scieee Science in your language
[en] (orig)

The LysR-type transcription factor PacR is a global regulator of photosynthetic carbon assimilation in Anabaena

Abstract

Cyanobacteria perform water-splitting photosynthesis and are important primary producers impacting the carbon and nitrogen cycles at global scale. They fix CO2 through ribulose-bisphosphate carboxylase/oxygenase (RuBisCo) and have evolved a distinct CO2 concentrating mechanism (CCM) that builds high CO2 concentrations in the vicinity of RuBisCo favouring its carboxylase activity. Filamentous cyanobacteria such as Anabaena fix CO2 in photosynthetic vegetative cells, which donate photosynthate to heterocysts that rely on a heterotrophic metabolism to fix N2. CCM elements are induced in response to inorganic carbon limitation, a cue that exposes the photosynthetic apparatus to photodamage by over-reduction. An Anabaena mutant lacking the LysR-type transcription factor All3953 grew poorly and dies under high light. The rbcL operon encoding RuBisCo was induced upon carbon limitation in the wild type but not in the mutant. ChIP-Seq analysis was used to globally identify All3953 targets under carbon limitation. Targets include, besides rbcL, genes encoding CCM elements, photorespiratory pathway- photosystem- and electron transport-related components, and factors, including flavodiiron proteins, with a demonstrated or putative function in photoprotection. Quantitative reverse transcription polymerase chain reaction analysis of selected All3953 targets showed regulation in the wild type but not in the mutant. All3953 (PacR) is a global regulator of carbon assimilation in an oxygenic photoautotroph

Read accessible full text

The LysR-type transcription factor PacR is a global regulator of photosynthetic carbon assimilation in Anabaena

Author: Picossi Goñi, Silvia María; Flores García, Enrique; Herrero Moreno, Antonia
Publisher: Blackwell Publishing
Year: 2015
DOI: 10.1111/1462-2920.12800
Source: https://idus.us.es/bitstreams/87b97e5d-8e85-422c-8f4a-2a45a06502b6/download
Fo Pee Re iew Only
The LysR
-
ype ansc ip ion ac o PacR is a global egula o
o pho osyn he ic ca bon assimila ion in Anabaena
Jou nal:
En i onmen al Mic obiology and En i onmen al Mic obiology Repo s
Manusc ip ID:
EMI-2014-1511.R1
Manusc ip Type:
EMI - Resea ch a icle
Jou nal:
En i onmen al Mic obiology
Da e Submi ed by he Au ho :
22-Jan-2015
Comple e Lis o Au ho s:
Picossi, Sil ia; Consejo Supe io de In es igaciones Cien í icas, Ins i u o de
Bioq´uímica Vege al y Fo osín esis
Flo es, En ique; Consejo Supe io de In es igaciones Cien í icas, Ins i u o
de Bioq´uímica Vege al y Fo osín esis
He e o, An onia; Consejo Supe io de In es igaciones Cien í icas, Ins i u o
de Bioquímica Vege al y Fo osín esis
Keywo ds:
bac e ia, en i onmen al signal/s ess esponses, gene
exp ession/ egula ion
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
1
The LysR- ype ansc ip ion ac o PacR is a global egula o o pho osyn he ic 1
ca bon assimila ion in Anabaena 2
3
Sil ia Picossi, En ique Flo es and An onia He e o* 4
5
Ins i u o de Bioquímica Vege al y Fo osín esis, Consejo Supe io de In es igaciones 6
Cien í icas and Uni e sidad de Se illa, Amé ico Vespucio 49, E-41092, Se ille, Spain. 7
8
9
*Co esponding au ho . Tel.: +34 954489522. Fax: +34 954460165. E-mail add ess: 10
he e o@ib .csic.es 11
12
Keywo ds: ChIP; Cyanobac e ia; Oxygenic pho o ophy; Pho op o ec ion; RuBisCo 13
14
Running i le: Pho osyn he ic ca bon assimila ion egula o 15
16
Accession link o da a: 17
h p://www.ncbi.nlm.nih.go /geo/que y/acc.cgi? oken=a cxwkacxpyd ax&acc=GSE58861 18
19
20
21
22
Page 1 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
2
Summa y 23
Cyanobac e ia pe o m wa e -spli ing pho osyn hesis and a e impo an p ima y 24
p oduce s impac ing he ca bon and ni ogen cycles a global scale. They ix CO
2
25
h ough ibulose bisphospha e ca boxylase/oxygenase (RuBisCo) and ha e 26
e ol ed a dis inc CO
2
concen a ing mechanism (CCM) ha builds high CO
2
27
concen a ions in he icini y o RuBisCo a o ing i s ca boxylase ac i i y. 28
Filamen ous cyanobac e ia such as Anabaena ix CO
2
in pho osyn he ic 29
ege a i e cells, which dona e pho osyn ha e o he e ocys s ha ely on a 30
he e o ophic me abolism o ix N
2
. CCM elemen s a e induced in esponse o 31
ino ganic ca bon limi a ion, a cue ha exposes he pho osyn he ic appa a us o 32
pho odamage by o e - educ ion. An Anabaena mu an lacking he LysR- ype 33
ansc ip ion ac o All3953 g ows poo ly and dies unde high ligh . The bcL 34
ope on encoding RuBisCo is induced upon ca bon limi a ion in he wild ype bu 35
no in he mu an . ChIP-Seq analysis was used o globally iden i y All3953 a ge s 36
unde ca bon limi a ion. Ta ge s include, besides bcL, genes encoding CCM 37
elemen s, pho o espi a o y pa hway, pho osys em- and elec on anspo -38
ela ed componen s, and ac o s, including la odii on p o eins, wi h a 39
demons a ed o pu a i e unc ion in pho op o ec ion. qRT-PCR analysis o 40
selec ed All3953 a ge s showed egula ion in he wild ype bu no in he mu an . 41
All3953 (PacR) is a global egula o o ca bon assimila ion in an oxygenic 42
pho oau o oph. 43
44
45
Page 2 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
3
In oduc ion
46
As he o ganisms ha de eloped oxygenic pho osyn hesis, cyanobac e ia ha e played 47
a c ucial ole in Ea h's his o y and he e olu ion o li e in ou plane . Indeed, he 48
p oduc ion o O
2
as a esul o cyanobac e ial ac i i y was esponsible o he oxida ion 49
o he Ea h's a mosphe e abou 2.5-2.3 billion yea s ago (Lyons e al., 2014). 50
Fu he mo e, all he ex an plas ids o euka yo ic algae and plan s a e o cyanobac e ial 51
o igin. Cyanobac e ia we e he i s o ganisms o link he ac i i y o he wo ypes o 52
pho osys ems (PSI and PSII), which allowed he gene a ion o high elec ochemical 53
po en ial, and o combine hem wi h a H
2
O-spli ing complex. Nowadays, mos 54
cyanobac e ia a e pho o ophs elying on oxygenic pho osyn hesis o gene a e ATP 55
and educing equi alen s o he ixa ion o CO
2
and he assimila ion o ino ganic 56
ni ogen. Indeed, hey a e esponsible o an impo an ac ion o he p ima y 57
p oduc i i y in he Ea h's oceans, whe e hey a e impo an CO
2
and N
2
ixe s, hus 58
impac ing he C and N cycles a a global scale (Knoll 2008; P ice e al., 2008). 59
The enzyme esponsible o he bulk o CO
2
ixa ion in he biosphe e is ibulose-60
1,5-bisphospha e ca boxylase/oxygenase (RuBisCo), which has a ela i ely low a ini y 61
o CO
2
and, mo eo e , i can also accep O
2
as a subs a e. Compensa ing o his 62
ela i ely low pe o mance, RuBisCo is conside ed he mos abundan enzyme on 63
Ea h. As a ca boxylase, RuBisCo ca alyzes he i s s ep o he Cal in-Benson-64
Bassham (CBB) cycle, i.e., he inco po a ion o a mosphe ic CO
2
in o ibulose-1,5-65
bisphospha e o gi e wo molecules o 3-phosphoglyce a e. As an oxygenase, i 66
ca alyzes he inco po a ion o O
2
in o ibulose-bisphospha e, which p oduces 2-67
phosphoglycola e ha leads o pho o espi a ion wi h a subsequen loss o ixed C and 68
ene gy. To inc ease he e iciency o CO
2
ixa ion, cyanobac e ia ha e de eloped a 69
dis inc CO
2
concen a ing mechanism (CCM) cons i u ed by ino ganic ca bon (C
i
) 70
anspo e s ha inco po a e bica bona e and CO
2
in o he cell, and a p o einaceous 71
compa men , he ca boxysome, whe e RuBisCo, oge he wi h ca bonic anhyd ase, is 72
Page 3 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
4
con ined (P ice e al., 2008; Came on e al., 2014). Th ee high-a ini iy bica bona e 73
anspo e s ( he ABC- ype Cmp, also called BCT1, and he Na
+
-dependen BicA and 74
Sb A), and wo CO
2
anspo e s ( he high-a ini y NDH-I
3
and he low-a ini y NDH-I
4
) 75
ha e been iden i ied in di e en cyanobac e ia (see P ice, 2011). Th ough CCM, Ci in 76
he o m o CO
2
can concen a e in he icini y o cyanobac e ial RuBisCo, o allow high 77
speci ic ac i i y o p oduc ion o 3-phosphoglyce a e o le els much highe han in 78
plan s (Came on e al., 2014). Indeed, componen s o cyanobac e ial CCM ha e been 79
ans o med in obacco, wi h he esul o imp o ed speci ic ac i i y o CO
2
ixa ion, 80
which ep esen s a s ep owa ds imp o ed pho osyn hesis in plan s (Lin e al., 2014). 81
In unicellula cyanobac e ia, CCM elemen s a e egula ed by C
i
a ailabili y. 82
Especially genes encoding C
i
anspo e s a e induced, whe eas he s uc u al genes 83
o ca boxysome componen s and he bcL/S genes encoding RuBisCo a e only 84
mode a ely esponsi e (see P ice e al., 2008; Came on e al., 2014). In chemo ophic 85
bac e ia he p ocess o CO
2
ixa ion and he esponse o C
i
limi a ion a e usually 86
con olled by LysR- ype ansc ip ional egula o s (LTTRs). The genes encoding he 87
enzymes o he CBB cycle a e usually ound in clus e s egula ed by CbbR ac o s, 88
which cons i u e a sub- amily o LTTRs (Gibson and Tabi a, 1996). In unicellula 89
cyanobac e ia, a numbe o CbbR homologs ha e been cha ac e ized. CmpR is an 90
ac i a o o he cmp genes (Nishimu a e al., 2008), whe eas CcmR (aka NdhR) ac s as 91
a ansc ip ional ep esso o mul iple genes encoding o he C
i
anspo e s (e.g., Figge 92
e al., 2001; Wang e al., 2004). A hi d ype o CbbR-like p o ein, he ac i a o o he 93
RuBisCo genes, has no ye been iden i ied in cyanobac e ia. 94
Filamen ous he e ocys - o ming cyanobac e ia, o which Anabaena sp. PCC 95
7120 (he ea e Anabaena) is a model o ganism, addi ionally ha e he capaci y o cell 96
di e en ia ion o u n some O
2
-e ol ing pho osyn he ic cells o he ilamen in o 97
he e ocys s, which a e he e o ophic cells especialized in he ixa ion o a mosphe ic 98
N
2
. Thus, Anabaena is a uly plu icellula bac e ium wi h di e en cell ypes specialized 99
in di e en nu i ional asks ha exchange nu ien s and egula o s and con ibu e o 100
Page 4 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology

Fo Pee Re iew Only
5
he pe o mance o he ilamen as he o ganism uni (see Flo es and He e o, 2010). 101
Ni ogen assimila ion and he e ocys di e en ia ion in Anabaena a e egula ed by he 102
global ansc ip ion ac o N cA, which esponds o he cellula C- o-N a io, and he 103
he e ocys -speci ic ansc ip ion ac o He R (see He e o e al., 2013). The Anabaena 104
genomic sequence includes h ee genes anno a ed as CbbR-like LTTRs (Kaneko e 105
al., 2001). O hese, all0862 has been iden i ied as cmpR, and i s p oduc ac i a es he 106
exp ession o he cmp ope on (al 2877-al 2880) and he cmpR gene i sel in esponse 107
o C
i
limi a ion (López-Igual e al., 2012). No ably, his egula ion is e ec ed in 108
combina ion wi h N cA, hus e ealing a mode o co- egula ion by C and N a ailabili y 109
(López-Igual e al., 2012). Fu he mo e, in Anabaena he bcLXS ope on encoding 110
RuBisCo, which is mode a ely induced unde C
i
limi a ion (López-Igual e al., 2012), is 111
ep essed in he he e ocys s (Madan and Nie zwicki-Baue , 1993), a egula ion likely 112
exe ed by N cA (Ramasub amanian e al., 1994; Picossi e al., 2014). 113
He e we ha e iden i ied he CbbR-homolog All3953 as he ac i a o o he 114
RuBisCo-encoding ope on in Anabaena. We ha e de e mined he All3953 egulon by 115
ChIP-Seq, which has e ealed ha All3953 is a global egula o o C
i
assimila ion 116
genes and genes in ol ed in p o ec ion o he pho osyn he ic appa a us agains 117
oxida i e damage ha a e egula ed by Ci a ailabili y. 118
119
Resul s 120
All3953, an RbcR-like ac o in Anabaena sp. PCC 7120 121
To gain insigh in o he LTTR All3953 in Anabaena, he exp ession o he all3953 gene 122
unde di e en g ow h condi ions was analyzed by no he n blo . Th ee bands o 123
hyb idiza ion co esponding o ansc ip s o ca. 1.9, 1.6 and 1.3 kb, espec i ely, which 124
appea ed simila ly ep esen ed be o e and a e Ci limi a ion could be obse ed (Supp. 125
Fig. 1A). On he o he hand, all3953 exp ession did no signi ican ly espond o N 126
deple ion (Supp. Fig. 1B). The la e esul was consis en wi h p e ious global 127
Page 5 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
6
ansc ip ional s udies (Ehi a and Ohmo i, 2006; Flahe hy e al., 2011) and wi h he 128
lack o binding associa ed o all3953 o he N-con ol ansc ip ional egula o N cA 129
upon combined ni ogen deple ion (Picossi e al., 2014). 130
131
Isola ion and cha ac e iza ion o an all3953 mu an 132
To s udy he ole o All3953, a mu an s ain bea ing an inac i a ed e sion o all3953 133
was cons uc ed (see Expe imen al p ocedu es). In s ain CSS74 mos o he all3953 134
gene was dele ed and he C.S3 gene casse e (encoding Sm/Sp esis ance) was 135
in oduced o acili a e seg ega ion and main enance o he mu a ion in Anabaena 136
(Supp. Fig. 2A). As a con ol, s ain CSS77 bea ing he C.S3 gene casse e in he 137
Anabaena plasmid alpha was also cons uc ed. Fo cis complemen a ion, a wild- ype 138
e sion o all3953 was ans e ed o s ain CSS74 in an in eg a i e plasmid, 139
gene a ing s ain CSS74C (Supp. Fig. 2A). 140
S ain CSS74 exhibi ed poo g ow h unde s anda d g ow h condi ions wi h 141
ammonium as a ni ogen sou ce, and i o med sho ilamen s in liquid medium, 142
whe eas s ain CSS74C beha ed simila ly o CSS77 (no shown). To quan i y he 143
dele e ious e ec o he all3953 mu a ion, g ow h a es we e calcula ed in liquid 144
medium unde di e en illumina ion and C
i
-supply condi ions. G ow h a e o he con ol 145
s ain CSS77 was highes (0.892 days
-1
) unde high ligh (HL) and high ca bon (HC), 146
and was abou 30% lowe unde he o he es ed condi ions (Fig. 1A). In con as , 147
g ow h o s ain CSS74 was se e ely a ec ed unde HL HC condi ions (g ow h a e ca. 148
70% lowe han ha o he con ol) (Fig. 1A), unde which i ended up dying a e abou 149
5 days (Fig. 1B). Unde HL and low ca bon (LC) o low ligh (LL) HC, he de ec was 150
close o 30% wi h ega d o he con ol, al hough a e p olonged incuba ion he mu an 151
was mo e se e ely a ec ed unde HL LC. The de ec was he smalles (ca. 15%) unde 152
LL LC condi ions (Fig. 1A,B). In solid medium, g ow h o s ain CSS74 was simila , and 153
simila o ha o he con ol, in he p esence o ammonium, ni a e o no combined 154
Page 6 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
7
ni ogen unde LL LC condi ions, whe eas unde HL LC a se e e g ow h de ec was 155
obse ed wi h ega d o he con ol wi h any o he es ed ni ogen sou ces (no shown). 156
In summa y, he lack o All3953 had a dele e ious e ec on g ow h, especially unde 157
HL (and HC) condi ions. 158
To u he cha ac e ize he g ow h de ec o he all3953 mu an , he a e o 159
oxygen e olu ion using CO
2
as a inal elec on accep o was measu ed unde di e en 160
illumina ion condi ions in he CSS74 mu an in ela ion o he con ol s ain CSS77. 161
When exponen ially-g owing cells we e incuba ed o 24 h unde LL HC, he oxygen 162
e olu ion a e was sligh ly lowe in s ain CSS74 in compa ison o CSS77 (88 and 163
105 µmol O
2
·[mg Chl]
-1
·h
-1
, espec i ely). Unde HL he di e ence be ween he wo 164
s ains was la ge (167, o CSS77, and 110, o CSS74, µmol O
2
·[mg Chl]
-1
·h
-1
). 165
166
E ec o all3953 mu a ion on bcLXS exp ession 167
To es he e ec o he all3953 mu a ion on he exp ession o he bcLXS ope on, 168
no he n blo analysis was pe o med wi h RNA isola ed om cells o he con ol and 169
mu an s ains g own wi h HC and ans e ed o LC condi ions. A e 1 h incuba ion 170
wi h LC, a ca. 2- old inc ease in he amoun o he bcLXS ansc ip s could be 171
obse ed in he con ol s ain. No induc ion could be de ec ed in he mu an (Fig. 2). In 172
he complemen ed s ain CSS74C he exp ession o bcLXS inc eased in LC simila ly 173
o he con ol (Fig. 2). These esul s indica ed ha he induc ion o he bcLXS ope on 174
upon C
i
de iciency was dependen on All3953 and ha he de ec in s ain CSS74 was 175
exclusi ely due o he lack o All3953. 176
177
ChIP-Seq analysis o he All3953 a ge s 178
To de e mine he DNA a ge s o All3953 a a genomic le el, we used ch oma in 179
immunop ecipi a ion ollowed by high- h oughpu sequencing analysis. To his end, we 180
cons uc ed a s ain (CSS57) exp essing om he all3953 p omo e a e sion o 181
Page 7 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
8
All3953 C- e minally ussed o TAP- ag (Rigau e al., 1999), as well as a con ol s ain 182
(CSS68) exp essing he TAP- ag alone unde he con ol o he all3953 p omo e 183
(Supp. Fig. 2B, see Expe imen al p ocedu es). Immunop ecipi a ion was ca ied ou 184
using cells o s ains CSS57 and CSS68 g own wi h ammonium as he ni ogen sou ce 185
unde HC condi ions and incuba ed o 3 h wi h ammonium unde LC condi ions. 186
The analysis o he sequences esul ed in a o al o 142 All3953 binding 187
egions, o which 127 we e loca ed in he ch omosome, 10 in plasmid alpha, h ee in 188
plasmid be a and wo in plasmid gamma. Each binding egion was asc ibed o one o 189
wo genes acco ding o he loca ion (midpoin ) o he egion, and he ela i e loca ion 190
wi h espec o he assigned gene was also indica ed (Table 1 and Supp. Table 1). A 191
o al o 175 genes we e asc ibed o he 142 binding egions. The binding egions we e 192
mos ly loca ed ups eam o he asc ibed genes (72%), whe eas 21% we e in agenic 193
and 7% we e loca ed downs eam o genes. The esul s o he ChIP-Seq analysis a e 194
a ailable a GEO accession numbe GSE58861 195
(h p://www.ncbi.nlm.nih.go /geo/que y/acc.cgi?acc= GSE58861). 196
The 175 asc ibed genes we e classi ied acco ding o hei unc ional ca ego y 197
(Table 2). Rema kably, he e we e 19 genes encoding p o eins ela ed o 198
pho osyn hesis and espi a ion, and 21 genes encoding egula o y p o eins, including 199
All7179, a SigB homolog. The es we e mos ly genes encoding hypo he ical o 200
unknown p o eins (42%), bu also genes encoding p o eins in ol ed in ansla ion, in 201
biosyn hesis o amino acids and co ac o s, p os he ic g oups and ca ie s, in anspo , 202
and in o he cellula p ocesses. Table 3 highligh s All3953-binding egions ela ed o 203
pho osyn hesis and espi a ion among which, con i ming ou esul s o gene 204
inac i a ion, he gene encoding he la ge subuni o he RuBisCo ( bcL; binding egion 205
#37) is included. The ac ha a high numbe o genes in ol ed in pho osyn hesis and 206
C ixa ion, including bcL, we e iden i ied as a ge s o RbcR sugges s ha his p o ein 207
is a global ansc ip ion ac o o pho osyn he ic C assimila ion. 208
Page 8 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
15
pCSE120 [S.K3/L.HEH2 (BamHI)/C.S3 (BamHI); nomencla u e as in (Elhai and Wolk, 374
1988)], was inse ed ob aining plasmid pCSS162. Plasmid pCSS162 was ans e ed o 375
s ain PCC 7120 by conjuga ion (Elhai e al., 1997). Exconjugan s esis an o Sm and 376
Sp, which had he ∆all3953::C.S3 cons uc in eg a ed by double ecombina ion we e 377
selec ed, ob aining s ain CSS74. The seg ega ion o he mu a ion was es ed by PCR 378
(Supp. Fig. 2) wi h p ime s all3953-14, all3953-15, all3953-17 and all3953-20. 379
To cons uc a con ol s ain exp essing Sm
and Sp
plasmid pCSS163, a 380
de i a i e o plasmid pCSEL24 (Olmedo-Ve d e al., 2006) con aining he C.S3 gene 381
casse e, was ans e ed o Anabaena by conjuga ion. Exconjugan s ha had he 382
pCSS163 in eg a ed in he alpha plasmid o Anabaena we e selec ed, ob aining he 383
s ain CSS77 (Supp. Fig. 2). 384
To complemen he all3953 mu a ion o s ain CSS74, a DNA agmen 385
encompassing he whole all3953 gene and sequences ups eam om i was amplified 386
by PCR using he p ime pai all3953-24/all3953-25, bo h including EcoRI si es, and 387
s ain PCC 7120 DNA as he empla e. This agmen was cloned in he EcoRI si e o 388
he mobilizable Nm
encoding ec o pRL424 (Elhai and Wolk, 1988) p oducing plasmid 389
pCSS164, which was ans e ed o s ain CSS74 by conjuga ion ollowed by selec ion 390
o Nm
. The genomic s uc u e o he exconjugan s in he all3953 egion (Supp. Fig. 2) 391
was co obo a ed by PCR. 392
To cons uc a s ain exp essing All3953-C-TAP, he all3953 gene (including he 393
ups eam egion) was PCR-ampli ied wi h p ime s all3953-11 and all3953-12 and DNA 394
o PCC 7120 as he empla e. The TAP- ag was PCR-ampli ied wi h p ime s TAP ag-1 395
and TAP ag-2 using DNA o plasmid pBS1479 as he empla e (Puig e al., 2001). The 396
wo PCR p oduc s we e diges ed wi h SalI and liga ed, a e which he liga ion p oduc 397
was used as he empla e o an o e lapping PCR using p ime s all3953-11 and 398
TAP ag-2. The PCR p oduc was diges ed wi h Ps I and liga ed o he mobilizable 399
ec o pCSV3 (Vallada es e al., 2011) diges ed wi h Ps I, ende ing plasmid pCSS107. 400
Page 15 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology

Fo Pee Re iew Only
16
To cons uc a con ol s ain wi h he TAP- ag unde he con ol o he all3953 401
p omo e , a 0.4-kb egion ups eam o all3953 was PCR-ampli ied using p ime s 402
all3953-11 and all3953-18 and DNA o pCSS107 as he empla e. The PCR p oduc 403
was diges ed wi h SalI and liga ed o he PCR-ampli ied TAP- ag diges ed wi h SalI, 404
a e which he liga ion p oduc was used as he empla e o an o e lapping PCR using 405
p ime s all3953-11 and TAP ag-2. The PCR p oduc was diges ed wi h Ps I and liga ed 406
o Ps I-diges ed pCSV3 o gi e plasmid pCSS157. Plasmids pCSS107 and pCSS157 407
we e ans e ed by conjuga ion o s ain PCC 7120 and single Sm
Sp
ecombinan s 408
we e selec ed, ob aining s ain CSS57 and CSS68, espec i ely. Wes e n blo s using 409
Pe oxidase-An i-Pe oxidase Soluble Complex (PAP, Sigma-Ald ich) we e pe o med o 410
ensu e ha he wo s ains exp essed he TAP- ag (Supp. Fig. 2B). 411
412
Ch oma in immunop ecipi a ion 413
Cells o s ains CSS57 g owing exponen ially (3-5 µg Chl·ml
-1
) in he ligh (80 414
µE·m
-2
·s
-1
) in medium supplemen ed wi h 2 µg·ml
-1
Sm and Sp, in HC condi ions we e 415
incuba ed wi h LC o 3 h. Fo maldehyde was hen added o he cul u es o a inal 416
concen a ion o 1%, and he cul u es we e incuba ed o 15 min. Glycine was added a 417
125 mM inal concen a ion and he incuba ion was con inued o 5 min o s op he 418
ixing eac ion. The cells we e hen il e ed, washed wi h cold TBS (20 mM T is-HCl, pH 419
7.4, 140 mM NaCl) and collec ed in ubes (25 ml o cul u e pe ube). The pelle s we e 420
ozen in liquid ni ogen and s o ed a -20°C un il used. Pelle s co esponding o abou 421
25 ml o cul u e we e esuspended in 500 µl o lysis bu e (50 mM HEPES-KOH, pH 422
7.5, 140 mM NaCl, 1 mM EDTA, 1% T i on X-100, 0.1% sodium deoxychola e, 423
supplemen ed wi h Mini EDTA- ee p o ease inhibi o cock ail [Roche]) and, a e 424
addi ion o 150 µl o glass beads (acid-washed, 425-600 µm [Sigma]), he cells we e 425
b oken in a mul i o exe a 2,000 pm o 1 h a 4°C. The cell lysa es we e collec ed by 426
cen i uga ion and he ex ac s we e subjec ed o sonica ion o shea he DNA o abou 427
300-bp agmen s (60 cycles o 10 s, 20 s ice, 15% ampli ude, in a B anson Digi al 428
Page 16 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
17
Soni ie ). A e cen i uga ion o elimina e cell deb is, he whole-cell ex ac s we e 429
s o ed a −20°C o immedia ely used o immunop ecipi a ion. 430
Immunop ecipi a ion o DNA was ca ied ou as desc ibed (Picossi e al., 2014), 431
wi h some modi ica ions. Whole-cell ex ac s we e p epa ed a 4 mg·ml
-1
o o al p o ein 432
wi h lysis bu e (in 500 µl o al olume). A 50-µl sample was aken as he inpu sample, 433
and he ex ac s we e incuba ed wi h 15 µl IgG-conjuga ed Dynabeads (abou 6 µg 434
IgG) a 4ºC wi h o a ion o 12-14h. The washes o he Dynabeads, as well as he 435
elu ion o he immunop ecipi a ed ma e ial, he c osslinking e e sion and he isola ion 436
o he DNA we e pe o med as in (Picossi e al., 2014). 437
438
Massi e sequencing o he immunop ecipi a ed DNA 439
Inpu and ChIP DNA samples we e sen o sequencing o he Func ional Genomics 440
Co e Facili y o he Ins i u e o Resea ch in Biomedicine, Ba celona (Spain). Nex 441
gene a ion sequencing was ca ied ou using Illumina’s sequencing echnology. ChIP 442
DNA Sample P ep Ki (Illumina) was used o lib a y p epa a ion. Lib a ies we e loaded 443
a 8 pM concen a ion in o he low cell using he Clus e S a ion unning ecipe V7 wi h 444
he Single-Read Clus e Gene a ion Ki 4 (all Illumina). The low cell was loaded in o 445
he Genome Analyze II and samples we e sequenced o 120 nucleo ides om a 446
single end using he Sequencing Ki 5 and ecipe 8 (all Illumina). Manu ac u e ’s 447
ecommenda ions we e s ic ly ollowed. Illumina sequencing da a we e p e-p ocessed 448
wi h he s anda d Illumina pipeline e sion 1.5 and sequences we e aligned o he PCC 449
7120 genome (h p://genome.mic obedb.jp/cyanobase/Anabaena) wi h he Bow ie 450
so wa e 0.12.5 (Langmead e al., 2009). The analysis o he esul s we e ca ied ou 451
using he T i o m algo i hm (Ko nacke e al., 2012) as in (Picossi e al., 2014). The 452
sequences in he ChIP samples o s ain CSS68 (TAP con ol) we e used as he 453
backg ound o he sequences ound o s ain CSS57 (All3953-TAP), and hus o 454
de e mine he speci ic binding egions o All3953-TAP in he genome o Anabaena. 455
Page 17 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
18
The binding egions we e isualized and analyzed using he UCSC Mic obial Genome 456
B owse (Scheneide e al., 2006). They we e asc ibed o one o wo genes, in case i 457
was no possible o asc ibe hem o only one, and classi ied as ups eam o he gene, i 458
he midpoin o he binding egion was loca ed ups eam o he s a o he gene, 459
in e nal, i he midpoin o he binding egion was inside he gene, o downs eam, i he 460
midpoin o he binding egion was loca ed downs eam o he end o he gene o which 461
i had been asc ibed. 462
463
No he n and qRT-PCR analyses 464
Isola ion o o al RNA om Anabaena was done as desc ibed p e iously (Mohamed 465
and Jansson, 1989). No he n analysis was pe o med as desc ibed p e iously (López-466
Igual e al., 2012). 467
Fo qRT-PCR, 750 ng o DNA- ee RNA samples we e used o all he PCR 468
p ime pai s. Fo he RT eac ion, he Quan i ech Re e se ansc ip ion ki (Qiagen), 469
wi h he Random Hexame P ime mix (100 ng pe sample) (Bioline) was used. The 470
cDNA p oduced was dilu ed 7.5 imes o use 2 µl o cDNA pe PCR eac ion. PCR was 471
done using he Quan imix Easy SYG Ki (Bio ools) (SYBR g een I) in a iCycle iQ Mul i-472
Colo Real Time PCR De ec ion Sys em (Bio-Rad). The abundance o a ansc ip in 473
he RNA sample was calcula ed as: abundance= 2^[C (sample)-C (con ol)], whe e he 474
RNA sample o he con ol s ain CSS77 in HC condi ion (0) was used as he con ol. 475
476
Oxygen e olu ion 477
2-ml samples o exponen ially g own cul u es in HC LL o HC HL condi ions we e used 478
o measu e O
2
e olu ion wi h an O
2
elec ode calib a ed wi h cul u e medium and 479
Na
2
S
2
O
4
as he educing agen . O
2
p oduc ion was measu ed in he ligh (400 480
µE·m
-2
·s
-1
) a e a se en-minu e incuba ion in he da k. 481
482
Page 18 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
19
Acknowledgmen s 483
This wo k was suppo ed by g an s BFU2010-17980 and BFU2013-44686-P om he 484
Spanish go e nmen , co- inanced by FEDER. The au ho s a e g a e ul o K. Ko nacke 485
o ca ying ou he T i o m and CisFinde analyses, and o H. Aue and I. Pons, om 486
he Func ional Genomics Co e Facili y o he IRB, Ba celona (Spain); o F. Monje-487
Casas and Yagu Allah e diye a-Rinne o c i ical eading o he manusc ip and o M. 488
J. Hue as and A. To ado o help wi h O
2
p oduc ion measu emen s. 489
490
REFERENCES 491
492
Black, T.A., Cai, Y., and Wolk C.P. (1993) Spa ial exp ession and au o egula ion o 493
he R, a gene in ol ed in he con ol o he e ocys de elopmen in Anabaena. Mol 494
Mic obiol 9: 77-84. 495
Came on, C.J., Su e , M., and Ke eld, C.A. (2014) The ca boxysome: Func ion, 496
s uc u e and cellula dynamics. The Cell Biology o Cyanobac e ia, eds. Flo es E, 497
He e o A (Cais e Academic P ess, No olk), pp. 171-188. 498
Ehi a, S., and Ohmo i, M, (2006) N A, a ni ogen- esponsi e esponse egula o 499
acili a es he e ocys de elopmen in he cyanobac e ium Anabaena sp. s ain PCC 500
7120. Mol Mic obiol 59: 1692-1703. 501
Elhai., J., Vep i skiy, A., Mu o-Pas o , A.M., Flo es, E, and Wolk, C.P. (1997) Reduc ion 502
o conjugal ans e e iciency by h ee es ic ion ac i i ies o Anabaena sp. s ain 503
PCC 7120. J Bac e iol 179: 1998-2005. 504
Eisenhu , M., Ru h, W., Haimo ich, M., Bauwe, H., Kaplan, A., and Hagemann, M. 505
(2008) The pho o espi a o y glycola e me abolism is essen ial o cyanobac e ia and 506
migh ha e been con eyed endosymbio ically o plan s. P oc Na l Acad Sci USA 507
105: 17199-17204. 508
Elhai, J., and Wolk, C.P. (1988) A e sa ile class o posi i e-selec ion ec o s based on 509
he non iabili y o palind ome-con aining plasmids ha allows cloning in o long 510
polylinke s. Gene 68: 119-138. 511
E mako a, M., Ba chiko a, N., Allah e diye a, Y., and A o, E.M. (2013) No el 512
he e ocys -speci ic la odii on p o eins in Anabaena sp. PCC 7120. FEBS Le 587: 513
82-7. 514
Figge, R.M., Cassie -Chau a , C., Chau a , F., and Ce , R. (2001) Cha ac e iza ion 515
and analysis o an NAD(P)H dehyd ogenase ansc ip ional egula o c i ical o he 516
su i al o cyanobac e ia acing ino ganic ca bon s a a ion and osmo ic s ess. Mol 517
Mic obiol 39: 455-68. 518
Flahe y, B.L., Van Nieuwe bu gh, F., Head, S.R., and Golden, J.W. (2011) Di ec ional 519
RNA deep sequencing sheds new ligh on he ansc ip ional esponse o Anabaena 520
sp. s ain PCC 7120 o combined-ni ogen dep i a ion. BMC Genomics 12: 332. 521
Flo es, E., and He e o, A. (2010) Compa men alized unc ion h ough cell 522
di e en ia ion in ilamen ous cyanobac e ia. Na Re Mic obiol 8: 39-50. 523
Gibson, J.L., and Tabi a, F.R. (1996) The molecula egula ion o he pen ose 524
phospha e pa hway in p o eobac e ia and cyanobac e ia. A ch Mic obiol 166: 141-525
150. 526
He e o, A., Picossi, S., and Flo es, E. (2013) Gene Exp ession du ing he e ocys 527
di e en ia ion. Ad Bo Res 65: 281-329. 528
Page 19 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
20
Kaneko, T., Nakamu a, Y., Wolk, C.P., Ku i z, T., Sasamo o, S., and Wa anabe, A. 529
(2001) Comple e genomic sequence o he ilamen ous ni ogen- ixing 530
cyanobac e ium Anabaena sp. s ain PCC 7120. DNA Res 8: 205-213. 531
Knoll, A.H. (2008) Cyanobac e ia and Ea h his o y. The Cyanobac e ia: Molecula 532
Biology, Genomics and E olu ion, eds. He e o A, Flo es E (Cais e Academic 533
P ess, No olk), pp. 1-19. 534
Ko nacke , K., Rye, M.B., Hands ad, T., and D ablos, F. (2012) The T i o m algo i hm: 535
imp o ed sensi i i y and speci ici y in ChIP-Seq peak inding. BMC Bioin o ma ics 536
13: 176. 537
Langmead, B., T apnell, C., Pop, M., and Salzbe g, S.L. (2009) Ul a as and memo y-538
e icien alignmen o sho DNA sequences o he human genome. Genome Biol 10: 539
R25. 540
Lin, M.T., Occhialini, A., And alojc, P.J., Pa y, M.A.J., and Hanson, M.R. (2014) A 541
as e Rubisco wi h po en ial o inc ease pho osyn hesis in c ops. Na u e 513: 547-542
550. 543
López-Igual, R., Picossi, S., López-Ga ido, J., Flo es, E., and He e o, A. (2012) N 544
and C con ol o ABC- ype bica bona e anspo e Cmp and i s LysR- ype 545
ansc ip ional egula o CmpR in a he e ocys - o ming cyanobac e ium, Anabaena 546
sp. En i on Mic obiol 14: 1035-1048. 547
Lyons, T.W., Reinha d, C.T., and Plana sky, N.J. (2014) The ise o oxygen in Ea h's 548
ea ly ocean and a mosphe e. Na u e 506: 307-315. 549
Madan, A.P., and Nie zwicki-Baue , S.A. (1993) In si u de ec ion o ansc ip s o 550
ibulose-1,5-bisphospha e ca boxylase in cyanobac e ial he e ocys s. J Bac e iol 551
175: 7301-7306. 552
Maddocks, S.E., and Oys on, P.C. (2008) S uc u e and unc ion o he LysR- ype 553
ansc ip ional egula o (LTTR) amily p o eins. Mic obiology 154: 3609-3623. 554
Mohamed, A., and Jansson, C. (1989) In luence o ligh on accumula ion o 555
pho osyn hesis-speci ic ansc ip s in he cyanobac e ium Synechocys is 6803. Plan 556
Mol Biol 13: 693-700. 557
Nie zwicki-Baue , S.A., Cu is, S.E., and Haselko n, R. (1984) Co ansc ip ion o genes 558
encoding he small and la ge subuni s o ibulose-1,5-bisphospha e ca boxylase in 559
he cyanobac e ium Anabaena 7120. P oc Na l Acad Sci USA 81: 5961-5965. 560
Nishimu a, T., Takahashi, Y., Yamaguchi, O., Suzuki, H., Maeda, S., and Oma a, T. 561
(2008) Mechanism o low CO
2
-induced ac i a ion o he cmp bica bona e anspo e 562
ope on by a LysR amily p o ein in he cyanobac e ium Synechococcus elonga us 563
s ain PCC 7942. Mol Mic obiol 68: 98-109. 564
Olmedo-Ve d, E., Mu o-Pas o , A.M., Flo es, E., and He e o, A. (2006) Localized 565
induc ion o he n cA egula o y gene in de eloping he e ocys s o Anabaena sp. 566
s ain PCC 7120. J Bac e iol 188: 6694-6649. 567
Picossi, S., Flo es, E. and He e o, A. (2014) ChIP analysis un a els an excep ionally 568
wide dis ibu ion o DNA binding si es o he N cA ansc ip ion ac o in a 569
he e ocys - o ming cyanobac e ium. BMC Genomics 15: 22. 570
Polla i, M., Ruo salainen, V., Ran amaki, S., Tyys ja i, E., and Tyys ja i, T. (2009). 571
Simul aneous inac i a ion o sigma ac o s B and D in e e es wi h ligh acclima ion 572
o he cyanobac e ium Synechocys is sp. s ain PCC 6803. J Bac e iol 191: 3992-573
4001. 574
Puig, O., Caspa y, F., Rigau , G., Ru z, B., Bou e e , E., B agado-Nilsson, E., Wilm, 575
M., and Se aphin, B. (2001) The andem a ini y pu i ica ion (TAP) me hod: a 576
gene al p ocedu e o p o ein complex pu i ica ion. Me hods 24: 218-229. 577
P ice, G.D., Badge , M.R., Woodge , F.J., and Long, B.M. (2008). Ad ances in 578
unde s anding he cyanobac e ial CO
2
-concen a ing-mechanism (CCM): unc ional 579
componen s, Ci anspo e s, di e si y, gene ic egula ion and p ospec s o 580
enginee ing in o plan s. J Exp Bo. 59: 1441-1461. 581
P ice, G.D. (2011) Ino ganic ca bon anspo e s o he cyanobac e ial CO
2
582
concen a ing mechanism. Pho osyn h Res 109: 47-57. 583
Page 20 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology

Fo Pee Re iew Only
21
Ramasub amanian, T.S., Wei, T.-F. and Golden, J.W. (1994) Two Anabaena sp. s ain 584
PCC 7120 DNA-binding ac o s in e ac wi h ege a i e cell- and he e ocys -speci ic 585
genes. J Bac e iol 176: 1214-1223. 586
Rigau , G., She chenko, A., Ru z, B., Wilm, M., Mann, M., and Se aphin, B. (1999) A 587
gene ic p o ein pu i ica ion me hod o p o ein complex cha ac e iza ion and 588
p o eome explo a ion. Na. Bio echnol 17: 1030-1032. 589
Rippka, R., De uelles, J., Wa e bu y, J.B., He dman, M., and S anie , R.Y. (1979) 590
Gene ic assignmen s, s ain s o ies and p ope ies o pu e cul u es o 591
cyanobac e ia. J Gen Mic obiol 111: 1-61. 592
Schae e , M.R., and Golden, S.S. (1989) Di e en ial exp ession o membe s o a 593
cyanobac e ial psbA gene amily in esponse o ligh . J Bac e iol 171: 3973-3781. 594
Scheneide , K.L., Polla d, K.S., Bae sch, R., Pohl, A., and Lowe, T.M. (2006) The 595
UCSC a chaeal genome b owse . Nucleic Ac Res 34: D407–D410. 596
Vallada es, A., Rod íguez, V., Cama go, S., Ma ínez-Nöel, G.M., He e o, A., and 597
Luque, I. (2011) Speci ic ole o he cyanobac e ial PipX ac o in he he e ocys s o 598
Anabaena sp. s ain PCC 7120. J Bac e iol 193(5): 1172-1182. 599
Wang, H.L., Pos ie , B.L., and Bu nap, R.L. (2004) Al e a ions in global pa e ns o 600
gene exp ession in Synechocys is sp. PCC 6803 in esponse o ino ganic ca bon 601
limi a ion and he inac i a ion o ndhR, a LysR amily egula o . J Biol Chem 279: 602
5739-5751. 603
604
605
606
Page 21 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
22
Figu e legends: 607
Fig. 1. G ow h o he all3953 mu an . A, The g ow h a e cons an (µ = ln2/
d
, whe e
d
is 608
he doubling ime)
was calcula ed om he inc ease o p o ein con en de e mined in 609
0.2 ml samples o cul u es. The able shows he mean and s anda d de ia ion om 3 610
independen cul u es o each s ain and condi ion. ∆all3953 is s ain CSS74; CSS77 is 611
a con ol s ain ha ca ies he Sm/Sp- esis an de e minan in a wild- ype backg ound. 612
B, Samples o cul u es we e pho og aphed a e 5 days o incuba ion unde he 613
indica ed condi ions. HL, high ligh ; LL, low ligh ; HC, high ca bon; LC, low ca bon. 614
615
Fig. 2. Exp ession o bcLXS in he ∆all3953 mu an and complemen ed s ain. 616
No he n analysis ca ied ou wi h RNA om s ains CSS77 (con ol) CSS74 (∆all3953) 617
and CSS74C (CSS74 complemen ed) was isola ed om cells g own wi h HC (0) and 618
incuba ed o 1h (1) wi h LC. The memb anes we e hyb idized wi h an in e nal 619
agmen o he bcL gene (uppe panels) and, as a loading and ans e con ol, o he 620
npB gene (lowe panels). A owheads poin o he main ansc ip s de ec ed wi h he 621
bcL gene p obe (app oxima e sizes a e indica ed). 622
623
Fig. 3. Consensus All3953 binding sequence and bcL p omo e . A, The p ima y 624
consensus mo i based on 142 high con idence CSS57 ChIP-Seq peak sequences is 625
shown wi h indica ion o he p obabili y o occu ence o each base along he 22-n 626
sequence. W is A o T; Y is C o T; B is C, G o T. B, S uc u e o he bcLXS p omo e 627
egion. The ansc ip ion ini ia ion poin o he ope on (+1) and he -10 and -35 boxes 628
( om Nie zwicki-Baue e al., 1984) a e indica ed in ed. The N cA-binding si e 629
(GTAN
8
TAC) is indica ed in g een, and he h ee pu a i e binding si es o All3953 (Box 630
I, Box II and Box III) a e indica ed in blue. 631
632
Page 22 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
23
Fig. 4. qRT-PCR analysis o he exp ession o selec ed pho osyn hesis and espi a ion-633
ela ed All3953 gene a ge s. T ansc ip ional esponse o he indica ed genes o C
i
634
limi a ion in he con ol (CSS77) and ∆all3953 mu an (CSS74) s ains was 635
in es iga ed. RNA was isola ed om cells g own wi h 10 mM NaHCO
3
-supplemen ed 636
medium bubbled wi h 1%CO
2
in ai (0) incuba ed o 1 h (1) o 3 h (3) in NaHCO
3
- ee 637
medium bubbled wi h ai . Ba s ep esen he mean ansc ip le els (± s anda d 638
de ia ion) in h ee independen expe imen s. 639
640
Page 23 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
1
The LysR- ype ansc ip ion ac o PacR is a global egula o o pho osyn he ic 1
ca bon assimila ion in Anabaena 2
3
Sil ia Picossi, En ique Flo es and An onia He e o* 4
5
Ins i u o de Bioquímica Vege al y Fo osín esis, Consejo Supe io de In es igaciones 6
Cien í icas and Uni e sidad de Se illa, Amé ico Vespucio 49, E-41092, Se ille, Spain. 7
8
9
*Co esponding au ho . Tel.: +34 954489522. Fax: +34 954460165. E-mail add ess: 10
he [email p o ec ed] 11
12
Keywo ds: ChIP; Cyanobac e ia; Oxygenic pho o ophy; Pho op o ec ion; RuBisCo 13
14
Running i le: Pho osyn he ic ca bon assimila ion egula o 15
16
Accession link o da a: 17
h p://www.ncbi.nlm.nih.go /geo/que y/acc.cgi? oken=a cxwkacxpyd ax&acc=GSE58861 18
19
20
21
22
Page 24 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
8
upon C
i
de iciency was dependen on All3953 and ha he de ec in s ain CSS74 was 182
exclusi ely due o he lack o All3953. 183
184
ChIP-Seq analysis o he All3953 a ge s 185
To de e mine he DNA a ge s o All3953 a a genomic le el, we used ch oma in 186
immunop ecipi a ion ollowed by high- h oughpu sequencing analysis. To his end, we 187
cons uc ed a s ain (CSS57) exp essing om he all3953 p omo e a e sion o 188
All3953 C- e minally ussed o TAP- ag (Rigau e al., 1999), as well as a con ol s ain 189
(CSS68) exp essing he TAP- ag alone unde he con ol o he all3953 p omo e 190
(Supp. Fig. 2B, see Expe imen al p ocedu es). Immunop ecipi a ion was ca ied ou 191
using cells o s ains CSS57 and CSS68 g own wi h ammonium as he ni ogen sou ce 192
unde HC condi ions and incuba ed o 3 h wi h ammonium unde LC condi ions. 193
The analysis o he sequences esul ed in a o al o 142 All3953 binding 194
egions, o which 127 we e loca ed in he ch omosome, 10 in plasmid alpha, h ee in 195
plasmid be a and wo in plasmid gamma. Each binding egion was asc ibed o one o 196
wo genes acco ding o he loca ion (midpoin ) o he egion, and he ela i e loca ion 197
wi h espec o he assigned gene was also indica ed (Table 1 and Supp. Table 1). A 198
o al o 175 genes we e asc ibed o he 142 binding egions. The binding egions we e 199
mos ly loca ed ups eam o he asc ibed genes (72%), whe eas 21% we e in agenic 200
and 7% we e loca ed downs eam o genes. The esul s o he ChIP-Seq analysis a e 201
a ailable a GEO accession numbe GSE58861 202
(h p://www.ncbi.nlm.nih.go /geo/que y/acc.cgi?acc= GSE58861). 203
The 175 asc ibed genes we e classi ied acco ding o hei unc ional ca ego y 204
(Table 2). Rema kably, he e we e 19 genes encoding p o eins ela ed o 205
pho osyn hesis and espi a ion, and 21 genes encoding egula o y p o eins, including 206
All7179, a SigB homolog. The es we e mos ly genes encoding hypo he ical o 207
unknown p o eins (42%), bu also genes encoding p o eins in ol ed in ansla ion, in 208
Page 31 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology

Fo Pee Re iew Only
9
biosyn hesis o amino acids and co ac o s, p os he ic g oups and ca ie s, in anspo , 209
and in o he cellula p ocesses. Table 3 highligh s All3953-binding egions ela ed o 210
pho osyn hesis and espi a ion among which, con i ming ou esul s o gene 211
inac i a ion, he gene encoding he la ge subuni o he RuBisCo ( bcL; binding egion 212
#37) is included. The ac ha a high numbe o genes in ol ed in pho osyn hesis and 213
C ixa ion, including bcL, we e iden i ied as a ge s o RbcR sugges s ha his p o ein 214
is a global ansc ip ion ac o o pho osyn he ic C assimila ion. 215
A CisFinde analysis o he p ima y consensus mo i was ca ied ou based on 216
142 high-con idence ChIP-Seq peak sequences (Fig. 3A). The consensus mo i ound 217
has a dyad-symme y a chi ec u e and ma ches he consensus o LysR- ecogni ion 218
binding si es (RBS) (T-N
11
-A) (Maddocks and Oys on, 2008), as well as he consensus 219
binding si es p oposed o CbbR ac o s (TNA-N
7/8
-TNA). The p ima y mo i s iden i ied 220
in he cen al 100 n o he binding egions a e indica ed in Supp. Table 1 ( o some 221
binding egions mo e han one mo i ha e been iden i ied). 222
223
Exp ession analysis o some All3953 a ge s in Anabaena 224
To co obo a e ou ChIP-Seq analysis and o suppo he no ion ha All3953 is indeed 225
a global egula o o C ixa ion genes, he exp ession le els o some o he 226
pho osyn hesis- and C- ixa ion- ela ed a ge genes, i s esponse o C
i
limi a ion and i s 227
dependence on All3953 was u he analyzed by qRT-PCR (Fig. 4). S ains CSS77 and 228
CSS74 we e g own in ammonium and HC unde s anda d ligh condi ions (80 229
µE·m
-2
·s
-1
) a 30ºC up o he exponen ial phase. They we e hen ans e ed o medium 230
wi h ammonium unde LC condi ions. As p e iously shown by no he n analysis, 231
ansc ip ion le els o he all3953 gene did no signi ican ly change a e C
i
dep i a ion 232
in he con ol s ain CSS77. As expec ed, all3953 ansc ip le els we e no de ec able 233
in CSS74, co obo a ing ha he all3953 mu a ion was seg ega ed in his s ain. The 234
bcL gene (al 1524) was 4.6- old induced a 3 h a e ans e o LC in s ain CSS77, 235
Page 32 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
10
whe eas no induc ion was obse ed in CSS74, hus co obo a ing he dependence on 236
All3953. In e es ingly, unde HC he exp ession o bcL in he mu an was highe han 237
in he con ol s ain, sugges ing ha besides as an ac i a o unde LC, All3953 could 238
be ac ing as a ep esso o bcL unde HC condi ions. 239
ORF all4446 ( l 4) was highly induced (abou 100- old), and i s le el was 240
maximum 1 h a e he shi o LC (Fig. 4). In he all3953 mu an , he basal ansc ip ion 241
o all4446 in HC was abou 8- old lowe han in he con ol s ain, and i was only 242
sligh ly induced (2- old) upon he shi o LC. all3891 ( l 1A) was induced abou 6- old 3 243
h a e he shi o LC in he con ol s ain, whe eas only a 2- old induc ion was 244
obse ed in he all3953 mu an . all1304 (bica bona e anspo e homolog) and al 4156 245
(NdhF homolog) we e bo h highly induced (up o 30- and 20- old, espec i ely) upon 246
ans e o s ain CSS77 o LC. In con as , no induc ion o al 4156 and only a small 247
induc ion o all1304 ook place in s ain CSS74. Exp ession o al 4592 (psbAIII) 248
inc eased abou 5- old upon C
i
dep i a ion in CSS77, bu did no app eciably change in 249
CSS74. The al 0223 (NdhA homolog) gene was abou 2- old induced unde C
i
250
dep i a ion in CSS77 bu no in CSS74. Finally, he exp ession o al 1004 (alanine-251
glyoxyla e amino ans e ase) was ep essed by 5- old unde LC condi ions in CSSL77 252
bu no in CSS74. These esul s con i m ha exp ession o he abo e s udied genes is 253
egula ed, ei he posi i ely o nega i ely, by All3953. 254
255
Discussion 256
We ha e iden i ied he LTTR All3953 as he ac i a o o he RuBisCo-encoding genes 257
in he cyanobac e ium Anabaena sp. PCC 7120. All3953 appea s o ac i a e he bcL 258
ope on unde C
i
limi a ion and o ep ess i when C
i
is abundan . An LTTR ac o 259
egula ing he exp ession o he bcL ope on has no , o ou knowledge, been 260
desc ibed in any cyanobac e ium. The exp ession o all3953 does no espond o C
i
261
limi a ion (Supp. Fig. 1) and, indeed, no binding egion o All3953 was ound adsc ibed 262
Page 33 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
11
o all3953. Thus, he all3953 gene seems o belong o he non-au o egula ed LTTRs. 263
All3953 sha es 28 and 26% iden ical esidues wi h NdhR om Synechocys is sp. PCC 264
6803 and Synechococcus sp. PCC 7002 (CcmR), espec i ely. 265
By ChIP-Seq analysis o a s ain bea ing a TAP- agged e sion o All3953, we 266
ha e de e mined 142 All3953-bound egions a 3 h a e ans e om high o low C
i
267
condi ions, which ha e been assigned o 177 genes. Apa om genes encoding 268
unknown o hypo he ical p o eins, he la ge ca ego y is o genes encoding egula o y 269
p o eins, including he ansc ip ional egula o s Al 0353 (a LTTR) and All4500 (CRP-270
like), he wo-componen esponse egula o All3348, he wo-componen senso 271
his idine-kinase All1145 and he g oup 2-sigma 70- ype sigma ac o All7179 (Supp. 272
Table 1). In e es ingly, when compa ing o Synechocys is sigma ac o s, All7179 273
(SigB4) is mo e simila oa homolog o Synechocys is SigB, which, along wi h SigD has 274
been shown o be impo an o PSII eco e y in his unicellula cyanobac e ium (Polla i 275
e al., 2009). All3953 also binds ups eam o genes pa S and he N, whose p oduc s 276
egula e he e ocys di e en ia ion (Supp. Table 1). The ac ha All3953 binds o he 277
p omo e egion o genes encoding o he egula o y p o eins sugges s a wide ole o 278
his p o ein in he physiology o he o ganism. 279
In he p omo e egion o he bcL ope on we ha e ound h ee pu a i e binding 280
si es o All3953, Box I, Box II, and Box III (Fig. 3B) ha esemble he consensus 281
ecogni ion sequence ound by Cis inde analysis (Fig. 3A). I is concei able ha , like in 282
some o he LTTRs hese boxes combine ep ession and ac i a ion si es. In his ega d, 283
binding o All3953 o Box III, o e lapping gene p omo e elemen s, could be ela ed o 284
he ep ession o bcL obse ed unde high C
i
(Fig. 4). On he o he hand, as 285
men ioned abo e, he bcL ope on is ep essed in he e ocys s by he global 286
ansc ip ional egula o N cA, o which a binding si e is ound o e lapping he ope on 287
TSP (Ramasub amanian e al., 1994; Picossi e al., 2014) (Figu e 3B). I is concei able 288
ha N cA binding in hese di e en ia ed cells in e e e wi h All3952-media ed ac i a ion. 289
Page 34 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
12
Besides being he ac i a o o he RuBisCo genes, All3953 a ge s include 290
genes in ol ed in o he p ocesses ela ed o ca bon assimila ion, such as C
i
anspo 291
(all1304, encoding an homolog o he BicA bica bona e anspo e ; al 4156 encoding a 292
homolog o he NdhF3 subuni o he NDH-1
3
CO
2
up ake sys em; and al 0869 293
encoding a homolog o he NdhF4 subuni o he NDH-1
4
CO
2
up ake sys em); 294
componen s o he ca boxysome shell (all0868, pu a i e ccmK) and 2-295
phosphoglycola e me abolism (al 1004 and al 2873, possibly ela ed o 296
pho o espi a ion [Eisenhu e al., 2008]). No ably, All3953 a ge s include also a 297
numbe o genes encoding pho osys em componen s, such as al 5154 (psaA, 298
encoding he PSI co e p o ein PsaA), al 3727 (psbAII, encoding a componen o o m II 299
o he PSII co e p o ein PsbA [D1]), al 4592 (psbAIII, encoding ano he componen o 300
o m II o PsbA) and al 1216 (PSII 12 kD ex insic p o ein PsbU), and genes ela ed o 301
PS ac i i y. In he la e g oup a e al 4149 (bili e din educ ase, pu a i ely in ol ed in 302
phycobilisome -PSII an enna- syn hesis), and genes ha can pa icipa e in 303
pho osyn he ic elec on ans e , such as al 0223 and al 0348 (ndhA and ndhD, 304
subuni s o o he pu a i e NADH dehyd ogenases), al 1576 (dehyd ogenase subuni ), 305
all0737 ( hio edoxin educ ase), all1365 (Cy M cy och ome), all4148 ( e edoxin I), 306
all3891 and all4446 ( la odii on p o eins Fl 1A and Fl 4, espec i ely). (Besides in CO
2
307
up ake, NdhF3 and NdhF4 can also pa icipa e in elec on ans e .) 308
Repo s on gene exp ession egula ion by C
i
a e sca ce o Anabaena. 309
Howe e , in he unicellula cyanobac e ium Synechocys is sp. PCC 6803 310
ansc ip omic analysis has al eady shown down- egula ion o some genes encoding 311
polypep ides o PSI and PSII complexes as well as o phycobilisome componen s, 312
upon ans e o C
i
limi a ion condi ions, likely as an adap a ion o lowe assimila o y 313
powe demand, and up- egula ion o some PSII co e polypep ides, in e p e ed as 314
adap a ion o condi ions o sho age o elec on accep o s ha could lead o 315
pho odamage and inc eased u no e o PS co e componen s (Wang e al., 2004). Ou 316
analysis ex ends he a ay o pho osyn he ic genes esponding o C
i
limi a ion, 317
Page 35 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
13
ema kably o include he co e PSI eac ion cen e psaA gene. Mo eo e , excep o 318
al 1004 ha esponds nega i ely, all he Anabaena pho osyn he ic genes men ioned 319
abo e inc ease exp ession upon he shi o C
i
limi a ion. 320
No ewo hy, o he majo i y o pho osyn he ic gene a ge s o All3953 in 321
Anabaena, a unc ion in p o ec ion agains eac i e oxygen species, which can be 322
gene a ed by C
i
limi a ion o exposu e o HL, has ei he been desc ibed o could be 323
p edic ed. Thus, he psbAII and psbAIII genes a e induced unde HL in he unicellula 324
Synechococcus sp. PCC 7942, and cells cul u ed unde HL showed mo e o m II, and 325
less o m I (encoded by psbAI), o D1 compa ed o cells unde LL (Schae e and 326
Golden, 1989). Rega ding la odii on p o eins, genes, l 1A, l 3A, and specially l 2 327
and l 4 o Anabaena ha e been shown up- egula ed in ege a i e cells in low Ci, and 328
l 1A and l 3A also in high ligh , whe eas l 1B and l 3B a e exp essed exclusi ely in 329
he e ocys s (E mako a e al., 2013). Whe eas Fl 1A and Fl 3A appea in ol ed in 330
pho o educ ion o oxygen o wa e by emo ing excess elec ons om PSI h ough 331
NAD(P)H dehyd ogenases, Fl 2 and Fl 4 could ha e a ole in pho op o ec ion o PSII 332
unde low Ci (E mako a e al., 2013). Rega ding pho o espi a ion, i has also been 333
conside ed o ha e a ole in emo al o excess O
2
(Eisenhu e al., 2008). To he bes 334
o ou knowledge, he egula o esponsible o he esponse o C
i
a ailabili y o any 335
pho osyn he ic gene has no been iden i ied in cyanobac e ia (oxygenic pho o ophs). 336
Ou ChIP-Seq and exp ession analysis indica e ha All3953 is a egula o o 337
pho osyn he ic genes in Anabaena. 338
The g ow h a e o Anabaena is highes unde HL HC condi ions (Fig. 1), 339
implying ha his cyanobac e ium has mechanisms o ge p o i o HC while 340
coun e ac ing HL s ess. The all3953 mu an s ain CSS74 exhibi ed a g ow h de ec in 341
all he condi ions es ed, bu especially unde HL, whe e i ends-up dying (Fig. 1). This 342
sha es he idea ha in Anabaena All3953 is equi ed o cope wi h HL s ess. The e ec 343
o he lack o All3953 seems mo e de imen al in ela ion o impai ed pho op o ec ion 344
han o impai ed C
i
sca enging (p e e ence o he mu an o LL LC o e HL HC 345
Page 36 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology

Fo Pee Re iew Only
14
condi ions). Indeed, e en in LL, he mu an seems o pe o m sligh ly be e wi h LC 346
han wi h HC (Fig. 1). Al hough LC could suppose a limi a ion o elec on accep o s, an 347
inc eased a e o pho o espi a ion unde LC oge he wi h he ac ha some o he 348
All3953 a ge s ha could cope wi h excess oxygen a e esidually induced upon he 349
ans e om HC o LC in he CSS74 mu an (Fig. 4) could con ibu e o he p e e ence 350
o his s ain o LC o e HC, especially unde HL. 351
Ou esul s show ha in Anabaena he esponses o C
i
a ailabili y include 352
egula ion o genes encoding elemen s o CCM and RuBisCo, bu also o 353
pho osyn he ic genes o adjus gene a ion o assimila o y powe while p ese ing he 354
pho osyn he ic appa a us om oxida i e damage, which is specially ele an in 355
oxygenic pho o ophs. Because All3953 is a ansc ip ional egula o globally 356
coo dina ing hese esponses, we ha e named i PacR (Pho osyn he ic assimila ion o 357
ca bon Regula o ). 358
359
Expe imen al p ocedu es 360
S ains 361
Anabaena sp. s ain PCC 7120 was g own pho oau ophically a 30°C wi h illumina ion 362
(80 µE·m
-2
·s
-1
) in liquid BG11
0
medium (Rippka e al., 1979) supplemen ed wi h 3 mM 363
NH
4
Cl, 6 mM TES bu e and 10 mM NaHCO
3
and bubbled wi h a mix u e o CO
2
and 364
ai (1% / ) (HC). O he condi ions used we e no NaHCO
3
supplemen and bubbling 365
wi h ai (LC); 12 µE·m
-2
·s
-1
(LL); 175 µE·m
-2
·s
-1
(HL). Fo g ow h on pla es illumina ion 366
was 9 µE·m
-2
·s
-1
(LL) o 34 µE·m
-2
·s
-1
(HL). Fo he mu an s gene a ed in his wo k, 367
an ibio ics we e used a he ollowing concen a ions: Sm, 2 µg ml
−1
; Sp, 2 µg ml
−1
; and 368
Nm, 25 µg ml
−1
o bubbled cul u es; and Sm, 5 µg ml
−1
; Sp, 5 µg ml
−1
; and Nm, 369
40 µg ml
−1
o cul u es in solid medium. 370
371
S ain cons uc ion 372
Page 37 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
15
To cons uc a mu an o he all3953 gene, he 5' and 3' end o he gene, along wi h he 373
lanking egions, we e PCR ampli ied using ch omosomal DNA o PCC 7120 as he 374
empla e and p ime s all3953-14 (BglII) and all3953-15 (SalI), and p ime s all3953-16 375
(SalI) and all3953-17 (Ps I), espec i ely (all p ime s a e speci ied in Supp. Table 2). 376
The PCR p oduc s we e diges ed wi h SalI and liga ed. The esul ing mix u e was used 377
as a empla e o o e lapping PCR wi h p ime s all3953-14 and all3953-17. The new 378
PCR p oduc was diges ed wi h BglII and Ps I and liga ed o he BglII-Ps I-diges ed 379
pRL271 (Black e al., 1993), ob aining plasmid pCSS161. Plasmid pCSS161 was 380
diges ed wi h SpeI and he 2-kb Sm
Sp
gene casse e C.S3, excised wi h XbaI om 381
pCSE120 [S.K3/L.HEH2 (BamHI)/C.S3 (BamHI); nomencla u e as in (Elhai and Wolk, 382
1988)], was inse ed ob aining plasmid pCSS162. Plasmid pCSS162 was ans e ed o 383
s ain PCC 7120 by conjuga ion (Elhai e al., 1997). Exconjugan s esis an o Sm and 384
Sp, which had he ∆all3953::C.S3 cons uc in eg a ed by double ecombina ion we e 385
selec ed, ob aining s ain CSS74. The seg ega ion o he mu a ion was es ed by PCR 386
(Supp. Fig. 2) wi h p ime s all3953-14, all3953-15, all3953-17 and all3953-20. 387
To cons uc a con ol s ain exp essing Sm
and Sp
plasmid pCSS163, a 388
de i a i e o plasmid pCSEL24 (Olmedo-Ve d e al., 2006) con aining he C.S3 gene 389
casse e, was ans e ed o Anabaena by conjuga ion. Exconjugan s ha had he 390
pCSS163 in eg a ed in he alpha plasmid o Anabaena we e selec ed, ob aining he 391
s ain CSS77 (Supp. Fig. 2). 392
To complemen he all3953 mu a ion o s ain CSS74, a DNA agmen 393
encompassing he whole all3953 gene and sequences ups eam om i was amplified 394
by PCR using he p ime pai all3953-24/all3953-25, bo h including EcoRI si es, and 395
s ain PCC 7120 DNA as he empla e. This agmen was cloned in he EcoRI si e o 396
he mobilizable Nm
encoding ec o pRL424 (Elhai and Wolk, 1988) p oducing plasmid 397
pCSS164, which was ans e ed o s ain CSS74 by conjuga ion ollowed by selec ion 398
o Nm
. The genomic s uc u e o he exconjugan s in he all3953 egion (Supp. Fig. 2) 399
was co obo a ed by PCR. 400
Page 38 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
16
To cons uc a s ain exp essing All3953-C-TAP, he all3953 gene (including he 401
ups eam egion) was PCR-ampli ied wi h p ime s all3953-11 and all3953-12 and DNA 402
o PCC 7120 as he empla e. The TAP- ag was PCR-ampli ied wi h p ime s TAP ag-1 403
and TAP ag-2 using DNA o plasmid pBS1479 as he empla e (Puig e al., 2001). The 404
wo PCR p oduc s we e diges ed wi h SalI and liga ed, a e which he liga ion p oduc 405
was used as he empla e o an o e lapping PCR using p ime s all3953-11 and 406
TAP ag-2. The PCR p oduc was diges ed wi h Ps I and liga ed o he mobilizable 407
ec o pCSV3 (Vallada es e al., 2011) diges ed wi h Ps I, ende ing plasmid pCSS107. 408
To cons uc a con ol s ain wi h he TAP- ag unde he con ol o he all3953 409
p omo e , a 0.4-kb egion ups eam o all3953 was PCR-ampli ied using p ime s 410
all3953-11 and all3953-18 and DNA o pCSS107 as he empla e. The PCR p oduc 411
was diges ed wi h SalI and liga ed o he PCR-ampli ied TAP- ag diges ed wi h SalI, 412
a e which he liga ion p oduc was used as he empla e o an o e lapping PCR using 413
p ime s all3953-11 and TAP ag-2. The PCR p oduc was diges ed wi h Ps I and liga ed 414
o Ps I-diges ed pCSV3 o gi e plasmid pCSS157. Plasmids pCSS107 and pCSS157 415
we e ans e ed by conjuga ion o s ain PCC 7120 and single Sm
Sp
ecombinan s 416
we e selec ed, ob aining s ain CSS57 and CSS68, espec i ely. Wes e n blo s using 417
Pe oxidase-An i-Pe oxidase Soluble Complex (PAP, Sigma-Ald ich) we e pe o med o 418
ensu e ha he wo s ains exp essed he TAP- ag (Supp. Fig. 2B). 419
420
Ch oma in immunop ecipi a ion 421
Cells o s ains CSS57 g owing exponen ially (3-5 µg Chl·ml
-1
) in he ligh (80 422
µE·m
-2
·s
-1
) in medium supplemen ed wi h 2 µg·ml
-1
Sm and Sp, in HC condi ions we e 423
incuba ed wi h LC o 3 h. Fo maldehyde was hen added o he cul u es o a inal 424
concen a ion o 1%, and he cul u es we e incuba ed o 15 min. Glycine was added a 425
125 mM inal concen a ion and he incuba ion was con inued o 5 min o s op he 426
ixing eac ion. The cells we e hen il e ed, washed wi h cold TBS (20 mM T is-HCl, pH 427
7.4, 140 mM NaCl) and collec ed in ubes (25 ml o cul u e pe ube). The pelle s we e 428
Page 39 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
17
ozen in liquid ni ogen and s o ed a -20°C un il used. Pelle s co esponding o abou 429
25 ml o cul u e we e esuspended in 500 µl o lysis bu e (50 mM HEPES-KOH, pH 430
7.5, 140 mM NaCl, 1 mM EDTA, 1% T i on X-100, 0.1% sodium deoxychola e, 431
supplemen ed wi h Mini EDTA- ee p o ease inhibi o cock ail [Roche]) and, a e 432
addi ion o 150 µl o glass beads (acid-washed, 425-600 µm [Sigma]), he cells we e 433
b oken in a mul i o exe a 2,000 pm o 1 h a 4°C. The cell lysa es we e collec ed by 434
cen i uga ion and he ex ac s we e subjec ed o sonica ion o shea he DNA o abou 435
300-bp agmen s (60 cycles o 10 s, 20 s ice, 15% ampli ude, in a B anson Digi al 436
Soni ie ). A e cen i uga ion o elimina e cell deb is, he whole-cell ex ac s we e 437
s o ed a −20°C o immedia ely used o immunop ecipi a ion. 438
Immunop ecipi a ion o DNA was ca ied ou as desc ibed (Picossi e al., 2014), 439
wi h some modi ica ions. Whole-cell ex ac s we e p epa ed a 4 mg·ml
-1
o o al p o ein 440
wi h lysis bu e (in 500 µl o al olume). A 50-µl sample was aken as he inpu sample, 441
and he ex ac s we e incuba ed wi h 15 µl IgG-conjuga ed Dynabeads (abou 6 µg 442
IgG) a 4ºC wi h o a ion o 12-14h. The washes o he Dynabeads, as well as he 443
elu ion o he immunop ecipi a ed ma e ial, he c osslinking e e sion and he isola ion 444
o he DNA we e pe o med as in (Picossi e al., 2014). 445
446
Massi e sequencing o he immunop ecipi a ed DNA 447
Inpu and ChIP DNA samples we e sen o sequencing o he Func ional Genomics 448
Co e Facili y o he Ins i u e o Resea ch in Biomedicine, Ba celona (Spain). Nex 449
gene a ion sequencing was ca ied ou using Illumina’s sequencing echnology. ChIP 450
DNA Sample P ep Ki (Illumina) was used o lib a y p epa a ion. Lib a ies we e loaded 451
a 8 pM concen a ion in o he low cell using he Clus e S a ion unning ecipe V7 wi h 452
he Single-Read Clus e Gene a ion Ki 4 (all Illumina). The low cell was loaded in o 453
he Genome Analyze II and samples we e sequenced o 120 nucleo ides om a 454
single end using he Sequencing Ki 5 and ecipe 8 (all Illumina). Manu ac u e ’s 455
Page 40 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
24
(GTAN
8
TAC) is indica ed in g een, and he h ee pu a i e binding si es o All3953 (Box 641
I, Box II and Box III) a e indica ed in blue. 642
643
Fig. 4. qRT-PCR analysis o he exp ession o selec ed pho osyn hesis and espi a ion-644
ela ed All3953 gene a ge s. T ansc ip ional esponse o he indica ed genes o C
i
645
limi a ion in he con ol (CSS77) and ∆all3953 mu an (CSS74) s ains was 646
in es iga ed. RNA was isola ed om cells g own wi h 10 mM NaHCO
3
-supplemen ed 647
medium bubbled wi h 1%CO
2
in ai (0) incuba ed o 1 h (1) o 3 h (3) in NaHCO
3
- ee 648
medium bubbled wi h ai . Ba s ep esen he mean ansc ip le els (± s anda d 649
de ia ion) in h ee independen expe imen s. 650
651
Page 47 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology

Fo Pee Re iew Only
Table 1. Resul s o he ChIP-Seq analysis o All3953 binding o DNA a 3 h a e C
i
limi a ion
*Some o he binding egions we e asc ibed o mo e han one gene (see Supp. Table 1).
Binding egions ound
Genes asc ibed
Posi ion o he binding egion wi h espec o he gene
ups eam
in e nal
downs eam
Ch omosome
127
157
118
29
10
Alp
ha
10
13
8
4
2
Be a
3
3
0
3
0
Gamma
2
2
0
1
1
To al
142
175
126
37
13
Page 48 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
1
Table 2. Func ional ca ego ies o he genes asc ibed o he All3953 binding egions.
Func ional ca ego y Numbe
Amino acid biosyn hesis 5
Biosyn hesis o co ac o s, p os he ic g oups, and ca ie s 4
Cell en elope 2
Cellula p ocesses 5
Cen al in e media y me abolism 3
DNA eplica ion, ecombina ion and epai 3
Ene gy me abolism 4
O he ca ego ies 19
Pho osyn hesis and espi a ion 19
Pu ines, py imidines, nucleosides and nucleo ides 2
Regula o y p o eins 21
T ansla ion 9
T anspo and binding p o eins 4
Unknown and hypo he ical p o eins 75
Page 49 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
Table 3. All3953-binding egions assigned o pho osyn hesis and espi a ion- ela ed genes.
BR NLQ LOC GENE POSITION FUNCTION
¶
ST
START SEQ
7
172,84
239694
al 0223*
ups eam NADH dehyd ogenase subuni 1; NdhA + 239712
AGGTATTAGTTTAACTAATGTT
12
38,58
398948
al 0348 ups eam close
NADH dehyd ogenase subuni 4; NdhD + 398912
AACAATTCCTTAATATAATGTA
19
62,81
859596
all0737 ups eam hio edoxin educ ase - 859596
ATTCATAAAAGCGTTTTATATC
25
238,45
997693
all0868 ups eam CO
2
concen a ing mechanism p o ein CcmK
+ 997698
ATGTATAAGTTTTATTAATATG
al 0869 ups eam NADH dehyd ogenase subuni 5
27
66,90
1175262
al 1004*
ups eam alanine--glyoxyla e amino ans e ase + 1175259
GTATATAGGCGATCATTATGGC
31
36,15
1433154
al 1216 ups eam pho osys em II 12 kD ex insic p o ein PsbU + 1433147
AAATATTGTGAGCATTAATAAG
34
385,11
1547013
all1304*
ups eam bica bona e anspo e - 1546894
GTGCATTTGCAATAGTTATTAT
35
31,96
1620674
all1365 downs eam cy och ome Cy M + 1620645
CGTAATAAATTTTAATCATCAT
37
63,26
1785455
al 1524*
ups eam RbcL + 1785446
ACTTATGCCATTTCTTGATATA
38
204,06
1843221
al 1576 ups eam a dehyd ogenase subuni - 1843218
AGTAATAACTGCTACTTATTAC
61
29,78
3499605
al 2873 in e nal 3' end possible glyce a e kinase - 1843218
CAAAATTAAACTGTCTAATTTC
86
170,25
4499861
al 3727 ups eam pho osys em II p o ein D1 (psbAII) + 4499883
GTATATATATTTTAGTAATATT
91
155,06
4693128
all3891*
ups eam la op o ein ( l 1A) + 4693099
ATTTATAAGTTTTACTTAAGCT
98
166,48
4993006
all4148 ups eam e edoxin I - 4993375
AACCATAAATTTTTCTAATAAC
99
61,47
4999503
al 4156*
ups eam NADH dehyd ogenase subuni 5; NdhF + 4999503
AAAGATAAATTTGCCTTATTTA
108
163,25
5332512
all4446*
ups eam la op o ein ( l 4) - 5332500
AATAATAAATTTTACTAATAAA
112
233,71
5489698
al 4592*
ups eam pho osys em II p o ein D1 (psbAIII) + 5489979
CTATATAGTTTTTACTCATATT
121
51,04
6151146
al 5154 ups eam pho osys em I co e p o ein A1 + 6151133
GGACATAAGTTTTACGAATTGT
*Genes whose exp ession has been s udied by qRT-PCR
¶
Func ions a e as speci ied in cyanobase (h p://genome.mic obedb.jp/cyanobase/Anabaena).
BR: binding egion, NLQ: -logQ alue , LOC: ch omosome loca ion o he midpoin o he binding egion, ST: DNA s and, START: ch omosome loca ion o he 5’ end o he
pu a i e binding sequence o All3953 (SEQ).
Page 50 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
Figu e 1
262x350mm (300 x 300 DPI)
Page 51 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
Figu e 2
262x350mm (300 x 300 DPI)
Page 52 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology

Fo Pee Re iew Only
Figu e 3
297x420mm (300 x 300 DPI)
Page 53 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology
Fo Pee Re iew Only
Figu e 4
297x420mm (300 x 300 DPI)
Page 54 o 54
Wiley-Blackwell and Socie y o Applied Mic obiology