Ci a ion: Peña-Nei a, A.; Co iella,
M.G.i.; Ubeda, C.; Pas enes, C.;
Villalobos, L.; Con ado , L.; In an e,
R.; Gómez, C. Phenolic,
Polysaccha ides Composi ion, and
Tex u e P ope ies du ing Ripening
and S o age Time o New Table
G ape Cul i a s in Chile. Plan s 2023,
12, 2488. h ps://doi.o g/10.3390/
plan s12132488
Academic Edi o s: Jelena D agiši´c
Maksimo i´c and Vuk Maksimo i´c
Recei ed: 25 Ap il 2023
Re ised: 16 June 2023
Accep ed: 26 June 2023
Published: 29 June 2023
Copy igh : © 2023 by he au ho s.
Licensee MDPI, Basel, Swi ze land.
This a icle is an open access a icle
dis ibu ed unde he e ms and
condi ions o he C ea i e Commons
A ibu ion (CC BY) license (h ps://
c ea i ecommons.o g/licenses/by/
4.0/).
plan s
A icle
Phenolic, Polysaccha ides Composi ion, and Tex u e P ope ies
du ing Ripening and S o age Time o New Table G ape
Cul i a s in Chile
Al a o Peña-Nei a 1,*, Ma iona Gil i Co iella 2, C is ina Ubeda 3, Claudio Pas enes 4, Luís Villalobos 4,† ,
Lo e o Con ado 4, Rod igo In an e 4and Camila Gómez 1
1
Depa men o Ag o-Indus y and Enology, Facul ad de Ciencias Ag onómicas, Uni e sidad de Chile, San a
Rosa 11315, La Pin ana, San iago 8820000, Chile
2Ins i u o de Ciencias Químicas Aplicadas, Facul ad de Ingenie ía, Uni e sidad Au ónoma de Chile, A . El
Llano Sube caseaux 2801, San Miguel, San iago 8910060, Chile; [email p o ec ed]
3
Á ea de Nu ición y B oma ología, Depa amen o de Nu ición y B oma ología, Toxicología y Medicina Legal,
Facul ad de Fa macia, Uni e sidad de Se illa, C/P. Ga cía González no. 2, E-41012 Se illa, Spain;
[email p o ec ed]
4
Depa men o Plan P oduc ion, Facul ad de Ciencias Ag onómicas, Uni e sidad de Chile, San a Rosa 11315,
La Pin ana, San iago 8820000, Chile; [email p o ec ed] (C.P.); [email p o ec ed] (L.V.)
*Co espondence: [email p o ec ed]; Tel.: +56-9-94991911
† P esen add ess: Cen o de Es udios A anzados en F u icul u a, Rengo 2940000, Chile.
Abs ac :
The aim o his s udy is o de e mine he phenolic and polysaccha idic composi ion, ex u e
p ope ies, and gene exp ession o new seedless able g ape cul i a s Timco
™
and K issy
™
and
compa e hem o he adi ional able g ape a ie y C imson Seedless (Vi is ini e a L.), du ing ipen-
ing and in comme cial pos ha es condi ions. Acco ding o he esul s, phenolic compounds we e
p esen in e y di e en p opo ions. The o al an hocyanins esponsible o skin colo inc eased
du ing ma u a ion and he majo i y an hocyanin in he h ee cul i a s was peonidin-3-glucoside,
ollowed by mal idin-3-glucoside. The phenolic compounds p esen ed a di e en beha io (de-
c easing o inc easing) du ing pos ha es . The o al skin soluble polysaccha ides dec eased du ing
ipening and pos ha es in C imson Seedless and K issy
™
and emained cons an om echnologi-
cal ma u i y o pos ha es s o age in Timco
™
. In all cul i a s, he majo i y soluble polysaccha ide
ac ion was ha wi h a molecula mass be ween 500 and 35 KDa. The skin mechanical p ope ies
o able g apes we e good pa ame e s o di e en ia ing a ie ies, wi h be e esul s o he new
cul i a s, compa ed o he adi ional C imson Seedless, especially in pos ha es . Genes in ol ed in
he la onoid pa hway and cell wall me abolism in skins exhibi ed an inc ease in exp ession om
e aison o emaining cons an a he end o he be y ipening.
Keywo ds:
Vi is ini e a; C imson Seedless; Timco
™
; K issy
™
; polyphenolic p o ile; gene exp ession;
phenylp opanoid biosyn hesis
1. In oduc ion
G ape ipening has been s udied o many yea s and ha es ing ui a op imal
ipeness is essen ial o ma ke ing and s o ing able g apes [1].
The quali y o he g ape be y a ha es is de e mined by se e al signi ican physio-
logical and biochemical changes ha occu simul aneously in he g ape be y du ing he
ipening phase.
Ve aison, he i s symp om o ipening, ma ks he s a o majo me abolic changes,
including suga accumula ion, so ening o he be ies, an hocyanin o ma ion, o ganic
acid me abolism, and accumula ion o la o compounds [2–4].
In gene al, able g apes ha e bigge be ies and i me pulp compa ed o wine g apes.
Due o hei educed p opensi y o wi he ing and c ushing, hese cha ac e is ics make
Plan s 2023,12, 2488. h ps://doi.o g/10.3390/plan s12132488 h ps://www.mdpi.com/jou nal/plan s
Plan s 2023,12, 2488 2 o 21
able g apes less ulne able o ha m du ing anspo a ion. On he o he hand, consume s
gene ally p e e seedless a ie ies wi h medium-sized be ies, c isp, hin skin, and a swee
as e [
5
,
6
]. A echnological ma u i y, he quali y o able g apes is de e mined by hei
appea ance, physical, and chemical cha ac e is ics. While he balance be ween swee ness
and acidi y is a undamen al concep in assessing he quali y o many ui s, such as
able g apes [
6
], ex u e is an impo an ac o in de e mining he quali y o able g apes.
The i icul u e and pos ha es indus ies may be in e es ed in ins umen mechanical
p ope ies o iden i y he po en ial o each a ie y and help mee ma ke demands [
7
].
These mechanis ic a iables a e associa ed wi h ce ain o ganolep ic p ope ies and hus
indi ec ly a ec consume accep ance o he p oduc [
7
,
8
]. G ape be ies’ loss o i mness
du ing ipening has equen ly been linked o he b eakdown o cell walls, pa icula ly
pec ic polysaccha ides [
9
]. Changes in he s uc u e and composi ion o he cell wall a e
he esul o hyd oly ic enzymes p oduced by he ui , namely polygalac u onase (PG),
pec ines e ase (PE),
β
-galac osidase (
β
-GAL), pec a e lyase (PL), and cellulase, esul ing
om complex in e ac ions [
10
]. The ac i i y o hese enzymes and he exp ession o he
genes encoding hem di e be ween able g ape a ie ies, which may explain di e ences
in he i mness o he a ie ies a he ime o ha es [9,10].
Fu he mo e, he appea ance o g apes has a signi ican impac on hei comme cial
alue, and poo ly colo ed ed–pink a ie ies lead o low consume accep ance [
11
]. The e is
a s ong co ela ion be ween an hocyanin concen a ion and he g ape skin colo index [
12
].
Only du ing e aison do an hocyanins begin o o m in he skin o ed g apes. Many
o he genes in ol ed in he la onoid pa hway exhibi a d ama ic inc ease in exp ession in
skin cells a e aison, acco ding o analysis o hei pa e ns o exp ession. Despi e a ia-
ions in gene exp ession le els be ween g ape a ie ies, exp ession o he gene encoding a
glycosyl ans e ase in ol ed in he las s ages o an hocyanin p oduc ion was posi i ely
linked wi h an hocyanin syn hesis [
3
]. In addi ion o an hocyanins, g apes a e ich in o he
phenolic compounds hough o ha e an ioxidan p ope ies and heal h bene i s [
5
]. Fo
his eason, able g apes can be conside ed as a p oduc wi h unc ional p ope ies, as hey
a e ich in nu ien s and an ioxidan s and hus ha e many heal h bene i s [13].
Abou 80% o Chile’s p oduc ion o able g apes is expo ed. Chile is he wo ld’s
and he Sou he n Hemisphe e’s op expo e o able g apes, acco ding o he Uni ed
S a es Depa men o Ag icul u e (USDA). G ape expo s o he 2019/2020 season eached
app oxima ely 657,000 ons [
14
,
15
]. In ecen yea s, Chile has been in oducing se e al new
a ie ies om a ious na ional and in e na ional b eeding p og ams o he wo ld ma ke ,
which a e eplacing adi ional g ape a ie ies such as Red Globe, C imson Seedless, and
Thompson Seedless. Chile is sea ching o g apes wi h a supe io size, be e condi ion, and
as e [
14
,
16
]. Las season (2021/2022), adi ional a ie ies (Red Globe, C imson Seedless,
Thompson, Flame, Sug aone, Au umn Royal) accoun ed o 48% o p oduc ion, wi h he
emaining 52% being o e 30 licensed new a ie ies, such as Timco
™
, Swee Celeb a ion
™
,
A a15™, Allison™, Magen a™, Sca lo a™, P is ine™, Sable™, K issy™, and Maylen.
Due o he lack o cha ac e iza ion o new a ie ies du ing ipening and pos ha es
s o age, he aim o his s udy is o de e mine he phenolic and polysaccha idic composi ion,
ex u e p ope ies, and gene exp ession o new seedless able g ape cul i a s Timco
™
and
K issy
™
and compa e hem o he adi ional able g ape a ie y C imson Seedless (Vi is
ini e a L.), du ing ipening and in comme cial pos ha es condi ions. We e alua ed a
a ie y o pa ame e s including: (i) g ape ma u i y indica o s, (ii) phenolic composi ion and
an ioxidan ac i i y o skins, (iii) skin soluble polysaccha ides acco ding o molecula mass
dis ibu ion, ( i) ex u e p ope ies, and ( ) gene exp ession o ansc ip ional egula o s
and biosyn he ic enzymes o he an hocyanin pa hway and cell wall me abolism o be y
skins, ela ed o he syn hesis o an hocyanins and colo , as well as he ex u e o be ies,
espec i ely.
Plan s 2023,12, 2488 3 o 21
2. Resul s and Discussion
2.1. E olu ion o Basic Physical and Chemical Va iables
The be y weigh , equa o ial diame e , leng h, and echnological ma u i y pa ame e s
such as o al soluble solids (
◦
B ix), TA (exp essed as g H
2
SO
4
equi alen s pe li e o juice),
and pH o a ie ies in es iga ed a e shown in Table 1.
Table 1.
Da a o sampling, he be y weigh , equa o ial diame e , leng h, and echnological ma u i y
pa ame e s o g apes om cul i a s C imson Seedless, Timco
™
, and K issy
™
du ing ipening and
pos ha es s o age.
Va iable Cul i a Pe iod be o e Ha es Pe iod Pos ha es
Sampling Da es:
30 Janua y
2018
(D1)
12 Feb ua y
2018
(D2)
26 Feb ua y
2018
(D3)
9 Ma ch 2018
(D4)
2 May 2018
(D5)
25 June 2018
(D6)
Weigh o 50
be ies (g)
C imson 244.8 ±18.5 a 264.6 ±22.4 ab 296.4 ±25.3 b 294.0 ±37.9 b 262.5 ±22.4 ab 262.7 ±27.8 ab
Timco™ 420.8 ±21.2 a 471.3 ±24.6 ab 493.2 ±13 ab 522.0 ±60.4 b 527.8 ±57.5 b 526.2 ±29.7 ab
K issy™ 331.7 ±14.7 a 426.7 ±39.4 ab 485.1 ±28.3 b 432.8 ±27.2 ab 420.1 ±78.5 ab 457.6 ±90.5 b
Leng h (mm)
C imson 17.58 ±0.55 a 18.25 ±0.25 a 18.70 ±0.81 a 18.27 ±0.84 a 17.04 ±0.34 a 16.64 ±0.56 a
Timco™ 21.91 ±0.36 a 22.71 ±0.56 a 22.82 ±0.33 a 22.68 ±0.93 a 22.19 ±0.67 a 21.96 ±1.1 ab
K issy™ 20.87 ±0.36 a 22.90 ±0.90 b 23.83 ±0.33 b 22.42 ±0.39 b 21.75 ±1.47 b 21.50 ±2.11 b
Equa o ial
diame e (mm)
C imson 22.52 ±0.53 a 24.11 ±1.16 b 25.20 ±0.49 b 24.72 ±0.50 b 24.06 ±1.02 b 23.37 ±1.19 ab
Timco™ 26.73 ±0.67 a 28.25 ±0.55 b 28.77 ±0.47 b 30.53 ±1.17 b 30.14 ±1.73 b 29.67 ±0.58 b
K issy™ 20.85 ±1.06 a 25.66 ±0.84 b 25.58 ±0.67 b 24.91 ±0.84 b 24.72 ±1.25 b 23.07 ±2.62 ab
To al soluble
solids (◦B ix)
C imson 13.47 ±0.31 c 15.13 ±0.12 cb 16.87 ±0.12 b 18.73 ±0.31 ab 20.20 ±0.35 ab 21.73 ±0.64 a
Timco™ 13.47 ±0.23 c 16.20 ±0.20 bc 17.27 ±0.31 b 18.73 ±0.23 ab 19.40 ±0.20 a 21.40 ±0.35 a
K issy™ 13.60 ±0.20 c 16.07 ±0.31 bc 18.33 ±0.12 bc 19.40 ±0.53 b 20.87 ±1.01 ab 22.07 ±0.31 a
pH
C imson 2.90 ±0.01 a 3.18 ±0.04 a 3.16 ±0.02 a 3.35 ±0.52 a 3.50 ±0.02 a 3.54 ±0.04 a
Timco™ 2.92 ±0.03 a 3.21 ±0.06 a 3.26 ±0.06 b 3.36 ±0.02 a 3.50 ±0.02 a 3.56 ±0.05 a
K issy™ 2.90 ±0.02 a 3.17 ±0.07 a 3.30 ±0.03 b 3.40 ±0.04 a 3.50 ±0.06 a 3.54 ±0.01 a
Ti a able
acidi y (g
H2SO4/L)
C imson 6.35 ±0.10 ab 5.97 ±0.26 b 3.68 ±0.21 b 3.22 ±0.14 c 3.95 ±0.24 b 3.98 ±0.11 b
Timco™ 6.62 ±0.60 a 5.36 ±0.34 a 3.54 ±0.10 a 3.74 ±0.07 a 4.32 ±0.29 a 4.03 ±0.10 a
K issy™ 8.20 ±0.02 b 7.15 ±0.25 a 4.32 ±0.07 ab 4.27 ±0.22 bc 5.04 ±0.21 b 4.8 ±0.04 a
Di e en le e s wi hin a ow indica e s a is ical di e ences among sampling poin s (p< 0.05, Tukey pos hoc es )
o he same a iable and cul i a . Sampling along ha es : D1, e aison; D2, 12 DAV (days a e e aison); D3, 26
DAV; D4, 37 DAV. Sampling along s o age: D5, 54 DOS (days o s o age); D6, 108 DOS.
Be y size is he mos impo an quali y ac o in he in e na ional able g ape ma ke .
P e e ence o g ape be ies is a ec ed by be y size, ex u e, skin hickness, and as ingency.
In seedless cul i a s, be y size is usually inc eased by ex e nal applica ion o gibbe ellin o
cy okinins in he ea ly s ages o ui de elopmen [
17
] as a ou ine ag onomic p ac ice in
comme cial able g ape ineya ds.
In gene al, be y weigh and equa o ial diame e inc eased o a ying deg ees du ing
ipening o all s udied able g apes. A comme cial ma u i y (D4), he be ies weighed
be ween 294 and 522 mg, which co esponded o he C imson Seedless and Timco
™
a ie ies, espec i ely, and hei weigh dec eased du ing s o age, excep o he K issy
™
cul i a . The g ea e s anda d de ia ion p esen ed in he weigh by K issy
™
du ing
pos ha es s o age compa ed o he o he a ie ies unde s udy would indica e a g ea e
he e ogenei y in he be ies, which could explain he sligh inc ease obse ed owa d he
las sampling, conside ing ha in each sampling du ing s o age, be ies a e ob ained om
di e en bunches s o ed inside boxes. The leng h o he be ies o all a ie ies showed
a sligh inc ease du ing ipening, unlike he equa o ial diame e ha inc eased in he
same pe iod wi h alues in D4 in a ange be ween 24.72 (C imson Seedless) and 30.53 mm
(Timco™). Bo h pa ame e s emained unchanged du ing he pos ha es pe iod.
Suga and o ganic acids a e impo an o be y la o . The o al soluble solids (TSS)
con en is commonly used o assess he quali y o able g apes and de e mine ha es
ipeness. The TSS a ied among cul i a s a di e en sampling da es because o hei
ea ly ma u i y and di e en ipening beha io . The TSS alues o he h ee cul i a s
Plan s 2023,12, 2488 4 o 21
a echnological ma u i y (D4) anged om 18.73 (C imson Seedless and Timco
™
) o
19.40 (K issy
™
). This may be due o he phenomenon o e apo a ion du ing long- e m
s o age [
18
]. Fu he mo e, as expec ed, all a ie ies showed a signi ican inc ease in he
pH and a signi ican dec ease in o al acidi y du ing ipening. Du ing s o age, he pH
emained almos cons an , while o al acidi y inc eased sligh ly in all h ee a ie ies. Ou
esul s conce ning he physiochemical pa ame e s ag ee wi h p e ious s udies conce ning
able g apes’ ipening and pos ha es s o age [9,16,17].
2.2. E olu ion o Phenolic Compounds and An ioxidan s in Skins
Phenolics a e good an ioxidan s because o hei ulne abili y o oxida ion owing o
hei hyd oxyl g oups and unsa u a ed double bonds (18). The polyphenolic p o ile o
g apes is a ec ed by he a ie y, geog aphic, clima ic, and ag onomical condi ions, among
o he ac o s [17,19–21].
The beha io in he e olu ion o o al phenols du ing ipening was qui e simila o
he h ee cul i a s. The o al phenols alues in skins a echnological ma u i y (D4) anged
om 0.75 gallic acid mg/g FW (Timco
™
) o 1.51 gallic acid mg/g FW (C imson Seedless).
The alues a e like hose epo ed o ed able g apes by o he au ho s [20,21].
Du ing he pos ha es pe iod, i was possible o obse e a dec ease in o al phenols
o he C imson Seedless samples. On he o he hand, bo h Timco
™
and K issy
™
showed
an inc ease in he alue o o al phenols. Sheng e al. [
22
], o he Summe black a ie y,
obse ed an inc ease in he o al phenol con en du ing 28 days o s o age. These au ho s
poin ou ha his inc ease is g ea e wi h he exposu e o he be ies o UV adia ion gi en
an inc ease in he exp ession o he genes in he phenylp opanoid pa hway ha a e s ill
ac i e pos ha es .
All he a ie ies s udied showed an inc ease in he con en o o al an hocyanins
du ing ma u a ion and up o he da e o echnological ma u i y (D4), he da e on which he
samples p esen ed a ange be ween 0.38 o Timco
™
and 0.75 o C imson Seedless (Table 2).
This coincides wi h o he au ho s who ha e obse ed an inc ease in he concen a ion o
o al an hocyanins om e aison o echnological ma u i y [
3
,
10
,
11
]. Compa ing bo h
pos ha es s o age da es (54 and 75 days), he C imson Seedless and K issy
™
samples
showed a dec ease in he o al an hocyanin con en , while he Timco
™
ones did no
expe ience changes.
Acco ding o Xie e al. [
23
], he concen a ion o an hocyanins in g ape be ies in
ad anced ipening p ocesses is a balance be ween syn hesis and deg ada ion. These
au ho s obse ed ha al hough an hocyanin syn hesis genes we e highly exp essed in he
Yan73 g ape cul i a a he la e ipening s age, an hocyanins we e ma kedly deg aded,
p esumably by he ac ion o enzymes pe oxidase and polyphenol oxidase (PPO). This
balance could a o deg ada ion o e ime, especially in a long pos ha es s o age. This
could explain he apid dec ease in an hocyanin con en obse ed in he Timco
™
samples
om D4 ( echnological ma u i y) o D5, which subsequen ly main ained hei concen a ion
un il D6. On he o he hand, du ing pos ha es s o age, an ea ly inc ease in an hocyanin
con en was obse ed in he cul i a o he able g ape ‘Yaghou i’ (Vi is ini e a L.), an
inc ease ha would be associa ed wi h he syn hesis o an hocyanins ela ed o he inc ease
in suga concen a ion (TSS) du ing he i s pe iod o s o age. A e his pe iod o inc ease,
a subsequen dec ease is also obse ed [
24
] which coincides wi h he beha io p esen ed
in pos ha es s o age by he cul i a s C imson Seedless and K issy
™
, o TSS and o al
an hocyanins (Tables 1and 2).
To al annins dec eased in all a ie ies du ing ipening (Table 2). A he da e o
comme cial ha es , he highes alues we e p esen ed by C imson Seedless (5.47) and
K issy
™
(6.57) and he lowes by Timco
™
(3.48). The alues o he o al annins om
skins a he ime o echnological ma u i y a e wi hin he alues obse ed o 36 g ape
cul i a s (Vi is ini e a L.) by o he au ho s [
25
]. The e olu ion o annins om e aison o
echnological ma u i y has been s udied by se e al au ho s [
26
]. Some o hem poin ou
ha mos o he annin syn hesis occu s immedia ely a e ui se and ends se e al weeks
Plan s 2023,12, 2488 5 o 21
be o e e aison, while he second s age o annin accumula ion occu s jus be o e his poin ,
whe e he maximum annin le els a e ound [
26
,
27
]. A e e aison, Bogs e al. [
28
] ound
ha he exp essed genes mos ele an o annin syn hesis we e no longe de ec able. This
may pa ly explain why annins do no accumula e du ing ipening and he gene ally
dec easing le els ha we obse ed.
Table 2.
To al phenols, an hocyanins, annins, an ioxidan capaci y, and main indi idual an hocyanins
in skins in C imson Seedless, Timco
™
, and K issy
™
cul i a s du ing ipening and pos ha es
s o age.
Va iable 1Cul i a Pe iod be o e Ha es Pe iod Pos ha es
Sampling Da es:
30 Janua y
2018
(D1)
12 Feb ua y
2018
(D2)
26 Feb ua y
2018
(D3)
9 Ma ch 2018
(D4)
2 May 2018
(D5)
25 June 2018
(D6)
To al phenols
(mg/g FW)
C imson 1.32 ±0.09 b 1.57 ±0.09 c 1.52 ±0.18 c 1.51 ±0.23 c 1.23 ±0.03 a 1.29 ±0.28 ab
Timco™ 0.75 ±0.10 a 0.89 ±0.07 b 0.78 ±0.41 ab 0.75 ±0.06 ab 0.86 ±0.16 b 0.89 ±0.15 b
K issy™ 1.45 ±0.12 b 1.46 ±0.12 b 1.33 ±0.11 a 1.44 ±0.13 b 1.87 ±0.54 bc 1.90 ±0.17 c
To al
an hocyanins
(mg/g FW)
C imson 0.40 ±0.03 a 0.81 ±0.07 c 0.78 ±0.09 c 0.75 ±0.15 c 0.81 ±0.04 c 0.65 ±0.12 b
Timco™ 0.33 ±0.09 b 0.34 ±0.09 b 0.33 ±0.16 b 0.38 ±0.05 c 0.29 ±0.13 a 0.29 ±0.09 a
K issy™ 0.34 ±0.03 a 0.55 ±0.10 b 0.63 ±0.06 c 0.65 ±0.07 c 0.74 ±0.27 c 0.57 ±0.03 b
To al annins
(mg/g FW)
C imson 6.67 ±0.25 b 5.77 ±0.44 b 5.36 ±0.98 ab 5.47 ±1.33 ab 4.75 ±0.66 a 4.81 ±1.11 ab
Timco™ 5.61 ±3.83 b 3.24 ±0.69 a 5.87 ±0.62 b 3.48 ±0.63 a 4.38 ±0.85 a 5.10 ±0.63 a
K issy™ 8.96 ±2.94 ab 6.57 ±0.95 b 6.22 ±0.55 b 6.57 ±0.67 b 9.17 ±2.96 ab 9.53 ±1.63 a
An ioxidan
ac i i y (ORAC)
(mmol/g TE FW)
C imson 4188 ±195 a 5569 ±366 b 5396 ±670 b 4627 ±169 ab 5477 ±195 b 4450 ±212 ab
Timco™ 1180 ±161 a 2368.33 ±484 b 2463 ±190 b 2453 ±289 b 3105 ±181 c 2894 ±286 bc
K issy™ 3428 ±262 a 4710 ±327 b 4713 ±146 b 3821 ±145 ab 3105 ±181 a 3088 ±223 a
Delphinidin-3-
glucoside
(µg/g FW)
C imson ND 11.1 ±0.10 a 12.2 ±0.30 a 13,4 ±0.50 a 13.1 ±0.20 a 12.6 ±0.30 a
Timco™ ND ND ND ND ND ND
K issy™ 10.10 ±0.20 b 7.20 ±0.30 a 12.01 ±0.10 c 10.41 ±0.10 b 10.31 ±0.20 b 9.21 ±0.12 b
Cyanidin-3-
glucoside
(µg/g FW)
C imson 10.01 ±0.31 a 18.20 ±0.31 b 20.12 ±0.27 b 21.20 ±0.17 b 19.35 ±0.21 b 19.21 ±1.02 b
Timco™ 20.12 ±1.01 a 19.17 ±1.01 a 20.67 ±0.61 a 19.58 ±1.17 a 20.02 ±1.13 a 19.00 ±1.01 a
K issy™ 20.02 ±1.00 a 19.41 ±1.63 a 30.03 ±3.44 b 51.61 ±4.83 bc 50.37 ±5.16 bc 56.10 ±7.12 c
Pe unidin-3-
glucoside
(µg/g FW)
C imson ND 10.01 ±0.90 a 10.71 ±1.21 a 11.09 ±1.36 a 10.21 ±1.98 a 10.11 ±0.96 a
Timco™ ND ND ND ND ND ND
K issy™ 11.07 ±0.71 a 20.12 ±3.01 b 20.42 ±1.97 b 40.25 ±2.58 c 17.35 ±3.13 b 15.01 ±2.08 b
Peonidin-3-
glucoside
(µg/g FW)
C imson 70.16 ±4.14 a 110.41 ±5.29 ab 113.71 ±4.86 b 249.97 ±6.19 d 222.39 ±4.02 c 222.95 ±5.06 c
Timco™ 40.27 ±4.75 a 80.62 ±4.99 b 100.96 ±6.07 c 120.82 ±5.54 cd 140.76 ±7.21 d 110.91 ±6.95 cd
K issy™ 70.17 ±4,29 a 80.23 ±7.03 a 140.86 ±8.32 b 210.88 ±6.97 c 223.83 ±8.23 c 212.20 ±6.01 cd
Mal idin-3-
glucoside
(µg/g FW)
C imson 113.19 ±7.11 a 119.41 ±4.28 a 127.12 ±6.02 a 147.44 ±6.92 b 172.17 ±6.81 c 116.19 ±6.54 a
Timco™ 20.92 ±3.81 a 30.86 ±5.51 b 38.03 ±5.86 b 39.03 ±2.42 b 27.32 ±3.81 b 31.43 ±4.42 b
K issy™ 31.43 ±4.31 a 42.74 ±4.62 a 91.29 ±5.71 b 88.28 ±6.53 b 44.24 ±5.71 a 51.45 ±6.31 ab
1
Di e en le e s wi hin a ow indica e s a is ical di e ences among sampling poin s (p< 0.05, Tukey pos hoc
es ) o he same a iable and cul i a . To al phenols a e exp essed as Gallic acid equi alen s. To al annins a e
exp essed as Ca echin equi alen s. An hocyanins a e exp essed as mal idina-3-glucoside equi alen s. FW means
esh weigh . Sampling along ha es : D1, e aison; D2, 12 DAV (days a e e aison); D3, 26 DAV; D4, 37 DAV.
Sampling along s o age: D5, 54 DOS (days o s o age); D6, 108 DOS.
Du ing pos ha es , no signi ican changes we e obse ed in any o he a ie ies
s udied. In con as , Sheng e al. [
22
] obse ed ha du ing he s o age o able g apes o he
Summe black a ie y, a apid dec ease in 21 days was app ecia ed o o al annins, and a
s eady dec ease he ea e .
The an ioxidan ac i i y o g apes depends on he quan i a i e di e ences in phenolic
compounds and he con en o a ious o he an ioxidan s, such as ca o enoids and i amin
C, which dec ease du ing ipening [
29
,
30
]. All g ape a ie ies s udied showed ele a ed
ORAC alues a echnological ma u i y anging om 2453
µ
mol TE/100 g (TimcoTM)
o 4627
µ
mol TE/100 g (C imson Seedless). In all he a ie ies, i was obse ed ha
he an ioxidan capaci y p esen ed an ea ly inc ease in he i s s age o ma u a ion and
emained wi hou signi ican di e ences un il he comme cial ha es . These esul s di e
om hose obse ed by o he s udies in ha he an ioxidan capaci y dec eased du ing he

Plan s 2023,12, 2488 6 o 21
ipening o he be ies [
29
,
31
,
32
]. This could be because hese s udies we e ca ied ou wi h
g apes des ined o p oduce wine ha each a highe s a e o ma u a ion compa ed wi h
able g apes and he e o e he e is a g ea e p obabili y o a dec ease in he compounds
esponsible o he an ioxidan capaci y.
A he end o s o age, he an ioxidan ac i i y le els in all he a ie ies ( anging om
2894–4450
µ
mol TE/100 g) did no lead o an excessi e educ ion in he an ioxidan capaci y
o g apes. These esul s ag ee wi h Nicolosi e al. [
33
], who s udied he e olu ion o he
an ioxidan capaci y in pos ha es s o age o he able g ape a ie ies Vi o ia, Supe io
Seedless®, I alia, C imson Seedless, Red Globe, and Black Pea l.
De e mining he an hocyanin p o ile o g apes a di e en s ages o ma u i y is im-
po an o unde s anding he phenolic changes ha occu du ing g ape be y de el-
opmen [
34
]. An hocyanins monome s, delphinidin-3-glucoside, cyanidin-3-glucoside,
pe unidin-3-glucoside, peonidin-3-glucoside, and mal idin-3-glucoside we e iden i ied
in able g apes o he a ie ies s udied, excep o Timco
™
in which he p esence o
delphinidin-3-glucoside and pe unidin-3-glucoside we e no de ec ed. In all a ie ies
a ha es ime (D4), he majo i y an hocyanin was peonidin-3-glucoside, ollowed by
mal idin-3-glucoside, in ag eemen wi h o he au ho s [
33
]. In his s udy, he con en
o he wo main an hocyanins p esen ed in C imson Seedless, Timco
™
, and K issy
™
signi ican ly inc eased owa d he las weeks o ipening.
The goal o pos ha es s o age echniques is o manipula e he me abolism o ui s
du ing s o age o ex end he shel li e o p oduce. Pos ha es ea men s such as low
empe a u es, high CO
2
concen a ions, and con olled and modi ied a mosphe e pack-
aging slow down many me abolic p ocesses, leading o na u al de e io a ion and loss o
quali y [
19
]. Howe e , some o hese ea men s ad e sely a ec an hocyanin le els, which
ad e sely a ec ui colo and nu i ional alue. Pos ha es cold s o age is known o
ac i a e modula ion in a a ie y o ui s, including able g apes, bu may a ec an ho-
cyanin biosyn hesis, deg ada ion, o bo h [
35
]. Du ing pos ha es s o age, a dec ease in
he concen a ion o he wo majo an hocyanins was obse ed o all a ie ies s udied,
when compa ing he las sampling da e (D6) wi h he echnological ma u i y da e (D4).
This coincides wi h o he au ho s [
29
], who obse ed du ing 60 days o pos ha es s o age
(0–1
◦
C) he dec ease in he an hocyanins delphinidin-3-glucoside, cyanidin-3-glucoside,
pela gonidin-3-glucoside, and mal idin-3-glucoside in be ies o he able g ape cul i a
Rishbaba.
2.3. E olu ion o Skin Soluble Polysaccha ides
The plan cell wall is a complex in e connec ed s uc u e composed o polysaccha ides,
cell wall p o eins, and polyphenols. Du ing ui ipening and pos ha es s o age, he
chemical composi ion o cell walls and issue s uc u es changes, a ec ing he senso y,
chemical, and physical p ope ies o g apes [36,37].
Table 3shows he esul s o soluble polysaccha ides o he skins o he h ee a ie ies
unde s udy, du ing ipening and in pos ha es s o age. These pec in polysaccha ides a e
he building blocks o pec in, which a e eleased om he complex cell wall ne wo k by
he ac ions o a ious ypes o endogenous and exogenous enzymes du ing ipening [
37
].
Du ing ipening, he be y unde goes many composi ional changes ha a ec he inal
chemical composi ion and o e all polysaccha ide p o ile a ha es and a ec he i mness
du ing and h oughou he ipening pe iod o he be y [38,39].
La ge changes in speci ic polysaccha ide componen s and in p o ein con en a e
obse ed du ing so ening and ipening [
40
]. Faso i e al. [
41
] epo ed ha he mos
p ominen changes in he g ape skins om he ipening s age o mid- ipening o ull
ipeness we e due o he modi ica ion o hemicellulose and pec in in he inne laye , mainly
he modi ica ion o cellulose (pec in was mo e less) in he epide mal laye .
Pec in depolyme iza ion and solubiliza ion co ela es wi h skin wall swelling, leading
o he conclusion ha pec in depolyme iza ion and de-es e i ica ion a e key p ocesses
leading o inc eased cell wall po osi y and he so ening o ui du ing ipening.
Plan s 2023,12, 2488 7 o 21
Table 3.
Skin soluble polysaccha ides (mg o pec in/g o skins) acco ding o molecula mass dis ibu-
ion: F1 > 500 KDa, F2: 500–35 KDa, F3: 35–5 KDa.
Va iable 1Cul i a Pe iod be o e Ha es Pe iod Pos ha es
Sampling Da es:
30 Janua y
2018
(D1)
12 Feb ua y
2018
(D2)
26 Feb ua y
2018
(D3)
9 Ma ch 2018
(D4)
2 May 2018
(D5)
25 June 2018
(D6)
F1
(mg/g o skins)
C imson 134.1 ±12.4 bc 161.1 ±12.2 bc 164.4 ±109.5 c 81.3 ±4.8 ab 79 ±52.8 ab 25.1 ±9.8 a
Timco™ ND ND ND 13 ±1.4 a 20.5 ±4.2 ab 22.3 ±5.4 b
K issy™ 23.2 ±4.9 ab 24.7 ±16.1 b 16.6 ±3.8 ab 15.7 ±1.8 ab 9.4 ±1.2 a 12.9 ±4 ab
F2
(mg/g o skins)
C imson 354.5 ±35.9 c 374 ±17.1 c 308.3 ±21.6 c 281.7 ±16.7 bc 127.3 ±44.6 a 163.1 ±4 ab
Timco™ 179.7 ±38.4 b 118.8 ±14.7 a 113.5 ±43.9 a 209.5 ±8.2 b 209.2 ±36.9 b 206.1 ±33.9 b
K issy™ 153.6 ±26.9 ab 123.7 ±26.6 ab 129.4 ±11.0 ab 159.8 ±24.7 b 113.7 ±14.6 a 147.1 ±24.5 ab
F3
(mg/g o skins)
C imson 266.7 ±3.1 c 297.8 ±29.9 cd 320.4 ±10 d 147.4 ±15.7 b 71.8 ±28 a 101.6 ±10.7 a
Timco™ 173.9 ±82.4 b 89.1 ±6.7 a 59.7 ±29.6 d 98.7 ±15.5 a 97.4 ±7.7 a 109.9 ±14.7 ab
K issy™ 227.9 ±40.4 c 185.4 ±79.3 bc 116.9 ±25.0 ab 119.4 ±16.3 ab 84.7 ±11.2 a 116.9 ±16.4 ab
To al polysac-
cha ides
(mg/g o skins)
C imson 755.3 ±30.3 c 832.8 ±50.1 c 793.1 ±335.4 c 510.4 ±14.4 b 278.1 ±119.1 a 289.8 ±23.1 a
Timco™ 353.6 ±118.9 c 207.9 ±12.2 ab 173.2 ±73.5 a 321.2 ±11.9 bc 327.1 ±40.8 bc 338.3 ±53.8 c
K issy™ 404.7 ±59.3 c 333.8 ±83.6 bc 262.8 ±32 ab 294.9 ±38.7 ab 207.8 ±24.7 a 276.9 ±42.7 ab
1
Di e en le e s wi hin a ow indica e s a is ical di e ences among sampling poin s (p< 0.05, Tukey pos hoc
es ) o he same a iable and cul i a . Resul s a e exp essed as pec in equi alen s. Sampling along ha es : D1,
e aison; D2, 12 DAV (days a e e aison); D3, 26 DAV; D4, 37 DAV. Sampling along s o age: D5, 54 DOS (days o
s o age); D6, 108 DOS.
In all a ie ies, a dec ease in o al polysaccha ides was obse ed du ing ipening
(Table 3), which in echnological ma u i y (D4) eached alues in a ange o 510.4 mg/g o
C imson Seedless and 294.9 mg/g o K issy
™
. These esul s ag ee wi h wha was obse ed
by O ega-Regules e al. [
42
], who epo ed ha di e en g ape cul i a s unde go di e en
changes in hei polysaccha ide p o iles du ing ipening and he e is no change in a abinose
concen a ion. Rhamnose, howe e , was mo e a ied, ei he inc easing, emaining cons an ,
o dec easing sligh ly depending on he cul i a , which can explain he di e en e olu ion
in ce ain ac ions o polysaccha ides.
A comme cial ha es , he ac ion o polysaccha ides wi h he highes concen a ion
co esponded o F2 (molecula mass be ween 500 and 35 KDa), ollowed by F3 (molecula
mass om 35 o 5 KDa) and inally, F1 (molecula mass g ea e han > 500 KDa). This coin-
cided wi h wha was obse ed by Gil e al. [
43
], who epo ed ha he o al concen a ion o
medium o low molecula weigh polysaccha ides in Cabe ne Sau ignon cul i a g apes
inc eased wi h g ea e g ape ma u i y. Timco
™
and K issy
™
p esen ed a simila beha io
(wi hou s a is ical di e ences be ween D1 and D4). On he con a y, C imson Seedless
p esen ed a dec ease in his ac ion.
2.4. Mechanical Beha io o Red Table G ape Va ie ies C imson, Timco™, and K yssy™ du ing
Ripening and Ex ended Cold S o age Pe iod
Tex u e is an impo an ac o in de e mining he quali y o able g apes o esh
consump ion. Be y i mness is conside ed a measu emen o i s eshness [44].
Tex u e includes all physical p ope ies pe cei ed h ough con ac ha a e ela ed o
de o ma ion when a o ce is applied ha can be objec i ely measu ed in e ms o o ce,
dis ance, and ime [
45
]. These mechanical a iables a e co ela ed wi h se e al senso y
a ibu es and hus indi ec ly wi h consume accep abili y o p oduc s [7,8].
Senso y cha ac e is ics such as skin hickness and iabili y and lesh i mness a e
sugges ed o di e en ia e comme cial able g ape cul i a s [
46
]. Ne e heless, he e a e
ew desc ip ions o he physical–mechanical pa ame e s o able g apes in he li e a u e,
and only a ew epo s a e a ailable on a ie al di e ences in he mechanical p ope ies o
g ape ex u e.
The esul s o he mechanical beha io o ed able g ape a ie ies C imson, Timco
™
,
and K yssy
™
, du ing ipening and an ex ended cold s o age pe iod a e p esen ed below
(Figu es 1–4).
Plan s 2023,12, 2488 8 o 21
Plan s 2023, 12, x FOR PEER REVIEW 8 o 22
Tex u e includes all physical p ope ies pe cei ed h ough con ac ha a e ela ed o
de o ma ion when a o ce is applied ha can be objec i ely measu ed in e ms o o ce,
dis ance, and ime [45]. These mechanical a iables a e co ela ed wi h se e al senso y
a ibu es and hus indi ec ly wi h consume accep abili y o p oduc s [7,8].
Senso y cha ac e is ics such as skin hickness and iabili y and lesh i mness a e
sugges ed o diffe en ia e comme cial able g ape cul i a s [46]. Ne e heless, he e a e
ew desc ip ions o he physical–mechanical pa ame e s o able g apes in he li e a u e,
and only a ew epo s a e a ailable on a ie al diffe ences in he mechanical p ope ies
o g ape ex u e.
The esul s o he mechanical beha io o ed able g ape a ie ies C imson, Timco
TM
,
and K yssy
TM
, du ing ipening and an ex ended cold s o age pe iod a e p esen ed below
(Figu es 1–4).
Figu e 1. Two-dimensional plo o he wo i s p incipal componen s in PCA o he cul i a s s udied
(C imson Seedless, Timco™, K issy™). Mechanical a iables in yellow diamond (maximum o ce,
maximum o ce a ea, lineal dis ance, Young’s modulus, inal o ce, numbe s o peaks, and o al a -
eas) and obse a ion ( a ie y:da e) in do s.
Figu e 2. Maximum Fo ce o h ee ed able g apes a six diffe en sampling da es. S anda d e o
is shown o each pa ame e (n = 50). Sampling along ha es : D1, e aison; D2, 12 DAV (days a e
Figu e 1.
Two-dimensional plo o he wo i s p incipal componen s in PCA o he cul i a s s udied
(C imson Seedless, Timco
™
, K issy
™
). Mechanical a iables in yellow diamond (maximum o ce,
maximum o ce a ea, lineal dis ance, Young’s modulus, inal o ce, numbe s o peaks, and o al a eas)
and obse a ion ( a ie y:da e) in do s.
Plan s 2023, 12, x FOR PEER REVIEW 8 o 22
Tex u e includes all physical p ope ies pe cei ed h ough con ac ha a e ela ed o
de o ma ion when a o ce is applied ha can be objec i ely measu ed in e ms o o ce,
dis ance, and ime [45]. These mechanical a iables a e co ela ed wi h se e al senso y
a ibu es and hus indi ec ly wi h consume accep abili y o p oduc s [7,8].
Senso y cha ac e is ics such as skin hickness and iabili y and lesh i mness a e
sugges ed o diffe en ia e comme cial able g ape cul i a s [46]. Ne e heless, he e a e
ew desc ip ions o he physical–mechanical pa ame e s o able g apes in he li e a u e,
and only a ew epo s a e a ailable on a ie al diffe ences in he mechanical p ope ies
o g ape ex u e.
The esul s o he mechanical beha io o ed able g ape a ie ies C imson, Timco
TM
,
and K yssy
TM
, du ing ipening and an ex ended cold s o age pe iod a e p esen ed below
(Figu es 1–4).
Figu e 1. Two-dimensional plo o he wo i s p incipal componen s in PCA o he cul i a s s udied
(C imson Seedless, Timco™, K issy™). Mechanical a iables in yellow diamond (maximum o ce,
maximum o ce a ea, lineal dis ance, Young’s modulus, inal o ce, numbe s o peaks, and o al a -
eas) and obse a ion ( a ie y:da e) in do s.
Figu e 2. Maximum Fo ce o h ee ed able g apes a six diffe en sampling da es. S anda d e o
is shown o each pa ame e (n = 50). Sampling along ha es : D1, e aison; D2, 12 DAV (days a e
Figu e 2.
Maximum Fo ce o h ee ed able g apes a six di e en sampling da es. S anda d e o
is shown o each pa ame e (n= 50). Sampling along ha es : D1, e aison; D2, 12 DAV (days
a e e aison); D3, 26 DAV; D4, 37 DAV. Sampling along s o age: D5, 54 DOS (days o s o age); D6,
108 DOS.
P incipal componen s analysis (PCA) was pe o med o be e unde s and he di -
e ences among g apes acco ding o he cul i a , physical, and mechanical pa ame e s
(Figu e 1). F om he loadings o selec ed a iables (p e up u e a iable: Young’s modulus
o elas ici y o he skin; a up u e: maximum o ce, maximum o ce a ea; pos up u e
a iables: numbe o peaks, inal o ce, inal o ce a ea, and lineal dis ance.). PC1 (56.50%
o al a iance) was mos highly co ela ed wi h skin mechanical p ope ies such as lin-
eal dis ance, Young’s modulus o he skin, inal o ce, numbe o peaks, and o al a eas.
PC2 (34.90% o al a iance) was mos co ela ed wi h he maximum o ce and maximum
o ce a ea.
Plan s 2023,12, 2488 9 o 21
Plan s 2023, 12, x FOR PEER REVIEW 9 o 22
e aison); D3, 26 DAV; D4, 37 DAV. Sampling along s o age: D5, 54 DOS (days o s o age); D6, 108
DOS.
Figu e 3. Young’s Modulus o h ee ed able g apes in six diffe en sampling da es. S anda d e o
is shown o each pa ame e (n = 50). Sampling along ha es : D1, e aison; D2, 12 DAV (days a e
e aison); D3, 26 DAV; D4, 37 DAV. Sampling along s o age: D5, 54 DOS (days o s o age); D6, 108
DOS.
Figu e 4. Peak numbe s o h ee ed able g apes in six diffe en sampling da es. S anda d e o is
shown o each pa ame e (n = 50). Sampling along ha es : D1, e aison; D2, 12 DAV (days a e
e aison); D3, 26 DAV; D4, 37 DAV. Sampling along s o age: D5, 54 DOS (days o s o age); D6, 108
DOS.
P incipal componen s analysis (PCA) was pe o med o be e unde s and he diffe -
ences among g apes acco ding o he cul i a , physical, and mechanical pa ame e s (Fig-
u e 1). F om he loadings o selec ed a iables (p e up u e a iable: Young’s modulus o
elas ici y o he skin; a up u e: maximum o ce, maximum o ce a ea; pos up u e a i-
ables: numbe o peaks, inal o ce, inal o ce a ea, and lineal dis ance.). PC1 (56.50% o al
a iance) was mos highly co ela ed wi h skin mechanical p ope ies such as lineal dis-
ance, Young’s modulus o he skin, inal o ce, numbe o peaks, and o al a eas. PC2
(34.90% o al a iance) was mos co ela ed wi h he maximum o ce and maximum o ce
a ea.
Figu e 3.
Young’s Modulus o h ee ed able g apes in six di e en sampling da es. S anda d e o
is shown o each pa ame e (n= 50). Sampling along ha es : D1, e aison; D2, 12 DAV (days
a e e aison); D3, 26 DAV; D4, 37 DAV. Sampling along s o age: D5, 54 DOS (days o s o age); D6,
108 DOS.
Plan s 2023, 12, x FOR PEER REVIEW 9 o 22
e aison); D3, 26 DAV; D4, 37 DAV. Sampling along s o age: D5, 54 DOS (days o s o age); D6, 108
DOS.
Figu e 3. Young’s Modulus o h ee ed able g apes in six diffe en sampling da es. S anda d e o
is shown o each pa ame e (n = 50). Sampling along ha es : D1, e aison; D2, 12 DAV (days a e
e aison); D3, 26 DAV; D4, 37 DAV. Sampling along s o age: D5, 54 DOS (days o s o age); D6, 108
DOS.
Figu e 4. Peak numbe s o h ee ed able g apes in six diffe en sampling da es. S anda d e o is
shown o each pa ame e (n = 50). Sampling along ha es : D1, e aison; D2, 12 DAV (days a e
e aison); D3, 26 DAV; D4, 37 DAV. Sampling along s o age: D5, 54 DOS (days o s o age); D6, 108
DOS.
P incipal componen s analysis (PCA) was pe o med o be e unde s and he diffe -
ences among g apes acco ding o he cul i a , physical, and mechanical pa ame e s (Fig-
u e 1). F om he loadings o selec ed a iables (p e up u e a iable: Young’s modulus o
elas ici y o he skin; a up u e: maximum o ce, maximum o ce a ea; pos up u e a i-
ables: numbe o peaks, inal o ce, inal o ce a ea, and lineal dis ance.). PC1 (56.50% o al
a iance) was mos highly co ela ed wi h skin mechanical p ope ies such as lineal dis-
ance, Young’s modulus o he skin, inal o ce, numbe o peaks, and o al a eas. PC2
(34.90% o al a iance) was mos co ela ed wi h he maximum o ce and maximum o ce
a ea.
Figu e 4.
Peak numbe s o h ee ed able g apes in six di e en sampling da es. S anda d e o
is shown o each pa ame e (n= 50). Sampling along ha es : D1, e aison; D2, 12 DAV (days
a e e aison); D3, 26 DAV; D4, 37 DAV. Sampling along s o age: D5, 54 DOS (days o s o age); D6,
108 DOS.
Based on hese esul s, he skin mechanical p ope ies o able g apes we e good
pa ame e s o di e en ia ing a ie ies. Hence, hey migh be used o ad an age as a ie al
ma ke s, since hese pa ame e s a e also li le in luenced by he ipening s age o he g ape,
as has been demons a ed o wine g apes [47].
The maximum o ce ( i mness), began o dec ease om he sampling da e wo o
he h ee a ie ies. Howe e , du ing he cold s o age pe iod a e ha es , Timco
™
and
K yssy
™
main ained hei i mness while i s ongly dec eased in C imson Seedless
(
Figu e 2
). Du ing he ma u a ion pe iod, hese esul s coincide wi h hose o Conne [
48
]
o he ge mplasm o he Muscadine a ie y. Acco ding o he esul s o ha au ho , he
i mness was ound o decline wi h inc easing ma u i y and s o age imes, as was obse ed
in he case o C imson Seedless.
Young’s modulus is a measu e o he elas ici y ( igidi y) o he skin. A low Young’s
modulus ep esen s a be y wi h low u gidi y [
48
]. Timco
™
and K yssy
™
ended o
main ain hei u go , whe eas C imson Seedless was s ongly a ec ed by a long cold
Plan s 2023,12, 2488 16 o 21
Table 4. Con .
Gene Ab Accession Sense Sequence (50→30) Amplicon (bp) Tm (◦C) E iciency
XET2 AY043238.1 Fo wa d
AGCCTGTGGAATGCGGATGACT
121 61.45 1.98
Re e se
CCACTGAAGCCTCACACCCATC
PME
NM_001281162.1
Fo wa d
GTGATGCCACGGTGGTCTTCCA
85 62.8 1.96
Re e se
CCTTGGGCGGTGATGGTGTTCT
GRIP28
NM_001281212.1
Fo wa d
GCAGTTGGCTCACACCGCTTTG
125 62.4 2.05
Re e se
AACAGTCCTGAACCGCCTCCAA
F30H
NM_001280987.1
Fo wa d
AGGAGGAGGTTGCGGTGCTAAC
132 62.3 1.98
Re e se
CGCCGAACACTCTCCTGCCTAA
F3050H
NM_001281235.1
Fo wa d
TCCATCGCATGGCTGGACATCC
101 62.55 1.93
Re e se
GCCGTGTGCTCCTCCATCATCT
UFGT AF000372.1 Fo wa d
TCAGGCGGAGGTCCTAGCACAT
81 62.3 2.11
Re e se
GCCACGCTTTCCCACAATGAGT
ACT
XM_002282480.4
Fo wa d
GGCTGGATTTGCGGGTGATGAT
80 61.5 1.97
Re e se
CCATGACACCAGTGTGCCTTGG
AIG1
XM_002281960.4
Fo wa d
GCACGGCTGAAGGCAGAAGAGA
104 62.4 1.99
Re e se
TCCGTCTCCCTCTGTGCTCTCT
GADPH
XM_002263109.3
Fo wa d
AGGCTGGAGAAGGCTGCTACCT
139 62.4 1.89
Re e se
TGCTGGACCTGTTGTCACCGAT
3.7.2. RNA Ex ac ion om G ape Skin and cDNA Syn hesis
RNA ex ac ion was pe o med om g apes p e iously s o ed a
−
80
◦
C. The skins
we e peeled wi h esh, s e ile azo blades, imme sed in liquid ni ogen in a mo a , and
immedia ely pul e ized wi h a pis il un il a ine powde was achie ed. RNA was ex ac ed
ollowing he sodium pe chlo a e me hod [
55
], wi h some modi ica ions. The s ill cold
ine powde was ans e ed o a 50 mL alcon ube and slowly added o 15 mL o he
ex ac ion bu e which con ained sodium pe chlo a e 5 M, T is 0.3 M pH 8.3, SDS 1%,
PEG 20000 2%, PVPP 8.5%, and 2-me cap oe hanol 2%. The ex ac was o exed o
45 s and s o ed a
−
20
◦
C o 45 min. The ex ac was hen passed h ough a sy inge
con aining glass wool and a 0.45 um PVDF il e a he base by cen i uging a 1500
×
g o
5 min a 4
◦
C. The elua e was hen o exed wi h 1.5 ol. o 100% cold e hanol, allowed
o p ecipi a e o 30 min a
−
20
◦
C, and hen cen i uged a 1500
×
g o 45 min a 4
◦
C.
Then, he supe na an was disca ded and 2 mL o T is 10 mM wi h EDTA 1 mM pH 7.5
was added o he p ecipi a e. The aqueous phase was eco e ed a e each addi ion o
1 ol. o phenol, chlo o o m, and isoamyl alcohol (25:24:21) and 1 ol. o chlo o o m:
isoamyl alcohol (24:1) o he abo e solu ion. To he aqueous solu ion was added 0.1 ol o
sodium ace a e 3 M pH 5.2 and 2 ol. o 80% cold e hanol and he gene ic ma e ial was
allowed o p ecipi a e o 2 h a
−
20
◦
C and hen cen i uged a 12,500
×
g o 30 min a
4
◦
C. Subsequen ly, he supe na an was disca ded, hen 1 mL o 80% cold e hanol was
added o he p ecipi a e which was hen sedimen ed, insed, and d ied. Subsequen ly,
he supe na an was disca ded, 1 mL o cold 80% e hanol was added o he esul ing
p ecipi a e, and hen cen i uged a 10,000
×
g o 10 min a 4
◦
C, and hen he supe na an
was disca ded again and allowed o d y. The pelle was esuspended in nuclease- ee wa e ,
0.25 ol o LiCl
2
10 M was added, and he RNA p ecipi a e was kep o e nigh a 4
◦
C.
The pelle was cleaned wice wi h 80% cold e hanol, esuspended wi h 40
µ
L nuclease- ee
wa e , and ea ed wi h ecombinan DNase I (Roche, Mannheim, Ge many), ollowing he
manu ac u e ’s ins uc ions. Quali y and quan i y o esul an RNA was assessed h ough
elec opho e ic bleach-gel echnique [
82
] and spec opho ome y (OD 260/280). The cDNA
syn hesis was pe o med wi h 1 ug o RNA, which was hen e e se ansc ibed using
he Supe Sc ip
™
IV Fi s -S and cDNA Syn hesis Reac ion ki (The mo Fishe Scien i ic,
Ca lsbad, Cali o nia, Uni ed S a es), ollowing he manu ac u e ’s p o ocol.

Plan s 2023,12, 2488 17 o 21
3.7.3. Gene Exp ession Analysis by qPCR
Gene exp ession analysis was pe o med by he Ligh cycle
™
96 sys em (Roche
Diagnos ics, Mannheim, Ge many) and using Fas S a Essen ial DNA G een Mas e ki
(Roche Diagnos ics, Mannheim, Ge many), ollowing he manu ac u e ’s p o ocols. The
mix u e o he qPCR eac ion was 0.5
µ
M o each p ime , a 1:50 dilu ion o he cDNA,
and he mas e mix in a inal eac ion olume o 20
µ
L. Ampli ica ion cu es analysis was
pe o med by he Ligh Cycle
®
96 so wa e (Roche Diagnos ics, Mannheim, Ge many)
and he pu i y o he ampli ied p oduc s was con i med by mel ing cu e analysis. Each
sampling da e had 3 biological eplica es and 3 echnical eplica es o each g ape a ie y.
To ob ain he ela i e exp ession o each gene, i e 10- old se ial dilu ions we e assessed
o calcula e he ampli ica ion e iciency acco ding o (1), whe e E is he e iciency o each
p ime and m is he slope be ween se ial dilu ions and he h eshold cycle (Cq).
E=10(−1
m)−1 (1)
The e iciencies o each p ime we e summa ized in Table 4, and hese alues we e
used o ob ain he ela i e exp ession o each gene o in e es (GOI) wi h espec o hei
e e ence genes (R) ollowing he exp ession (2). To ob ain he ela i e exp ession and
ollow hei e olu ion h ough ime, he Cq o GOI and e e ence genes we e e e enced o
he Cq mean alue o each gene om he C imson a ie y a he i s sampling da e.
ela i e exp ession =E−(CqGOI−CqGOICal)
GOI
n
q∏n
i=1E−(CqRi−CqRiCal)
Ri
(2)
3.8. S a is ical Analyses
Da a analysis was pe o med using In oS a ( e sion 2017p, FCA-Uni e sidad Na-
cional de Có daba, A gen ina). Means we e compa ed using ANOVA and pos hoc es
(Tukey) (
α
= 0.05). All es s me he assump ion o esidual no mali y. Gene exp ession
analyses o each sampling da e we e e alua ed by ANOVA analysis, es ing he assump-
ions o no mali y and homogenei y o a iance. Means we e subjec ed o pos hoc Tukey
analysis when p- alues we e less han 0.05.
4. Conclusions
De e mining he op imum ha es ime is a signi ican ac o a ec ing he quali y
o able g apes. Moni o ing he e olu ion o g apes’ physicochemical p ope ies, pheno-
lic, and polysaccha idic composi ion and ex u e p ope ies du ing ipening could be a
aluable ool o de e mining he op imum ha es ime o ensu e op imal pos ha es
condi ions and ma ke accep abili y. The ma ke is looking o g apes wi h a supe io size,
condi ion, and as e and has been in oducing new a ie ies om se e al na ional and
in e na ional b eeding p og ams, such as Timco
™
and K issy
™
, ha a e eplacing popula
g ape a ie ies, such as C imson Seedless. Acco ding o he esul s, phenolic compounds
om skins we e p esen in e y di e en p opo ions among he a ie ies s udied. The
o al an hocyanins esponsible o he colo o he skins inc eased du ing ipening and
he majo i y indi idual an hocyanins in he h ee a ie ies was peonidin-3-glucoside, ol-
lowed by mal idin-3-glucoside. The phenolic compounds p esen ed a di e en beha io
(dec easing o inc easing) du ing pos ha es . The o al skin soluble polysaccha ides de-
c eased du ing ipening and pos ha es in C imson Seedless and K yssy
™
and emained
cons an om echnological ma u i y o pos ha es s o age in Timco
™
. In all a ie ies,
he majo i y soluble polysaccha ide ac ion was ha wi h a molecula mass be ween 500
and 35 KDa (F2). The skin mechanical p ope ies o able g apes we e good pa ame e s o
di e en ia ing a ie ies, wi h be e esul s o he new a ie ies Timco
™
and K yssy
™
,
compa ed o he adi ional a ie y C imson Seedless, especially pos ha es . Fo his
wo k, Timco
™
was he c ispies a ie y whe eas C imson Seedless’ peak coun s dec eased
Plan s 2023,12, 2488 18 o 21
d ama ically a e cold s o age. Timco
™
and K yssy
™
ended o main ain hei u go ,
whe eas C imson was s ongly a ec ed by a long cold s o age. The i mness began o
dec ease ea ly du ing ipening o he h ee a ie ies; howe e , a he cold s o age pe iod,
Timco
™
and K yssy
™
main ained hei i mness while i s ongly dec eased in C imson.
The cell wall me abolism gene exp ession p o iles ollowed simila ends in exoca p issues
h oughou be y de elopmen in all he a ie ies s udied. Simila esul s we e obse ed o
genes in ol ed in he phenylp opanoid pa hway. These esul s may posi ion he Timco
™
and K yssy
™
a ie ies as a e y good al e na i e and compe i o o C imson Seedless,
which is cu en ly one o he able g ape cul i a s in Chile wi h a high comme cial demand.
Au ho Con ibu ions:
Concep ualiza ion, A.P.-N., M.G.i.C. and L.V.; me hodology, C.G. and L.V.;
da a cu a ion, M.G.i.C. and A.P.-N.; w i ing—o iginal d a p epa a ion, A.P.-N. and L.C.;
w i ing— e iew and edi ing, C.U., M.G.i.C., C.P., L.V., R.I. and A.P.-N.; unding acquisi ion, A.P.-N.
All au ho s ha e ead and ag eed o he published e sion o he manusc ip .
Funding:
This esea ch was unded by ANID-Chile [FONDECYT 1181142, FONDEQUIP EQM130129
p ojec s].
Da a A ailabili y S a emen : The da a is con ained wi hin he manusc ip .
Acknowledgmen s:
The au ho s a e g a e ul o he GESEX ui Expo e Company o p o iding
he comme cial ineya ds and he pos ha es s o age cold chambe s, o he ials o his s udy.
Con lic s o In e es :
The au ho s decla e no con lic o in e es . The unde s had no ole in he design
o he s udy; in he collec ion, analyses, o in e p e a ion o he da a; in he w i ing o he manusc ip ;
o in he decision o publish he esul s.
Re e ences
1.
Coombe, B.G. Rela ionship o G ow h and De elopmen o Changes in Suga s, Auxins, and Gibbe ellins in F ui o Seeded and
Seedless Va ie ies o Vi is ini e a.Plan Physiol. 1960,35, 241–250. [C ossRe ] [PubMed]
2. Coombe, B.G. Resea ch on De elopmen and Ripening o he G ape Be y. Am. J. Enol. Vi ic. 1992,43, 101–110. [C ossRe ]
3. Robinson, S.P.; Da ies, C. Molecula Biology o G ape Be y Ripening. Aus . J. G ape Wine Res. 2000,6, 175–188. [C ossRe ]
4.
B ummell, D.A.; Ha ps e , M.H. Cell Wall Me abolism in F ui So ening and Quali y and I s Manipula ion in T ansgenic Plan s.
Plan Mol. Biol. 2001,47, 311–339. [C ossRe ]
5.
Seccia, A.; Viscecchia, R.; Na done, G. Table G apes as Func ional Food: Consume P e e ences o Heal h and En i onmen al
A ibu es. BIO Web Con . 2019,15, 03011. [C ossRe ]
6.
Jayasena, V.; Came on, I.
◦
B ix/Acid Ra io as a P edic o o Consume Accep abili y o C imson Seedless Table G apes. J. Food
Qual. 2008,31, 736–750. [C ossRe ]
7.
Rolle, L.; Si e , R.; Segade, S.R.; Mau y, C.; Ge bi, V.; Jou jon, F. Ins umen al Tex u e Analysis Pa ame e s as Ma ke s o
Table-G ape and Wineg ape Quali y: A Re iew. Am. J. Enol. Vi ic. 2012,63, 11–28. [C ossRe ]
8. Abbo , J.A. Quali y Measu emen o F ui s and Vege ables. Pos ha es Biol. Technol. 1999,15, 207–225. [C ossRe ]
9.
Balic, I.; Ejsmen ewicz, T.; Sanhueza, D.; Sil a, C.; Pe edo, T.; Olmedo, P.; Ba os, M.; Ve donk, J.C.; Pa edes, R.; Meneses, C.; e al.
Biochemical and Physiological S udy o he Fi mness o Table G ape Be ies. Pos ha es Biol. Technol.
2014
,93, 15–23. [C ossRe ]
10.
Peppi, M.C.; Fidelibus, M.W.; Dokoozlian, N. Abscisic Acid Applica ion Timing and Concen a ion A ec Fi mness, Pigmen a ion,
and Colo o ‘Flame Seedless’ G apes. Ho Science 2006,41, 1440–1445. [C ossRe ]
11.
Shahab, M.; Robe o, S.R.; Ahmed, S.; Colombo, R.C.; Sil es e, J.P.; Koyama, R.; de Souza, R.T. Rela ionship be ween An hocyanins
and Skin Colo o Table G apes T ea ed wi h Abscisic Acid a Di e en S ages o Be y Ripening. Sci. Ho ic.
2020
,259, 108859.
[C ossRe ]
12.
Yang, J.; Ma inson, T.E.; Liu, R.H. Phy ochemical P o iles and An ioxidan Ac i i ies o Wine G apes. Food Chem.
2009
,116,
332–339. [C ossRe ]
13.
Cid, P.; Ga cía, M.; Pinole , A.; Ba ba, P. Pheno yping Tools o Gene ic Imp o emen o Table G apes in Chile. Ac a Ho ic.
2019
,
1248, 267–274. [C ossRe ]
14.
Eu o esh. Chile’s Table G ape Expo s o Rise by 29%. 2021. A ailable online: www.eu o esh-dis ibu ion.com/news/chiles-
able-g ape-expo s- o- ise-by-29/ (accessed on 26 Decembe 2022).
15.
Eu o esh. Chile’s G ape Expo s Remain S able Despi e D ough . 2020. A ailable online: www.eu o esh-dis ibu ion.com/
news/chiles-g ape-expo s- emain-s able-despi e-d ough (accessed on 17 Sep embe 2022).
16.
Reynolds, A.; Wa dle, D.; Zu owski, C.; Looney, N. Phenylu eas, CPPU and hidiazu on a ec yield componen s, ui composi ion,
and s o age po en ial o ou seedless g ape selec ions. J. Am. Soc. Ho . Sci. 1992,117, 85–89. [C ossRe ]
17.
B ewe , M.S. Na u al An ioxidan s: Sou ces, Compounds, Mechanisms o Ac ion, and Po en ial Applica ion. Comp . Re . Food Sci.
Food Sa . 2011,10, 195–247. [C ossRe ]
Plan s 2023,12, 2488 19 o 21
18.
Gallo, V.; Mas o illi, P.; Ca agna, I.; Ni i, G.; La onico, M.; Longoba di, F.; Minoja, A.P.; Napoli, C.; Romi o, V.; Schä e , H.; e al.
E ec s o ag onomical p ac ices on chemical composi ion o able g apes e alua ed by NMR spec oscopy. J. Food Comp. Anal.
2014,35, 44–52. [C ossRe ]
19.
Deng, Y.; Wu, Y.; Li, Y. E ec s o High O
2
Le els on Pos -Ha es Quali y and Shel Li e o Table G apes du ing Long-Te m
S o age. Eu . Food Res. Technol. 2005,221, 392–397. [C ossRe ]
20.
Lago-Vanzela, E.S.; Da-Sil a, R.; Gomes, E.; Ga cía-Rome o, E.; He mosín-Gu ié ez, I. Phenolic Composi ion o he B azilian
Seedless Table G ape Va ie ies BRS Cla a and BRS Mo ena. J. Ag ic. Food Chem. 2011,59, 8314–8323. [C ossRe ]
21.
Zhang, L.; Li, X.; Pang, Y.; Cai, X.; Lu, J.; Ren, X.; Kong, Q. Phenolics composi ion and con en s, as he key quali y pa ame e s o
able g apes, may be in luenced ob iously and di e en ly in esponse o sho - e m high empe a u e. LWT
2021
,149, 111791.
[C ossRe ]
22.
Sheng, K.; Zheng, H.; Shui, S.; Yan, L.; Liu, C.; Zheng, L. Compa ison o Pos ha es UV-B and UV-C T ea men s on Table G ape:
Changes in Phenolic Compounds and Thei T ansc ip ion o Biosyn he ic Genes du ing S o age. Pos ha es Biol. Technol.
2018
,
138, 74–81. [C ossRe ]
23.
Xie, S.; Liu, Y.; Chen, H.; Zhang, Z.; Ge, M. An hocyanin deg ada ion and he unde lying molecula mechanism in a ed- leshed
g ape a ie y. LWT 2021,151, 112198. [C ossRe ]
24.
Nia, A.E.; Taghipou , S.; Siahmansou, S. P e-ha es applica ion o chi osan and pos ha es Aloe e a gel coa ing enhances quali y
o able g ape (Vi is ini e a L. c . ‘Yaghou i’) du ing pos ha es pe iod. Food Chem. 2021,347, 129012. [C ossRe ]
25.
Downey, M.; Mazza, M.; Seddon, T.J.; Roch o , S.; Millikan, M. Va ia ion in Condensed Tannin Con en , Composi ion and
Polyme Leng h Dis ibu ion in he Skin o 36 G ape Cul i a s. Cu . Bioac . Compd. 2012,8, 200–217. [C ossRe ]
26.
Wa elo , A.; No on, E. Chemis y and Reac i i y o Tannins in Vi is spp.: A Re iew. Molecules
2020
,25, 2110. [C ossRe ]
[PubMed]
27.
Downey, M.O.; Ha ey, J.S.; Robinson, S.P. Syn hesis o Fla onols and Exp ession o Fla onol Syn hase Genes in he De eloping
G ape Be ies o Shi az and Cha donnay (Vi is ini e a L.). Aus . J. G ape Wine Res. 2003,9, 110–121. [C ossRe ]
28.
Bogs, J.; Downey, M.O.; Ha ey, J.S.; Ash on, A.R.; Tanne , G.J.; Robinson, S.P. P oan hocyanidin Syn hesis and Exp ession o
Genes Encoding Leucoan hocyanidin Reduc ase and An hocyanidin Reduc ase in De eloping G ape Be ies and G ape ine
Lea es. Plan Physiol. 2005,139, 652–663. [C ossRe ]
29.
Eshghi, S.; Ka imi, R.; Shi i, A.; Ka ami, M.; Mo adi, M. E ec s o polysaccha ide-based coa ings on pos ha es s o age li e o
g ape: Measu ing he changes in nu i ional, an ioxidan and phenolic compounds. J. Food Meas. Cha ac .
2022
,16, 1159–1170.
[C ossRe ]
30.
Razungles, A.; Bayono e, C.L.; Co donnie , R.E.; Sapis, J.C. G ape Ca o enoids: Changes Du ing he Ma u a ion Pe iod and
Localiza ion in Ma u e Be ies. Am. J. Enol. Vi ic. 1988,39, 44–48. [C ossRe ]
31.
Doshi, P.; Adsule, P.; Bane jee, K. Phenolic Composi ion and An ioxidan Ac i i y in G ape ine Pa s and Be ies (Vi is ini e a L.)
C . Kishmish Cho nyi (Sha ad Seedless) du ing Ma u a ion. In . J. Food Sci. Technol. 2006,41, 1–9. [C ossRe ]
32.
Benbougue a, N.; Richa d, T.; Saucie , C.; Ga cia, F. Vol amme ic Beha io , Fla anol and An hocyanin Con en s, and An ioxidan
Capaci y o G ape Skins and Seeds du ing Ripening (Vi is ini e a Va . Me lo , Tanna , and Sy ah). An ioxidan s
2020
,9, 800.
[C ossRe ]
33.
Nicolosi, E.; Fe li o, F.; Amen a, M.; Russo, T.; Rapisa da, P. Changes in he Quali y and An ioxidan Componen s o Minimally
P ocessed Table G apes du ing S o age. Sci. Ho ic. 2018,232, 175–183. [C ossRe ]
34.
Downey, M.O.; Dokoozlian, N.K.; K s ic, M.P. Cul u al P ac ice and En i onmen al Impac s on he Fla onoid Composi ion o
G apes and Wine: A Re iew o Recen Resea ch. Am. J. Enol. Vi ic. 2006,57, 257–268. [C ossRe ]
35. De Pascual-Te esa, S.; Sanchez-Balles a, M.T. An hocyanins: F om Plan o Heal h. Phy ochem. Re . 2008,7, 281–299. [C ossRe ]
36.
Albe sheim, P.; Da ill, A.; Robe s, K.; Sede o , R.; S aehelin, A. Plan Cell Walls. F om Chemis y o Biology. Ann. Bo .
2011
,
108, iii–ix. [C ossRe ]
37.
Guadalupe, Z.; Ayes a án, B.; Williams, P.; Doco, T. De e mina ion o Mus and Wine Polysaccha ides by Gas Ch oma og aphy-
Mass Spec ome y (GC-MS) and Size-Exclusion Ch oma og aphy (SEC). In Polysaccha ides; Sp inge In e na ional Publishing:
Cham, Swi ze land, 2015; pp. 1–28.
38.
Ga ido-Bañuelos, G.; Buica, A.; Schückel, J.; Zie sman, A.J.J.; Willa s, W.G.T.; Moo e, J.P.; Du Toi , W.J. In es iga ing he
Rela ionship be ween G ape Cell Wall Polysaccha ide Composi ion and he Ex ac abili y o Phenolic Compounds in o Shi az
Wines. Pa I: Vin age and Ripeness E ec s. Food Chem. 2019,278, 36–46. [C ossRe ]
39.
Nunan, K.J.; Sims, I.M.; Bacic, A.; Robinson, S.P.; Finche , G.B. Changes in Cell Wall Composi ion du ing Ripening o G ape
Be ies. Plan Physiol. 1998,118, 783–792. [C ossRe ]
40.
Nunan, K.J.; Da ies, C.; Robinson, S.P.; Finche , G.B. Exp ession Pa e ns o Cell Wall-Modi ying Enzymes du ing G ape Be y
De elopmen . Plan a 2001,214, 257–264. [C ossRe ]
41.
Fasoli, M.; Dell’Anna, R.; Dal San o, S.; Bales ini, R.; Sanson, A.; Pezzo i, M.; Mon i, F.; Zenoni, S. Pec ins, Hemicelluloses and
Celluloses Show Speci ic Dynamics in he In e nal and Ex e nal Su aces o G ape Be y Skin Du ing Ripening. Plan Cell Physiol.
2016,57, 1332–1349. [C ossRe ]
42.
O ega-Regules, A.; Ros-Ga cía, J.M.; Bau is a-O ín, A.B.; López-Roca, J.M.; Gómez-Plaza, E. Changes in Skin Cell Wall
Composi ion du ing he Ma u a ion o Fou P emium Wine G ape Va ie ies. J. Sci. Food Ag ic. 2008,88, 420–428. [C ossRe ]
Plan s 2023,12, 2488 20 o 21
43.
Gil, M.; Qui os, M.; Fo , F.; Mo ales, P.; Gonzalez, R.; Canals, J.-M.; Zamo a, F. In luence o G ape Ma u i y and Mace a ion
Leng h on Polysaccha ide Composi ion o Cabe ne Sau ignon Red Wines. Am. J. Enol. Vi ic. 2015,66, 393–397. [C ossRe ]
44.
Va gas, A.; Pe ez, J.; Pablo Zo oli, J.; Pe ez, A. E olu ion o he Tex u e in Thompson Seedless Be ies. Cien. In es ig. Ag ic.
2001
,
27, 117–126. [C ossRe ]
45.
Le aie , H.; Rolle, L.; Zeppa, G.; Ge bi, V. Assessmen o G ape Skin Ha dness by a Punc u e Tes . J. Sci. Food Ag ic.
2008
,88,
1567–1575. [C ossRe ]
46. Cli , M.A.; De e , M.C.; Reynolds, A.G. Desc ip i e P o iling o New and Comme cial B i ish Columbia Table G ape Cul i a s.
Am. J. Enol. Vi ic. 1996,47, 301–308. [C ossRe ]
47.
To chio, F.; Cagnasso, E.; Ge bi, V.; Rolle, L. Mechanical P ope ies, Phenolic Composi ion and Ex ac abili y Indices o Ba be a
G apes o Di e en Soluble Solids Con en s om Se e al G owing A eas. Anal. Chim. Ac a
2010
,660, 183–189. [C ossRe ]
[PubMed]
48. Conne , P.J. Ins umen al Tex u al Analysis o Muscadine G ape Ge mplasm. Ho Science 2013,48, 1130–1134. [C ossRe ]
49.
Zouid, I.; Si e , R.; Mehinagic, E.; Mau y, C.; Che alie , M.; Jou jon, F. E olu ion o G ape Be ies du ing Ripening: In es iga ions
in o he Links be ween Thei Mechanical P ope ies and he Ex ac abili y o Thei Skin An hocyanins. OENO One
2010
,44, 87.
[C ossRe ]
50.
Mau y, C.; Madie a, E.; Le Moigne, M.; Mehinagic, E.; Si e , R.; Jou jon, F. De elopmen o a Mechanical Tex u e Tes o E alua e
he Ripening P ocess o Cabe ne F anc G apes. J. Tex u e S ud. 2009,40, 511–535. [C ossRe ]
51.
Van Hecke, E.; Alla , K.; Bou ie , J.M. Tex u e and S uc u e o C ispy-Pu ed Food P oduc s Pa Ii: Mechanical P ope ies in
Punc u e. J. Tex u e S ud. 1998,29, 617–632. [C ossRe ]
52.
Roudau , G.; Dac emon , C.; Vallès Pàmies, B.; Colas, B.; Le Mes e, M. C ispness: A C i ical Re iew on Senso y and Ma e ial
Science App oaches. T ends Food Sci. Technol. 2002,13, 217–227. [C ossRe ]
53.
Bou ne, M.C. P ac ice o Objec i e Tex u e Measu emen . In Food Tex u e and Viscosi y; Academic P ess: New Yo k, NY, USA,
1982; pp. 118–198.
54.
Saeleaw, M.; Schleining, G. A Re iew: C ispness in D y Foods and Quali y Measu emen s Based on Acous ic–Mechanical
Des uc i e Techniques. J. Food Eng. 2011,105, 387–399. [C ossRe ]
55.
Boss, P.K.; Da ies, C.; Robinson, S.P. Analysis o he Exp ession o An hocyanin Pa hway Genes in De eloping Vi is Vini e a L.
C Shi az G ape Be ies and he Implica ions o Pa hway Regula ion. Plan Physiol. 1996,111, 1059–1066. [C ossRe ]
56.
Naka suka, T.; Nishiha a, M.; Mishiba, K.; Yamamu a, S. Tempo al Exp ession o Fla onoid Biosyn hesis-Rela ed Genes Regula es
Flowe Pigmen a ion in Gen ian Plan s. Plan Sci. 2005,168, 1309–1318. [C ossRe ]
57.
Kobayashi, S.; Go o-Yamamo o, N.; Hi ochika, H. Associa ion o V mybA1 Gene Exp ession wi h An hocyanin P oduc ion in
G ape (Vi is ini e a) Skin-Colo Mu an s. J. Jpn. Soc. Ho ic. Sci. 2005,74, 196–203. [C ossRe ]
58.
Nakajima, J.; Tanaka, Y.; Yamazaki, M.; Sai o, K. Reac ion Mechanism om Leucoan hocyanidin o An hocyanidin 3-Glucoside, a
Key Reac ion o Colo ing in An hocyanin Biosyn hesis. J. Biol. Chem. 2001,276, 25797–25803. [C ossRe ]
59.
Cas ella in, S.D.; Di Gaspe o, G. T ansc ip ional Con ol o An hocyanin Biosyn he ic Genes in Ex eme Pheno ypes o Be y
Pigmen a ion o Na u ally Occu ing G ape ines. BMC Plan Biol. 2007,7, 46. [C ossRe ]
60.
Cas ella in, S.D.; Gambe a, G.A.; Wada, H.; Shackel, K.A.; Ma hews, M.A. F ui Ripening in Vi is ini e a: Spa io empo al
Rela ionships among Tu go , Suga Accumula ion, and An hocyanin Biosyn hesis. J. Exp. Bo . 2011,62, 4345–4354. [C ossRe ]
61.
Glissan , D.; Dédaldéchamp, F.; Del o , S. T ansc ip omic Analysis o G ape Be y So ening du ing Ripening. OENO One
2008
,
42, 1. [C ossRe ]
62.
Te ie , N.; Glissan , D.; G imple , J.; Ba ieu, F.; Abbal, P.; Cou u e, C.; Ageo ges, A.; A anasso a, R.; Léon, C.; Renaudin, J.-P.;
e al. Isogene Speci ic Oligo A ays Re eal Mul i ace ed Changes in Gene Exp ession du ing G ape Be y (Vi is ini e a L.)
De elopmen . Plan a 2005,222, 832–847. [C ossRe ]
63.
Ba na on, L.; Doco, T.; Te ie , N.; Ageo ges, A.; Romieu, C.; Pelle in, P. In ol emen o Pec in Me hyl-Es e ase du ing he
Ripening o G ape Be ies: Pa ial CDNA Isola ion, T ansc ip Exp ession and Changes in he Deg ee o Me hyl-Es e i ica ion o
Cell Wall Pec ins. Phy ochemis y 2001,58, 693–701. [C ossRe ]
64.
She chik, V.E.; Hugou ieux-Co e-Pa a , N. PaeX, a Second Pec in Ace yles e ase o E winia Ch ysan hemi 3937. J. Bac e iol.
2003
,
185, 3091–3100. [C ossRe ]
65.
Lione i, V.; Raiola, A.; Ma ei, B.; Bellincampi, D. The G ape ine V PMEI1 Gene Encodes a No el Func ional Pec in
Me hyles e ase Inhibi o Associa ed o G ape Be y De elopmen . PLoS ONE 2015,10, e0133810. [C ossRe ] [PubMed]
66.
Di Ma eo, A.; Gio ane, A.; Raiola, A.; Cama della, L.; Boni en o, D.; De Lo enzo, G.; Ce one, F.; Bellincampi, D.; Tse noglou, D.
S uc u al Basis o he In e ac ion be ween Pec in Me hyles e ase and a Speci ic Inhibi o P o ein. Plan Cell
2005
,17, 849–858.
[C ossRe ] [PubMed]
67.
Ishima u, M.; Kobayashi, S. Exp ession o a Xyloglucan Endo-T ansglycosylase Gene Is Closely Rela ed o G ape Be y So ening.
Plan Sci. 2002,162, 621–628. [C ossRe ]
68.
Lija e zky, D.; Ca bonell-Beje ano, P.; G imple , J.; B a o, G.; Flo es, P.; Fenoll, J.; Hellín, P.; Oli e os, J.C.; Ma ínez-Zapa e ,
J.M. Be y Flesh and Skin Ripening Fea u es in Vi is ini e a as Assessed by T ansc ip ional P o iling. PLoS ONE
2012
,7, e39547.
[C ossRe ]
69.
Va gas, A.M.; Faja do, C.; Bo ego, J.; De And és, M.T.; Ibáñez, J. Polymo phisms in V Pel Associa e wi h Va ia ion in Be y
Tex u e and Bunch Size in he G ape ine. Aus . J. G ape Wine Res. 2013,19, 193–207. [C ossRe ]
Plan s 2023,12, 2488 21 o 21
70. Ahmed, A.E.; Laba i ch, J.M. Cell Wall Me abolism in Ripening F ui . Plan Physiol. 1980,65, 1014–1016. [C ossRe ]
71.
Rosli, H.G.; Ci ello, P.M.; Ma ínez, G.A. Changes in Cell Wall Composi ion o Th ee F aga ia x Ananassa Cul i a s wi h Di e en
So ening Ra e du ing Ripening. Plan Physiol. Biochem. 2004,42, 823–831. [C ossRe ]
72.
Schlosse , J.; Olsson, N.; Weis, M.; Reid, K.; Peng, F.; Lund, S.; Bowen, P. Cellula Expansion and Gene Exp ession in he
De eloping G ape (Vi is ini e a L.). P o oplasma 2008,232, 255–265. [C ossRe ]
73.
Naleway, J.J.; Coleman, D.J.; Hawley, R.M.; Cook, G.M. Cellulase Assay as a Me hod o Moni o ing G ape Ripening. FASEB J.
2008,22, 841.2. [C ossRe ]
74.
Ubeda, C.; Co iella, M.G.I.; Villalobos-Gonzalez, L.; Gomez, C.; Pas enes, C.; Peña-Nei a, A. Ripening and S o age Time E ec s
on he A oma ic P o ile o New Table G ape Cul i a s in Chile. Molecules 2020,25, 5790. [C ossRe ]
75.
In e na ional O ganisa ion o Vine and Wine (OIV). Compedium o In e na ional Me hods o Wine and Mus Analysis, 2022nd OIV ed.;
In e na ional O ganisa ion o Vine and Wine (OIV): Pa is, F ance, 2022; Volume 1, ISBN 978-2-85038-052-5.
76.
Ribé eau-Gayon, P.; Glo ies, Y.; Maujean, A.; Dubou dieu, D. Phenolic Compounds. In Handbook o Enology, Volume 2: The
Chemis y o Wine and S abiliza ion and T ea men s; John Wiley & Sons, L d.: Chinches e , UK, 2006; pp. 141–203.
77.
Me cu io, M.D.; Dambe gs, R.G.; He de ich, M.J.; Smi h, P.A. High Th oughpu Analysis o Red Wine and G ape Phenolics-
Adap a ion and Valida ion o Me hyl Cellulose P ecipi able Tannin Assay and Modi ied Some s Colo Assay o a Rapid 96 Well
Pla e Fo ma . J. Ag ic. Food Chem. 2007,55, 4651–4657. [C ossRe ]
78.
Peña-Nei a, A.; Cáce es, A.; Pas enes, C. Low Molecula Weigh Phenolic and An hocyanin Composi ion o G ape Skins om C .
Sy ah (Vi is ini e a L.) in he Maipo Valley (Chile): E ec o Clus e s Thinning and Vineya d Yield. Food Sci. Technol. In .
2007
,13,
153–158. [C ossRe ]
79.
Cejudo-Bas an e, M.J.; del Ba io-Galan, R.; He edia, F.J.; Medel-Ma aboli, M.; Peña-Nei a, A. Loca ion e ec s on he polyphenolic
and polysaccha idic p o iles and colou o Ca ignan g ape a ie y wines om he Chilean Maule egion. Food Res. In .
2018
,106,
729–735. [C ossRe ]
80.
Gil-Co iella, M.; Peña-Nei a, Á. Ex ac ion o Soluble Polysaccha ides om G ape Skins. Cienc. In es ig. Ag a .
2017
,44, 83–93.
[C ossRe ]
81.
González-Agüe o, M.; Ga cía-Rojas, M.; Di Geno a, A.; Co ea, J.; Maass, A.; O ellana, A.; Hin ichsen, P. Iden i ica ion o Two
Pu a i e Re e ence Genes om G ape ine Sui able o Gene Exp ession Analysis in Be y and Rela ed Tissues De i ed om
RNA-Seq Da a. BMC Genom. 2013,14, 878. [C ossRe ]
82.
A anda, P.S.; LaJoie, D.M.; Jo cyk, C.L. Bleach gel: A simple aga ose gel o analyzing RNA quali y. Elec opho esis
2012
,33,
366–369. [C ossRe ]
Disclaime /Publishe ’s No e:
The s a emen s, opinions and da a con ained in all publica ions a e solely hose o he indi idual
au ho (s) and con ibu o (s) and no o MDPI and/o he edi o (s). MDPI and/o he edi o (s) disclaim esponsibili y o any inju y o
people o p ope y esul ing om any ideas, me hods, ins uc ions o p oduc s e e ed o in he con en .