as hei euka yo ic coun e pa s
(So ek and Cossa 2010), and helped o ealize ha bac e-
ia amply use pos - ansc ip ional con ol o egula e gene
exp ession (Hö e al. 2018). In RNA-seq, he expe imen al
s eps p io o sequencing a e uni e sal and consis mainly
o RNA ex ac ion, enzyma ic diges ion o genomic DNA,
deple ion o ibosomal RNA ( RNA), and con e sion o
he emaining RNA pool in o complemen a y DNA
(cDNA) lib a ies. The emo al o RNA ( ypically ∼90% o
he o al cellula RNA) is impo an as i much inc eases
co e age o messenge RNA (mRNA) and egula o y non-
coding RNA. A s aigh o wa d me hod o a oid RNA
eads in euka yo ic RNA-seq s udies ha nesses oligo(dT)
oligonucleo ides ha anneal o he poly(A) ail o mRNAs
o selec i ely p ime e e se ansc ip ion (RT). Howe e ,
p oka yo ic ansc ip s a e no no mally polyadenyla ed
(D ey us and Regnie 2002), which necessi a es he de el-
opmen o al e na i e RNA emo al s a egies.
The mos popula me hods o RNA deple ion om p o-
ka yo ic samples ollow a “pull-ou ”s a egy whe eby
RNA molecules a e deple ed om a sample wi h comple-
men a y oligonucleo ides coupled o magne ic beads. This
s a egy unde lies se e al comme cial eady- o-use ki s, es-
pecially he popula MICROBExp ess and RiboMinus ki s
(The mo Fishe Scien i ic) as well as he Ribo-Ze o echnol-
ogy (Illumina). While i gene ally achie es excellen esul s
o modelbac e iasuchasEsche ichiacoli, hese ki s a eas-
socia ed wi h bo h, high cos ($60–80 pe sample) and a
4
These au ho s con ibu ed equally o his wo k.
Co esponding au ho s: alexande .wes e mann@uni-wue zbu g.
de, [email p o ec ed]
A icle is online a h p://www. najou nal.o g/cgi/doi/10.1261/ na.
075945.120. F eely a ailable online h ough he RNA Open Access
op ion.
© 2020 P ezza e al. This a icle, published in RNA, is a ailable
unde a C ea i e Commons License (A ibu ion-NonComme cial 4.0
In e na ional), as desc ibed a h p://c ea i ecommons.o g/licenses/
by-nc/4.0/.
METHOD
RNA (2020) 26:1069–1078; Published by Cold Sp ing Ha bo Labo a o y P ess o he RNA Socie y 1069
limi ed e iciency o nonmodel species such as he as
majo i y o hose >1000 di e en bac e ia in he human
mic obio a. In addi ion, Ribo-Ze o—long conside ed he
gold s anda d o bac e ial RNA deple ion (Giannoukos
e al. 2012; Pe o a e al. 2017)—was ecen ly discon in-
ued. This has enewed e o s in he communi y o de elop
in-house solu ions o RNA deple ion (Kim e al. 2019;
Cul ine e al. 2020).
A ailable al e na i e bac e ial RNA emo al s a egies
use RNase H-media ed diges ion o RNA:DNA hyb ids
(Huang e al. 2020), size-selec ion o mRNAs h ough
liquid ch oma og aphy (Cas o e al. 2013), o selec i e ex-
clusion o RNAs om cDNA con e sion wi h “no -so- an-
dom”hexame s (Hi akawa e al. 2011; Chugani e al.
2012); he la e is also a ailable as pa o he Uni e sal
P oka yo ic RNA-Seq ki (NuGen). O e all, hese me hods
achie e good o excellen (∼70%–99%) RNA deple ion
a es. Howe e , each o hese p o ocols deple es RNA
a he RNA le el, ha is, p io o mul iplexing. This limi s
he applicabili y o hese echniques o s udies wi h low-
inpu ma e ial o high- h oughpu analysis including sin-
gle-cell RNA-seq. Some ecen lib a y p epa a ion al e na-
i es such as RNA ag-seq (Shishkin e al. 2015) ba code
RNA samples and pool hem o join RNA deple ion,
he eby educing cos . Howe e , since ba coding a he
RNA le el equi es high inpu amoun s, i oo, is li le sui -
ed o low-inpu bac e ial RNA-seq.
Ins ead o emo ing RNA om he inpu sample, RNA
agmen s migh as well be emo ed a he cDNA le el,
ha is, ollowing lib a y p eampli ica ion and mul iplexing.
An ea ly s udy diges ed RNA-de i ed cDNAs wi h a dou-
ble s and-speci ic DNase a e mel ing and eannealing
(Yi e al. 2011). Howe e , his me hod equi es subs an ial
op imiza ion o he eannealing condi ions. Mo eo e , he
p o ocol is ye o be combined wi h
mul iplexing o cDNA. In o he wo ds,
i s ill equi es nanog am amoun s o
inpu RNA, while i s e iciency o
RNA ead deple ion is in e io o he
abo e-desc ibed me hods (Yi e al.
2011; Giannoukos e al. 2012). A sec-
ond s udy in oduced cDNA-le el
deple ion o RNAs h ough p obe-di-
ec ed deg ada ion (PDD; [A che e
al. 2014]), in which DNA p obes a e
annealed o RNA-de i ed cDNAs
and deg aded wi h double s and-
speci ic DNase. While p omising,
his me hod equi es ci cula iza ion
o he cDNA agmen s, hampe ing
i s in oduc ion in common RNA-seq
p o ocols.
Recen ly, p og ammed DNA clea -
age by he CRISPR-associa ed nucle-
ase Cas9 has been in oduced as a
no el echnology o deple e wi h high sequence speci-
ici y “unwan ed” agmen s om euka yo ic cDNA lib a -
ies. In his so-called DASH (deple ion o abundan
sequences by hyb idiza ion) app oach (Gu e al. 2016),
a pool o single-guide RNAs (sgRNAs) is used o di ec
Cas9 clea age o RNA-de i ed cDNA molecules du ing
lib a y p epa a ion. Since he clea ed agmen s a e no
ampli ied in he subsequen PCR s ep, in ac non- RNA
agmen s become en iched (Fig. 1). To illus a e he
powe o DASH, a pool o iled ( oughly e e y 50 bases)
sgRNAs agains human mi ochond ial RNAs educed
he co esponding cDNA eads by mo e han 1000- old,
while i concomi an ly inc eased co e age o non iboso-
mal ansc ip s by ∼2.4- old. DASH has also been used
o inc ease co e age o nonabundan ansc ip s in
human small RNA-seq lib a ies by a ge ing adap e di-
me s and issue-speci ically highly exp essed mic oRNAs
(Ha digan e al. 2019) and o deple e hemoglobin an-
sc ip s om pola bea pe iphe al blood RNA samples
be o e long- and sho - ead sequencing (By ne e al.
2019). Simila o DASH o euka yo ic cDNA, a he mos a-
ble Cas9 a ian was ecen ly used o clea e E.coli 16S
RNA sequences in cDNA du ing PCR-media ed lib a y
ampli ica ion (Schmid e al. 2019).
The p omise o DASH o p o ide a gene ic app oach
no wi hs anding, he me hod is ye o be ully es ablished
o bac e ial ansc ip omics. In his s udy, we e alua e
DASH o bac e ial sho - ead RNA-seq o wo in ensely
s udied bac e ia: Salmonella en e ica se o a
Typhimu ium (hence o h, Salmonella), which is a majo
model species o bo h, bac e ial RNA biology and pa ho-
genesis; and Bac e oides he aio aomic on as an example
o an abundan human mic obio a species. The p esen ed
sgRNA design so wa e and op imized we -lab p o ocols
FIGURE 1. O e iew o he bac e ial DASH wo k low. Schema ic o he p inciple behind
DASH-media ed emo al o RNA-de i ed cDNA agmen s om sequencing lib a ies. The in-
di idual s eps in he bac e ial DASH pipeline a e indica ed in he zoom-in a he bo om.
P ezza e al.
1070 RNA (2020) Vol. 26, No. 8
bea g ea po en ial o e icien , sensi i e, and economic
emo al o unwan ed RNA sequences o RNA-seq analy-
sis o any bac e ium o in e es .
RESULTS
P oo -o -concep o bac e ial DASH and op imiza ion
o Cas9 eac ion condi ions
The well-s udied G am-nega i e bac e ium Salmonella has
been he subjec o many RNA-seq s udies (K oge e al.
2013; Wes e mann e al. 2016). Unless deple ed,
Salmonella RNA ypically ep esen s ∼95% o all cDNA
eads in a lib a y (Fig. 2A; Be in e al. 2019). Salmonella
RNA is ansc ibed om se en ibosomal ope ons ( n)
ac oss he ch omosome, gi ing ise o each se en homo-
logs o he 16S (genes sA-G) and 23S ( lA-G), and eigh
copies o 5S RNA ( he nD locus ca ies wo 5S RNA-en-
coding genes). Gene ally speaking, he sequences o
he RNA genes a e highly conse ed ac oss all loci, bu
hey do show indels and poin mu a ions.
To deple e ibosomal agmen s in cDNA om
Salmonella o al RNA, we ini ially designed a pool o
sgRNAs a ge ing he consensus sequence o each RNA
gene. To his end, we w o e a Py hon sc ip ha iden i ies
SpCas9 a ge si es wi hin RNA genes based on he ol-
lowing selec ion c i e ia: (i) pe ec complemen a i y o a
leas i e ou o he se en (16S and 23S) o six ou o he
eigh (5S) RNA copies, (ii) a GC con en o 35%–70%,
(iii) a p edic ed low endency o o m seconda y s uc u es,
and (i ) ollowed by he “NGG”p o ospace adjacen mo-
i (PAM) o ecogni ion by he SpCas9 nuclease (Jinek
e al. 2012). The sc ip aimed a iden i ying one a ge
si e ha sa is ied he se c i e ia on a e age e e y ∼50
bp along he a ge space, as his densi y p o ed su icien
in euka yo ic DASH (Fig. 2B; see Ma e ials and Me hods
o de ails on sgRNA design; Gu e al. 2016). As a esul ,
ou sc ip p oposed 113 sgRNAs in o al. We hen o de ed
DNA oligonucleo ides, each comp ising a T7 p omo e , a
single a ge si e, and he i s pa o he SpCas9 sgRNA
sca old. To hese sense oligonucleo ides, we added a uni-
e sal, pa ially o e lapping e e se DNA oligonucleo ide
con aining he emaining po ion o he sgRNA sca old.
The esul ing annealing p oduc s
we e illed up wi h he co esponding
nucleobases, gi ing ise o he dou-
ble-s anded DNA empla es ha
we e subjec ed o in i o ansc ip-
ion wi h T7 RNA polyme ase o yield
he sgRNA pool.
Salmonella cDNA was p eampli ied
in wo PCR cycles and subsequen ly
incuba ed wi h he in i o- ansc ibed
sgRNA pool and SpCas9 nuclease o
2 h a 37°C. We used a mola sgRNA:
Cas9:cDNA a io o 1000:100:1—as
in e ed as op imal in he o iginal
DASH p o ocol (Gu e al. 2016).
Following diges ion, we emo ed
Cas9 wi h a silica-based column pu i i-
ca ion ki and p oceeded wi h 16 cy-
cles o PCR o ampli y he unclea ed
cDNA agmen s. Sequencing o he
esul ing lib a y e ealed ha , e en
a e Cas9 clea age, ∼83% o he ob-
ained Salmonella eads de i ed om
RNA, hus a me e ∼13% educ ion
o e he con ol lib a y (Fig. 2C).
Using he same sgRNA pool, we
hen es ed whe he di e en eac ion
condi ions would inc ease deple ion
e iciency. Howe e , highe Cas9 con-
cen a ions only made RNA deple-
ion less e icien , sugges ing ha —
among he concen a ions es ed—
he abo e sgRNA:Cas9 a io o
B
AC
FIGURE 2. Ini ial DASH un on Salmonella o al RNA. (A) Composi ion o o al RNA ex ac ed
om exponen ially g owing Salmonella as deduced om RNA-seq eads. (B) Conse a ion o
Salmonella RNAs genes and loca ion o he iden i ied sgRNA a ge si es. The pe -base con-
se a ion o each RNA gene ac oss all Salmonella RNA homologs is plo ed. Abo e each con-
sensus sequence ( ep esen ed as a g ay ec angle), he designed sgRNAs a ge si es a e
indica ed by a black iangle. (C) Pilo un o DASH-media ed RNA deple ion in Salmonella.
(Le ) The ac ion o ibosomal-de i ed eads o e he o al numbe o mapped eads o a con-
ol and a DASH- ea ed lib a y. (Righ ) Same da a a e exp essed as e iciency o DASH-medi-
a ed RNA deple ion.
RNA deple ion in bac e ia ia DASH
www. najou nal.o g 1071
1000:100 was op imal o bac e ial DASH, oo (Fig. 3A).
Howe e , p eincuba ion o Cas9 wi h he sgRNA pool,
mean o allow o mo e ime o he ibonucleop o ein
complex o o m p io o addi ion o he cDNA subs a e,
did inc ease RNA deple ion e iciency o ∼20% (Fig. 3B).
Based on his inding, a Cas9:sgRNA p eincuba ion s ep
was included in all u he eac ions.
Maximizing sgRNA densi y
The abo e-desc ibed ini ial ∼20% deple ion o RNA eads
om Salmonella o al RNA lib a ies was a a c y om he
>99% deple ion p e iously epo ed o human RNA sam-
ples (Gu e al. 2016). Inspec ion o he ead leng h dis ibu-
ion ob ained om ou “DASHed”Salmonella lib a ies
(1000:100 sgRNA:Cas9 a io) con i med e icien deple-
ion o RNA-de i ed eads >50 n (Fig. 3C). Howe e ,
sho e RNA eads we e e en en iched o e he un ea ed
con ol sample. Fo compa ison, he DASH ea men
ha dly a ec ed he ead leng h dis ibu ion o non iboso-
mal eads (Fig. 3D). This sugges ed ha sho ibosomal
cDNA agmen s e aded Cas9 clea age, p esumably
because hey we e less likely o con ain a ull-leng h
sgRNA a ge sequence.
To es whe he co e ing mo e si es wi hin he RNA se-
quences would mo e e icien ly emo e hose e ac o y
sho RNA eads, we modi ied ou design ool o ob ain
a sgRNA pool wi h he maximal numbe o a ge si es
(Fig. 4A). This new sgRNA pool a ge ed all copies o he
RNA genes indi idually a he han jus hei consensus
sequences. Disca ding sgRNAs wi h po en ial o - a ge
e ec s, his inal pool consis ed o 797 sgRNAs. Wi h he
same mola a io o 1000:100:1 (sgRNA:Cas9:cDNA) as
abo e, his pool b ough RNA deple ion e iciency o
38% (Fig. 4B).
Gi en he much la ge numbe o sgRNAs in his
new pool, we specula ed ha highe mola excess o
Cas9:sgRNA o e cDNA could u he imp o e deple-
ion e iciency. Indeed, changing he mola a io o
35,000:3500:1 (sgRNA:Cas9:cDNA) u he inc eased he
deple ion e iciency, up o 56% (Fig.
4B). Consequen ly, he numbe o de-
ec ed (RPKM > 1) Salmonella an-
sc ip s a he se sequencing dep hs
o ∼5–12 M eads inc eased om
2724 in he un ea ed sample o
3875 in he DASH- ea ed lib a y
(Supplemen al Fig. S1A).
To assess whe he any sgRNA in
his la ge pool showed signs o o -
a ge ing, we compa ed gene-wise
ead coun s be ween he DASH- ea -
ed and cogna e un ea ed lib a ies.
Excluding RNA, ead coun s o all
gene ic ea u es showed e y high
co ela ion be ween he wo lib a ies
(Fig. 4C). Likewise, ead co e age
ac oss RNA genes dec eased upon
DASH, libe a ing mo e in o ma i e
eads ha mapped o mRNAs (e.g.,
dnaK) o egula o y small RNA
(sRNA) sequences (PinT, In R, ChiX;
Fig. 4D). Toge he , his demons a es
ha ou design pipeline indeed se-
lec s sgRNAs wi h e y li le o - a -
ge ing and so enables speci ic
emo al o RNA eads.
Inc easing he sensi i i y o DASH
One key ad an age o RNA deple-
ion a he cDNA le el is ha i
does no lowe he amoun o s a -
ing ma e ial o lib a y p epa a ion.
The e o e, we es ed whe he DASH
B
A
C
D
FIGURE 3. Op imiza ion o DASH eac ion condi ions. (A) RNA deple ion e iciency upon
DASH clea age wi h a ying amoun s o Cas9 and he sgRNA pool. Cas9 and sgRNA amoun s
a e indica ed as mola excess o e a single agmen o he cDNA lib a y. (B) Impac o p ein-
cuba ion o sgRNA and Cas9 p io o DASH on RNA deple ion e iciency. (C) Leng h dis ibu-
ion o he mapped po ions o eads aligning o RNAs a e DASH compa ed wi h an
un ea ed con ol. F equency alues a e exp essed as ac ion (%) o he o al numbe o eads
mapping o RNAs. (D) Same as in Cbu o eads aligning o non- RNA genes.
P ezza e al.
1072 RNA (2020) Vol. 26, No. 8
could imp o e he sensi i i y o ou RNA-seq p o ocol by
sys ema ically dec easing he quan i y o inpu RNA om
∼800 ng o ∼0.4 ng (Fig. 5A). Using a ixed 1000:100:1 mo-
la a io o sgRNA:Cas9:cDNA, we obse ed e icien RNA
deple ion wi h each o he ou amoun s es ed, albei e i-
ciency a ied om ∼30% o ∼50% (Fig. 5A). Impo an ly,
he numbe o de ec ed gene ic ea u es (which is a
mo e obus eadou ) wi h RPKM > 1 was s able in he
wo highes RNA inpu amoun s and
dec eased only in he lowes one
(Supplemen al Fig. S1B, op), likely
due o he s ochas ic loss o low-abun-
dance ansc ip s. Fo high-abun-
dance ansc ip s (RPKM > 25), DASH
inc eased he numbe o de ec ed
genes i espec i e o inpu amoun
(Supplemen al Fig. S1B, bo om).
In he o iginal euka yo ic DASH p o-
ocol(Gue al.2016), heCas9enzyme
is emo ed a e he clea age eac ion
by pu i ica ion o e a column, which
uns he isk o losing cDNA as well.
He e, we implemen ed diges o he
Cas9 p o ein by p o einase K (Ha di-
gan e al. 2019) as anal e na i e ocol-
umn pu i ica ion in bac e ial DASH.
T ea men wi h p o einase K did no
a ec he emo al o RNA eads (Fig.
5A), bu esul ed in inc eased cDNA
yields a e he pos -DASH PCR ampli-
ica ion (Supplemen al Table S1).
Las ly, we es ed whe he DASH
wo ks wi h a lib a y p epa a ion ki
ha is op imized o low inpu sam-
ples. Using he Taka a SMARTe
S anded To al RNA-Seq ki wi h 1
ng o al Salmonella RNA as inpu ,
we success ully emo ed mo e han
hal o he RNA eads (Fig. 5B). Con-
comi an ly, and simila o he abo e li-
b a ies gene a ed wi h he NEBNex
ki , he p opo ion o mRNA and
sRNA eads inc eased by app oxi-
ma ely nine old (Fig. 5C). Howe e ,
DASH ea men led o a sligh in-
c ease in he ac ion o eads <12 n
in leng h, which should no be a majo
conce n since hese eads a e ypi-
cally il e ed ou du ing ead p ocess-
ing (Supplemen al Fig. S2A). Taken
oge he , his demons a es ha
combining DASH wi h a lib a y con-
s uc ion p o ocol op imized o mi-
nu e RNA amoun s enables obus
RNA-seq analysis o low-inpu sam-
ples ex ac ed om as ew as ∼1000 bac e ia, and po en-
ially e en ewe .
DASHing Bac e oides he aio aomic on RNA
To add ess gene alizabili y o bac e ial DASH, we selec ed
a phylogene ically dis an species. The Bac e oidia ep e-
sen a i e and human in es inal mic obio a membe B.
B
A
C
D
FIGURE 4. Imp o ed DASH e iciency by maximizing sgRNA a ge si e densi y. (A) Wo k low
o he so wa e de eloped o he design o high-densi y sgRNA pools. The numbe o sgRNAs
passing each s ep is indica ed o he igh .(B) RNA deple ion e iciency using he 797 sgRNA
pool in di e en a ios o Cas9 and sgRNA. Cas9 and sgRNA amoun s a e indica ed as mola
excess o e a single agmen o he cDNA lib a y. (C) Co ela ion o ansc ip abundances in
he con ol e sus DASHed (3500:35,000 excess o Cas9:sgRNA) lib a ies. Red do s (n= 22)
ep esen RNA ansc ip s, blue ones (n= 1511) he gene ic ea u es wi h a leas 15 eads
in he con ol and 150 eads in he DASH lib a y, and g ay do s (n= 3469) he gene ic ea u es
below his h eshold. The eg ession line and co ela ion coe icien we e compu ed o he
blue do s only. (D) Sequence ead co e age o a ep esen a i e RNA locus and he dnaK,
pinT, in R, and chiX genes in he con ol and DASH lib a ies (3500:35,000 excess o Cas9:
sgRNA).
RNA deple ion in bac e ia ia DASH
www. najou nal.o g 1073

he aio aomic on ha bo s i e RNA ope ons in i s genome,
each ca ying one 23S, 16S, and 5S gene copy. Using ou
cus om sc ip , we designed 651 sgRNAs a ge ing all B.
he aio aomic on RNA ope ons indi idually (same selec-
ion c i e ia as o he op imized Salmonella RNA deple-
ion; see Fig. 4A). These sgRNAs we e es ed in pa allel
wi h he wo di e en lib a y cons uc ion ki s and sgRNA:
Cas9:cDNA mola a ios used o Salmonella samples
(Figs. 4A, 5), on nanog am amoun s o B. he aio aomic on
RNA (Fig. 6A). We obse ed deple ion o RNA eads up o
86% o he s anda d lib a y p epa a ion ki (NEB) and up o
76% o he low-inpu p o ocol (Taka a), wi h a co espond-
ing inc ease in co e age o non- RNA ansc ip s (Fig. 6B,D;
Supplemen al Fig. S2B). As be o e, he e was a high co e-
la ion wi hin abundance o gene ic ea u es be ween he
un ea ed and he DASH samples (Fig 6C), a guing o neg-
ligible i any o - a ge ing by he sgRNAs.
DISCUSSION
Fi s sys ema ic e alua ion o DASH o bac e ial
ansc ip omics
This s udy epo s he adap a ion o he DASH echnology
o p oka yo ic RNA samples. Th ough Cas9-media ed
clea age o RNA-de i ed cDNA agmen s p io o lib a y
ampli ica ion, ou p o ocol inc eases
co e age o non ibosomal ansc ip s
in Salmonella and Bac e oides o al
RNA samples by ∼12- o ∼3.8- old, e-
spec i ely. Only a ew changes o he
no mal lib a y p epa a ion p o ocol
we e necessa y o implemen ou
DASH p o ocol in o a s anda d Illu-
mina sho - ead sequencing pipeline.
Since i emo es RNA agmen s
a e RT, DASH o e s he majo ad-
an age ha an ini ial ampli ica ion
o he cDNA lib a y can be pe o med
be o e Cas9 clea age. This inc eases
he o e all amoun o cDNA and min-
imizes s ochas ic agmen loss. Fo
his eason, ou app oach eaches
good deple ion (∼50%–80%) e en
wi h minu e RNA amoun s well below
he lowe ecommended limi o he
common RNA deple ion ki s and
echniques (Supplemen al Table S2).
Impo an ly, he ecommended mini-
mal inpu amoun o he “gold s an-
da d”Ribo-Ze o ki was 500 ng RNA,
whe eas ou DASH app oach wo ks
obus ly o ∼400 pg o inpu RNA
(Fig. 5A). Gi en ha we ha e succeed-
ed in combining DASH wi h s a e-o -
he-a lib a y p epa a ion ki s used in euka yo ic single-
cell ansc ip omics, we expec o be able o u he educe
he necessa y amoun o s a ing ma e ial in he u u e.
Ob iously, his would open bac e ial RNA-seq o many ex-
ci ing a eas o mic obiology; o gi e jus one example, i
would allow one o pe o m gene exp ession p o iling on
bac e ia eco e ed om insec gu s.
While he up on in es men o pu chasing all DASH
eagen s is high (Supplemen al Table S4), we es ima e a
cos o $3–7 pe sample o RNA-seq lib a ies, which is
>10- old lowe han o comme cial RNA deple ion ki s
(Supplemen al Table S2). In his ega d, bac e ial DASH
will emain compe i i e e en wi h a e y ecen ly eleased
new Ribo-Ze o ki (“Ribo-Ze o Plus,”Illumina ca alog num-
be : 20037135), which despi e now using enzyma ic RNA
deple ion ins ead o RNA pull-ou , s ill uns a ∼$80 pe
sample. Wha is mo e, DASH bea s po en ial o u he
cos educ ion, o example, h ough in-house p oduc ion
o he Cas9 p o ein o he T7 RNA polyme ase o in i o
ansc ip ion.
Al hough op imized on Salmonella RNA samples, he
condi ions es ablished he e enabled us o success ully un
DASH on a phylogene ically dis an bac e ium, B. he aio-
aomic on. This a gues ha ou p o ocol is applicable o o-
al RNA om di e se bac e ial species and, po en ially, e en
oo ganismsbeyond hebac e ialkingdom.Inp inciple, he
B
A
C
FIGURE 5. DASH o low-inpu RNA samples. (A) DASH e iciency o s eadily dec easing inpu
RNA amoun s and o di e en Cas9 emo al me hods. DASH was pe o med on 1/5 h o he
cDNA esul ing om e e se ansc ip ion. Cas9 and he sgRNA pool we e used in a 1000 and
10,000 excess o e a single agmen o he cDNA lib a y, espec i ely. The indica ed RNA
amoun s co espond o he e e se ansc ip ion inpu , while he cDNA amoun s e e o
wha was used o DASH. (B) Deple ion e iciency o DASH (3500:35,000 excess o Cas9:
sgRNA) when combined wi h di e en lib a y p epa a ion ki s. The indica ed RNA amoun s
co espond o he e e se ansc ip ion inpu . (C) RNA class dis ibu ion o sequencing eads
in he con ol and DASH samples shown in panel B.
P ezza e al.
1074 RNA (2020) Vol. 26, No. 8
modula i y o ou DASH app oach should allow o he de-
sign o combined sgRNA pools a ge ing di e en species
o ibodeple ion o samples de i ed om mixed popula-
ions, such as me a ansc ip omic samples o RNA mix u es
isola ed om in ec ed hos cells and issues.
Compa ison o p e ious DASH p o ocols
The o iginal desc ip ion o DASH on euka yo ic samples
(Gu e al. 2016) epo ed a educ ion o he a ge ed ag-
men s by 99%, subs an ially highe
han wha we achie ed he e in bac e-
ia. How can his di e ence be ex-
plained? Bo h he o iginal DASH (Gu
e al. 2016) and a ecen ly upda ed
p o ocol (Dyne man e al. 2020) we e
combined wi h long- ead sequencing
whe e a e age inse size was ∼300
n . Simila ly, he p e ious DASH-like
expe imen wi h he mos able Cas9
was applied o an E.coli cDNA lib a y
wi h an a e age inse size o 300–400
n (Schmid e al. 2019). In con as ,
we desc ibe he applica ion o DASH
o a s anda d Illumina RNA-seq pipe-
line wi h a maximal ead leng h o 75
n . Ob iously, he longe he inse s,
he highe he numbe o a ge able
agmen s, which biases DASH o-
wa d longe eads (Fig. 3C). Howe e ,
sho - ead sequencing is he s anda d
in he ield o bac e ial RNA-seq and
we he e o e p edic ou DASH e -
sion o be pa icula ly use ul o any
ansc ip omics app oach ha in-
ol es bac e ia. Addi ionally, ou im-
p o ed DASH p o ocol omi s he
mul iple phenol/chlo o o m ex ac-
ion o column pu i ica ion s eps o
euka yo ic DASH (Gu e al. 2016;
Dyne man e al. 2020). Ins ead, we e-
mo e Cas9 wi h a simple p o einase K
ea men p io o u he lib a y am-
pli ica ion. Since his minimizes he
isk o cDNA loss om o ganic ex ac-
ion o silica column pu i ica ion, ou
p o ocol will be pa icula ly sui able
o low-inpu samples.
By using a he mos able Cas9,
Quake and colleagues ecen ly dem-
ons a ed ha DASH could be pe -
o med simul aneously wi h cDNA
lib a y ampli ica ion (Schmid e al.
2019). Howe e , he he mos able
Cas9 a ian used in he s udy equi es a complex, 6 n -
long PAM, which d ama ically educes he numbe o pos-
sible sgRNA si es wi hin he RNA sequence space. Using
ou Py hon sc ip wi h his hexame ic PAM, a mos 115
sgRNAs (as compa ed o 797 sgRNAs o SpCas9) could
be designed o Salmonella RNA. This is abou he di e -
ence be ween ou ini ial (Fig. 3) and he inal (Fig. 4) sgRNA
pools, which ansla es in a h ee old di e ence in RNA
ead emo al. The e o e, al hough he classical Cas9
om S ep ococcus pyogenes equi es clea age and
PCR ampli ica ion o occu subsequen ly (no in pa allel),
B
A
C
D
FIGURE 6. DASH-media ed emo al o Bac e oides he aio aomic on RNA. (A) RNA deple-
ion e iciency om a B. he aio aomic on cDNA lib a y. DASH was combined wi h he di e en
lib a y p epa a ion ki s and using he indica ed a ios o Cas9 and sgRNA o e cDNA ag-
men s. The indica ed RNA amoun s co espond o he e e se ansc ip ion inpu . (B) RNA
class dis ibu ion o eads in con ol and DASH (3500:35,000 excess o Cas9:sgRNA) samples.
(C) Co ela ion o ansc ip abundances in he con ol and DASH lib a ies shown in panel B.
Red do s (n= 15) ep esen RNA ansc ip s, blue ones (n= 2474) he gene ic ea u es wi h
a leas 15 eads in he con ol lib a y and 150 eads in he DASH sample, and g ay do s (n=
2658) he ea u es below his cu o . The eg ession line and co ela ion coe icien we e com-
pu ed o he blue do s only. (D) Sequence ead co e age o a ep esen a i e RNA locus and
BT_3550 (encoding a pu a i e long-chain a y acid-CoA ligase) and he gibS and BTnc201
egula o y RNA genes (bo om) in he con ol and DASH lib a y o panels Band C.
RNA deple ion in bac e ia ia DASH
www. najou nal.o g 1075
i has an ad an age o e he mos able Cas9 wi h espec
o RNA ead deple ion in sho - ead lib a ies.
sgRNA design ool
As pa o his wo k, we de eloped a Py hon sc ip o de-
signing sgRNAs a ge ing he RNAs o a selec ed species
wi h known e e ence genome (including anno a ions o
ibosomal genes) ha ou pu s he sequences o he DNA
oligonucleo ides needed as empla es o in i o- an-
sc ibe he cus omized sgRNA pool. Impo an ly, howe e ,
ou so wa e can also be ed wi h manually en e ed coo di-
na es o RNA genes, which will be impo an o o gan-
isms ha lack a comple e ansc ip ome anno a ion, such
as many ele an mic obio a membe s and impo an en i-
onmen al bac e ia.
Based on he assump ion ha maximizing sgRNA densi-
y imp o es deple ion e iciencies, ou pipeline p edic s all
possible sgRNAs and il e s ou only hose sequences wi h
ex eme GC con en (<30% o >80%) o p edic ed o - a -
ge e ec s. Howe e , ou algo i hm does no emo e
guides wi h low p edic ed on- a ge ac i i ies, as we pos u-
la e ha —as long as ee Cas9 molecules a e no he a e-
limi ing ac o —indi idual sgRNAs wi h low on- a ge ac-
i i y would no nega i ely impac ibosomal deple ion e -
iciency by he en i e pool. In his espec , ou so wa e
di e s om he many CRISPR design ools ha ha e
been de eloped o genome edi ing (Liu e al. 2020) and
sea ch o he “bes ”sgRNA pe each a ge gene/locus.
Pe spec i e
Fu he op imiza ion o he DASH app oach could include
es ing al e na i e Cas nucleases (Gona opoulos-
Pou na zis e al. 2020; Wessels e al. 2020), o example,
high- ideli y Cas e sions and enzymes wi h al e ed PAM
p e e ence o ele a ed he mos abili y (Schmid e al.
2019). Mo eo e , a be e unde s anding o he minimal
sgRNA densi y o sa u a ed deple ion e iciency could
help o educe bo h, he cos o he sgRNA empla e
pool and he amoun s o Cas9 and sgRNA pe eac ion.
Among he es ed in e als, we iden i ied a Cas9:sgRNA
a io o 1:10 as op imal; howe e , e alua ing mo e e ined,
in e media e a ios in he u u e could esul in mo e e i-
cien a ge clea age. Finally, i is likely ha mul iple
ounds o DASH on he same sample (Dyne man e al.
2020) lead o mo e e icien deple ion.
MATERIALS AND METHODS
RNA isola ion
Bac e ial RNA was isola ed om an in i o cul u e o S.en e ica
se o a Typhimu ium s ain SL1344 (S ocke e al. 1983) g own
in Lennox b o h (LB) medium o an op ical densi y a 600 nm
(OD
600
) o 2.0 o om a cul u e o B. he aio aomic on VPI-5482
g own in TYG medium o an OD
600
o 0.5. To his end, cells
we e ha es ed and o al RNA ex ac ed using he TRIzol eagen
(In i ogen) acco ding o he manu ac u e ’s ecommenda ions.
To emo e con amina ing genomic DNA, samples we e u he
ea ed wi h 0.25 U o DNase I (Fe men as) pe 1 µg o RNA o
45 min a 37°C, ollowed by phenol–chlo o o m ex ac ion and
e hanol p ecipi a ion o he RNA ansc ip s. RNA quali y was
checked on an Agilen 2100 Bioanalyze (Agilen Technologies).
sgRNA design and syn hesis
Ta ge sequences wi hin Salmonella RNA genes we e iden i ied
and selec ed wi h wo e sions o a cus om Py hon sc ip . In he
i s e sion (Figs. 2–4), all RNA copies we e aligned wi h
MUSCLE (Edga 2004) and he consensus sequence o each
gene was gene a ed so ha all posi ions iden ical in a leas six
(16S, 23S) o se en (5S) RNA copies we e main ained. All 20-n
po en ial gRNA a ge s we e iden i ied by sea ching bo h s ands
o he p esence o he “NGG”PAM and hen il e ed o emo e
hose si es wi h an ex eme GC con en (i.e., GC < 35% o >70%)
o s ong p edic ed seconda y s uc u es (MFE < −5, as compu ed
wi h RNA old [Lo enz e al. 2011]). Wi hin he emaining pool,
gRNAs we e hen selec ed o be ∼50 n dis an om each o he ,
s a ing om he one closes o he 5′end o he RNA sequence.
The esul ing 113 sequences we e pu chased om IDT as a
unique oligo pool, each wi h he ollowing s uc u e (5′ o 3′):
T7 p omo e (TTCTAATACGACTCACTATA) + gRNA sequence +
sca old (GTTTTAGAGCTAGAAATAGC). Since ac i i y o he T7
p omo e is enhanced when wo G’s a e p esen a he ansc ip-
ion s a si e, one o wo G’s we e added immedia ely a e he T7
p omo e in oligos de i ed om gRNAs s a ing wi h a single o
no G, espec i ely.
The second e sion o he Py hon sc ip (Figs. 4, 5) designed all
possible gRNA a ge sequences, independen o he conse a-
ion and s uc u edness o each egion. The only il e ing c i e ia
we e GC con en be ween 30%–80% and a low p edic ed o - a -
ge p obabili y, de ined as he absence o sequences in he
Salmonella ch omosome o plasmids ha aligned o he gRNA
wi h up o h ee misma ches (iden i ied wi h Bow ie [Langmead
e al. 2009]), ollowed by a alid PAM. The esul ing 979 sequenc-
es we e pu chased om IDT as an “oPools Oligo Pool”wi h a sim-
ila s uc u e han abo e, excep ha he sca old was GTTTTA
GAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCA
ACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT and was ol-
lowed by a sequence o ill-in eac ions (ACGATGTCGCAG
AGTATGCC). The p ime used o illing-in was 5′-GGCA
TACTCTGCGACATCGT-3′. Design o he B. he aio aomic on
pool was done as abo e, esul ing in 651 sequences. The sc ip
is eely a ailable on h ps://gi hub.com/gp ezza/DASH_
RNA_deple ion.
dsDNA empla es o in i o ansc ip ion we e gene a ed in a
ill-in eac ion pe o med wi h he KAPA HiFi Ho S a ReadyMix
(KAPA Biosys ems). The i s pool eac ion was p imed wi h 5′-AA
AAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACT
AGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3′and con-
sis ed o dena u a ion a 95°C o 3 min, annealing, and ex ension
om 95°C o 30°C a 0.1°C/sec wi h 10 sec pause e e y 10°C and
a inal ex ension a 72°C o 1 min. The second pool was illed-in
P ezza e al.
1076 RNA (2020) Vol. 26, No. 8
wi h he 5′-GGCATACTCTGCGACATCGT-3′p ime and dena-
u a ion a 95°C o 3 min, annealing a 60°C o 20 sec, and ex en-
sion a 72°C o 1 min.
sgRNA pools we e in i o- ansc ibed om 300 ng o column-
pu i ied dsDNA empla e wi h he MEGAsho sc ip T7
T ansc ip ion Ki (The mo Fishe Scien i ic) and hen pu i ied
wi h he Mona ch RNA Cleanup Ki (NEB). SpCas9 p o ein was
pu chased om NEB (M0386M).
cDNA lib a y gene a ion, Cas9 clea age, lib a y
ampli ica ion, and Illumina sequencing
Bac e ial o al RNA was agmen ed a 94°C o 2.75 min using he
NEBNex Magnesium RNA F agmen a ion Module (NEB), de-
phospho yla ed a he 3′end, phospho yla ed a he 5′end and
decapped using 10 U T4-PNK ± 40 nmol ATP and 5 U RppH, e-
spec i ely (NEB). A e each s ep, RNA was pu i ied wi h he
Zymo RNA Clean & Concen a o ki (Gu e al. 2016). cDNA lib a -
ies we e gene a ed wi h he NEBNex Mul iplex Small RNA
Lib a y P ep Ki (NEB) and p eampli ied wi h wo cycles o PCR.
Following pu i ica ion wi h he Oligo Clean & Concen a o ki
(Zymo Resea ch), DASH ea men was pe o med simila o Gu
e al. (2016). Speci ically, he pu i ied cDNA lib a y was incuba ed
wi h he Cas9-sgRNA complex o 2 h a 37°C a he indica ed mo-
la a ios. Whe e men ioned, Cas9 and he sgRNA pool we e p e-
incuba ed a 37°C o 15 min be o e addi ion o he cDNA. A e
he diges , Cas9 was emo ed om he eac ion by column pu i-
ica ion wi h he Oligo Clean & Concen a o ki (Zymo Resea ch)
o ea men wi h 0.8 U (∼20 µg) p o einase K (NEB) o 15 min a
37°C, ollowed by hea -inac i a ion (15 min a 95°C). The esul ing
DASHed samples we e PCR ampli ied o 12–24 cycles o selec
o non ibosomal, undiges ed cDNAs and pu i ied wi h MagSi-
NGS
p ep
Plus beads (S einb enne Labo sys eme).
Al e na i ely, cDNA lib a ies we e gene a ed om bac e ial o-
al RNA using he Taka a SMARTe S anded To al RNA-Seq Ki 2
wi h 4 min RNA agmen a ion a 94°C and i e cycles o PCR o
cDNA lib a y p eampli ica ion. A e column pu i ica ion, DASH
was pe o med as desc ibed abo e. The esul ing DASHed sam-
ples we e column pu i ied, PCR ampli ied wi h Taka a’s
SeqAmp DNA Polyme ase o 18 cycles and u he pu i ied
wi h AMPu e XP beads (Beckman Coul e ).
Sequencing o lib a ies, spiked wi h 5% PhiX con ol lib a y, was
pe o med in single-end mode on he Illumina Nex Seq 500 pla -
o m wi h he Mid Ou pu Ki 2.5 (75 cycles). A summa y o all se-
quenced samples and he espec i e eac ion condi ions is
epo ed in Supplemen al Table S3.
Demul iplexed FASTQ iles we e gene a ed wi h bcl2 as q2
2.20.0.422 (Illumina). The sequencing da a is cu en ly being up-
loaded a NCBI Gene Exp ession Omnibus (h p://www.ncbi.nlm
.nih.go /geo) unde he accession numbe GSE147155.
Da a analysis
Reads we e immed o NEBNex o Illumina T uSeq (Taka a ki )
adap e sequences using Cu adap e sion 2.5 wi h de aul pa-
ame e s and he –nex seq- im=20 swi ch o handle wo colo se-
quencing chemis y. Reads ha we e immed o leng h 0 we e
disca ded.
P ocessed eads we e mapped o he Salmonella
(NC_016810.1, NC_017718.1, NC_017719.1, NC_017720.1) o
Bac e oides (NC_004663.1, NC_004703.1) e e ence sequences.
We modi ied he NC_016810.1 Salmonella ch omosome anno a-
ion o include an upda ed sRNA anno a ion (Hö e al. 2020). The
B. he aio aomic on sRNA anno a ion s ems om D Ryan, L
Jenniches, S Reicha d , e al. (in p ep.). Mapping was pe o med
wi h READemp ion e sion 0.4.3 (Fö s ne e al. 2014) wi h he a -
gumen –a80(NEB samples) o –a80–R(Taka a samples) and
wi h segemehl 0.2.0 (Ho mann e al. 2009). Gene quan i ica ion
was done wi h he READemp ion subcommand gene_quan i
wi h a gumen s –a–o10. Co e age plo s we e gene a ed wi h
he subcommand co e age and isualized wi h IGV (Robinson
e al. 2011). Read leng h dis ibu ion was analyzed wi h
SAM ools (Li e al. 2009). RNA deple ion e iciency was de ined
as
100 −DASH RNA eads % ∗100
no DASH RNA eads % .
SUPPLEMENTAL MATERIAL
Supplemen al ma e ial is a ailable o his a icle.
ACKNOWLEDGMENTS
We hank Elena Ka zowi sch om he Co e Uni SysMed a he
Uni e si y o Wü zbu g o excellen echnical suppo . This
wo k was suppo ed by he In e disziplinä e Zen um ü
Klinische Fo schung (IZKF) a he Uni e si y o Wü zbu g (p ojec
Z-6). G.P. was suppo ed by a g an o he Ge man Excellence
Ini ia i e o he G adua e School o Li e Sciences, Uni e si y o
Wü zbu g.
Recei ed Ap il 18, 2020; accep ed May 1, 2020.
REFERENCES
A che SK, Shi okikh NE, P eiss T. 2014. Selec i e and lexible deple-
ion o p oblema ic sequences om RNA-seq lib a ies a he cDNA
s age. BMC Genomics 15: 401. doi:10.1186/1471-2164-15-401
Be in V, Pena anda C, Bandyopadhyay N, Yang R, Abi ua A,
Bha acha yya RP, Fan A, A aham R, Li ny J, Sho esh N, e al.
2019. Hyb idiza ion-based cap u e o pa hogen mRNA enables
pai ed hos -pa hogen ansc ip ional analysis. Sci Rep 9: 19244.
doi:10.1038/s41598-019-55633-6
By ne A, Supple MA, Volden R, Laid e KL, Shapi o B, Vollme s C.
2019. Deple ion o hemoglobin ansc ip s and long- ead se-
quencing imp o es he ansc ip ome anno a ion o he pola
bea (U sus ma i imus). F on Gene 10: 643. doi:10.3389/ gene
.2019.00643
Cas o TL, Sey e N, Ramos RT, Ba bosa S, Ca alho RD, Pin o AC,
Ca nei o AR, Sil a WM, Pacheco LG, Downson C, e al. 2013.
Ion o en -based ansc ip ional assessmen o a
Co ynebac e ium pseudo ube culosis equi s ain e eals dena u -
ing high-pe o mance liquid ch oma og aphy a p omising RNA
deple ion me hod. Mic ob Bio echnol 6: 168–177. doi:10.1111/
1751-7915.12020
Chugani S, Kim BS, Pha a asukol S, B i nache MJ, Choi SH,
Ha wood CS, G eenbe g EP. 2012. S ain-dependen di e si y in
RNA deple ion in bac e ia ia DASH
www. najou nal.o g 1077