ORIGINAL RESEARCH
published: 15 May 2017
doi: 10.3389/ micb.2017.00834
F on ie s in Mic obiology | www. on ie sin.o g 1May 2017 | Volume 8 | A icle 834
Edi ed by:
Lau e Weisskop ,
Uni e si y o F ibou g, Swi ze land
Re iewed by:
Da id Bal us,
Uni e si y o A izona, USA
Ra aella Bales ini,
Consiglio Nazionale Delle Rice che,
I aly
*Co espondence:
Sebas iàn Lòpez-Fe nàndez
[email p o ec ed]
Special y sec ion:
This a icle was submi ed o
Plan Mic obe In e ac ions,
a sec ion o he jou nal
F on ie s in Mic obiology
Recei ed: 24 Janua y 2017
Accep ed: 24 Ap il 2017
Published: 15 May 2017
Ci a ion:
Lòpez-Fe nàndez S, Mazzoni V,
Ped azzoli F, Pe o I and Campisano A
(2017) A Phloem-Feeding Insec
T ans e s Bac e ial Endophy ic
Communi ies be ween G ape ine
Plan s. F on . Mic obiol. 8:834.
doi: 10.3389/ micb.2017.00834
A Phloem-Feeding Insec T ans e s
Bac e ial Endophy ic Communi ies
be ween G ape ine Plan s
Sebas iàn Lòpez-Fe nàndez1, 2, 3*, Vale io Mazzoni1, Fede ico Ped azzoli4, Ila ia Pe o 1, 5
and And ea Campisano1
1Resea ch and Inno a ion Cen e, Fondazione Edmund Mach, San Michele all’Adige, I aly, 2In ec ion Biology Depa men ,
Ins i u e o Mic obiology, Technische Uni e si ä B aunschweig, B aunschweig, Ge many, 3Depa men Mic obial D ugs,
Helmhol z Cen e o In ec ion Resea ch, B aunschweig, Ge many, 4Technology T ans e Cen e, Fondazione Edmund Mach,
San Michele all’Adige, I aly, 5Cen e Ag icul u e Food En i onmen , Uni e si y o T en o, T en o, I aly
Bac e ial endophy es colonize he inne issues o hos plan s h ough he oo s
o h ough discon inui ies on he plan su ace, including wounds and s oma a.
Li le is known ega ding a possible ole o insec s in acqui ing and ansmi ing
non-phy opa hogenic mic oo ganisms om plan o plan , especially hose endophy es
ha a e bene icial symbion s p o iding plan p o ec ion p ope ies and homeos a ic
s abili y o he hos . To unde s and he ecological ole o insec s in he ansmission
o endophy ic bac e ia, we used eshly ha ched nymphs o he Ame ican sap- eeding
lea hoppe Scaphoideus i anus ( ec o ) o ans e mic oo ganisms ac oss g ape ine
plan s. A e con ac wi h he ec o , sink plan s we e colonized by a complex endophy ic
communi y domina ed by P o eobac e ia, highly simila o ha p esen in sou ce plan s. A
simila bac e ial communi y, bu wi h a highe a io o Fi micu es, was ound on S. i anus.
Insec s eeding only on sink plan s ans e ed an en i ely di e en bac e ial communi y
domina ed by Ac inobac e ia, whe e Mycobac e ium sp., played a majo ole. Despi e
he ac ha insec s dwelled mos ly on plan s ems, he bac e ial communi ies in plan
oo s esembled mo e closely hose inside and on insec s, when compa ed o hose o
abo e-g ound plan o gans. We p o e he e he po en ial o insec ec o s o ans e
en i e endophy ic bac e ial communi ies be ween plan s. We also desc ibe he ole o
plan s and bac e ial endophy es in es ablishing mic obial communi ies in plan - eeding
insec s.
Keywo ds: endophy es, py osequencing, molecula ecology, insec s, g ape ine
INTRODUCTION
Plan s a e open sys ems ha cons an ly acqui e wa e and nu ien s om he soil and in e ac wi h
he as biological di e si y o he su oundings (Médiène e al., 2011). This di e si y encompasses
o he plan s, animals (i.e., p o ozoa, annelids, nema odes, a h opods, and e eb a es) and
mic oo ganisms. The complex in e ac ion among hese di e se playe s in luences c op heal h and
p oduc i i y (A angana e al., 2014). A be e unde s anding o he ou come o hese in e ac ions
is c ucial o imp o ing sus ainable c op managemen and a he same ime o iden i ying new
app oaches o pes managemen .
Insec s and o he in e eb a es can ansmi di e se mic obial plan pa hogens (e.g., i uses,
phy oplasmas, ungi, and bac e ia). Mos insec ec o s belong o he Hemip e a, an o de
Lòpez-Fe nàndez e al. An Insec T ans e s Bac e ial Endophy es in G ape ine
cha ac e ized by pie cing and sucking mou hpa s ha enable
eeding om phloem o xylem essels and, consequen ly,
allow hem o acqui e and ansmi phy opa hogens. Fo
example plan hoppe s and lea hoppe s can ansmi nume ous
phy oplasmas, i uses and bac e ia (Ha is and Ma amo osch,
1980). The ansmission o insec -bo ne pa hogens and he
ecological ole o insec s as ec o s o pa hogenic mic oo ganisms
ha e been deeply s udied in nume ous c ops (Wein aub and
Beanland, 2006). Mechanis ically, he e a e simila i ies (modes
o acquisi ion and deli e y) in he insec -media ed ansmission
o indi idual mu ualis s and pa hogens be ween plan s (B igh
and Bulghe esi, 2010; Pè ez-B ocal e al., 2013). Howe e , li le
is known abou he e ec s o ansmi ing en i e communi ies
o mu ualis symbion s and he implica ions o his ansmission
in plan hos i ness. In addi ion, in o ma ion ega ding he
po en ial use o ansmi ed mu ualis s as a p ophylac ic ool in
plan p o ec ion and he ecological implica ions o a possible
na u al inocula ion wi h such mic oo ganisms by phloem-
eeding insec s is lacking.
We chose he Ame ican g ape ine lea hoppe , Scaphoideus
i anus (Hemip e a: Cicadellidae), as insec model because his
species has been la gely s udied as ec o o he la escence do ée
phy oplasma (FDP). S. i anus is mono ol ine and specialis on
g ape ine, which means ha i li es and eeds on g ape ine
om ha ched nymphs o adul s (Chuche and Thié y, 2014).
The li e cycle o he insec begins in summe wi h he egg
laying in he ba k o woody s ems o g ape ine, ollowed by
a win e diapause wi h g adual ha chings occu ing om May
o ea ly Augus . Nymphs ( i e ins a s) emain mos o he
ime on he abaxial side o lea es o he plan hey ha ched
on. Unde labo a o y condi ions, a a empe a u e o 23–25◦C,
he ime lapse om egg ha ching o adul hood is ∼30 days.
The adul s can li e o se e al weeks and emales su i e on
a e age 60 days (Je mini e al., 2015). S. i anus is mainly a
phloem eede , al hough mou h s yle s can e enly pie ce bo h
phloem and xylem essels (Chuche e al., 2011). While eeding,
he insec can acqui e FDP ha can be hen ansmi ed o
o he g ape ines in a pe sis en -p opaga i e manne (Foissac and
Wilson, 2009). The ansmission p ocess includes an incuba ion
pe iod o abou 1 mon h du ing which phy oplasmas mul iply,
mos ly in he o e- and mid-gu , and accumula e in he sali a y
glands un il hey each a densi y ha pe mi s ansmission
(Chuche and Thié y, 2014). The e iciency o FDP acquisi ion
is co ela ed wi h phy oplasma i e in he sou ce plan (Gale o
e al., 2016). The ansmission is non- anso a ial, which means
ha newbo n nymphs do no ca y he mic oo ganism, bu a he
hey acqui e i om in ec ed plan s. S. i anus engages in mul iple
symbioses wi h bac e ia, including Ca dinium sp., Asaia sp.,
and yeas -like endosymbion s (Sacchi e al., 2008). Endophy es
asymp oma ically colonize he inne issues o plan s (Schulz
and Boyle, 2006). Plan coloniza ion mechanisms o bac e ial
endophy es a e complex and symbiosis genes in he genomes o
he mic obe, in e -kingdom signaling be ween he plan and he
bac e ium and plan immuni y may play impo an oles in i ,
as is he case in many o he plan -mic oo ganisms in e ac ions
(Iniguez e al., 2005; Reinhold-Hu ek and Hu ek, 2011; Kusa i
e al., 2015). The coloniza ion o he plan may esul in e ec s
ha span om plan g ow h p omo ion by ni ogen ixa ion
(San oyo e al., 2016) o an agonis ic p ope ies agains plan
pa hogens (Rabha e al., 2014) and syn hesis o exogenous plan
ho mones ha media e de elopmen al p ocesses in he plan
(Khan e al., 2012). Coloniza ion o bac e ial endophy es is issue-
speci ic (Quad -Hallmann e al., 1997). While many endophy ic
bac e ia can in ec and colonize he plan issues h ough he
oo s and mo e up o he s ems (Compan e al., 2008, 2013),
some endophy es a e known o pene a e he lea es o he plan ,
possibly h ough s oma a (Compan e al., 2010). In addi ion,
e ical ansmission o endophy es has also been demons a ed
by he ac ha colonized seeds can be a majo sou ce o he plan ’s
endomic obiome (T uyens e al., 2015).
The use o endophy es o disease biocon ol has been
pos ula ed in di e se symbiosys ems and he e ec i eness o
endophy es o plan p o ec ion and plan g ow h p omo ion
has been demons a ed (Me cado-Blanco and Lug enbe g, 2014).
Howe e , he ansmission o plan s o bene icial bac e ia
by insec s is s ill poo ly unde s ood. E idence sugges s he
ansmission o endosymbion s o S. i anus (namely Asaia sp.
and Ca dinium sp.) h ough eeding (Gonella e al., 2015).
These mic oo ganisms can also be ans e ed om insec o
insec by he ene eal ou e, du ing copula ion and hen om
insec o plan by eeding. Whe he o no hese symbion s
can su i e as endophy es o plan s is s ill unclea . In addi ion,
epo s show he ho izon al ansmission o a common bac e ial
endophy e, Me hylobac e ium mesophilicum, o Ca ha an hus
oseus plan s h ough he lea hoppe Bucephalogonia xan hophis
(Gai e al., 2009). In his wo k, he bac e ium isola ed as an
endophy e om ci us plan s was ans o med wi h an enhanced
G een Fluo escen P o ein (eGFP)-encoding plasmid, and hen
ans e ence expe imen s we e se up whe e he bac e ium was
acked wi h he eGFP signal inside he plan s and in he insec .
The ansmission o endophy es by insec s is a p omising
subjec o s udy, no only because i may allow he econs uc ion
o an impo an s ep in hei ecology, bu also because i may
enable he e icien deli e y o bene icial mic oo ganisms o
c ops. Fo his eason, he aim o his wo k was o assess he
ansmission by S. i anus o he endophy ic bac e ial communi y
om g ape ine plan s na u ally colonized by endophy es o
mic op opaga ed, bac e ia- ee g ape ine plan le s. Using 454
sequencing and qPCR assis ed acking o endophy es, he
s uc u e o he endophy ic bac e ial communi y was elucida ed.
In addi ion, he ole o S. i anus as ec o o bac e ial endophy ic
communi ies was es ablished. Mo eo e , he e ec o plan
and insec hos s in endophy ic communi y s uc u e e ealed
in e ac ions in he i-pa i e sys em (sou ce plan , sink plan and
insec ec o ).
MATERIALS AND METHODS
Plan Ma e ial
Fou 2-yea -old g ape ine (Vi is ini e a L.) plan s (c . Pino
noi g a ed on Kobe 5BB) we e g own unde g eenhouse-
con olled condi ions a 24 ±1◦C, 70 ±10% ela i e humidi y
(RH) and a pho ope iod o 16L:8D h. Plan s we e g own
in po s on an o ganic plan subs a e and we e no ea ed
F on ie s in Mic obiology | www. on ie sin.o g 2May 2017 | Volume 8 | A icle 834
Lòpez-Fe nàndez e al. An Insec T ans e s Bac e ial Endophy es in G ape ine
wi h any pes icides o he en i e cou se o he expe imen s.
These plan s a e he ea e e e ed o as “sou ce” (SRC),
since hey hos he ypical complex mic obial communi y o
plan s g own unde na u al condi ions (Campisano e al.,
2014a).
A o al o 35 in i o axenically mic op opaga ed g ape ine
plan le s c Pino noi clone I-SMA 185 Co e —[Associazione
cos i u o i i icoli i aliani (ACOVIT); Co e i, 1992] we e
p epa ed. Homogeneous (mean weigh =0.409 g; s anda d
de ia ion =0.058 g) and coe al heal hy plan le s wi h a leas
h ee lea es we e selec ed o he expe imen s. B ie ly, he
plan le s we e mic op opaga ed in cylind ical glass ubes on
comple e Mu ashige-Skoog (MS) medium pH 5.6 supplemen ed
wi h 3% suc ose and 0.6% mic oaga (Duche a biochemie,
The Ne he lands). Explan s wi h one node and in e node we e
incuba ed in a g ow h chambe o 51 days a 21 ±1◦C,
16L:8D h pho ope iod and a pho on i adiance o 50 µm
s/m2. These in i o plan le s a e he ea e e e ed o as “sink”
plan s (SNK) and hey ep esen he plan s whe e he bac e ial
communi y will be deli e ed. To u he exclude any bac e ial
p esence in he issues, 10 o hese 35 SNK we e used as
con ols.
Insec s
S. i anus eggs o igina ed om 2-yea -old g ape ine canes
collec ed om o ganic a ms in No he n I aly (Villazzano,
T en o, I aly, 46◦05′N, 11◦14′E) du ing he i s week o
Decembe 2014 and s o ed in a cool chambe (4 ±1◦C).
S a ing om he beginning o Ap il 2015, bundles o canes
(0.5 kg) we e weekly placed inside plas ic boxes con aining
humid Pe li e (Pe li ech, I aly) in a clima e chambe (24 ±
1◦C, 16L:8D h pho ope iod, 75% RH) whe e, a e 30–60 days,
eggs g adually ha ched. F eshly ha ched nymphs (IN) we e
emo ed daily and gen ly ans e ed o a SRC using a suc ion
aspi a o .
Expe imen al Design
The ansmission expe imen (Figu e 1) was ca ied ou
independen ly ou imes, using new plan s and insec s. Fou
SRC we e kep unde cons an en i onmen al condi ions as
men ioned abo e. Then, 96 IN we e placed and con ined on o
ou well de eloped SRC lea es, whe e es ic ed a eas we e
delimi ed by small cages ( ou cages pe plan , wi h six INs each
o a o al o 24 insec s pe plan ) made ou o a mesh slee e (250
µm mesh size) and a suppo ing plas ic cylind ical s uc u e (ø =
10 cm; h =20 cm). The IN we e le eed and g ow o 14 days un il
hey eached a s age be ween he hi d and ou h nymphal ins a .
Then, ou o he 96 IN p e iously ans e ed, 48 indi iduals we e
collec ed om he SRC (12 IN pe SRC) and ans e ed o 16
SNK ( ou SNK wi h h ee IN pe each SRC). In addi ion, an
insec - ee SNK pe each SRC was included as a s e ili y con ol
o he eplica e. Be o e ans e ing he IN, su ace o he MS
medium suppo ing he mic op opaga ed SNK was o e laid wi h
1 ml o s e ile mel ed pa a in (Sigma-Ald ich, Ge many) in o de
o p e en he con amina ion o he g ow h medium and he
oo s by mic oo ganisms ca ied by IN. In his way, we could
assu e ha no con ac be ween he oo s o he g ow h medium
was aking place. Once ans e ed o he SNK, IN we e allowed
o eed o 10 days a 21◦C, 16L:8D h pho ope iod and a pho on
i adiance o 50 µm s/m2un il hey we e i h ins a nymphs o
adul s.
As con ol, i e SNK (CTRLSNK) we e each in es ed wi h i e
eshly ha ched nymphs (CTRLIN) ha had no been p e iously
ea ed on SRC, bu we e eeding only on SNK (Figu e 1B). In
addi ion, om he emaining en SNK, i e we e used o p obe
o bac e ial DNA in he plan ’s issues. To al plan DNA was
ex ac ed using he me hod p e iously desc ibed (Campisano
e al., 2014a) and he ex ac ed DNA was ampli ied using he
p ime pai 799F/1520R (Yousa e al., 2014). Since he i e es ed
plan s we e PCR nega i e (no ampli ica ion o bac e ial 16S DNA
gene), hey we e conside ed bac e ia- ee. Al hough p ime s 799F
FIGURE 1 | Expe imen al design. (A) Se up o endophy e ansmission expe imen s h ough Scaphoideus i anus—Tes s. (1) Sou ce plan s (SRC) we e in es ed
wi h insec s (IN); (2) insec s we e placed on sink plan s (SNK); (3) insec s and sink plan s we e incuba ed; (4) su aces o insec s we e washed (INSRUF); (5) insec s,
oo s (ROOTSNK), and s ems (STEMSNK) o sink plan s we e sepa a ed. Su ace s e iliza ion was pe o med be o e each DNA ex ac ion s ep. (B) Se up o
endophy e ansmission expe imen s h ough S. i anus—Con ols. (1) Con ol insec s (CTRLIN) we e le o ha ch on g ape ine unks; (2) con ol insec s we e placed
in con ol sink plan s (CTRLSNK); (3) con ol insec s and con ol sink plan s we e incuba ed, (4) con ol insec s, con ol oo s (CTRLROOT), and con ol s ems
(CTRLSTEM) we e sepa a ed. Su ace s e iliza ion was pe o med be o e each DNA ex ac ion s ep.
F on ie s in Mic obiology | www. on ie sin.o g 3May 2017 | Volume 8 | A icle 834
Lòpez-Fe nàndez e al. An Insec T ans e s Bac e ial Endophy es in G ape ine
and 1520R a e a uni e sal pai o 16S DNA ampli ica ion, s ill
some p oka yo es migh no ha e been de ec ed. Thus, he las
i e SNK plan le s we e used o con ol mic obial con amina ion
inside he issues. SNK we e incuba ed unde he same condi ions
wi hou IN. Then, plan s we e c ushed in a s e ile mo a wi h 1
ml phospha e bu e saline 1X, pH 7.2, and he esul ing ex ac
was pla ed on Lu ia-Be ani aga (LBA; Sigma Ald ich, Ge many)
and incuba ed a 30◦C o 5 days, a e which no g ow h was
eco ded.
A e he incuba ion pe iod, all SNK and IN we e asep ically
emo ed om he glass ubes. SNK we e cu in o s ems
(STEMSNK) and oo s (ROOTSNK); CTRLSNK we e likewise
cu in o CTRLROOT and CTRLSTEM samples. IN we e washed
wi h dis illed s e ile wa e by ho oughly o exing in o de
o dislodge he majo i y o su ace-adhe ing bac e ia. The
bac e ial cells in he washing wa e (INSURF) we e pelle ed by
cen i uga ion a 13,000 pm on a able op cen i uge and s o ed
a −20◦C be o e ex ac ing he DNA. All SRC, IN, CTRLIN,
STEMSNK, ROOTSNK, CTRLSTEM, and CTRLROOT we e
hen su ace-s e ilized by successi e washing in 98% e hanol o
wo min, 4% sodium hypochlo i e o 2 min and 70% e hanol
o 2 min as desc ibed p e iously (Panche e al., 2012), and hen
insed h ee imes wi h dis illed s e ile wa e . The wa e om he
inal washing s ep o all samples was pla ed on LBA and incuba ed
o 5 days a 30◦C o check o mic obial g ow h as a p oxy o
su ace disin ec ion e icacy.
DNA Ex ac ion, 16S DNA Ampli ica ion,
and Py osequencing
A e s e iliza ion, SRC, IN, CTRLIN, STEMSNK, ROOTSNK,
CTRLSTEM, and CTRLROOT we e asep ically ans e ed o
s e ile s ainless s eel capsules con aining s eel beads. The ma e ial
was ozen in liquid ni ogen o 5 min and c ushed in a Re sch
MM200 issue lyse (Qiagen, The Ne he lands) o 2 min a a
equency o 25 he z. The esul ing powde was weigh ed and
hen deoxy ibonucleic acids we e ex ac ed using he Fas DNATM
SPIN Ki o Soil (MP, Uni ed S a es) acco ding o manu ac u e ’s
ins uc ions. DNA om he INSURF samples was ex ac ed wi h
he same ki a e pelle ing and suspending he cells in ex ac ion
bu e be o e wo kup.
DNA was hen quan i ied in an UV-VIS nanod op
8,000 spec opho ome e (The mo Fische Scien i ic,
Uni ed S a es) and PCR-ampli ied using he p ime
pai 799F (AACMGGATTAGATACCCK) and 1520R
(AAGGAGGTGATCCAGCCGCA) a ge ing he V5–V9
16S DNA hype a iable egions wi hou ampli ica ion o plas id
DNA. These p ime s bea 454 adap o s and a sample-speci ic
ba code on he o wa d p ime . PCR was pe o med using he
Roche high ideli y Fas S a PCR sys em (Roche, Swi ze land)
in a inal olume o 25 µl. The ollowing olumes, eagen s and
concen a ions we e used: 2.5 µl ampli ica ion bu e 10X, 5 µl
MgCl225 mM, 0.5 µl e e se p ime 10 µM, 0.5 µl o wa d
p ime 10 µM, 2.5 µl dNTPs 25 mM, 1 µl DMSO, 2.5 Bo ine
se um albumin (BSA) 10 mg/ml, 0.4 µl HI-FI Taq polyme ase 5
U/µl and wa e . DNA was adjus ed o an ini ial concen a ion
o 3 ng/µl and o some samples dilu ions o 1:10 we e used
in o de o ob ain op imal ampli ica ion. Thi y cycles o PCR
we e ca ied ou acco ding o he manu ac u e ’s ins uc ions
wi h condi ions o ampli ica ion as ollows: 5 min o ini ial
dena u a ion a 95◦C, 30 s a 95◦C, 1 min o annealing a
53◦C, 2 min o ex ension a 72◦C, and a inal ex ension s ep 10
min a 72◦C. PCR p oduc s we e sepa a ed in a 1.5% aga ose
gel s ained wi h SYBR R
Sa e DNA Gel S ain (The mo Fishe
Scien i ic, Uni ed S a es), and isualized on a Gel Doc XR+
sys em (BiO-RAD, Uni ed S a es). The app op ia e ampli ica ion
bands we e excised om he gel. DNA was eco e ed using he
Pu eLink Quick gel ex ac ion Ki (The mo Fishe Scien i ic,
Uni ed S a es) acco ding o manu ac u e ’s ins uc ions. Th ee
di e en ampli ica ions o each sample we e pe o med and he
PCR p oduc s we e pu i ied om gel and pooled oge he o
py osequencing. Amplicons we e quan i ied wi h quan i a i e
PCR using he lib a y quan i ica ion ki Roche 454 Ti anium
(KAPA Biosys ems, Uni ed S a es) and pooled in equimola
a io in he inal amplicon lib a y. Py osequencing was ca ied
ou on he Roche GS FLX+sys em using he new XL+
chemis y dedica ed o long eads o up o 800 bp, ollowing he
manu ac u e ’s ecommenda ions.
Bac e ial 16S DNA Amplicon
Demul iplexing and S a is ical Analysis
Ou pu s om he 454 py osequencing we e analyzed using he
“Quan i a i e Insigh s in o Mic obial Ecology (QIIME)” pipeline,
e sion 1.9.0 (Capo aso e al., 2010b). The analysis consis ed o
decoding he sequence lowg am iles (SFF) and p oducing as a
and quali y iles wi h which leng h o sequences and quali y o
eads we e checked. Amplicon sequences we e demul iplexed
(assigned o sample pools) acco ding o hei ba coded p ime .
Only bac e ial sequences a leas 300 n long we e e ained.
Sequences we e unca ed when he quali y sco e in a 50 n long
sliding window wen below 25.
Chime ic PCR p oduc s we e iden i ied using USEARCH
6.1.544 (Edga , 2010). Ope a ional axonomic uni s (OTUs) we e
picked using a h eshold iden i y o 97% and he G eengenes
da abase, Augus 2013 e sion (DeSan is e al., 2006). USEARCH
clus e seeds we e used as ep esen a i es o OTUs, while
axonomy was assigned using USEARCH and he G eengenes
da abase as a empla e. Sequences assigned o chlo oplas s and
mi ochond ia we e emo ed. OTUs ep esen ed by only one o
wo eads (single ons and double ons) we e emo ed om he
OTU ables. The amplicons we e hen aligned de no o using
pynas (Capo aso e al., 2010a) and he alignmen was used o
gene a e a phylogene ic ee.
F om py osequencing we ob ained 1,404,963 eads om he
whole se o samples, wi h a median o 13,271 eads pe sample.
A e he i s quali y con ol s eps whe e we emo ed sho
sequences (<200 n ), mis-sequenced agmen s and mu a ed
amplicons, only 1,024,657 sequences we e le . Following emo al
o chime ic sequences using he Usea ch algo i hm, 871,497
emained as non-chime ic sequences. He e, a maximum o
31,039 sequences o IN samples and a minimum o 57 sequences
o CTRLIN samples we e ob ained, and a mean o 12,939
sequences o all he samples.
F on ie s in Mic obiology | www. on ie sin.o g 4May 2017 | Volume 8 | A icle 834
Lòpez-Fe nàndez e al. An Insec T ans e s Bac e ial Endophy es in G ape ine
Fo clus e ing OTUs, we picked a ep esen a i e se o
sequences ha u he ep esen ed he OTU wi h 97% accu acy,
esul ing in 2,005 g ouped sequences a ailable o analysis. Some
o he sequences ob ained we e ound o be o plan na u e
(plas id sequences) and we e emo ed, leading o a inal coun
o 1,923 sequences. F om hose, we emo ed he sequences ha
we e ep esen ed in <1% o he o al popula ion, ob aining an
OTU able wi h a o al o 447 OTUs ha we e de ined as clus e s
composed o h ee o mo e sequences.
Alpha- and be a-di e si y we e es ima ed on mul iple OTU
ables a e ied o 1,300 eads (conside ing he sample wi h
he lowes numbe o eads). Alpha-di e si y di e ences we e
es ed o s a is ical signi icance using 999 Mon e Ca lo
pe mu a ions and he p- alue ob ained co ec ed using he
Bon e oni co ec ion o mul iple compa isons. Be a-di e si y
was compu ed using he phylogene ic unweigh ed UniF ac
dis ances. PCoA plo s ende ing sample dis ances we e isualized
using Empe o and u he d awn in R. A K uskal–Wallis es
was used o assess i he di e en ial dis ibu ion o OTUs and
axa was s a is ically signi ican o all he a iables analyzed. The
mul i a ia e es ANOSIM o de ec di e ences be ween g oups
o samples was used as implemen ed in QIIME.
T ansmission and Quan i ica ion o
Endophy es h ough qPCR
To quan i y he bac e ia ans e ed by S. i anus ac oss plan s, we
used a simila se ing o he one desc ibed abo e. In his case, he
sou ce o inoculum is no he SRC, bu a bac e ial cell suspension
o cul i able endophy es isola ed om g ape ine unks in a
p e ious wo k. These bac e ia we e classi ied as En e obac e
ludwigii EnVs6, E. ludwigii EnVs2, and Pan oea agans PaV 9
(Campisano e al., 2015; Lòpez-Fe nàndez e al., 2015).
B ie ly, hese bac e ial endophy es we e ans o med wi h he
eGFP encoding plasmid pMP4655 (Bloembe g e al., 2000) as
ollows: bac e ia we e g own on LBA o 48 h a 30◦C. Then,
2 ml o supe op imal b o h amended wi h suc ose (SOC)
we e inocula ed wi h a single colony and incuba ed o 24 h
a 30◦C and 160 pm (Hanahan, 1983). Aliquo s o 400 µl o
his s a e cul u e we e inocula ed in o 40 ml o SOC b o h
and hen incuba ed o u he 24 h a 30◦C and 160 pm.
Cells we e hen cen i uged a 45,895 pm o 15 min a 4◦C,
and subsequen ly suspended in elec opo a ion bu e (glyce ol
10%, dis illed s e ile wa e main ained a <4◦C) o plasmid
inse ion in o he bac e ial cells. Th ee washing s eps we e
pe o med wi h elec opo a ion bu e , educing in hal es he
esuspension olume. A he end, aliquo s o 50 µl o bu e ed
imme sed (compe en ) bac e ia we e dispensed in ubes and
kep a −80◦C. Bac e ial cells we e hen gen ly mixed wi h 1
µg o he plasmid and incuba ed on ice o 30 min. La e ,
he mix u e was ans e ed o 0.2 cm elec opo a ion cu e es
(Bio ad, Uni ed S a es) and elec opo a ed a 1,500 mV, 25 µF,
and 200 . Cells we e immedia ely imme sed in 800 µl o
SOC and incuba ed a 30◦C and 160 pm o 2 h. Cul u es
we e cen i uged and hal o he olume disca ded. Then, cells
we e suspended in he emaining olume and pla ed on o LBA
supplemen ed wi h e acycline (20 µg/ml). T ans o man s we e
con i med by ampli ying he esis ance ma ke casse e e A/R,
p esen in he plasmid, wi h p ime s di ec ed owa d he gene, as
p e iously epo ed (Mølle e al., 2016).
Endophy ic cells bea ing he pMP4655 we e g own on LB
o 24 h and cell densi ies we e adjus ed o 3 ×107CFU/ml.
Then, cells we e cooled down on ice and washed h ee imes
wi h PBS 1X, pH 7.2. A e he las washing s ep, cells we e e-
suspended in 200 µl o a T is-EDTA-suc ose pH 8.0 solu ion
(TES: T is 10 mM, EDTA 1 mM, suc ose 5% w/ ) and dis ibu ed
in he lids o bo omless ( eplaced by a co on plug) 1.5 ml plas ic
ubes (Eppendo , Ge many). Lids we e co e ed wi h one laye o
s e ile pa a ilm (Bemis NA, Uni ed S a es).
S. i anus indi iduals we e ea ed as desc ibed abo e. Insec s
we e ans e ed o plas ic ubes wi h he lids hanging upside
down, and le o eed on he eGFP- agged bac e ia o 5 days.
In his se ing, insec s punched he pa a ilm laye on he lid,
eleasing and eeding om he bac e ia- ich TES solu ion.
A e eeding, insec s we e ans e ed o in i o
mic op opaga ed g ape ine plan le s, as desc ibed in he
expe imen s abo e. Pe each bac e ium es ed we pe o med one
se o ou eplica es consis ing o ou plan s in es ed wi h h ee
insec s pe plan plus one nega i e con ol whe e no insec s we e
ans e ed. Replica es we e incuba ed o 5 days. A he end
o he incuba ion, he insec s, oo s and s ems we e collec ed
sepa a ely. DNA om he insec s and plan s was ex ac ed
using he NucleoSpin R
Plan II ki ( o ROOTNSK, STEMSNK,
CTRLROOT, and CTRLSTEM) and he Nucleospin R
Tissue
( o IN and CTRLIN) acco ding o manu ac u e ins uc ions
(Mache ey-Nagel, Ge many). DNA was quan i ied as desc ibed
abo e.
Bac e ial DNA, including he pMP4655 eGFP encoding
plasmid, was quan i ied on a Roche Ligh Cycle R
480 Real-
Time PCR (Roche, Swi ze land) wi h he pla inum SYBR G een
qPCR supe Mix-UDG (The mo Fishe Scien i ic, Uni ed S a es).
The ollowing ampli ica ion p o ocol was used: 1 hold a 50◦C
ac i a ion (UDG incuba ion) o 5 min, 1 hold a 95◦C o 5
min ac i a ion, 40 cycles a 95◦C o 30 s o mel ing and a
58◦C o 45 s o annealing and ex ension. An analysis o mel ing
cu es a 95◦C o 5 s, ollowed by a down un il 55◦C o 1 min,
was pe o med o check o speci ici y o he eac ion. Absolu e
quan i ica ion o eGFP gene copies in plan s and insec s was done
based on in e pola ion om a s anda d cu e ob ained wi h se ial
10- old dilu ions o he eGFP gene ( om 3 ×106 o 3 ×101eGFP
gene copies/µl) in DNA o con ol plan s o insec s, espec i ely.
Nucleo ide Sequence Accession Numbe s
The sequencing ou pu is deposi ed a he Eu opean Nucleo ide
A chi e (ENA a h ps://www.ebi.ac.uk), and can be ound unde
he accession numbe ERS1629270, s udy name PRJEB20051.
RESULTS
Ou da a show ha he whole mic obial communi ies li ing
on he plan a e anspo ed be ween plan s by insec ec o s.
By eeding and ouching he plan , insec s acqui e a se o
mic oo ganisms ha adically di e s om hose hey ha e a
F on ie s in Mic obiology | www. on ie sin.o g 5May 2017 | Volume 8 | A icle 834

Lòpez-Fe nàndez e al. An Insec T ans e s Bac e ial Endophy es in G ape ine
ha ching. Insec s a e able o ca y and ans e his se o o he
plan s hey dwell and eed upon.
S uc u e o he Communi y in he Tes ed
G ape ine Symbiosys em
The ela i e abundances o bac e ial phyla a ied be ween
hos s. The con ol samples had a dis inc i ely di e en species
composi ion han he es samples (Figu e 2 and Table 1). In
he SRC, he bac e ial communi y was mainly composed o
P o eobac e ia, whe e he mos abundan classes we e Be a-,
Gamma-, and Alpha-p o eobac e ia. The es o he communi y
was composed o Ac inobac e ia (a majo i y in he class
Ac inobac e ia), Fi micu es (wi h mos membe s a ilia ed wi h
he class Bacilli), Bac e oide es ( he classes Sphingobac e iia
and Spi ospi ae made he majo i y o he phylum) and, in a
smalle p opo ion, Acidobac e ia ( ep esen ed only by he class
Solibac e es), and Chlamydiae ( ep esen ed only by he class
Chlamydiia). Only a small ac ion o he OTUs could no
be assigned o any pa icula axon. The bac e ial communi y
o IN was composed mos ly o P o eobac e ia ollowed by
Fi micu es, Ac inobac e ia, Bac e oide es, and Acidobac e ia, he
la e ep esen ing he leas abundan phylum. The INSURF
communi y was simila o he inne bac e ial mic obio a o IN
wi h he majo i y o OTUs assigned o P o eobac e ia, ollowed
by Fi micu es, Ac inobac e ia, Bac e oide es, and Acidobac e ia.
In ou analysis, only one OTU was exclusi ely associa ed wi h
he INSURF samples. Using Basic Local Alignmen Sea ch Tool
(BLAST), his sequence was assigned o he Sinobac e aceae, a
amily ha includes he closely ela ed wa e -sp ing associa ed
bac e ium Ne skia sp. This sequence was ne e de ec ed in any
plan sample o inside he insec s.
Mic obio a o he SNK was mos ly composed o
P o eobac e ia, wi h Be a- and Gamma-p o eobac e ia being he
mos abundan classes. Del ap o eobac e ia we e also p esen
and he es o he phyla had only ew ep esen a i es (Table 1).
A u he analysis o he endophy ic communi y composi ion
in he abo e- and below-g ound compa men s e ealed
di e ences in he wo plan compa men s. P o eobac e ial
OTUs in STEMSNK we e highly ep esen ed (in o de
o abundance: Be ap o eobac e ia, Gammap o eobac e ia,
Alphap o eobac e ia, and Del ap o eobac e ia). Ac inobac e ia,
Fi micu es, Acidobac e ia, Bac e oide es, and Chlamydiae we e
less abundan .
In ROOTSNK, P o eobac e ia we e also he mos abundan
OTUs (in o de o abundance: Be a-, Gamma-, Alpha-,
and Del a-p o eobac e ia). Ac inobac e ia, Fi micu es,
Acidobac e ia, Bac e oide es, Chlamydia, and he candida e
clade TM6 we e he leas abundan . In con as , he bac e ial
communi y o con ol plan s (CTRLROOT, CTRLSTEM, whe e
eshly ha ched insec s had ed wi hou p io con ac wi h
SRC) was domina ed by Ac inobac e ia, wi h only a small
p opo ion o P o eobac e ia (Be a- and Gamma-, bu no Alpha-
p o eobac e ia). The communi y in CRTLIN was also domina ed
by Ac inobac e ia.
Selec ed Endophy es A e T ansmi ed
be ween G ape ine Plan s
Fo y OTUs we e ans e ed by IN om SRC o SNK and
ound bo h in ROOTSNK and in STEMSNK (Table 2).
These we e ne e ound in he CTRLROOT o CTRLSTEM,
sugges ing ha hey we e e icien ly ansmi ed om
SRC o SNK by IN. In pa icula , among he sequences
FIGURE 2 | Rela i e abundance o OTUs assigned a he phylum le el. S acked ba plo s ep esen he pe cen ages o 216 membe s o he OTU able in biom
o ma . In he legend, unassigned co espond o OTUs whose axonomy could no be cla i ied a he 97% con idence using he G eengenes da abase.
F on ie s in Mic obiology | www. on ie sin.o g 6May 2017 | Volume 8 | A icle 834
Lòpez-Fe nàndez e al. An Insec T ans e s Bac e ial Endophy es in G ape ine
TABLE 1 | Rela i e abundance o OTUs in he symbiosys em S. i anus—g ape ine, assigned a phylum and class le el.
Phylum Class SRC IN STEMSNK ROOTSNK INSURF CTRLIN CTRLTROOT CTRLSTEM
Unassigned Unassigned 4.6 0.9 2.4 1.5 4.0 0.0 0.0 0.1
Acidobac e ia Acidobac e iia 0 0.1 0 0.2 0 0 0 0
DA052 clade 0.3 0.1 0.8 0.5 0.4 0 0 0
Solibac e es 0 0 0 0 0 0 0 0
To al 0.3 0.2 0.8 0.7 0.4 0.0 0.0 0.0
Ac inobac e ia Ac inobac e ia 5.3 4.6 19 13.1 8.2 99.5 94.5 98
The moleophilia 0 0 0.1 0 0 0 0 0
To al 5.3 4.6 19.1 13.1 8.2 99.5 94.5 98.0
Bac e oide es Bac e oidia 0.1 0 0 0.1 0 0 0 0
Cy ophagia 0 0.1 0.1 0 0 0 0 0
Fla obac e iia 0 0 0 0 0 0 0 0
Sphingobac e iia 0.5 0.2 0 0.1 0 0 0 0
Sap ospi ae 0.5 1 0.1 0.4 0.4 0 0 0
To al 1.1 1.3 0.2 0.6 0.5 0.0 0.0 0.0
Chlamydiae Chlamydiia 0.1 0 0.1 0.1 0.1 0 0 0
To al 0.1 0.0 0.1 0.1 0.1 0.0 0.0 0.0
Elusimic obia Elusimic obia 0 0 0 0 0.1 0 0 0
To al 0.0 0.0 0.0 0.0 0.1 0.0 0.0 0.0
FBP FBP 0 0 0 0 0 0 0 0
To al 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0
Fi micu es Bacilli 4.5 21.5 12.7 9.7 27.7 0 0 0.1
Clos idia 0.1 0.6 0.1 0.2 0.4 0 0 0
To al 4.6 22.1 12.8 10.0 28.1 0.0 0.0 0.1
Fusobac e ia Fusobac e iia 0 0 0 0 0.1 0 0 0
To al 0.0 0.0 0.0 0.0 0.1 0.0 0.0 0.0
Gemma imonade es Gemma imonade es 0 0 0 0 0 0 0 0
To al 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0
P o eobac e ia Alpha 13.9 2.7 5.7 4.4 2.1 0.2 0.2 0.1
Be a 36.6 29.5 40.9 45.9 31.8 0.2 4.9 0.1
Del a 0.7 0.3 0.3 0.4 0.5 0 0 0
Gamma 32.7 38.2 17.3 23 24.1 0 0.3 1.7
To al 83.9 70.6 64.3 73.8 58.5 0.4 5.4 1.9
SBR1093 VHS-B5-50 0 0 0 0 0 0 0 0
To al 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0
TM6 SJA-4 0 0 0 0.1 0 0 0 0
To al 0.0 0.0 0.0 0.1 0.0 0.0 0.0 0.0
The mi Deinococci 0 0.1 0.1 0 0 0 0 0
To al 0.0 0.1 0.1 0.0 0.0 0.0 0.0 0.0
o he main phyla (i.e., P o eobac e ia, Ac inobac e ia,
Bac e oide es, Chlamydiae, and Fi micu es), P o eobac e ia
we e he mos highly ep esen ed axon, whe e he
mos abundan gene a we e Ag obac e ium,Pa acoccus,
Sphingomonas, E winia,Pseudomonas,Lysobac e , and
S eno ophomonas.
In con as , he mos abundan phyla in CTRLIN we e
Ac inobac e ia, especially he gene a Mycobac e ium,
F on ie s in Mic obiology | www. on ie sin.o g 7May 2017 | Volume 8 | A icle 834
Lòpez-Fe nàndez e al. An Insec T ans e s Bac e ial Endophy es in G ape ine
TABLE 2 | OTUs ansmi ed om sou ce (SRC) o sink plan s (STEMSNK and ROOTSNK) by S. i anus.
OTU Phylum Class O de Family Genus Species
1 Ac inobac e ia Ac inobac e ia Ac inomyce ales Unclassi ied Unclassi ied Unclassi ied
2 Ac inobac e ia Ac inobac e ia Ac inomyce ales Co ynebac e iaceae Co ynebac e ium du um
3 Ac inobac e ia Ac inobac e ia Ac inomyce ales Geode ma ophilaceae Unclassi ied Unclassi ied
4 Ac inobac e ia Ac inobac e ia Ac inomyce ales Mic ococcaceae Kocu ia palus is
5 Ac inobac e ia Ac inobac e ia Ac inomyce ales Mic ococcaceae Mic ococcus lu eus
6 Ac inobac e ia Ac inobac e ia Ac inomyce ales Noca dioidaceae Unclassi ied Unclassi ied
7 Ac inobac e ia Ac inobac e ia Ac inomyce ales P opionibac e iaceae P opionibac e ium Unclassi ied
8 Bac e oide es Fla obac e iia Fla obac e iales Fla obac e iaceae Fla obac e ium Unclassi ied
9 Bac e oide es Sap ospi ae Sap ospi ales Chi inophagaceae Sediminibac e ium Unclassi ied
10 Chlamydiae Chlamydiia Chlamydiales Pa achlamydiaceae Unclassi ied Unclassi ied
11 Fi micu es Bacilli Bacillales Bacillaceae Bacillus lexus
12 Fi micu es Bacilli Bacillales S aphylococcaceae S aphylococcus au eus
13 Fi micu es Clos idia Clos idiales Tissie ellaceae Anae ococcus Unclassi ied
14 P o eobac e ia Alphap o eobac e ia Rhizobiales Phyllobac e iaceae Unclassi ied Unclassi ied
15 P o eobac e ia Alphap o eobac e ia Rhizobiales Rhizobiaceae Unclassi ied Unclassi ied
16 P o eobac e ia Alphap o eobac e ia Rhizobiales Rhizobiaceae Ag obac e ium Unclassi ied
17 P o eobac e ia Alphap o eobac e ia Rhodobac e ales Rhodobac e aceae Pa acoccus Unclassi ied
18 P o eobac e ia Alphap o eobac e ia Rhodospi illales Rhodospi illaceae Unclassi ied Unclassi ied
19 P o eobac e ia Alphap o eobac e ia Ricke siales Unclassi ied Unclassi ied Unclassi ied
20 P o eobac e ia Alphap o eobac e ia Sphingomonadales Sphingomonadaceae Unclassi ied Unclassi ied
21 P o eobac e ia Alphap o eobac e ia Sphingomonadales Sphingomonadaceae Kais obac e Unclassi ied
22 P o eobac e ia Alphap o eobac e ia Sphingomonadales Sphingomonadaceae Sphingomonas Unclassi ied
23 P o eobac e ia Be ap o eobac e ia Bu kholde iales Alcaligenaceae Ach omobac e Unclassi ied
24 P o eobac e ia Be ap o eobac e ia Neisse iales Neisse iaceae Unclassi ied Unclassi ied
25 P o eobac e ia Be ap o eobac e ia Neisse iales Neisse iaceae Unclassi ied Unclassi ied
26 P o eobac e ia Be ap o eobac e ia Neisse iales Neisse iaceae Kingella Unclassi ied
27 P o eobac e ia Be ap o eobac e ia Neisse iales Neisse iaceae Neisse ia Unclassi ied
28 P o eobac e ia Be ap o eobac e ia Neisse iales Neisse iaceae Neisse ia cine ea
29 P o eobac e ia Del ap o eobac e ia Unclassi ied Unclassi ied Unclassi ied Unclassi ied
30 P o eobac e ia Del ap o eobac e ia Myxococcales 0319-6G20 Unclassi ied Unclassi ied
31 P o eobac e ia Gammap o eobac e ia Al e omonadales Al e omonadaceae Ma inobac e Unclassi ied
32 P o eobac e ia Gammap o eobac e ia En e obac e iales En e obac e iaceae Unclassi ied Unclassi ied
33 P o eobac e ia Gammap o eobac e ia En e obac e iales En e obac e iaceae E winia Unclassi ied
34 P o eobac e ia Gammap o eobac e ia Legionellales Unclassi ied Unclassi ied Unclassi ied
35 P o eobac e ia Gammap o eobac e ia Pseudomonadales Pseudomonadaceae Pseudomonas ni o educens
36 P o eobac e ia Gammap o eobac e ia Xan homonadales Sinobac e aceae Unclassi ied Unclassi ied
37 P o eobac e ia Gammap o eobac e ia Xan homonadales Xan homonadaceae Lu eimonas Unclassi ied
38 P o eobac e ia Gammap o eobac e ia Xan homonadales Xan homonadaceae Lysobac e Unclassi ied
39 P o eobac e ia Gammap o eobac e ia Xan homonadales Xan homonadaceae S eno ophomonas Unclassi ied
40 TM6 SJA-4 Unclassi ied Unclassi ied Unclassi ied Unclassi ied
Go donia,Noca dia,Rhodococcus, and Williamsia.
CTRLROOT and CTRLSTEM hos ed a communi y ha
esembled ha o he CTRLIN (Table 1). Fo example, he
genus Noca dia was de ec ed in all sample ypes, bu i s
p e alence was lowes in CTRLROOT samples. Likewise,
Rhodococcus and Ae omic obium we e less abundan
in CTRLROOT and CTRLSTEM han in CTRLIN. An
excep ion was he genus Williamsia, which was mo e
abundan in CTRLROOT and CTRLSTEM han in
CTRLIN.
Endophy ic Communi ies Mo e om
S ems o Roo s a e he T ans e P ocess
To iden i y coloniza ion dynamics o ansmi ed endophy es, we
compa ed he communi y in abo e- and below-g ound pa s o
he plan (ROOTSNK s. STEMSNK). In ou expe imen al se up,
plan oo s we e ex e nally sepa a ed om he s ems by a pa a in
laye placed o a oid su ace con amina ion o he syn he ic
medium. Ou da a hus indica e ha se e al OTUs we e de ec ed
bo h in STEMSNK and ROOTSNK, including S ep ococcus,
S e oidobac e ,Rals onia,Pseudomonas, and Me hylobac e ium.
F on ie s in Mic obiology | www. on ie sin.o g 8May 2017 | Volume 8 | A icle 834
Lòpez-Fe nàndez e al. An Insec T ans e s Bac e ial Endophy es in G ape ine
ROOTSNK had mo e P o eobac e ia han STEMSNK, while
Ac inobac e ia we e mo e abundan in STEMSNK han in
ROOTSNK.
STEMSNK samples we e domina ed by P o eobac e ia (Be a-
Gamma-, Alpha-, and Del a-p o eobac e ia). Ac inobac e ia,
Fi micu es, Acidobac e ia, Bac e oide es, and Chlamydiae
we e he leas abundan phyla. Simila ly, in ROOTSNK
P o eobac e ia ep esen ed mos o he communi y, ollowed
by he Ac inobac e ia, Fi micu es, Acidobac e ia, Bac e oide es,
Chlamydiae, and he candida e phylum TM6.
To e i y o insec ansmission, we also e alua ed he
endophy ic communi ies in abo e- and below-g ound pa s o
con ol sink plan s (CTRLSTEM and CTRLROOT) in con ac
only wi h CTRLIN. The bac e ial communi y o CTRLSTEM and
CTRLTROOT, whe e eshly ha ched CTRLIN had ed wi hou
p io con ac wi h SRC, was domina ed by Ac inobac e ia wi h a
small p opo ion o P o eobac e ia (Be a- and Gamma-, bu no
Alphap o eobac e ia we e p esen ).
Insec s Change he Communi y S uc u e
du ing Passage om Sou ce o Sink Plan s
To iden i y shi s in bac e ial communi y composi ion in he
ans e ing p ocess, we analyzed di e si y o e e y hos ype and
compa ed hei signi icance a a la ge scale (highe axonomic
hie a chy o phylum le el) and in some cases a a small scale
(genus le el).
The la ges di e si y was p esen in ROOTSNK ollowed
by STEMSNK. The hi d mos di e se mic obio a was ha o
SRC ollowed by IN (Figu e 3). In e ms o ichness, a la ge
numbe o new species was de ec ed in SRC (obse ed species
and Chao 1 index), hough he numbe o species in IN acqui ed
du ing eeding was less han a hal o wha i had been in
he SRC (Figu e 3 and Supplemen a y Figu e 1). In addi ion,
a iance wi hin samples was la ge in IN as compa ed o SRC,
sugges ing di e ences in species composi ion in each sample.
In STEMSNK he ichness inc eased conside ably mo e han in
he below-g ound pa o he plan , wi h a high a iance wi hin
samples, sugges ing ha he communi y ha was p e iously
s able in SRC was dis u bed in he SNK a e acquisi ion and
ansmission by IN. When looking a Shannon-Wiene and
Simpson’s indexes, di e si y was ound o be highe in SRC
(abundance o new species is la ge and e en) and lowe
in IN (Supplemen a y Table 1A). When he communi y was
ans e ed o STEMSNK, i s di e si y inc eased. The s anda d
a ia ion wi hin samples inc eased om SRC (0.878) o IN
(10.52), sugges ing less e enness pe sample. When passing
o he SNK, he s anda d a ia ion dec eased (STEMSNK =
10.52 and ROOTSNK =0.430), poin ing o a eco e y o
he communi y when mo ing om he insec o he plan
hos . Al hough INSURF had ew new species pe sample, he
di e si y was nea o ha o he o he samples, hin ing a
he possibili y o an inpu o insec su ace-associa ed bac e ia
o he endophy ic communi y (Supplemen a y Table 1A). The
di e si y o he con ols di e ed om ha o he ea ed samples.
The lowes di e si y and ichness we e eco ded o CTRLIN,
CTRLROOT, and CTRLSTEM. Ra e ac ion cu e analysis
(Supplemen a y Figu e 1) con i med ha he iches samples
we e SRC and he compa men s o he sink plan s (STEMSNK
and ROOTSNK), ollowed by he INSURF mic obiome and
by he inne mic obiome IN. CTRLROOT we e he poo es
samples in e ms o new species because no new OTUs being
disco e ed a e a sampling e o o 1,505 sequences/sampling.
FIGURE 3 | Alpha di e si y measu es on ansmission expe imen s. Alpha di e si y indexes (Richness: Obse ed species, Chao1; Di e si y: Shannon-Wiene ,
and Simpson) we e calcula ed on he OTU able a he phylum le el. Reads we e a e ied o 1,300 sequences o ha e an e en ep esen a ion o OTUs in each sample
ca ego y (o hos ).
F on ie s in Mic obiology | www. on ie sin.o g 9May 2017 | Volume 8 | A icle 834
Lòpez-Fe nàndez e al. An Insec T ans e s Bac e ial Endophy es in G ape ine
REFERENCES
A angana, A., Khasa, D., Chang, S., and Deg ande, A. (2014). “Ecological
in e ac ions and p oduc i i y in ag o o es y sys ems,” in T opical
Ag o o es y (Do d ech : Sp inge Ne he lands), 151–172. A ailable online a :
h p://link.sp inge .com/10.1007/978-94-007-7723-1_7 (Accessed Janua y 17,
2017).
Bacilio-Jimenez, M., Aguila -Flo es, S., Ven u a-Zapa a, E., Pé ez-Campos, E.,
Bouquele , S., e al. (2003). Chemical cha ac e iza ion o oo exuda es om
ice (O yza sa i a) and hei e ec s on he chemo ac ic esponse o endophy ic
bac e ia. Plan Soil 2, 271–277. doi: 10.1023/A:1022888900465
Bloembe g, G. V., Wij jes, A. H. M., Lame s, G. E. M., S uu man, N., and
Lug enbe g, B. J. J. (2000). Simul aneous imaging o Pseudomonas luo escens
WCS365 popula ions exp essing h ee di e en au o luo escen p o eins in he
hizosphe e: new pe spec i es o s udying mic obial communi ies. Mol. Plan
Mic obe In e ac . 13, 1170–1176. doi: 10.1094/MPMI.2000.13.11.1170
B igh , M., and Bulghe esi, S. (2010). A complex jou ney: ansmission o mic obial
symbion s. Na . Re . Mic obiol. 8, 218–230. doi: 10.1038/n mic o2262
Bulga elli, D., Schlaeppi, K., Spaepen, S., an Themaa , E. V. L., and Schulze-Le e ,
P. (2013). S uc u e and unc ions o he bac e ial mic obio a o plan s. Annu.
Re . Plan Biol. 64, 807–838. doi: 10.1146/annu e -a plan -050312-120106
Campisano, A., An onielli, L., Panche , M., Yousa , S., Pindo, M., and Pe o , I.
(2014a). Bac e ial endophy ic communi ies in he g ape ine depend on pes
managemen . PLoS ONE 9:e112763. doi: 10.1371/jou nal.pone.0112763
Campisano, A., Ome o, L., Compan , S., Panche , M., An onielli, L., Yousa ,
S., e al. (2014b). In e kingdom ans e o he acne-causing agen ,
P opionibac e ium acnes, om human o g ape ine. Mol. Biol. E ol. 31,
1059–1065. doi: 10.1093/molbe /msu075
Campisano, A., Panche , M., Puopolo, G., Puddu, A., Lòpez-Fe nàndez, S., Biagini,
B., e al. (2015). Di e si y in endophy e popula ions e eals unc ional and
axonomic di e si y be ween wild and domes ica ed g ape ines. Am. J. Enol.
Vi ic. 66, 12–21. doi: 10.5344/aje .2014.14046
Capo aso, J. G., Bi inge , K., Bushman, F. D., DeSan is, T. Z., Ande sen, G. L., and
Knigh , R. (2010a). PyNAST: a lexible ool o aligning sequences o a empla e
alignmen . Bioin o ma ics 26, 266–267. doi: 10.1093/bioin o ma ics/b p636
Capo aso, J. G., Kuczynski, J., S ombaugh, J., Bi inge , K., Bushman, F.
D., Cos ello, E. K., e al. (2010b). QIIME allows analysis o high-
h oughpu communi y sequencing da a. Na . Me hods 7, 335–336.
doi: 10.1038/nme h. .303
Chuche, J., and Thié y, D. (2014). Biology and ecology o he Fla escence
do ée ec o Scaphoideus i anus: a e iew. Ag on. Sus ain. De . 34, 381–403.
doi: 10.1007/s13593-014-0208-7
Chuche, J., Thié y, D., and Mazzoni, V. (2011). Do Scaphoideus i anus
(Hemip e a: Cicadellidae) nymphs use ib a ional communica ion?
Na u wissenscha en 98, 639–642. doi: 10.1007/s00114-011-0808-x
Compan , S., Clémen , C., and Sessi sch, A. (2010). Plan g ow h-p omo ing
bac e ia in he hizo- and endosphe e o plan s: hei ole, coloniza ion,
mechanisms in ol ed and p ospec s o u iliza ion. Soil Biol. Biochem. 42,
669–678. doi: 10.1016/j.soilbio.2009.11.024
Compan , S., Kaplan, H., Sessi sch, A., Nowak, J., Ai Ba ka, E., and Clèmen ,
C. (2008). Endophy ic coloniza ion o Vi is ini e a L. by Bu kholde ia
phy o i mans s ain PsJN: om he hizosphe e o in lo escence issues: FEMS
Mic obiol. Ecol. 63, 84–93. doi: 10.1111/j.1574-6941.2007.00410.x
Compan , S., Muzammil, S., Leb ihi, A., and Ma hieu, F. (2013). Visualiza ion o
g ape ine oo coloniza ion by he Saha an soil isola e Saccha o h ix alge iensis
NRRL B-24137 using DOPE-FISH mic oscopy. Plan Soil 370, 583–591.
doi: 10.1007/s11104-013-1648-6
Compan , S., Rei e , B., Sessi sch, A., Nowak, J., Clemen , C., and Ai Ba ka,
E. (2005). Endophy ic Coloniza ion o Vi is ini e a L. by plan g ow h-
p omo ing bac e ium Bu kholde ia sp. s ain PsJN. Appl. En i on. Mic obiol.
71, 1685–1693. doi: 10.1128/AEM.71.4.1685-1693.2005
Co e i, P. (1992, Ap il 12). Associazione Cos i u o i Vi icoi I aliani (ACOVIT).
Va ie à Pino Ne o N. A ailable online a : h ps://www.aco i .i /u e-da- ino/
149-pino -ne o-n
DeSan is, T. Z., Hugenhol z, P., La sen, N., Rojas, M., B odie, E. L., Kelle , K.,
e al. (2006). G eengenes, a chime a-checked 16S RNA gene da abase and
wo kbench compa ible wi h ARB. Appl. En i on. Mic obiol. 72, 5069–5072.
doi: 10.1128/AEM.03006-05
Diao, H., Yan, H. L., Xiao, Y., Yu, B., Yu, J., He, J., e al. (2016). In es inal mic obio a
could ans e hos Gu cha ac e is ics om pigs o mice. BMC Mic obiol.
16:238. doi: 10.1186/s12866-016-0851-z
Edga , R. C. (2010). Sea ch and clus e ing o de s o magni ude as e han BLAST.
Bioin o ma ics 26, 2460–2461. doi: 10.1093/bioin o ma ics/b q461
Fa and, S. K., Qin, Y., and Oge , P. (2002). “Quo um-sensing
sys em o Ag obac e ium plasmids: analysis and u ili y,” in
Me hods in Enzymology (Else ie ), 452–484. A ailable online a :
h p://linkinghub.else ie .com/ e ie e/pii/S0076687902581088 (Accessed
Janua y 17, 2017).
Foissac, X., and Wilson, M. R. (2009). “Cu en and possible u u e
dis ibu ions o phy oplasma diseases and hei ec o s,” in Phy oplasmas:
Genomes, Plan Hos s and Vec o s, eds P. G. Wein aub and P.
Jones (Walling o d, CT: CABI), 309–324. A ailable online a :
h p://www.cabi.o g/cabebooks/ebook/20093353140 (Accessed Janua y
17, 2017).
Gai, C. S., Laca a, P. T., Quecine, M. C., Au iac, M.-C., Lopes, J. R. S.,
A aújo, W. L., e al. (2009). T ansmission o Me hylobac e ium mesophilicum
by Bucephalogonia xan hophis o pa a ansgenic con ol s a egy o Ci us
a iega ed chlo osis. J. Mic obiol. 47, 448–454. doi: 10.1007/s12275-008-0303-z
Gale o, L., Milio dos, D., Pego a o, M., Sacco, D., Ve a i, F., Ma zachì, C.,
e al. (2016). Acquisi ion o Fla escence Do ée phy oplasma by Scaphoideus
i anus Ball om di e en g ape ine a ie ies. In . J. Mol. Sci. 17:1563.
doi: 10.3390/ijms17091563
Genin, S. (2010). Molecula ai s con olling hos ange and adap a ion o
plan s in Rals onia solanacea um: esea ch e iew. New Phy ol. 187, 920–928.
doi: 10.1111/j.1469-8137.2010.03397.x
Glad, C., Regna d, J. L., Que ou, Y., B un, O., and Mo o -Gaud y, J. F. (1992).
Phloem sap exuda es as a c i e ion o sink s eng h app ecia ion in Vi is
ini e a c . Pino noi g ape ines. Vi is 31, 131–138.
Gonella, E., Pajo o, M., Ma zo a i, M., C o i, E., Mand ioli, M., Pon ini, M., e al.
(2015). Plan -media ed in e speci ic ho izon al ansmission o an in acellula
symbion in insec s. Sci. Rep. 5:15811. doi: 10.1038/s ep15811
Hamil on, N. (2016). gg e n: An Ex ension o ‘ggplo 2’, o he C ea ion
o Te na y Diag ams. R Package Ve sion 2.1.5. A ailable online a :
h ps://CRAN.R-p ojec .o g/package=gg e n
Hanahan, D. (1983). S udies on ans o ma ion o Esche ichia coli wi h plasmids. J.
Mol. Biol. 166, 557–580. doi: 10.1016/S0022-2836(83)80284-8
Hanano, A., Ha ba, M., Al-Ali, M., and Ammouneh, H. (2014). Silencing o
E winia amylo o a sy69 AHL-quo um sensing by a Bacillus simplex AHL-
inducible aiiA gene encoding a zinc-dependen N- acyl-homose ine lac onase.
Plan Pa hol. 63, 773–783. doi: 10.1111/ppa.12142
Ha is, K. F., and Ma amo osch, K. (eds.) (1980). Vec o s o Plan Pa hogens. New
Yo k, NY: Academic P ess.
Iniguez, A. L., Dong, Y., Ca e , H. D., Ahme , B. M. M., S one, J. M.,
and T iple , E. W. (2005). Regula ion o en e ic endophy ic bac e ial
coloniza ion by plan de enses. Mol. Plan . Mic obe In e ac . 18, 169–178.
doi: 10.1094/MPMI-18-0169
Je mini, M., Mo isoli, R., Rigamoni, I., Gi gen i, P., and Mazzoni, V. (2015).
“Fe ili y, longe i y, o iposi ion dynamic and sex- a io o Scaphoideus i anus
Ball,” in IOBC-WPRS Mee ing o he Wo king G oup on “In eg a ed P o ec ion
and P oduc ion in Vi icul u e”, (Vienna). (Accessed Oc obe 20–23, 2015).
Khan, A., Hamayun, M., Kang, S.-M., Kim, Y.-H., Jung, H.-Y., Lee, J.-H., e al.
(2012). Endophy ic ungal associa ion ia gibbe ellins and indole ace ic acid can
imp o e plan g ow h unde abio ic s ess: an example o Paecilomyces o mosus
LHL10. BMC Mic obiol. 12:3. doi: 10.1186/1471-2180-12-3
Kusa i, P., Kusa i, S., Spi elle , M., and Kayse , O. (2015). Implica ions
o endophy e-plan c oss alk in ligh o quo um esponses o
plan bio echnology. Appl. Mic obiol. Bio echnol. 99, 5383–5390.
doi: 10.1007/s00253-015-6660-8
Lòpez-Fe nàndez, S., Sonego, P., Mo e o, M., Panche , M., Engelen, K., Pe o , I.,
e al. (2015). Whole-genome compa a i e analysis o i ulence genes un eils
simila i ies and di e ences be ween endophy es and o he symbio ic bac e ia.
F on . Mic obiol. 6:419. doi: 10.3389/ micb.2015.00419
Médiène, S., Valan in-Mo ison, M., Sa hou, J.-P., de Tou donne , S., Gosme, M.,
Be and, M., e al. (2011). Ag oecosys em managemen and bio ic in e ac ions:
a e iew. Ag on. Sus ain. De . 31, 491–514. doi: 10.1007/s13593-011-
0009-1
F on ie s in Mic obiology | www. on ie sin.o g 16 May 2017 | Volume 8 | A icle 834

Lòpez-Fe nàndez e al. An Insec T ans e s Bac e ial Endophy es in G ape ine
Me cado-Blanco, J., and Lug enbe g, B. (2014). Bio echnological
applica ions o bac e ial endophy es. Cu . Bio echnol. 3, 60–75.
doi: 10.2174/22115501113026660038
Mølle , T. S. B., O e gaa d, M., Nielsen, S. S., Bo olaia, V., Somme , M.
O. A., Gua dabassi, L., e al. (2016). Rela ion be ween e R and e A
exp ession in e acycline esis an Esche ichia coli.BMC Mic obiol. 16:39.
doi: 10.1186/s12866-016-0649-z
Mona d, C., Gan ne , S., Be ilsson, S., Hallin, S., and S enlid, J. (2016). Habi a
gene alis s and specialis s in mic obial communi ies ac oss a e es ial-
eshwa e g adien . Sci. Rep. 6:37719. doi: 10.1038/s ep37719
Panche , M., Ceol, M., Co neo, P. E., Longa, C. M. O., Yousa , S., Pe o , I.,
e al. (2012). Fungal endophy ic communi ies in g ape ines (Vi is ini e a
L.) espond o c op managemen . Appl. En i on. Mic obiol. 78, 4308–4317.
doi: 10.1128/AEM.07655-11
Pè ez-B ocal, V., La o e, A., and Moya, A. (2013). “Symbion s and pa hogens:
wha is he di e ence?” in Be ween Pa hogenici y and Commensalism, eds
U. Dob ind , H. H. Hacke , and C. S anbo g (New Yo k, NY; Heidelbe g:
Sp inge ), 215–243.
Pin o, C., Pinho, D., Sousa, S., Pinhei o, M., Egas, C., and Gomes, A. C. (2014).
Un a elling he di e si y o g ape ine mic obiome. PLoS ONE 9:e85622.
doi: 10.1371/jou nal.pone.0085622
Quad -Hallmann, A., Kloeppe , J. W., and Benhamou, N. (1997). Bac e ial
endophy es in co on: mechanisms o en e ing he plan . Can. J. Mic obiol. 43,
577–582. doi: 10.1139/m97-081
Rabha, A. J., Naglo , A., Sha ma, G. D., Gogoi, H. K., and Vee , V. (2014). In i o
e alua ion o an agonism o endophy ic Colle o ichum gloeospo ioides agains
po en ungal pa hogens o Camellia sinensis.Indian J. Mic obiol. 54, 302–309.
doi: 10.1007/s12088-014-0458-8
Reinhold-Hu ek, B., and Hu ek, T. (2011). Li ing inside plan s: bac e ial
endophy es. Cu . Opin. Plan Biol. 14, 435–443. doi: 10.1016/j.pbi.2011.04.004
Ryan, R. P., Monchy, S., Ca dinale, M., Tagha i, S., C ossman, L., A ison, M.
B., e al. (2009). The e sa ili y and adap a ion o bac e ia om he genus
S eno ophomonas.Na . Re . Mic obiol. 7, 514–525. doi: 10.1038/n mic o2163
Sacchi, L., Genchi, M., Clemen i, E., Biglia di, E., A anza i, A. M., Pajo o, M., e al.
(2008). Mul iple symbiosis in he lea hoppe Scaphoideus i anus (Hemip e a:
Cicadellidae): de ails o anso a ial ansmission o Ca dinium sp. and yeas -
like endosymbion s. Tissue Cell 40, 231–242. doi: 10.1016/j. ice.2007.12.005
San oyo, G., Mo eno-Hagelsieb, G., del Ca men O ozco-Mosqueda, M., and Glick,
B. R. (2016). Plan g ow h-p omo ing bac e ial endophy es. Mic obiol. Res. 183,
92–99. doi: 10.1016/j.mic es.2015.11.008
Schulz, B., and Boyle, C. (2006). “Wha a e Endophy es?” in Mic obial
Roo Endophy es, eds B. J. E. Schulz, C. J. C. Boyle, and T. N.
Siebe (Be lin; Heidelbe g: Sp inge ), 1–13. A ailable online a :
h p://link.sp inge .com/10.1007/3-540-33526-9_1 (Accessed Janua y 17,
2017).
Shi, S., Richa dson, A. E., O’Callaghan, M., DeAngelis, K. M., Jones, E. E.,
S ewa , A., e al. (2011). E ec s o selec ed oo exuda e componen s
on soil bac e ial communi ies. FEMS Mic obiol. Ecol. 77, 600–610.
doi: 10.1111/j.1574-6941.2011.01150.x
Thomas, G. H. (2016). Sialic acid acquisi ion in bac e ia-one subs a e, many
anspo e s. Biochem. Soc. T ans. 44, 760–765. doi: 10.1042/BST20160056
T uyens, S., Weyens, N., Cuype s, A., and Vang ons eld, J. (2015). Bac e ial
seed endophy es: gene a, e ical ansmission and in e ac ion wi h
plan s: bac e ial seed endophy es. En i on. Mic obiol. Rep. 7, 40–50.
doi: 10.1111/1758-2229.12181
an Baa len, P., an Belkum, A., Summe bell, R. C., C ous, P. W., and Thomma,
B. P. H. J. (2007). Molecula mechanisms o pa hogenici y: how do pa hogenic
mic oo ganisms de elop c oss-kingdom hos jumps? FEMS Mic obiol. Re . 31,
239–277. doi: 10.1111/j.1574-6976.2007.00065.x
Vandenkoo nhuyse, P., Quaise , A., Duhamel, M., Le Van, A., and Du esne, A.
(2015). The impo ance o he mic obiome o he plan holobion . New Phy ol.
206, 1196–1206. doi: 10.1111/nph.13312
Viana, D., Comos, M., McAdam, P. R., Wa d, M. J., Sel a, L., Guinane, C. M.,
e al. (2015). A single na u al nucleo ide mu a ion al e s bac e ial pa hogen hos
opism. Na . Gene . 47, 361–366. doi: 10.1038/ng.3219
Wein aub, P. G., and Beanland, L. (2006). Insec ec o s o phy oplasmas.
Annu. Re . En omol. 51, 91–111. doi: 10.1146/annu e .en o.51.110104.
151039
Yousa , S., Bulga i, D., Be gna, A., Panche , M., Quaglino, F., Casa i, P.,
e al. (2014). Py osequencing de ec s human and animal pa hogenic axa in
he g ape ine endosphe e. F on . Mic obiol. 5:327. doi: 10.3389/ micb.2014.
00327
Za aonaindia, I., and Gilbe , J. (2015). Unde s anding g ape ine-mic obiome
in e ac ions: implica ions o i icul u e indus y. Mic ob. Cell 2, 171–173.
doi: 10.15698/mic2015.05.204
Za aonaindia, I., Owens, S. M., Weisenho n, P., Wes , K., Hamp on-Ma cell,
J., Lax, S., e al. (2015). The soil mic obiome in luences g ape ine-associa ed
mic obio a. mBio 6:e02527-14. doi: 10.1128/mBio.02527-14
Con lic o In e es S a emen : The au ho s decla e ha he esea ch was
conduc ed in he absence o any comme cial o inancial ela ionships ha could
be cons ued as a po en ial con lic o in e es .
Copy igh © 2017 Lòpez-Fe nàndez, Mazzoni, Ped azzoli, Pe o and Campisano.
This is an open-access a icle dis ibu ed unde he e ms o he C ea i e Commons
A ibu ion License (CC BY). The use, dis ibu ion o ep oduc ion in o he o ums
is pe mi ed, p o ided he o iginal au ho (s) o licenso a e c edi ed and ha he
o iginal publica ion in his jou nal is ci ed, in acco dance wi h accep ed academic
p ac ice. No use, dis ibu ion o ep oduc ion is pe mi ed which does no comply
wi h hese e ms.
F on ie s in Mic obiology | www. on ie sin.o g 17 May 2017 | Volume 8 | A icle 834