1997 Ox o d Uni e si y P ess 1355–1361
Nucleic Acids Resea ch, 1997, Vol. 25, No. 7
Conse ed s uc u e o IS
200
elemen s in
Salmonella
Ca men R. Beuzón and Josep Casadesús*
Depa amen o de Gené ica, Facul ad de Biología, Uni e sidad de Se illa, Apa ado 1095, E-41080 Se illa, Spain
Recei ed Decembe 12, 1996; Re ised and Accep ed Feb ua y 7, 1997 DDBJ/EMBL/GenBank accession nos X56834, Y09564, Y08755
ABSTRACT
Sequence analysis o h ee IS
200
elemen s ( wo om
Salmonella
yphimu ium
, one om
Salmonella
abo uso is
) e eals a highly conse ed s uc u e,
wi h a leng h o 707–708 bp and absence o e minal
epea s. IS
200
con ains an open- eading- ame (ORF)
which po en ially encodes a pep ide o 151 amino
acids, wi h a pu a i e ibosome-binding-si e p ope ly
placed ups eam o he ORF. A po en ial RNA s em–
loop s uc u e ha migh occlude he ibosome-
binding-si e o he ORF is also ound. Ano he
conse ed ai is a po en ial RNA hai pin which
esembles a Rho-independen ansc ip ion e mi-
na o , loca ed nea one end o IS
200
. The junc ions
be ween IS
200
and hos DNA sequences a e A+T- ich.
Upon inse ion, IS
200
duplica es 1–2 bp o hos DNA
sequences. The obse a ion ha IS
200
elemen s
cha ac e ized as ‘hops’ a e oughly iden ical o hose
esiding in he
Salmonella
genome sugges s ha IS
200
ansposi ion is unlikely o gene a e inac i e copies. I
such is he case and many o all IS
200
elemen s a e
ac i e, he ex emely low equency o IS
200
ans-
posi ion may e lec he no mal beha io o he
elemen .
INTRODUCTION
IS200 is an inse ion elemen abundan in he genus Salmonella
(1,2) and spo adically ound in s ains o Shigella (2),
Esche ichia coli (3) and Ye sinia (4). The ch omosome o
Salmonella yphimu ium LT2 con ains six copies o IS200
(1,5,6); in o he S. yphimu ium s ains he numbe o IS200
copies anges om 1 o >12 (2). One pa adoxical ai o IS200
beha io is i s poo con ibu ion o spon aneous mu agenesis
(7,8), which can be co ela ed wi h he ex emely low
ansposi ion equency o he elemen (8–10). In ac , only wo
IS200 inse ion mu a ions ha e been epo ed in S. yphimu ium:
one in he his ope on (1), ano he in he gp gene (8). Hun s o
IS200-induced mu an s in S. yphimu ium, some imes in ol ing
posi i e selec ion s a egies, ha e con i med ha ansposi ion is
a e (7–10). Fu he mo e, su eys ca ied ou in ield isola es
ha e indica ed ha IS200 ansposi ion is also in equen in
na u al popula ions o Salmonella (11).
One possible explana ion o he low ac i i y o IS200 migh be
he gene a ion a ela i ely high equencies o de ec i e copies
o he elemen . Such a beha io has no p eceden s among
p oka yo ic inse ion elemen s (12) bu is ela i ely common in
euka yo ic ansposons (13). To in es iga e his possibili y, we
compa ed he s uc u e o IS200 ‘hops’ wi h ha o ‘genomic
copies’ o he elemen . The esul s we e unequi ocal: elemen s
cha ac e ized as IS200 hops a e ex emely simila , i no iden ical,
o IS200 elemen s esiding in he Salmonella genome. Thus
IS200 ansposi ion is unlikely o gene a e inac i e o abe an
copies. A co olla y is ha he ex emely low equency o IS200
ansposi ion and i s sca ce con ibu ion o spon aneous
mu agenesis likely e lec he no mal beha io o he elemen .
Cladog ams cons uc ed wi h he p edic ed pep ides o IS200
ORFs om Salmonella, E.coli and Ye sinia ma ch he
phylogene ic ee o he En e obac e iaceae (14,15). This
obse a ion gi es suppo o he hypo hesis ha IS200 is an
ances al elemen o en e ic bac e ia (16).
MATERIALS AND METHODS
Bac e ial s ains and plasmids
All s ains and isola es o S. yphimu ium used in his wo k de i e
om he s anda d wild- ype LT2. S ain SS44 o Salmonella
abo uso is (17) was p o ided by S. Rubino, Ins i u e o
Mic obiology, Uni e si à degli S udi di Sassa i, Sassa i, Sa dinia,
I aly. The plasmid ec o s used o cloning we e pBluesc ip I
KS(+) and pBluesc ip II SK(+) (S a agene, La Jolla, CA). pIZ46
is a pUC19 de i a i e ca ying a ail- o- ail dime o he 0.3 kb
EcoRI–HindIII agmen o IS200 (2). pIZ47 is a pUC19
de i a i e ca ying a e ame o he in e nal TaqI agmen o
IS200, lanked by EcoRI si es (I. Gibe and J. Casadesús,
unpublished). T ans o ma ion wi h plasmid DNA ollowed he
p ocedu e o Inoue e al. (18). The ecipien s ain o
ans o ma ion was E.coli DH5α (19).
Media and chemicals
Lu ia–Be ani medium (LB) wi h added NaCl (5 g/l) was used as
he s anda d ich b o h. Solid medium con ained Di co aga a a
inal concen a ion o 1.5%. EBU indica o pla es we e p epa ed
as desc ibed elsewhe e (20). Concen a ions o an ibio ics we e
as ollows: kanamycin sul a e (Sigma, S Louis, MO), 50 mg/l;
ampicillin (Sigma), 100 mg/l. The indica o 5-b omo-4-chlo o-3-
indolyl-β-D-galac opy anoside (‘X-gal’, Uni ed S a es Bio-
logical, Swampsco , MA), was dissol ed in N,N-dime hyl o ma-
mide (2 mg/ml) and used a he inal concen a ion o 25 µg/ml.
Fo gel elec opho esis, aga ose (SeaKem, FMC, Rockland, ME)
was p epa ed in ei he TAE o TBE bu e s (21). The inal aga ose
concen a ion (0.7–1.0%) depended on he ange o DNA
*To whom co espondence should be add essed. Tel: +34 5 455 7105; Fax: +34 5 455 7104; Email: [email p o ec ed]
Nucleic Acids Resea ch, 1997, Vol. 25, No. 7
1356
agmen s o be sepa a ed. E bu e con ained 40 mM T is-base
and 2 mM EDTA; pH was adjus ed o 7.9 wi h glacial ace ic acid.
The lysis solu ion con ained 3% sodium dodecyl sul a e, 50 mM
T izma base and 72 mM NaOH.
Bac e iophages and ansduc ion
The ansducing phage was P22 HT 105/1 in 201 (22), hence o h
e e ed as P22 HT. Phage sensi i i y was es ed wi h he
clea -plaque mu an P22 H5. To ob ain phage- ee isola es,
ansduc an s we e pu i ied on EBU pla es. Fo ansduc ion o
an ibio ic- esis ance ma ke s (e.g. Km ), ansducing mix u es
we e made on LB pla es and incuba ed 4–5 h be o e
eplica-p in ing o selec i e pla es wi h s e ile el e s.
Vi ulence plasmid cu ing
Cu ing o he i ulence plasmid (pSLT) o S. yphimu ium was
achie ed by des abiliza ion o he pa locus wi h a
kanamycin- esis an ca idge (23). The Km ca idge was
in oduced in o he s ain o be cu ed by P22 HT ansduc ion. Km
ansduc an s we e s eaked on EBU pla es; indi idual phage- ee
colonies we e hen sco ed o loss o kanamycin esis ance.
DNA ex ac ion and pu i ica ion
Genomic DNA p epa a ions we e ob ained acco ding o Ausubel
e al. (24), using 10 ml o an o e nigh cul u e. Plasmid DNA o
bo h clone analysis and DNA sequencing was ob ained wi h he
alkaline lysis me hod, wi hou phenol ex ac ion (25). Plasmid
DNA p epa a ions o he gene a ion o nes ed dele ions we e
ob ained wi h he ‘boiling’ me hod (26), ollowed by pu i ica ion
in Sephadex G-50 columns. Vi ulence plasmid DNA was
ex ac ed as desc ibed elsewhe e (11).
Diges ion, end modi ica ion and liga ion o DNA
agmen s
Res ic ion enzymes we e pu chased om P omega Bio ech
(Madison, WI), Boeh inge Mannheim (Mannheim, Ge many)
and New England Biolabs (Be e ly, MA). The bu e s used we e
hose p o ided by he supplie . Fo mul iple diges ions, we used
he ‘One-pho -all’ bu e (Pha macia Bio ech, San F ancisco,
CA). Deoxy ibonucleo ides and Klenow DNA polyme ase we e
pu chased om P omega Bio ech. T4 polynucleo ide ligase was
om Boeh inge Mannheim; liga ion was achie ed by incuba ing
>12 h a 16C. Fo blun end liga ion, a low-ATP bu e was used
(New England Biolabs, unpublished obse a ions).
DNA hyb idiza ion
Diges ion o DNA wi h es ic ion enzymes, elec opho e ic
sepa a ion o es ic ion agmen s, DNA dena u a ion, ans e o
DNA om aga ose gels o nylon il e s, DNA labeling and DNA
hyb idiza ion ollowed he p ocedu es desc ibed by Sou he n
(27) and Samb ook e al. (21). Reco e y o DNA om aga ose
gels was achie ed wi h he GeneClean sys em (Bio 101, La Jolla,
CA). The s anda d IS200 p obes we e he EcoRI agmen s o
pIZ46 and pIZ47. These agmen s we e eco e ed om aga ose
gels and pu i ied by he GeneClean sys em (Bio 101), modi ied
acco ding o Boyle and Lew (28). DNA p obes we e labeled wi h
he DIG DNA labeling ki om Boeh inge Mannheim.
Gene a ion o nes ed dele ions
Dele ions we e gene a ed wi h E.coli exonuclease III, using he
double-s anded nes ed dele ion ki om Pha macia Bio ech.
P o ec ed, 3′ o e hanging ends we e gene a ed by ApaI diges ion,
while he subs a e o exonuclease III diges ion was gene a ed
wi h ClaI. Dele ed plasmids we e ea ed wi h nuclease S1 o
gene a e blun ends; hese we e hen liga ed wi h T4 poly-
nucleo ide ligase.
DNA sequencing
Sequencing eac ions we e pe o med wi h he dideoxy chain
e mina ion p ocedu e (29), using he Sequenase ki e sion 2.0
(Uni ed S a es Biochemical Co po a ion, Cle eland, OH). The
p ime s used o sequencing a e shown in Table 1. Sequencing
gels we e p epa ed in TBE and con ained 6% ac ylamide and
500 g/l u ea. Gels we e un in a Poke Face SE1500 sequence
(Hoe e Scien i ic Ins umen s, San F ancisco, CA), d ied in a
Slab Gel D ye , model SE1160 (Hoe e ) and de eloped by
exposu e o an X- ay ilm.
Sequence analysis and phylogeny me hods
We used he compu e analysis package o he Gene ics Compu e
G oup, Uni e si y o Wisconsin, Madison, WI (30). F ee ene gies
o RNA seconda y s uc u es we e calcula ed wi h he p og am
‘Fold RNA’ (31). E olu iona y dis ances be ween pep ide
sequences we e measu ed using he Jukes–Can o algo i hm (32).
Phylogene ic ees we e cons uc ed wi h he G owT ee p og am,
using he ‘unweigh ed pai -g oup a ihme ic a e age’ (UPGMA)
me hod (33).
RESULTS
Sequence analysis o he inse ion hisD984::IS200
The o iginal mu a ion hisD984::IS200 (1) had been p e iously
cloned on se e al plasmid ec o s (2). One o hese clones, pIZ44,
is a pUC9 de i a i e ca ying a ∼2 kb inse which includes he
inse ion hisD984::IS200 and lanking sequences o he
S. yphimu ium his ope on (2). DNA sequencing o he
hisD984::IS200 inse ion (hence o h called IS200-HIS) was
ca ied ou di ec ly on pIZ44, using p ime s I, II and V (Table 1).
These p ime s we e designed using p e ious sequencing da a
(34). The EMBL accession numbe o IS200-HIS is X56834.
The p edic ed IS200 ORF (see below) uns opposi e o hisD ( o
a map o he his idine ope on; e . 35).
Table 1. DNA p ime s used o sequencing IS200 elemen s
P ime Sequence (5′–3′) O igin
T3 ATTAACCCTCACTAAAG pBluesc ip
T7 AATACGACTCACTATAG pBluesc ip
I GTGCAGAGGGTACTATC IS200
II GAGCTTAGCGCACACCC IS200
III CCCGCCGAAGATGAGTGTGT IS200
IV GTCTTCGGTATTTGGGCGC IS200
VCTGCCTACTGCCCTACGCTTCT IS200
1357
Nucleic Acids Resea ch, 1994, Vol. 22, No. 1
Nucleic Acids Resea ch, 1997, Vol. 25, No. 7 1357
Cha ac e iza ion o an IS200 elemen inse ed in he
S. yphimu ium i ulence plasmid
Inc ease in he numbe o IS200 elemen s is obse ed a low bu
de ec able equencies among he su i o s o s ab cul u es
(1,9,10), a beha io p e iously epo ed o o he inse ion
elemen s (36–38). Howe e , in a gi en s ain, IS200 copy numbe
can po en ially inc ease by duplica ion o ch omosomal egions
(39). This ca ea di ec ed ou sea ch o he de ec ion o IS200
inse ions in he S. yphimu ium i ulence plasmid; he a ionale
was ha a ‘hop’ in ans was unlikely o be caused by DNA
ea angemen s o he han ansposi ion.
Because he i ulence plasmid (pSLT) o S. yphimu ium LT2 does
no ca y IS200 (5), he p esence o IS200 inse ions in pSLT can be
sco ed by compa ing he IS200 p o iles o isola es ca ying ex a
IS200 copies and hose o de i a i es cu ed o he i ulence plasmid.
Cu ing o pSLT was achie ed wi h he me hod o Tinge and Cu iss
III (23). Analysis o 54 LT2 de i a i es ca ying mo e han six
IS200 copies yielded h ee independen examples o plasmid-bo ne
IS200 elemen s. Sou he n hyb idiza ion analysis o pSLT DNA
diges ed wi h P uII, HincII, Ps I and A aI (and wi h combina ions
o hese enzymes) indica ed ha P uII–HincII diges ion o one o he
candida es gene a ed a band o only 3.7 kb, absen in he cu ed
de i a i e. This 3.7 kb agmen was cloned on o he SmaI si e o
pBluesc ip II SK(+) o gene a e plasmid pIZ801. Nes ed dele ions
wi h exonuclease III educed he size o he inse o pIZ801 o 1 kb;
Sou he n hyb idiza ion analysis indica ed ha he esul ing plasmid,
pIZ802, s ill ca ied IS200. The inse o pIZ802 was sequenced
using p ime s T7, T3, III and IV (Table 1). This IS200 elemen
inse ed in he i ulence plasmid (EMBL accession no. Y09564)
will be hence o h called IS200-VP.
Cha ac e iza ion o an IS200 elemen om S.abo uso is
S ain SS44 o S.abo uso is ca ies an IS200 elemen on a ∼9 kb
Ps I ch omosomal agmen (11). Ps I agmen s o ∼9 kb om
S.abo uso is SS44 we e cloned on o pBluesc ip I KS(+). The
p esence o IS200 among Lac–, Ap ans o man s o E.coli
DH5α was sc eened by Sou he n hyb idiza ion, using he EcoRI
agmen o pIZ46 as a p obe (2). One posi i e isola e was he
sou ce o plasmid pIZ72. Res ic ion analysis p o ed ha pIZ72
ca ied an inse o 9.5 kb. This inse was spli in wo agmen s
o 6.5 and 3 kb by S uI diges ion. The 3 kb agmen (bu no he
6.5 kb agmen ) hyb idized agains IS200 p obes, sugges ing ha
he IS200 elemen was loca ed in he small S uI agmen . The
la e was cloned on o pBluesc ip I KS(+) o gene a e plasmid
pIZ73.
To educe he size o he 3 kb S uI agmen o pIZ73, nes ed
dele ions we e gene a ed wi h exonuclease III. The p esence o
IS200 among dele ion de i a i es o pIZ73 was de ec ed by
Sou he n hyb idiza ion, as abo e. One plasmid ca ying a ∼1 kb
inse (pIZ74) was chosen o DNA sequencing wi h p ime s I, II,
V, T3 and T7. This IS200 elemen (EMBL accesion no. Y08755)
will be hence o h called IS200-SAO.
Gene al ea u es o IS200 elemen s om Salmonella
The h ee IS200 elemen s sequenced a e e y simila . IS200-HIS
is 707 bp, while IS200-VP and IS200-SAO a e bo h 708 bp. Some
ele an ea u es ound in hei sequences a e as ollows.
(i) All elemen s lack e minal epea s, as p e iously epo ed
(8,34,40). The ends o he h ee elemen s a e highly conse ed:
in he le -mos 50 bp, only 1 bp di e ence is ound be ween
IS200-HIS and IS200-VP, while IS200-SAO shows a 2 bp
di e ence wi h bo h IS200-HIS and IS200-VP. In u n, he
igh -mos 50 bp a e iden ical in IS200-HIS and IS200-VP and
1 bp di e ence (wi h bo h) is ound in IS200-SAO.
(ii) The h ee elemen s con ain a single ORF which can
po en ially yield a pep ide o 151 amino acids. The p edic ed
pep ides encoded by IS200-HIS and IS200-VP a e iden ical,
while he p edic ed pep ide o IS200-SAO shows ou amino acid
changes (Fig. 1). The numbe o changes in he nucleo ide
sequence o he ORFs a e as ollows: (a) only 1 bp di e ence (a
a hi d-codon posi ion) be ween IS200-HIS and IS200-VP;
(b) 10 n di e ences (six a hi d-codon posi ions) be ween
IS200-SAO and IS200-HIS; (c) 11 n di e ences (se en a
hi d-codon posi ions) be ween IS200-SAO and IS200-VP. Thus
he di e gence is highe a he DNA le el han a he pep ide le el,
sugges ing ha he coding capaci y o he ORF is selec i ely
main ained.
A da abank sea ch indica ed ha he IS200 ORF is ela ed o he
ansposase o IS1004, an inse ion elemen ound in Vib io
chole ae (41). Addi ional e idence ha he IS200 ORF may
encode he ansposase o he elemen is p o ided by he
obse a ion ha exp ession o he IS200 ORF om an inducible
p omo e inc eases he equency o a ious IS200-associa ed
DNA ea angemen s (42; C. R. Beuzón and J. Casadesús,
unpublished). Un o una ely, he a i y o IS200 ansposi ion has
so a hampe ed a di ec su ey o he unc ion o ORF1 (e.g.
mu a ions in ORF1 should ende a non- ansposing elemen ).
(iii) A po en ial ibosome-binding si e (5′-AGGGG-3′) is
loca ed be ween nucleo ides –5 and –9 ups eam o he s a
codon o he ORF. The sequence di e s only 1 bp om he
consensus and is loca ed a a s anda d dis ance om he s a
codon (43,44). This pu a i e ibosome-binding-si e is 100%
conse ed in all elemen s cha ac e ized in his s udy (and in IS200
elemen s om o he sou ces: see below).
(i ) Two egions ha can be expec ed o gi e ise o seconda y
s uc u es in hei ansc ip s a e ound ups eam o he ORF. The
le -mos s uc u e (nucleo ides 9–32) can gi e ise o a hai pin
(∆G0: –14.1 kcal/mol) which eminds o a Rho-independen
ansc ip ion e mina o (Fig. 2). This egion has been ac ually
shown o cause he pola i y o he inse ion hisD984::IS200 on he
dis al gene hisC (40). The po en ial hai pin is iden ical in
IS200-HIS and IS200-VP and shows a 1 bp di e ence (loca ed in
he s em) in IS200-SAO. T ansc ip ional e mina o s, bo h
Rho-dependen and Rho-independen , ha e been ound nea he
ends o many inse ion sequences and a e usually ega ded as
con ol elemen s ha e mina e ansc ip s en e ing he IS (12).
The second s uc u e is de ined by wo in e ed epea s loca ed
be ween nucleo ides 66–85 and 120–139. The second epea is
only 3 bp away om he s a o he ORF. The in e ed epea s can
gi e ise o a s em–loop s uc u e in he ansc ip (∆G0:
–25.8 kcal/mol). I o med, his s uc u e migh cause occlusion
o he ibosome-binding-si e (Fig. 2). The po en ial s em–loop
egion is iden ical in IS200-HIS and IS200-SAO and shows a
1 bp di e ence (in he s em) in IS200-VP.
Res ic ion analysis o IS200 elemen s om
S. yphimu ium LT2
Fi e IS200 elemen s p esen in he ch omosome o S. yphimu ium
LT2 (copies I, II, III, V and VI; 5,6) we e cloned using ‘locked-in’
Nucleic Acids Resea ch, 1997, Vol. 25, No. 7
1358
Figu e 1. Alignmen o he p edic ed pep ides encoded by he ORF o IS200 elemen s om a ious sou ces. HIS, VP and SAO a e he h ee IS200 elemen s sequenced
in his wo k. Copy IV is one o he IS200 elemen s o he S. yphimu ium ch omosome (5,6,46). SARA17 is ano he Salmonella IS200 elemen (3), while ECOR8,
ECOR51, ECOR63 and ECOR72 a e IS200 elemen s om E.coli (3). An IS200 elemen om Y.pes is (4) is also included. Columns a e shaded when mo e han hal
o he en ies a e iden ical.
Mud-P22 p ophages (10,45). Diges ions we e ca ied ou wi h
es ic ion enzymes ha gene a e dis inc es ic ion agmen s in
he elemen s IS200-HIS, IS200-VP and IS200-SAO: HpaII,
HaeIII, HindIII, HphI and EcoRI. Res ic ion agmen s we e
hen analyzed by Sou he n hyb idiza ion agains IS200 p obes.
The i e elemen s p o ed o ha e iden ical es ic ion maps (da a
no shown). These esul s sugges ha IS200 elemen s om
S. yphimu ium ha e a highly conse ed s uc u e, as p e iously
p oposed (3). Copy IV was no included in hese expe imen s
because i has been al eady sequenced (46); i is ex emely simila
o bo h IS200-HIS and IS200-VP (see below).
Sequence compa isons among IS200 elemen s om
a ious sou ces
Sequences o o he IS200 elemen s we e e ie ed om he
EMBL da abank and used o u he compa isons. The se-
quences compiled we e: (i) he comple e sequence o an IS200
elemen om Ye sinia pes is (6); (ii) he comple e sequence o
IS200 copy IV om he ch omosome o S. yphimu ium (46); he
pa ial sequences ob ained o an IS200 elemen om Salmonella
s ain SARA17 (16) and o IS200 elemen s om E.coli s ains
ECOR8, ECOR51, ECOR63 and ECOR72 (16). Rele an da a
a e as ollows.
(i) IS200 copy IV is 710 bp (46), ha is, 2 bp longe han
IS200-SAO and IS200-VP and 3 bp longe han IS200-HIS. The
IS200 elemen om Y.pes is is 709 bp (4). The leng h o he IS200
elemen s om s ains SARA17, ECOR8, ECOR51, ECOR63 and
ECOR72 is no known (16).
(ii) Only 1 bp change is ound in he 50 bp o he le end o
IS200 copy IV, wi h espec o IS200-HIS and IS200-VP.
Likewise, 1 bp change is ound in he igh end. The ends o he
IS200 elemen om Y.pes is a e also ex emely simila o hose o
IS200-HIS, IS200-SAO and IS200-VP: only 2 bp di e ences
om each o he IS200-HIS ends; 3 and 2 bp, espec i ely, wi h
he igh and le ends o IS200-VP; 4 and 1 bp di e ences wi h
he ends o IS200-SAO. The ends o he IS200 elemen s ound in
s ains SARA17, ECOR8, ECOR51, ECOR63 and ECOR72
ha e no been sequenced (3,16).
(iii) The IS200 elemen om Y.pes is con ains an ORF ha
po en ially encodes a pep ide o 151 amino acids, like
IS200-SAO, IS200-VP and IS200-HIS. Howe e he ORF om
1359
Nucleic Acids Resea ch, 1994, Vol. 22, No. 1
Nucleic Acids Resea ch, 1997, Vol. 25, No. 7 1359
Figu e 2. (A) P edic ed s uc u e o he highly conse ed RNA hai pin loca ed
nea he le end o IS200. Base pai numbe s a e o IS200-HIS. (B) P edic ed
s uc u e o he s em–loop RNA s uc u e ha p ecedes he IS200 ORF. ‘SD’
indica es he posi ion o he pu a i e ibosome-binding-si e, whose bases a e
shown in bold ace. The posi ion o he s a codon o he ORF is also shown.
he Y.pes is IS200 elemen shows 14 amino acid di e ences wi h
he ORFs o IS200-HIS and IS200-VP (which a e iden ical). The
numbe o amino acid di e ences be ween IS200 SARA17 and
he pai IS200-HIS / IS200-VP is only i e. In ac , ou o hese
changes a ec he las i e amino acids o he p edic ed pep ide
and a e caused by a single –1 ameshi in IS200 SARA 17. The
ORF o IS200 copy IV is iden ical o ha o IS200 SARA 17.
(i ) The ORFs o he E.coli IS200 elemen s (3) encode
po en ial pep ides o ei he 152 amino acids (ECOR8, ECOR51
and ECOR63) o 142 amino acids (ECOR72). The numbe o
amino acid di e ences be ween hese elemen s and he pai
IS200-HIS/IS200-VP anges om 9 o 15.
( ) Excep when ameshi s a e in ol ed, he di e ences in
amino acid composi ion o he ORF unde es ima e he nucleo ide
a ia ion among IS200 elemen s. Fo ins ance, he ollowing
nucleo ide di e ences a e ound be ween he IS200-HIS ORF
egion and he ORFs o o he elemen s: IS200-VP, 1 bp; IS200
SARA17, 4 bp; IS200-SAO, 10 bp; IS200 ECOR51, 48 bp; and
IS200 ECOR72, 49 bp; IS200 ECOR 63, 52 bp; IS200 ECOR8,
53 bp; IS200 om Y.pes is, 75 bp.
Because he ORF is he only egion sequenced in all IS200
elemen s cha ac e ized om di e en hos s, we used he di e -
ences in he composi ion o hei p edic ed pep ides o ob ain he
phylogene ic ee shown in Figu e 3. This ee ep oduces he
phylogeny o he bac e ial species used as sou ces o IS200
(Salmonella, E.coli and Ye sinia: 14,15) and also e lec s he
ela edness among Salmonella species o se o a s (47). These
esul s a e he e o e suppo i e o he model ha IS200 is an
ances al elemen o he En e obac e iaceae (16).
Figu e 3. E olu iona y ee o IS200 elemen s om Salmonella, E.coli and
Ye sinia, cons uc ed using he p edic ed amino acid sequences o he pep ides
encoded by he IS200 ORF. A key o he names and ac onyms used o
designa e IS200 elemen s is gi en in he legend o Figu e 1. The scale ba
co esponds o one subs i u ion pe 100 amino acids.
Ou side he ORF, ex emely high sequence conse a ion is also
ound in he hai pin and s em–loop egions o IS200: o ins ance
no di e ences a e ound in hese DNA ac s be ween IS200 copy
IV (46) and he h ee elemen s whose sequence is epo ed in his
wo k (IS200-SAO, IS200-VP and IS200-HIS). The pu a i e
ibosome-binding-si e is also 100% conse ed in all IS200
elemen s, i espec i e o hei o igin.
Cha ac e iza ion o IS200 inse ion si es
The DNA sequences lanking he IS200 elemen inse ed a hisD
show wo A–T pai s a each side o he elemen (Fig. 4), hus
con i ming ha inse ion o IS200 a his si e caused a 2 bp
duplica ion, as p e iously epo ed (40). In u n, a da abank
sea ch o sequences homologous o he egions which lank he
IS200 inse ion in pSLT indica ed ha IS200 had inse ed in o he
imb ial ope on pe (48). An ex a A–T pai is ound a he IS200
inse ion si e, sugges ing ha IS200 inse ion a his si e has
gene a ed a 1 bp duplica ion.
The IS200 elemen om he S.abo uso is ch omosome is
lanked by wo A–T pai s a one side and eigh A–T pai s a he
o he side (Fig. 4). Because an IS200- ee e sion o his locus is
no a ailable, he occu ence o a duplica ion canno be con-
i med. Howe e , he p esence o A–T pai s a bo h sides sugges s
ha duplica ion o ei he 1 o 2 bp may ha e occu ed.
Suppo o he hypo hesis ha IS200 may duplica e 1 o 2 bp
a he inse ion si e is p o ided by addi ional da a collec ed om
he li e a u e (4,8) and om da abases (46). These da a, included
in Figu e 4, a e as ollows.
(i) The IS200 elemen inse ed in he gp gene is lanked by
h ee A–T pai s a one side and ou A–T pai s a he o he side
(8). Thus duplica ion o 1–3 bp may ha e occu ed. The exis ence
o a duplica ion canno be con i med because he wild- ype gp
sequence is no a ailable.
(ii) The IS200 elemen inse ed in he in A gene o Y.pes is is
lanked by ou A–T pai s a one side and wo A–T pai s a he
o he side (4); hus duplica ion o 1–2 bp may ha e occu ed. The
wild- ype sequence o he in A locus is no a ailable. Howe e ,
Nucleic Acids Resea ch, 1997, Vol. 25, No. 7
1360
Figu e 4. Junc ions be ween IS200 elemen s and hos sequences. The h ee uppe examples a e om elemen s sequenced in his s udy; sequences o he o he IS200
elemen s ha e been e ie ed om he li e a u e (4,8) o om he EMBL da abank (46).
in A loci ha e been sequenced in Y.en e ocoli ica (49,50) and
Y.pseudo ube culosa (51). These loci a e homologous o he
Y.pes is in A gene (77 and 94%, espec i ely). When he
compa ison is ca ied ou o he 30 bp ha lank he inse ion si e,
he homology is 100% and he only di e ence is he p esence o
wo ex a A–T pai s a he inse ion si e. Thus a 2 bp duplica ion
mus ha e occu ed.
Alignmen o IS200 inse ion si es does no disclose any
signi ican homologies; howe e , all he IS200 inse ion si es
appea o be A+T- ich: in he neighbo ing 13–25 bp, he
pe cen ages o A+T base pai s ange be ween 76 and 95%. Thus
we en a i ely sugges ha IS200 may ha e egional speci ici y
o A+T- ich DNA ac s, like o he inse ion elemen s (52–54).
DISCUSSION
Sequence compa isons sugges ha IS200 was al eady p esen in
he common ances o o E.coli, Salmonella and Ye sinia, a
hypo hesis ha ul ills he p edic ions o Bise cic and Ochman
(16). The ecen disco e y o an IS200-like elemen in Vib io
(41), a genus un ela ed o en e ic bac e ia, migh indica e ei he
he exis ence o IS200 in emo e s ages o bac e ial e olu ion o
he occu ence o ho izon al ans e . The la e is ega ded as a
a e e en among bac e ia (55), bu inse ion sequences a e
po en ial excep ions (56). In he case discussed he e, he high
di e gence be ween IS200 elemen s om en e ics and he
V.chole ae IS200-like elemen seems o ule ou ecen ho izon al
ans e (e.g., he p edic ed amino acid sequence o he ORF o he
V.chole ae IS200 elemen shows only a 40% iden i y wi h
IS200-HIS). Thus IS200 may be an ex emely old ansposable
elemen .
The IS200 elemen s cha ac e ized in his s udy a e 707–708 bp,
while S. yphimu ium copy IV is 710 bp (46) and he Y.pes is
IS200 elemen is 709 bp (4). A size o 707–710 bp makes IS200
one o he smalles inse ion elemen s ound in bac e ia (12).
Ano he ele an ea u e, he lack o e minal epea s, is a e
among p oka yo ic inse ion elemen s (12), albei wi h well-
known excep ions like bac e iophage Mu (57).
All IS200 inse ion si es show a high A+T con en , bu a
consensus a ge si e canno be deduced om he inse ion si es
a ailable. I he numbe o a ge s s udied is signi ican , he
p e e ence o IS200 o A+T- ich egions may co ela e he
beha io o IS200 wi h ha o elemen s ha show egional
speci ici y bu no de ined a ge s: o ins ance, IS1 (52–54), IS21
(58), IS50 (59,60) and IS186 (61,62). Regional speci ici y may
be aken as e idence ha he ansposase o he elemen
ecognizes a opological DNA s uc u e, a he han a de ined
a ge (63,64).
IS200 gene a es duplica ions o 1–2 bp a he inse ion si e
(Fig. 4), al hough he da a a ailable do no exclude he possibili y
o longe duplica ions (e.g., 3 bp). I con i med, he o ma ion o
duplica ions o a iable leng h would es ablish again a pa allel-
lism be ween IS200 and IS1 (54,65), IS21 (58) and IS186
(61,62).
The sca ci y o IS200-induced mu a ions and he lack o
eliable ansposi ion assays aised he ques ion o whe he he
Salmonella genome migh con ain inac i e (i.e., degene a e)
IS200 copies (9). Howe e , his s udy seems o ule ou his
possibili y: IS200 ‘hops’ and IS200 elemen s esiding in he
Salmonella genome a e simila o iden ical; hus mos , pe haps all
Salmonella IS200 elemen s can be expec ed o be ac i e. I such
is he case, he ex emely low equency o IS200 ansposi ion
(9,10) mus e lec he no mal beha io o he elemen . This
hypo hesis is suppo ed by he obse a ion ha na u al isola es o
Salmonella show s able S200 inge p in s (11).
Al hough he da a a ailable a e la gely desc ip i e, ce ain
s uc u al ea u es o IS200 sugges hypo he ical mechanisms ha
migh educe he ac i i y o he elemen . The pu a i e ansposase
gene appea s o be ansc ibed a ex emely low a es (10). In
addi ion, he hai pin loca ed nea he le end o IS200 migh
p e en ansc ip ion om ex e nal p omo e s and he s em–loop
ha occludes he ibosome-binding-si e o he pu a i e anspo-
sase gene migh keep ansla ion low. Al hough he exis ence o
hese mul iple con ols awai s expe imen al con i ma ion, i
p o ides a model o explain he pa adoxical beha io o IS200, an
inse ion elemen ha a ely ‘hops’. A low equency o
ansposi ion can be iewed as a sel - es ain mechanism (66);
hus he low ac i i y o IS200 migh ha e ac ually a o ed i s
e olu iona y pe sis ence.
ACKNOWLEDGEMENTS
This s udy was suppo ed by g an PB93/649 om he Di ección
Gene al de In es igación Cien í ica y Técnica (DGICYT) o
1361
Nucleic Acids Resea ch, 1994, Vol. 22, No. 1
Nucleic Acids Resea ch, 1997, Vol. 25, No. 7 1361
Spain. Addi ional unding was p o ided by he Regional
Go e nmen o Andalusia (Jun a de Andalucía). We a e g a e ul
o Angela Schia ino o he con ibu ion o he cloning o
IS200-SAO, o Ja ie Ruiz Albe o ad ice abou DNA
sequencing, o Nicolás P ados o help wi h compu e p og ams
and o Gab iel Gu ié ez o ad ice on phylogene ic ees. We
hank John Ro h, Ken Haack, Fe nando Go an es and Edua do
San e o o help ul discussions. We also acknowledge he
e icien assis ance ecei ed om José Có doba and Luis
Romanco.
REFERENCES
1 Lam, S. T. and Ro h J. R. (1983) Cell, 34, 951–960.
2 Gibe , I., Ba bé, J. and Casadesús, J. (1990) J. Gen. Mic obiol., 136,
2555–2560.
3 Bise cic, M. and Ochman, H. (1993) Gene ics, 133, 449–454.
4 Simone , M., Rio , B., Fo ineau, N. and Be che, P. (1996) In ec . Immun.,
64, 375–379.
5 Lam, S. T. and Ro h, J. R. (1983) Gene ics, 105, 801–811.
6 Sande son, K. E., Scio e, P., Liu, S. L. and Hessel, A. (1993) J. Bac e iol.,
175, 7624–7628.
7 Casadesús, J. and Ro h, J. R. (1989) Mol. Gen. Gene ., 216, 210–216.
8 O’Reilly, C., Black, G. W., La ey, R. and McConnell, D. J. (1990)
J. Bac e iol., 172, 6599–6601.
9 Casadesús, J., Beuzón, C. R. and Gibe , I. (1992) Gene . (Li e Sci. Ad .),
11, 179–186.
10 Beuzón, C. R. (1996) S uc u al and unc ional analysis o inse ion
elemen IS200. Ph. D. Thesis, Uni e si y o Se ille, Se ille, Spain.
11 Schia ino, A., Beuzón, C. R., Uzzau, S., Leo i, G., Cappuccinelli. P.,
Casadesús, J. and Rubino, S. (1996) Appl. En i on. Mic obiol., 62,
2375–2380.
12 Galas, D. J. and Chandle , M. (1989) In Be g, D. E. and Howe, M. M.
(eds) Mobile DNA. Ame ican Socie y o Mic obiology, Washing on, DC,
pp. 109–162.
13 Finnegan, D. J. (1989) T ends Gene ., 5, 103–107.
14 Ochman, H. and Wilson, A. C. (1987) In Neidha d . F. C., Ing aham, J. L.,
Low, K. B., Magasanik, B., Schaech e , M. and Umba ge , H. E. (eds)
Esche ichia coli and Salmonella yphimu ium. Cellula and Molecula
Biology. Ame ican Socie y o Mic obiology, Washing on, DC, pp.
1649–1654.
15 Law ence, J. G., Ha l, D. L. and Ochman, H. (1991) J. Gen. Mic obiol.,
137, 1911–1921.
16 Bise cic, M. and Ochman, H. (1993) J. Bac e iol., 175, 7863–7868.
17 Colombo, M. M., Leo i, G., Rubino, S., Ba ba o, A. and Cappuccinelli, P.
(1992) J. Gen. Mic obiol., 138, 725–731.
18 Inoue, H., Nojima, H. and Okayama, H. (1990) Gene, 93, 26–28.
19 Yanisch-Pe on, V., Viei a, J. and Messing, J. (1985) Gene, 33, 103–119.
20 Ga zón, A., Beuzón, C. R., Mahan, M. J. and Casadesús, J. (1996) Mol.
Gen. Gene ., 250, 570–580.
21 Samb ook, J., F i sch, E. F. and Mania is, T. (1989) Molecula Cloning; A
Labo a o y Manual. 2nd. edi ion. Cold Sp ing Ha bo Labo a o y P ess,
Cold Sp ing Ha bo , NY.
22 Schmiege , H. (1972) Mol. Gen. Gene ., 119, 75–88.
23 Tinge, S. A. and Cu iss, R. III (1990) In ec . Immun., 58, 3084–3092.
24 Ausubel, F. M., B en , R., Kings on, R. E., Moo e, D. D., Seidman, J. G.,
Smi h, J. A. and S uhl, K. (1987) Cu en P o ocols in Molecula Biology.
G eene Publishing Associa es & Wiley In e science, New Yo k, NY.
25 S ephen, D., Jones, C. and Scho ield, P. J. (1990) Nucleic Acids Res., 18,
7463–7464.
26 Holmes, D. S. and Quigley, M. (1981) Anal. Biochem., 114, 193–197.
27 Sou he n, E. M. (1975) J. Mol. Biol., 98, 503–517.
28 Boyle, J. S. and Lew, A. M. (1995) T ends Gene ., 11, 8.
29 Sange , F., Nicklen, S. and Coulson, A. R. (1977) P oc. Na l. Acad. Sci.
USA, 74, 5463–5467.
30 P og am Manual o he Wisconsin Package, Ve sion 8 (1994).
31 Zuke , M. (1989) Me hods Enzymol., 180, 262–288.
32 Swo o d, D. L. (1993) PAUP: phylogene ic analysis using pa simony,
e sion 3.1.1. Illinois Na u al His o y Su ey, Champaign, IL.
33 Snea h, P. H. A. and Sokal, R. R. (1973) Nume ical Taxonomy. W. H.
F eeman & Co, San F ancisco.
34 Gibe , I., Ca oll, K., Hillya d, D. R., Ba bé, J. and Casadesús, J. (1991)
Nucleic Acids Res., 19, 1343.
35 Winkle , M. E. (1996) In Neidha d , F. C., Cu iss, R. III, Ing aham, J. L.,
Lin, A. C. C., Low, K. B., Magasanik, B., Rezniko , W. S., Riley, M.,
Schaech e , M. and Umba ge , H. E. (eds) Esche ichia coli and
Salmonella. Cellula and Molecula Biology. 2nd. edi ion. Ame ican
Socie y o Mic obiology, Washing on, DC, pp. 485–505.
36 A be , W., Iida, S., Ju e, H., Caspe s, P., Meye , J. and Hänni, C. (1978)
Cold Sp ing Ha bo Symp. Quan . Biol., 43, 1197–1208.
37 G een, L., Mille , R., Dykhuizen, D. E. and Ha l, D. L. (1984) P oc. Na l.
Acad. Sci. USA, 81, 4500–4504.
38 Naas, T., Blo , M., Fi ch, W. M. and A be , W. (1994) Gene ics, 136,
721–730.
39 Ande son, R. P. and Ro h, J. R. (1979) Cold Sp ing Ha bo Symp. Quan .
Biol., 43, 1083–1087.
40 Lam, S. T. and Ro h, J. R. (1986) J. Mol. Biol., 187, 157–167.
41 Bik, E. M., Gouw, R. D. and Mooi, F. R. (1996) J. Clin. Mic obiol., 34,
1453–1461.
42 Haack, K. R. and Ro h, J. R. (1995) Gene ics, 141, 1245–1252.
43 Shine, J. and Dalga no, L. (1975) Na u e, 254, 34–38.
44 D ape , D. E. (1996) In Neidha d , F. C., Cu iss, R. III, Ing aham, J. L.,
Lin, A. C. C., Low, K. B., Magasanik, B., Rezniko , W, S., Riley, M.,
Schaech e , M. and Umba ge , H. E. (eds) Esche ichia coli and
Salmonella. Cellula and Molecula Biology. 2nd. edi ion. Ame ican
Socie y o Mic obiology, Washing on, D. C., pp. 902–908.
45 Youde ian, P., Sugiono, P., B ewe , K., Higgins, N. P. and Ellio , T. (1988)
Gene ics, 118, 581–592.
46 Bu nens, A. P., S anley, J., Hunkize , P., B oda d, I. and Nicole , J.
(unpublished) Z54217.
47 B enne , D. J. (1984) In K ieg. N. R. and Hol , J. G. (eds) Be gey’s
Manual o Sys ema ic Bac e iology. Williams & Wilkins, Bal imo e and
London, pp. 408–430.
48 F ied ich. M. J., Kinsey, N. E., Vila, J. and Kadne , R. J. (1993) Mol.
Mic obiol., 8, 543–558.
49 Young, V. B., Mille , V. L., Falkow, S. and Schoolnik, G. K. (1990) Mol.
Mic obiol., 4, 1119–1128.
50 Pepe, J. C., Badge , J. L. and Mille , V. L. (1994) Mol. Mic obiol., 11,
123–135.
51 Isbe g, R. R., Voo his, D. L. and Falkow, S. (1987) Cell, 50, 769–778.
52 Meye , J., Iida, S. and A be , W. (1980) Mol. Gen. Gene ., 178, 471–473.
53 Galas, D. J., Calos, P. and Mille , J. H. (1980) J. Mol. Biol., 144, 19–41.
54 Ze bib, D., Gamas, P., Chandle , M., P en ki, P., Bass, S. and Galas, D.
(1985) J. Mol. Biol., 185, 517–524.
55 Mayna d Smi h, J., Dowson, C. G. and Sp a , B. G. (1991) Na u e, 349,
29–31.
56 Law ence, J. G., Ochman, H. and Ha l, D. L. (1992) Gene ics, 131, 9–20.
57 Chaconas, G. (1987) In Symonds, N., Toussain , A., an de Pu e, P. and
Howe, M. M. Bac e iophage Mu. Cold Sp ing Ha bo Labo a o y, Cold
Sp ing Ha bo , NY, pp. 137–157.
58 Reimmann, C., Moo e, R., Li le, S., Sa ioz, A., Wille s, N. S. and Haas,
D. (1989) Mol. Gen. Gene ., 215, 416–424.
59 Be g, D. E., Schmand , M. A. and Lowe, J. B. (1983) Gene ics, 105,
813–828.
60 Lupski, J. R., Ge shon, P., Osaki, L. S. and Godson, G. N. (1984) Gene,
30, 99–106.
61 Ko ha y, R. K., Jones, D. and Candido, P. E. (1985) J. Bac e iol., 164,
957–959.
62 Sengs ag, C., Iida, S., Hies and-Naue , R. and A be , W. (1986) Gene, 49,
153–156.
63 S ellwagen, N. C. (1983) Biochemis y, 22, 6186–6193.
64 Gamas, P., Chandle , M. G., P enk i, P. and Galas, D. J. (1987) J. Mol.
Biol., 195, 261–272.
65 Iida, S., Hies and-Naue , R. and A be , W. (1985) P oc. Na l. Acad. Sci.
USA, 82, 839–843.
66 Dooli le, W. F., Ki kwood, T. B. L. and Demps e , M. A. H. (1984)
Na u e, 307, 501–502.