genes
G C A T
T A C G
G C A T
A icle
Mu a ion in he pssZ Gene Nega i ely Impac s
Exopolysaccha ide Syn hesis, Su ace P ope ies,
and Symbiosis o Rhizobium leguminosa um b .
i olii wi h Clo e
Paulina Lipa 1ID , José-Ma ía Vina dell 2ID , Joanna Kopci´nska 3, Agnieszka Zdybicka-Ba abas 4ID
and Monika Jancza ek 1,*ID
1Depa men o Gene ics and Mic obiology, Ins i u e o Mic obiology and Bio echnology, Facul y o Biology
and Bio echnology, Ma ia Cu ie-Skłodowska Uni e si y, Akademicka 19 S ., 20-033 Lublin, Poland;
[email p o ec ed]
2Depa men o Mic obiology, Facul y o Biology, Uni e si y o Se illa, A da. Reina Me cedes 6,
41012 Se illa, Spain; [email p o ec ed]
3Depa men o Bo any, Facul y o Ag icul u e and Biology, Wa saw Uni e si y o Li e Sciences,
Nowou synowska 166 S ., 02-787 Wa saw, Poland; [email p o ec ed]
4
Depa men o Immunobiology, Ins i u e o Biology and Biochemis y, Facul y o Biology and Bio echnology,
Ma ia Cu ie-Skłodowska Uni e si y, Akademicka 19 S ., 20-033 Lublin, Poland;
[email p o ec ed]
*Co espondence: [email p o ec ed]; Tel.: +48-81-537-59-74
Recei ed: 9 May 2018; Accep ed: 16 July 2018; Published: 23 July 2018


Abs ac :
Rhizobium leguminosa um b . i olii is a soil bac e ium capable o es ablishing a
ni ogen- ixing symbiosis wi h clo e plan s (T i olium spp.). This bac e ium sec e es la ge amoun s
o acidic exopolysaccha ide (EPS), which plays an essen ial ole in he symbio ic in e ac ion wi h he
hos plan . This polyme is biosyn hesized by a mul i-enzyma ic complex loca ed in he bac e ial inne
memb ane, whose componen s a e encoded by a la ge ch omosomal gene clus e , called Pss-I. In his
s udy, we cha ac e ize R. leguminosa um b . i olii s ain R 297 ha ha bo s a Tn5 ansposon inse ion
loca ed in he pssZ gene om he Pss-I egion. This gene codes o a p o ein ha sha es high iden i y
wi h bac e ial se ine/ h eonine p o ein phospha ases. We demons a ed ha he pssZ mu a ion
causes pleio opic e ec s in hizobial cells. S ain R 297 exhibi ed se e al physiological and symbio ic
de ec s, such as lack o EPS p oduc ion, educed g ow h kine ics and mo ili y, al e ed cell-su ace
p ope ies, and ailu e o in ec he hos plan . These da a indica e ha he p o ein encoded by he pssZ
gene is indispensable o EPS syn hesis, bu also equi ed o p ope unc ioning o R. leguminosa um
b . i olii cells.
Keywo ds:
Rhizobium leguminosa um;pssZ; se ine/ h eonine p o ein phospha ase; exopolysaccha ide
syn hesis; cell-su ace p ope ies; symbiosis; clo e
1. In oduc ion
Rhizobium leguminosa um b . i olii is a G am-nega i e bac e ium ha exis s as a ee-li ing
o ganism in he soil o es ablishes ni ogen- ixing symbiosis wi h clo e plan s (T i olium spp.).
This mic oo ganism belongs o a la ge and di e se g oup o soil bac e ia, collec i ely called hizobia,
which possess he abili y o induce nodules on oo s and s ems o legumes [
1
,
2
]. Wi hin nodules,
new plan o gans ensu ing a special ecological niche, hizobia educe dini ogen o ammonia, which is
hen used by he hos plan . The ni ogen- ixing symbiosis is a highly speci ic and complex p ocess,
Genes 2018,9, 369; doi:10.3390/genes9070369 www.mdpi.com/jou nal/genes
Genes 2018,9, 369 2 o 27
which in ol es many signals o plan and bac e ial o igin; among such signals, la onoids sec e ed
by legume oo s, and hizobial lipochi ooligosaccha ides and exopolysaccha ides (EPS) play c ucial
oles [1,3].
Recen indings indica e ha he unc ion o EPS in he legume– hizobium symbiosis is mo e
complex han ini ially an icipa ed and depends la gely on he hos plan . In gene al, his polysaccha ide
is equi ed o e ec i e symbiosis o bac e ia wi h a g ea majo i y o legumes, which o m
inde e mina e- ype nodules (e.g., clo e , e ch, pea, and al al a) [
1
,
4
,
5
]. The signi icance o EPS
in he symbiosis wi h his ype o legumes is con i med by he symbio ic pheno ype o hizobial
s ains de ec i e in EPS p oduc ion (e.g., R. leguminosa um b s. i olii and iciae and Sino hizobium
melilo i). These s ains a e only able o induce he o ma ion o small, pa ially in ec ed o e en emp y,
nodule-like s uc u es on he compa ible hos plan s ha a e ine ec i e in ni ogen ixa ion [
6
–
9
].
Howe e , some excep ions we e ound, e.g., Sino hizobium edii s ain HH103, whose EPS was shown
o no be equi ed o nodula ion o Glycy hiza u alensis, a hos plan ha also o ms inde e mina e- ype
nodules [
10
,
11
]. On he o he hand, al hough EPS can be dispensable o he symbiosis wi h legumes
ha o m de e mina e nodules (such as S. edii-soybean symbiosis) [
12
], i was ecen ly shown ha
Meso hizobium lo i EPS is an impo an signal o symbio ic in e ac ions wi h he hos s Lo us co nicula us
and Lo us japonicus, which o m de e mina e- ype nodules [
13
–
15
]. In ac , i has been demons a ed
in his symbiosis ha he ecogni ion o he app op ia e EPS by a legume ecep o is equi ed o
p ope in ec ion o hos plan oo s [
15
]. Apa om being a symbio ic signal equi ed o he ini ia ion
and elonga ion o in ec ion h eads (ITs; special ubula s uc u es ia which hizobia colonize oo
nodules), EPS p o ides p o ec ion agains hos plan de ense eac ions. Mo eo e , his polyme
plays se e al o he unc ions in ee-li ing hizobia, such as nu ien ga he ing, bio ilm o ma ion,
and p o ec ion agains desicca ion and o he s ess ac o s, ensu ing adap a ion o hese bac e ia o
changing en i onmen al condi ions [4,16,17].
The chemical s uc u e o EPS syn hesized by R. leguminosa um has been de e mined in de ail.
This polyme is composed o oc asaccha ide epea ing subuni s ha con ain D-glucose, D-glucu onic
acid, and D-galac ose esidues in a mola a io 5:2:1, and a e addi ionally subs i u ed wi h O-ace yl
and py u yl g oups [
18
–
22
]. EPS is syn hesized in high-molecula weigh and low-molecula
weigh o ms. Howe e , da a abou he gene ic con ol o EPS p oduc ion in R. leguminosa um
a e only agmen a y. So a , only he unc ion o a ew p o eins in ol ed in he syn hesis and
expo o EPS ha e been expe imen ally con i med. This polysaccha ide is biosyn hesized by a
la ge mul i-enzyma ic complex loca ed in he bac e ial inne memb ane (IM). PssA is in ol ed
in he ini ia ion o he EPS subuni assembly. This enzyme ans e s glucose-1-phospha e om
UDP-glucose o a lipid undecap enylphospha e (und-PP) ca ie ancho ed in he bac e ial IM [
23
].
PssDE [glucu onosyl-(
β
1,4)-glucosyl ans e ase], PssC [glucu onosyl-(
β
1,4)-glucu onosyl ans e ase],
and PssS [glucosyl-(
α
1,4)-glucu onosyl ans e ase] a e engaged in he subsequen h ee s eps o he EPS
uni assembly. These p o eins a e encoded by genes loca ed in a la ge ch omosomal Pss-I clus e [
24
–
26
].
Mu a ions in he pssA,pssD,pssE, o pssS genes o ally abolish EPS syn hesis [
6
,
7
,
9
,
25
,
26
]. Mo eo e ,
he p o ein encoded by pssJ is p obably in ol ed in he las s ep o he subuni syn hesis, since he
exo344::Tn5s ain ha ha bo s a mu a ion in his gene only p oduces esidual amoun s o s uc u ally
al e ed EPS, whose uni s we e lacking he e minal D-galac ose [
21
,
22
]. Howe e , he enzymes in ol ed
in he emaining s eps o EPS syn hesis ha e no ye been iden i ied. Based on sequence simila i ies
be ween Pss p o eins and enzymes a ailable in he p o ein da abases [PDB, CAZy] and on he
pheno ypes o se e al pss mu an s, I ashina and Ksenzenko [
24
] pos ula ed ha he subsequen s eps
o EPS subuni assembly migh be ca ied ou by PssF, PssI/PssG, and PssH/PssI glycosyl ans e ases,
encoded by genes loca ed in he Pss-I clus e . Mo eo e , he PssR, PssM, and PssK p o eins a e
mos p obably in ol ed in non-suga modi ica ions o EPS. Among hem, PssM, which exhibi s ke al
py u a e ans e ase ac i i y, adds py u yl g oups o he sub e minal suga esidue in he epea ing
uni s [
27
], whe eas PssR and PssK a e esponsible o he addi ion o O-ace yl and py u yl g oups o
he second and eigh suga esidues, espec i ely [
24
]. Fu he mo e, se e al genes in ol ed in EPS
Genes 2018,9, 369 3 o 27
polyme iza ion and sec e ion ha e been cha ac e ized (pssTNOP, pssL, and pssP2); all o hese, excep
o pssP2, a e also loca ed in he Pss-I egion [
28
–
30
]. I is well known ha hizobial EPS is syn hesized
by a Wzx/Wzy-dependen mechanism in which he subuni s a e assembled in he cy oplasmic lea le
o he IM, and hen anspo ed o he pe iplasmic lea le o he IM o polyme iza ion and subsequen
sec e ion [
31
,
32
]. This mechanism in ol es wo key p o eins, Wzx ( lippase) and Wzy (polyme ase).
In he case o R. leguminosa um, he Wzx lippase and Wzy polysaccha ide polyme ase a e encoded by
he pssL and pssT genes, espec i ely. In addi ion, polysaccha ide co-polyme ase (PCP, also classi ied
as a memb ane pe iplasmic auxilia y p o ein, MPA), encoded by he pssP gene, de e mines he leng h
o EPS chains [4,29,30].
Recen ly, PssP and o he membe s o he PCP g oup in ol ed in bac e ial EPS syn hesis we e
classi ied as bac e ial y osine kinases wi h au ophospho yla ing kinase ac i i y [
33
]. This ac i i y
has been shown o be essen ial o he oligome iza ion o hese p o eins, and, consequen ly, o EPS
p oduc ion and egula ion o he polyme chain leng h [
34
]. Despi e hese indings, he mechanism
de e mining he s ain-speci ic chain leng h o EPS is s ill no well unde s ood. Tocilj e al. [
35
] p oposed
a model dependen on he s oichiome y o he p o ein complex comp ising PCP. Mo eo e , oligome s
o Wza- ype p o eins (lipop o eins), o ming a channel in he ou e memb ane (OM), and in e ac ing
wi h he Wzx and Wzy p o eins, a e engaged in anspo ing he EPS ou o he cells h ough he OM.
In R. leguminosa um, his Wza- ype p o ein is PssN [
4
,
29
,
36
]. I is hough ha he mechanisms o
biosyn hesis and ansloca ion o polysaccha ides ou side he cell mus be empo ally and spa ially
coo dina ed. This could be achie ed by in e ac ions o di e en componen s o his mul i-p o ein
complex. In ac , mos p obably, glycosyl ans e ases in e ac wi h he lippase and he co-polyme ase,
and egula ion o he chain leng h could ake place a his s age [
37
]. The glucosyl ans e ase PssA,
which ini ia es he p ocess o EPS syn hesis and is a key elemen o his enzyma ic machine y,
is p oposed as a highly p obable si e o hese in e ac ions. This p o ein con ains se e al se ine
and h eonine esidues, which migh be po en ial si es o phospho yla ion. Mo eo e , o he p o eins
in luencing he enzyma ic ac i i y and/o p o ein-p o ein in e ac ions migh addi ionally modula e
he unc ion o his EPS-syn hesizing machine y.
In he cu en s udy, we ha e cha ac e ized a R. leguminosa um b . i olii s ain ha bo ing a
mu a ion in he pssZ gene, which is loca ed in he Pss-I egion. We demons a e ha his gene
plays an essen ial ole in EPS syn hesis, and a ec s di e en cell-su ace p ope ies and symbiosis o
R. leguminosa um b . i olii wi h clo e .
2. Ma e ials and Me hods
2.1. Bac e ial S ains, Plasmids, and G ow h Condi ions
Bac e ial s ains, plasmids and p ime s used in his s udy a e lis ed in Table 1.
Rhizobium leguminosa um s ains we e g own in 79CA medium supplemen ed wi h 1% glyce ol
a 28
◦
C wi h agi a ion (160 pm) [
45
], whe eas Esche ichia coli s ains we e cul u ed in Lu ia-Be ani
(LB) medium a 37
◦
C [
40
]. When equi ed, he media we e supplemen ed wi h he app op ia e
an ibio ics used a he ollowing inal concen a ions: kanamycin, 40
µ
g mL
−1
, ampicillin, 100
µ
g mL
−1
,
and nalidixic acid, 40
µ
g mL
−1
. To compa e g ow h kine ics o he s udied s ains, bac e ia we e
cul u ed o e 72 h and a e 0, 24, 48, and 72 h, he op ical densi y (OD
600
) o hese cul u es
was measu ed. Then, 100-
µ
L aliquo s we e aken and hei se ial dilu ions placed on o aga
pla es, incuba ed o 4 d, and he appea ing colonies (colony- o ming uni s, CFU) we e coun ed.
The expe imen was epea ed wice wi h h ee biological eplica es o each s ain es ed.
Genes 2018,9, 369 4 o 27
Table 1. Bac e ial s ains, plasmids, and oligonucleo ide p ime s used in his s udy.
S ains, Plasmids, and P ime s Cha ac e is ics Sou ce o
Re e ence
R. leguminosa um b . i olii
R 24.2 Wild ype, Ri , Nx [38]
R 297 R 24.2 pssZ::mTn5SSgusA40, Sp This wo k
R 297(pPL1) R 297 ca ying pssZ on pBBR1MCS-2 ec o , Km This wo k
R 24.2(pPL1) R 24.2 ca ying pssZ on pBBR1MCS-2 ec o , Km This wo k
R 24.2 (pBBR1MCS-2) R 24.2 ca ying pBBR1MCS-2 ec o , Km [39]
E. coli
DH5αsupE44 ∆lacU169 (φ80 lacZ∆M15) hsdR17 ecA1endA1gy A96 hi-1 elA1 [40]
S17-1 hi p o hsdR−hsdM+ ecA RP4-2-Tc::Mu-Km::Tn7[41]
mTn5SSgusA40 miniTn5in e poson con aining a p omo e less gusA gene, Sp [42]
Plasmids
pBBR1MCS-2 mob, lacZα, cloning ec o , Km [43]
pJBA21Tc pMP220 con aining gusA, Tc [44]
pPL1
pBBR1MCS-2 con aining a 1.8-kb SalI-XbaI agmen wi h he R 24.2 pssZ gene, Km
This wo k
P ime s Sequence (50–30)1
gusF1 GCGTTACAAGAAAGCCGGGCAATT This wo k
gusR1 GATCCAGACTGAATGCCCACAGGC This wo k
gusR2 CAGCAATTGCCCGGCTTTCTTGTAA This wo k
gusR3 GTCTGCCAGTTCAGTTCGTTGTTC This wo k
Xba-Fw1 GGGTTTATCTAGACTGGCATCGGCAC This wo k
Xba-Fw3 CAATCTCTATCTAGATGTGACCAACACC This wo k
Xba-Fw4 GGACGCTCTAGATCTTTCAATCCTC This wo k
Eco-Rw1 CCCGGTGAATTCGCCATCGTCAAC This wo k
J44-Rw4 CAACCGCAGTTTCCACTTTGCACC This wo k
J44-Rw5 GGATCTGAGATTCCTGATCAAGAAATG This wo k
Sal-Rw2 CCTTCATATTGTCGACTCTGACCGTT This wo k
Nx
, nalidixic acid esis ance, Ri
, i ampicin esis ance, Tc
, e acycline esis ance, Km
, kanamycin esis ance,
Sp
, spec inomycin esis ance.
1
The sequences o he EcoRI, XbaI, and SalI es ic ion si es a e unde lined.
R. leguminosa um:Rhizobium leguminosa um;E. coli:Esche ichia coli.
2.2. DNA Me hods and Sequence Analysis
S anda d molecula echniques, such as genomic and plasmid DNA isola ion, es ic ion enzyme
diges ion, cloning, hyb idiza ion, and ans o ma ion we e pe o med acco ding o [
40
]. Fo PCR
eac ions, Ready- o-use RED-Taq DNA polyme ase mix (Sigma-Ald ich, S . Louis, MO, USA) and
p ime s lis ed in Table 1we e used. Sequencing was pe o med using he BigDye e mina o cycle
sequencing ki (Applied Biosys ems, Fos e Ci y, CA, USA) and he ABI P ism 310 appa a us. Da abase
sea ches we e done wi h he FASTA and BLAST p og ams a he Na ional Cen e o Bio echnology
In o ma ion (Be hesda, MD, USA) and he Eu opean Bioin o ma ic Insi u e (Hinx on, UK) [
46
,
47
].
P omo e p edic ion in he pssZ egula o y egion was done using he BDGP (Be keley D osophila
Genome P ojec ) Neu al Ne wo k P omo e P edic ion [
48
] (Be kley, CA, USA), as well as using he
Malign e . 3.0 and Fuzznuc e . 2.10 p og ams [
49
,
50
] and he S. melilo i CTTGAC-N
17-18
-CTATAT
and E. coli TTGACA-N
17-18
-TATAAT p omo e consensus sequences as a que y [
51
]. Amino acid
sequence analyses we e pe o med using he BLASTP p og am [47].
2.3. Isola ion o a Rhizobium leguminosa um pssZ Mu an
S ain R 297 was ob ained as a esul o a andom mu agenesis o he wild- ype s ain R 24.2,
which was pe o med using E. coli S17-1 con aining he mTn5SSgusA40 ansposon wi h a p omo e less
gusA gene as a dono [
42
]. Localiza ion o he ansposon in he R 297 genome was de e mined by
hyb idiza ion wi h a gusA p obe, and PCR analyses wi h he use o p ime s complemen a y o di e en
egions o he Pss-I clus e and he 5
0
-end o gusA. PCR p oduc s ( om 1.5- o 1.9-kb long) we e
ob ained by using p ime pai s: gusR1/J44-Rw4, gusR1/J44-Rw5, gusR2/J44-Rw4, gusR2/J44-Rw5,
and gusR2/Eco-Rw1. Based on sequencing analysis o hese amplicons, he mTn5SSgusA40 inse ion
was loca ed wi hin pssZ om he Pss-I egion.
2.4. Cons uc ion o Plasmid pPL1 o Complemen a ion o he pssZ Mu a ion
To cons uc a plasmid con aining he en i e pssZ gene including i s ups eam egion,
he pBBR1MCS-2 ec o and a 1.8-kb long amplicon ob ained in he PCR eac ion wi h p ime s
Genes 2018,9, 369 5 o 27
Sal-Rw2/Xba-Fw3 (Table 1) we e used. The PCR p oduc was diges ed wi h XbaI and SalI enzymes
and liga ed o he pBBR1MCS-2 ec o diges ed wi h he same endonucleases. The esul ing plasmid,
pPL1, was e i ied by sequencing. Nex , pPL1 was in oduced in o E. coli S17-1 by ans o ma ion and
subsequen ly in o R 297 by bipa en al conjuga ion acco ding o [25].
2.5. β-glucu onidase Assay
Assays o
β
-glucu onidase ac i i y we e ca ied ou acco ding o he p o ocol desc ibed
by Mille [
52
] using 24-h bac e ial cul u es and p-Ni ophenyl-
β
-D-glucu onide as a subs a e
(Sigma-Ald ich, S . Louis, MO, USA) [
53
]. The epo ed alues a e gi en in Mille uni s and a e
a e ages o wo independen expe imen s wi h h ee eplica es o each s ain es ed.
2.6. Isola ion and Quan i ica ion o Exopolysaccha ide
Cul u es o hizobial s ains (5 mL) we e g own in 79CA o 48 h. Then, he cul u es we e
cen i uged (20 min, 12,000
×
g) and EPS was p ecipi a ed om he ob ained supe na an s using 4 ol.
( o high-molecula weigh , HMW EPS) o 10 ol. o 96% cold e hanol ( o low-molecula weigh ,
LMW EPS), acco dingly, collec ed by cen i uga ion, dissol ed in deionized wa e and analyzed
o ca bohyd a es acco ding o [
54
]. The o al suga con en was calcula ed as glucose equi alen s.
The expe imen was epea ed wice wi h h ee eplica es o indi idual s ain.
2.7. De e mina ion o Lipopolysaccha ide P o iles
Lipopolysaccha ide (LPS) p o iles o he es ed s ains we e de e mined as epo ed
p e iously [
26
]. B ie ly, 2-d bac e ial cul u es we e cen i uged and pelle s ob ained we e washed
wice wi h 0.9% NaCl o emo e EPS, and used o de e mine LPS p o iles acco ding o [
55
]. Samples
we e sepa a ed in 12.5% T icine SDS polyac ylamide gel elec opho esis (SDS-PAGE), and LPS in gels
was isualized by sil e s aining.
2.8. Cell Hyd ophobici y Assay
The hyd ophobici y o hizobial s ains was de e mined using a wo-phase me hod and dodecane
(Sigma-Ald ich, S . Louis, MO, USA) acco ding o [56]. Fo his assay, bac e ial pelle s ob ained om
24 h cul u es and esuspended in PUM bu e we e used. The deg ee o hyd ophobici y was calcula ed
as ollows: % hyd ophobici y = 100
−
100(OD
a
/OD
1
), whe e (OD
1
) is he op ical densi y a 405 nm o
bac e ial suspensions be o e adding dodecane and ODais he op ical densi y o hese cul u es a e a
15 min incuba ion wi h dodecane. The expe imen was pe o med wice wi h h ee eplica es o each
s ain analyzed.
2.9. Agg eaga ion Assay
The agg ega ion o hizobial cells was de e mined acco ding o he me hod desc ibed by
So oche e al. [
57
] wi h a sligh modi ica ion [
58
]. Fo his expe imen , 24 h cul u es o simila
op ical densi y (~OD
600
= 0.6) we e le o 24 h wi hou agi a ion a oom empe a u e. Nex , 300
µ
L o
he uppe phase o hese samples we e collec ed and hei OD
600
was measu ed (OD
A2
) in a mic opla e
eade (Bioch om Asys UVM 340). The emaining samples we e ex ensi ely o exed and hei OD
600
was measu ed (OD
A1
). The deg ee o agg ega ion was calcula ed as ollows: % agg ega ion = 100
Genes 2018, 9, x FOR PEER REVIEW 5 o 28
2.5. β-glucu onidase Assay
Assays o β-glucu onidase ac i i y we e ca ied ou acco ding o he p o ocol desc ibed by
Mille [52] using 24-h bac e ial cul u es and p-Ni ophenyl-β-D-glucu onide as a subs a e (Sigma-
Ald ich, S . Louis, MO, USA) [53]. The epo ed alues a e gi en in Mille uni s and a e a e ages o
wo independen expe imen s wi h h ee eplica es o each s ain es ed.
2.6. Isola ion and Quan i ica ion o Exopolysaccha ide
Cul u es o hizobial s ains (5 mL) we e g own in 79CA o 48 h. Then, he cul u es we e
cen i uged (20 min, 12,000× g) and EPS was p ecipi a ed om he ob ained supe na an s using 4 ol.
( o high-molecula weigh , HMW EPS) o 10 ol. o 96% cold e hanol ( o low-molecula weigh ,
LMW EPS), acco dingly, collec ed by cen i uga ion, dissol ed in deionized wa e and analyzed o
ca bohyd a es acco ding o [54]. The o al suga con en was calcula ed as glucose equi alen s. The
expe imen was epea ed wice wi h h ee eplica es o indi idual s ain.
2.7. De e mina ion o Lipopolysaccha ide P o iles
Lipopolysaccha ide (LPS) p o iles o he es ed s ains we e de e mined as epo ed p e iously
[26]. B ie ly, 2-d bac e ial cul u es we e cen i uged and pelle s ob ained we e washed wice wi h
0.9% NaCl o emo e EPS, and used o de e mine LPS p o iles acco ding o [55]. Samples we e
sepa a ed in 12.5% T icine SDS polyac ylamide gel elec opho esis (SDS-PAGE), and LPS in gels was
isualized by sil e s aining.
2.8. Cell Hyd ophobici y Assay
The hyd ophobici y o hizobial s ains was de e mined using a wo-phase me hod and
dodecane (Sigma-Ald ich, S . Louis, MO, USA) acco ding o [56]. Fo his assay, bac e ial pelle s
ob ained om 24 h cul u es and esuspended in PUM bu e we e used. The deg ee o
hyd ophobici y was calcula ed as ollows: % hyd ophobici y = 100 − 100(ODa/OD1), whe e (OD1) is
he op ical densi y a 405 nm o bac e ial suspensions be o e adding dodecane and ODa is he op ical
densi y o hese cul u es a e a 15 min incuba ion wi h dodecane. The expe imen was pe o med
wice wi h h ee eplica es o each s ain analyzed.
2.9. Agg eaga ion Assay
The agg ega ion o hizobial cells was de e mined acco ding o he me hod desc ibed by
So oche e al. [57] wi h a sligh modi ica ion [58]. Fo his expe imen , 24 h cul u es o simila op ical
densi y (~OD600 = 0.6) we e le o 24 h wi hou agi a ion a oom empe a u e. Nex , 300 μL o he
uppe phase o hese samples we e collec ed and hei OD600 was measu ed (ODA2) in a mic opla e
eade (Bioch om Asys UVM 340). The emaining samples we e ex ensi ely o exed and hei OD600
was measu ed (ODA1). The deg ee o agg ega ion was calcula ed as ollows: % agg ega ion = 100 -*
100(ODA2/ODA1). The assay was epea ed wice wi h h ee eplica es o each s ain es ed.
2.10. De e mina ion o Cell Mo ili y
Fo his pu pose, 5 μL aliquo s o bac e ial suspensions o an op ical densi y OD600 = 0.2 p epa ed
in s e ile wa e we e s abbed in o 0.3% 79CA aga (swimming) o placed on he su ace o 0.7% 79CA
aga (su ace mo ili y). Then, he pla es we e incuba ed a 25 °C o 15 days, and he mig a ion
dis ance om he si e o bac e ial addi ion was measu ed a e 3, 6, 9, and 15 days. The assay was
epea ed wice wi h h ee eplica es o each s ain examined.
2.11. De e mina ion o Rhizobial Sensi i i y o S ess Fac o s
To compa e ole ance o hizobial s ains o se e al s ess ac o s [SDS, sodium deoxychola e
(DOC), and e hanol], he minimal inhibi o y concen a ion o he indi idual componen was
de e mined. Fo his pu pose, 10 μL aliquo s o bac e ial suspensions o OD600 = 0.2 p epa ed in s e ile
100(ODA2/ODA1). The assay was epea ed wice wi h h ee eplica es o each s ain es ed.
2.10. De e mina ion o Cell Mo ili y
Fo his pu pose, 5
µ
L aliquo s o bac e ial suspensions o an op ical densi y OD
600
= 0.2 p epa ed
in s e ile wa e we e s abbed in o 0.3% 79CA aga (swimming) o placed on he su ace o 0.7% 79CA
aga (su ace mo ili y). Then, he pla es we e incuba ed a 25
◦
C o 15 days, and he mig a ion dis ance

Genes 2018,9, 369 6 o 27
om he si e o bac e ial addi ion was measu ed a e 3, 6, 9, and 15 days. The assay was epea ed
wice wi h h ee eplica es o each s ain examined.
2.11. De e mina ion o Rhizobial Sensi i i y o S ess Fac o s
To compa e ole ance o hizobial s ains o se e al s ess ac o s [SDS, sodium deoxychola e
(DOC), and e hanol], he minimal inhibi o y concen a ion o he indi idual componen was
de e mined. Fo his pu pose, 10
µ
L aliquo s o bac e ial suspensions o OD
600
= 0.2 p epa ed in s e ile
wa e we e placed on 79CA aga pla es con aining di e en concen a ions o he es ed compounds
(SDS: 0.05–1% w/ , DOC: 0.05–1% w/ , e hanol: 0.05–6% / ). The bac e ial g ow h on he indi idual
media was de e mined a e 48 h. The expe imen was epea ed h ee imes wi h h ee eplica es o
each s ain and condi ion es ed.
2.12. Bio ilm P oduc ion Assay
Bio ilm o ma ion assays we e pe o med acco ding o a me hod desc ibed by Rinaudi and
Gonzalez [
59
]. B ie ly, 24 h bac e ial cul u es we e dilu ed o OD
600
= 0.4 and 100
µ
L aliquo s
we e added o polys y ene mic opla e wells, and incuba ed a 28
◦
C wi hou agi a ion o 4 d.
Bio ilm p oduc ion was examined a e 2 and 4 d. A he co esponding ime poin , bac e ial g ow h
was de e mined by measu emen o OD
600
. Then, he supe na an was emo ed om he wells,
and bio ilm emaining on he bo om o he wells was washed wice wi h 0.9% NaCl, and s ained
wi h 0.1% c ys al iole . Nex , bio ilm was esol ed by addi ion o 95% e hanol, and i s amoun was
quan i ied by OD
560
measu emen in a mic opla e eade . Fo each ime poin , he expe imen was
epea ed wice wi h h ee eplica es o each s ain analyzed, and da a a e p esen ed as OD
560
/OD
600
.
2.13. De e mina ion o Cell Topology and P ope ies Using A omic Fo ce Mic oscopy
Bac e ial samples o a omic o ce mic oscopy (AFM) we e p epa ed acco ding o a me hod
desc ibed ea lie [
60
] wi h a mino modi ica ion [
56
]. B ie ly, 6-h cul u es o hizobial s ains we e
dilu ed in a esh po ion o he medium o OD
600
= 0.1, cen i uged, and he bac e ial pelle s ob ained
we e esuspended in 5
µ
L wa e , loaded on o 10-mm mica disks (Con inen al T ade, Wa saw, Poland),
and allowed o d y in oom empe a u e. Su ace p ope ies o hizobial cells we e imaged using
a NanoScope V AFM (Veeco, Oys e Bay, NY, USA) in Analy ical Labo a o y, Facul y o Chemis y,
Ma ia Cu ie-Skłodowska Uni e si y, Lublin, Poland. All measu emen s (wi h he excep ion o DMT
modulus; 5 N m
−1
TAP150A, B uke , Bille ica, MA, USA), we e done in he “Peak Fo ce QNM”
ope a ion mode using a silicon ip wi h a sp ing cons an o 96 N m
−1
(NSG30, NT-MDT, Moscow,
Russia). The ollowing pa ame e s we e de e mined: heigh and peak o ce e o s (cell opog aphy),
DMT (De jaguin, Mulle and Topo o ) modulus (cell lexibili y), adhesion (adhesion o ces be ween
he ip and he cell su ace) and de o ma ion (cell-su ace s i ness). Da a ob ained we e analyzed using
Nanoscope Analysis e . 1.40 so wa e (Veeco, Plain iew, NY, USA). Values o a e age oo mean-squa e
(RMS) oughness we e calcula ed using 20 ields sized 150
×
150 nm om 0.5
×
0.5
µ
m images o h ee
indi idual bac e ia, each om a di e en sample. A pai ed S uden ’s - es was used o assess di e ences
in es ed pa ame e s be ween he pssZ mu an and wild- ype cells. The h ee-dimensional images and
sec ion p o iles o he cells we e gene a ed using WSxM 5.0 so wa e (Nano ec, Mad id, Spain) [61].
2.14. Plan Expe imen s
Symbio ic p ope ies o hizobial s ains we e de e mined using ed clo e (T i olium p a ense c .
Diana) as a hos plan as desc ibed elsewhe e [
26
]. B ie ly, clo e seedlings we e placed on Fåh aeus
slan s [
62
] and a e 4 days we e inocula ed wi h bac e ial suspensions o OD
600
= 0.2 (100
µ
L aliquo
pe plan ). The plan s we e g own o 28 days unde na u al ligh supplemen ed wi h a i icial
ligh (14 h a 24
◦
C and 10 h a 18
◦
C) in a g eenhouse, and nodules appea ing on he oo s we e
coun ed a e each week. 4 week plan s we e ha es ed, and hei we shoo s and oo s we e weigh ed.
The expe imen was done in iplica e using 20 plan s o each s ain es ed.
Genes 2018,9, 369 7 o 27
2.15. Nodule Analysis Using Ligh and Elec on Mic oscopy
To compa e nodule occupa ion by he R 297 mu an and he con ol s ains R 24.2, R 297(pPL1)
and R 24.2(pPL1), he enzyma ic ac i i y o
β
-glucu onidase encoded by gusA in he mTn5SSgusA40
ansposon o he pJBA21Tc plasmid was used [
44
]. Clo e seedlings we e inocula ed wi h hese s ains
and g own up o 4 weeks. Nex , he nodules we e s ained using 50 mM sodium phospha e bu e
(pH 7.2) con aining 50
µ
g mL
−1
o 5-b omo-4-chlo o-3-indolyl-
β
-D-glucu onide [
25
] and analyzed
unde a Nikon ligh mic oscope (OPTIPHOT2). To cha ac e ize in de ail he s uc u e o he nodules
elici ed by he R 297 and R 24.2 s ains, plan ma e ial was p epa ed o elec on mic oscopy analysis
as desc ibed ea lie [25].
2.16. S a is ical Analysis
The s a is ical analyses o da a we e pe o med using he S uden ’s - es o he S a is ica ( e .12,
S a So , C aco , Poland; one-way analysis o a iance (ANOVA)) and signi ican di e ences be ween
he analyzed samples o he R 297 mu an and con ol s ains we e es ablished a p< 0.05.
3. Resul s
3.1. Gene ic Cha ac e iza ion o a Mu an S ain R 297 and Complemen a ion o a pssZ Mu a ion
We ecen ly analyzed he ch omosomal Pss-I egion o R. leguminosa um b . i olii R 24.2 and
de e mined i s gene ic o ganiza ion [
25
]. P io o ha , a andom mu agenesis o he R 24.2 s ain using
an mTn5SSgusA40 ansposon was pe o med o es ablish which o he genes om he Pss-I egion
a ec EPS syn hesis [
42
]. As a esul , a ew s ains unable o p oduce EPS we e ob ained, among hem
R 770 (pssS) and R 1933 (pssE), which ha e been desc ibed p e iously [
25
,
26
]. In he cu en s udy,
we cha ac e ized ano he R 24.2 de i a i e, named R 297, gene a ed using he ansposon mu agenesis
desc ibed abo e [
42
]. This mu an s ain o med small, non-mucoid colonies on 79CA aga pla es,
which essen ially di e ed om hose o med by he wild ype (Figu e 1).
Genes 2018, 9, x FOR PEER REVIEW 7 o 28
analyzed unde a Nikon ligh mic oscope (OPTIPHOT2). To cha ac e ize in de ail he s uc u e o he
nodules elici ed by he R 297 and R 24.2 s ains, plan ma e ial was p epa ed o elec on mic oscopy
analysis as desc ibed ea lie [25].
2.16. S a is ical Analysis
The s a is ical analyses o da a we e pe o med using he S uden ’s - es o he S a is ica ( e .12,
S a So , C aco , Poland; one-way analysis o a iance (ANOVA)) and signi ican di e ences
be ween he analyzed samples o he R 297 mu an and con ol s ains we e es ablished a p < 0.05.
3. Resul s
3.1. Gene ic Cha ac e iza ion o a Mu an S ain R 297 and Complemen a ion o a pssZ Mu a ion
We ecen ly analyzed he ch omosomal Pss-I egion o R. leguminosa um b . i olii R 24.2 and
de e mined i s gene ic o ganiza ion [25]. P io o ha , a andom mu agenesis o he R 24.2 s ain
using an mTn5SSgusA40 ansposon was pe o med o es ablish which o he genes om he Pss-I
egion a ec EPS syn hesis [42]. As a esul , a ew s ains unable o p oduce EPS we e ob ained,
among hem R 770 (pssS) and R 1933 (pssE), which ha e been desc ibed p e iously [25,26]. In he
cu en s udy, we cha ac e ized ano he R 24.2 de i a i e, named R 297, gene a ed using he
ansposon mu agenesis desc ibed abo e [42]. This mu an s ain o med small, non-mucoid colonies
on 79CA aga pla es, which essen ially di e ed om hose o med by he wild ype (Figu e 1).
Figu e 1. Mo phology o colonies o med by he wild- ype s ain R. leguminosa um R 24.2 and se e al
de i a i es: he mu an s ain R 297 (pssZ), complemen ed s ain R 297 (pPL1), and R 24.2 (pPL1)
ha bo ing addi ional pssZ copies.
Using hyb idiza ion, PCR ampli ica ion wi h se e al p ime s complemen a y o di e en genes
o he Pss-I egion, and sequencing analyses, he localiza ion o he mTn5SSgusA40 ansposon in
R 297, designa ed he exo44 mu a ion, in he pssZ gene was iden i ied (be ween posi ions 1428 and
1429 n , GenBank no. NZ_MAMO01000063) (Figu e 2). We ound ha pssZ is an indi idual open
eading ame (ORF) ha does no o m pa o any ope on; he e o e, he mu a ion in his gene would
no exe a pola e ec on adjacen genes o he Pss-I egion.
Figu e 2. Physical and gene ic map o he Pss-I egion o R. leguminosa um R 24.2. A ows below he
map indica e he di ec ion o gene ansc ip ion. Selec ed es ic ion si es a e ma ked: E, EcoRI; H,
Figu e 1.
Mo phology o colonies o med by he wild- ype s ain R. leguminosa um R 24.2 and se e al
de i a i es: he mu an s ain R 297 (pssZ), complemen ed s ain R 297 (pPL1), and R 24.2 (pPL1)
ha bo ing addi ional pssZ copies.
Using hyb idiza ion, PCR ampli ica ion wi h se e al p ime s complemen a y o di e en genes o
he Pss-I egion, and sequencing analyses, he localiza ion o he mTn5SSgusA40 ansposon in R 297,
designa ed he exo44 mu a ion, in he pssZ gene was iden i ied (be ween posi ions 1428 and 1429 n ,
GenBank no. NZ_MAMO01000063) (Figu e 2). We ound ha pssZ is an indi idual open eading ame
(ORF) ha does no o m pa o any ope on; he e o e, he mu a ion in his gene would no exe a
pola e ec on adjacen genes o he Pss-I egion.
Genes 2018,9, 369 8 o 27
Genes 2018, 9, x FOR PEER REVIEW 7 o 28
analyzed unde a Nikon ligh mic oscope (OPTIPHOT2). To cha ac e ize in de ail he s uc u e o he
nodules elici ed by he R 297 and R 24.2 s ains, plan ma e ial was p epa ed o elec on mic oscopy
analysis as desc ibed ea lie [25].
2.16. S a is ical Analysis
The s a is ical analyses o da a we e pe o med using he S uden ’s - es o he S a is ica ( e .12,
S a So , C aco , Poland; one-way analysis o a iance (ANOVA)) and signi ican di e ences
be ween he analyzed samples o he R 297 mu an and con ol s ains we e es ablished a p < 0.05.
3. Resul s
3.1. Gene ic Cha ac e iza ion o a Mu an S ain R 297 and Complemen a ion o a pssZ Mu a ion
We ecen ly analyzed he ch omosomal Pss-I egion o R. leguminosa um b . i olii R 24.2 and
de e mined i s gene ic o ganiza ion [25]. P io o ha , a andom mu agenesis o he R 24.2 s ain
using an mTn5SSgusA40 ansposon was pe o med o es ablish which o he genes om he Pss-I
egion a ec EPS syn hesis [42]. As a esul , a ew s ains unable o p oduce EPS we e ob ained,
among hem R 770 (pssS) and R 1933 (pssE), which ha e been desc ibed p e iously [25,26]. In he
cu en s udy, we cha ac e ized ano he R 24.2 de i a i e, named R 297, gene a ed using he
ansposon mu agenesis desc ibed abo e [42]. This mu an s ain o med small, non-mucoid colonies
on 79CA aga pla es, which essen ially di e ed om hose o med by he wild ype (Figu e 1).
Figu e 1. Mo phology o colonies o med by he wild- ype s ain R. leguminosa um R 24.2 and se e al
de i a i es: he mu an s ain R 297 (pssZ), complemen ed s ain R 297 (pPL1), and R 24.2 (pPL1)
ha bo ing addi ional pssZ copies.
Using hyb idiza ion, PCR ampli ica ion wi h se e al p ime s complemen a y o di e en genes
o he Pss-I egion, and sequencing analyses, he localiza ion o he mTn5SSgusA40 ansposon in
R 297, designa ed he exo44 mu a ion, in he pssZ gene was iden i ied (be ween posi ions 1428 and
1429 n , GenBank no. NZ_MAMO01000063) (Figu e 2). We ound ha pssZ is an indi idual open
eading ame (ORF) ha does no o m pa o any ope on; he e o e, he mu a ion in his gene would
no exe a pola e ec on adjacen genes o he Pss-I egion.
Figu e 2. Physical and gene ic map o he Pss-I egion o R. leguminosa um R 24.2. A ows below he
map indica e he di ec ion o gene ansc ip ion. Selec ed es ic ion si es a e ma ked: E, EcoRI; H,
Figu e 2.
Physical and gene ic map o he Pss-I egion o R. leguminosa um R 24.2. A ows below he
map indica e he di ec ion o gene ansc ip ion. Selec ed es ic ion si es a e ma ked: E, EcoRI; H,
HindIII; and B, BamHI. Loca ion o he mTn5SSgusA40 inse ion in he mu an R 297 genome is ma ked
by a ed iangle.
The p esence o a single copy o mTn5SSgusA40 in he R 297 genome was con i med using
Sou he n hyb idiza ion wi h a gusA p obe (da a no shown). The pssZ gene (locus BAE36_21610)
encodes a 263-aa p o ein ( he coding egion ex ends om posi ion 898 o 1689 n , NZ_MAMO01000063),
which sha es high iden i y wi h bac e ial se ine/ h eonine p o ein phospha ases (STPs) belonging o
he g oup o phosphop o ein phospha ases (PPP) om he me allophospha ase (MPP) supe amily
(MPP_PPP amily, Cd00144). Among hizobia, PssZ o R 24.2 (GenBank WP_026230739.1) sha es
high sequence iden i y wi h STPs o R. e li CFN42 (92% iden i y, GenBank ABC92003.1), Rhizobium sp.
CIAT894 (94%, WP_085738086.1), R. gallicum (54%, WP_040115590.1), Ag obac e ium hizogenes (52%,
WP_047457744.1), A. ume aciens (50%, WP_012652475.1), Meso hizobium lo i (47%, WP_063898332.1),
and B ady hizobium lupini (46%, EKJ95978.1). The mTn5SSgusA40 inse ion in he R 297 genome was
iden i ied 261 n downs eam o he 5
0
-end o he pssZ gene. The e o e, he encoded p oduc is a
unca ed p o ein ha lacks 176 C- e minal aa o he wild- ype PssZ p o ein (Figu e 3).
Genes 2018, 9, x FOR PEER REVIEW 8 o 28
HindIII; and B, BamHI. Loca ion o he mTn5SSgusA40 inse ion in he mu an R 297 genome is
ma ked by a ed iangle.
The p esence o a single copy o mTn5SSgusA40 in he R 297 genome was con i med using
Sou he n hyb idiza ion wi h a gusA p obe (da a no shown). The pssZ gene (locus BAE36_21610)
encodes a 263-aa p o ein ( he coding egion ex ends om posi ion 898 o 1689 n ,
NZ_MAMO01000063), which sha es high iden i y wi h bac e ial se ine/ h eonine p o ein
phospha ases (STPs) belonging o he g oup o phosphop o ein phospha ases (PPP) om he
me allophospha ase (MPP) supe amily (MPP_PPP amily, Cd00144). Among hizobia, PssZ o
R 24.2 (GenBank WP_026230739.1) sha es high sequence iden i y wi h STPs o R. e li CFN42 (92%
iden i y, GenBank ABC92003.1), Rhizobium sp. CIAT894 (94%, WP_085738086.1), R. gallicum (54%,
WP_040115590.1), Ag obac e ium hizogenes (52%, WP_047457744.1), A. ume aciens (50%,
WP_012652475.1), Meso hizobium lo i (47%, WP_063898332.1), and B ady hizobium lupini (46%,
EKJ95978.1). The mTn5SSgusA40 inse ion in he R 297 genome was iden i ied 261 n downs eam o
he 5′-end o he pssZ gene. The e o e, he encoded p oduc is a unca ed p o ein ha lacks 176 C-
e minal aa o he wild- ype PssZ p o ein (Figu e 3).
Figu e 3. Alignmen o amino acid sequences o STPs om R. leguminosa um R 24.2 (PssZ) (GenBank
WP_026230739.1), R. e li CFN42 (ABC92003.1), R. CIAT894 (WP_085738086.1), R. gallicum
(WP_040115590.1), and A. ume aciens (WP_012652475.1). Amino acids ha a e iden ical a indi idual
posi ions in a leas h ee o he analyzed p o eins a e ma ked by blue colo . The exac poin a which
he PssZ p o ein is in e up ed because o he exo44 mu a ion in he pssZ gene (be ween esidues 87
and 88) is ma ked by a blue ec angle. Mo i s 1–3 a e designa ed wi h black lines, whe eas aa esidues
po en ially engaged in me al binding a e highligh ed in yellow.
The PPP amily is one o wo known p o ein phospha ase amilies speci ic o se ine and
h eonine. This amily is ancien and i s membe s a e ound in all euka yo es, and in mos bac e ia
and a chaea [e.g., PP1, PP2A, PP2B (calcineu in), PP4, PP5, PP6, PP7, P pE, P pA/P pB, and ApA4
hyd olase]. The ca aly ic domain o hese PPP p o eins usually con ains h ee conse ed mo i s (-
GDXHG-, -GDXVDRG-, and -GNHE-). We iden i ied he ca aly ic domain a he N- e minus o he
R 24.2 PssZ (Figu e 3), as well as sequences co esponding o he h ee conse ed mo i s. Among
Figu e 3.
Alignmen o amino acid sequences o STPs om R. leguminosa um R 24.2 (PssZ)
(GenBank WP_026230739.1), R. e li CFN42 (ABC92003.1), R. CIAT894 (WP_085738086.1), R. gallicum
(WP_040115590.1), and A. ume aciens (WP_012652475.1). Amino acids ha a e iden ical a indi idual
posi ions in a leas h ee o he analyzed p o eins a e ma ked by blue colo . The exac poin a which
he PssZ p o ein is in e up ed because o he exo44 mu a ion in he pssZ gene (be ween esidues 87
and 88) is ma ked by a blue ec angle. Mo i s 1–3 a e designa ed wi h black lines, whe eas aa esidues
po en ially engaged in me al binding a e highligh ed in yellow.
Genes 2018,9, 369 9 o 27
The PPP amily is one o wo known p o ein phospha ase amilies speci ic o se ine and h eonine.
This amily is ancien and i s membe s a e ound in all euka yo es, and in mos bac e ia and a chaea
[e.g., PP1, PP2A, PP2B (calcineu in), PP4, PP5, PP6, PP7, P pE, P pA/P pB, and ApA4 hyd olase].
The ca aly ic domain o hese PPP p o eins usually con ains h ee conse ed mo i s (-GDXHG-,
-GDXVDRG-, and -GNHE-). We iden i ied he ca aly ic domain a he N- e minus o he R 24.2
PssZ (Figu e 3), as well as sequences co esponding o he h ee conse ed mo i s. Among hem,
he i s mo i (-S
D
V
HG
-; iden ical aa a e unde lined) sha ed he lowes sequence simila i y wi h he
co esponding conse ed mo i (-GDXHG-), whe eas he sequence o bo h he second (-
GD
Y
VDRG
-)
and he hi d (-
GNH
D-) mo i s we e almos iden ical o hose o he conse ed mo i s (-GDXVDRG-
and -GNHE-, espec i ely). Addi ional conse ed aa esidues (his idine, aspa a e, and aspa agine)
we e also de ec ed in PssZ [a posi ions 43 (D), 45 (H), 76 (D), 107–108 (NH), 186 (H), and 225 (H)].
These aa a e cha ac e is ic o enzymes belonging o he MPP amily and a e esponsible o binding
wo me al ions ( ypically, manganese, i on, o zinc), which a e coo dina ed by a double be a-shee
sandwich wi h a di-me al ac i e si e composed o esidues loca ed a he C- e minal egion o he shee s.
In silico sequence analysis o a egion ups eam o pssZ e ealed he p esence o mo i s
wi h high iden i y wi h he
−
35 and
−
10 mo i s o E. coli p omo e s, which a e ecognized by
sigma
70
RNA polyme ase. This p omo e sequence was loca ed 376 n ups eam o he pssZ ORF
(5
0
-
TTG
C
C
G-N
17
-
T
T
TA
C
T
-3
0
; nucleo ides iden ical wi h hose o he E. coli p omo e consensus a e
unde lined). Based on PCR analyses using se e al p ime pai s complemen a y o he p omo e less
gusA gene p esen in mTn5SSgusA40 and di e en pssZ egions, we ha e es ablished ha he gusA
gene has he same ansc ip ional o ien a ion as pssZ. Using a
β
-glucu onidase ac i i y assay, we
de e mined he ansc ip ional ac i i y o he pssZ p omo e o be 406.7 ±56.8 Mille uni s.
In o de o complemen he exo44 mu a ion o R 297, plasmid pPL1, con aining a 1.8-kb agmen
ha ha bo ed he comple e pssZ gene as well as i s p omo e egion, was cons uc ed. The in oduc ion
o plasmid pPL1 in o he R 297 mu an es o ed he mucoid colony pheno ype (simila o ha o he
wild- ype s ain), indica ing ha his 1.8-kb agmen o he Pss-I egion was su icien o complemen
he exo44 mu a ion. In addi ion, o es ablish he e ec o he p esence o addi ional pssZ copies on colony
mucoidy, plasmid pPL1 was in oduced in o he wild- ype s ain R 24.2. Nex , he amoun s o bo h
high- and low-molecula weigh (HMW and LMW, espec i ely) ac ions o EPS p oduced by s ains
R 24.2, R 297, R 297(pPL1), and R 24.2(pPL1) cul u ed in 79CA medium wi h 1% glyce ol as a ca bon
sou ce we e de e mined and compa ed (Figu e 4A). Bo h con ol s ains, R 24.2 and R 297(pPL1),
p oduced la ge amoun s o his polysaccha ide, and HMW EPS was he dominan ac ion ( he
HMW/LMW a io o R 24.2 was 2.33, whe eas ha o R 297(pPL1) was 1.79). Mo eo e , R 24.2(pPL1)
syn hesized mo e EPS (bo h HMW and LMW ac ions) han he wild- ype s ain. The p esence
o emp y ec o pBBR1MCS-2 in R 24.2 did no a ec he le el o EPS p oduc ion, as con i med
elsewhe e [
39
]. By con as , R 297 p oduced only esidual amoun s o EPS (1.09% o R 24.2 HMW
EPS and 3.48% o R 24.2 LMW EPS), indica ing ha he syn hesis o his polyme was d ama ically
impai ed in his mu an . These da a con i m ha pssZ plays an essen ial ole in EPS p oduc ion in
R. leguminosa um.
Fu he mo e, we asked whe he he exo44 mu a ion a ec ed he syn hesis o ano he su ace
polysaccha ide, he lipopolysaccha ide (LPS), in R 297. Consequen ly, LPS was ex ac ed om R 24.2,
R 297, R 297(pPL1), and R 24.2(pPL1), and analyzed by SDS-PAGE. As shown in Figu e 4B, he LPS
elec opho e ic p o iles o hese s ains we e iden ical, sugges ing no changes in his polyme . Howe e ,
we canno exclude he possibili y ha he mu a ion in pssZ esul ed in mino changes in he s uc u e
o LPS ha did no a ec he elec opho e ic mobili y o his polysaccha ide.
Genes 2018,9, 369 16 o 27
The s ains R 24.2, R 297(pPL1), and R 24.2(pPL1) exhibi ed high e ec i eness in hos oo
in ec ion, and a e 21 days pos inocula ion (dpi) all plan s inocula ed wi h hese bac e ia (100%) had
de eloped nodules on hei oo s (Figu e 10A). In con as , he capaci y o he pssZ mu an o in ec
clo e oo s was se e elly educed, as e idenced by only 10% and 30% plan s con aining oo nodules
a 7 dpi and 14 dpi, espec i ely. Apa om a delay in nodule o ma ion, he o al numbe o nodules
induced by R 297 on he hos oo s a 28-dpi was conside ably lowe (~2- old) han hose elici ed
by s ains R 24.2, R 297(pPL1), and R 24.2(pPL1) (Figu e 10B). Mo eo e , plan s inocula ed wi h he
mu an R 297 we e miniscule and only o med small, whi e nodule-like s uc u es, o en wi h a ypical
shape, whose mo phology sugges ed ha hey we e ine ec i e in ni ogen ixa ion (Figu e 11A,B).
This was con i med by he shoo mass o plan s inocula ed wi h R 297, which was nea ly 2- old
lowe han he shoo mass o plan s inocula ed wi h he con ol s ains, and e y simila o ha o
he uninocula ed plan s (Figu e 10C). In con as , clo e plan s inocula ed wi h R 24.2, R 297(pPL1),
and R 24.2(pPL1) we e all, wi h many pink elonga ed nodules on hei oo s, which sugges ed ha
hey we e e ec i e in ni ogen ixa ion (Figu e 11A,B).
Genes 2018, 9, x FOR PEER REVIEW 17 o 28
Figu e 11. Clo e plan s a 28 dpi wi h he wild- ype s ain R. leguminosa um R 24.2 and i s de i a i es
(A) and nodules elici ed on hei oo s by hese s ains (B).
Nex , he occupa ion o clo e oo nodules by hese hizobial s ains was examined. Fo his
expe imen , bac e ia ha bo ing he gusA gene encoding β-glucu onidase we e used (Figu e 12). We
obse ed ha s ains R 24.2, R 297(pPL1), and R 24.2(pPL1) e ec i ely occupied he nodules, and
hese bac e ia we e de ec ed in all zones o he 21-dpi nodules (i.e., in ec ion zone, in e zone, and
ni ogen- ixing zone), wi h he excep ion o he me is em (Figu e 12A–C). In con as , occupa ion o
clo e oo nodules by R 297 was conside ably educed. Mu an cells we e isible mainly on he oo
and nodule su ace, and a g ea majo i y o he nodules we e no occupied by his bac e ium (Figu e
12D,E). R 297 cells we e ound inside single nodule cells only spo adically (Figu e 12F–H). E en in
such spo adic olde (21-dpi) nodules, bac e ia we e p esen only in a ew plan cells (Figu e 12I).
Nex , we cha ac e ized he s uc u e o nodules elici ed by he R 297 mu an on clo e oo s in
mo e de ail. We p e iously desc ibed he s uc u e o wild- ype nodules induced by he R 24.2 s ain
on his hos plan [25,56]. As shown on Figu e 13, wild- ype clo e nodules exhibi a ypical s uc u e
wi h all zones cha ac e is ic o inde e mina e- ype nodules, including a la ge ni ogen ixa ion (NF)
zone wi h nume ous ma u e in ec ed plan cells con aining p ope ly di e en ia ed bac e oids (Figu e
13A,B and 13E,F). ITs exhibi ed a no mally o med h ead wall and la ge amoun s o h ead ma ix
(Figu e 13C,D).
Figu e 11.
Clo e plan s a 28 dpi wi h he wild- ype s ain R. leguminosa um R 24.2 and i s de i a i es
(A) and nodules elici ed on hei oo s by hese s ains (B).
Nex , he occupa ion o clo e oo nodules by hese hizobial s ains was examined. Fo his
expe imen , bac e ia ha bo ing he gusA gene encoding
β
-glucu onidase we e used (Figu e 12).
We obse ed ha s ains R 24.2, R 297(pPL1), and R 24.2(pPL1) e ec i ely occupied he nodules,
and hese bac e ia we e de ec ed in all zones o he 21-dpi nodules (i.e., in ec ion zone, in e zone,
and ni ogen- ixing zone), wi h he excep ion o he me is em (Figu e 12A–C). In con as , occupa ion
o clo e oo nodules by R 297 was conside ably educed. Mu an cells we e isible mainly on he
oo and nodule su ace, and a g ea majo i y o he nodules we e no occupied by his bac e ium

Genes 2018,9, 369 17 o 27
(Figu e 12D,E). R 297 cells we e ound inside single nodule cells only spo adically (Figu e 12F–H).
E en in such spo adic olde (21-dpi) nodules, bac e ia we e p esen only in a ew plan cells (Figu e 12I).
Genes 2018, 9, x FOR PEER REVIEW 18 o 28
Figu e 12. Ligh mic oscopy o clo e (T i olium p a ense) oo nodules elici ed by he wild- ype s ain
R. leguminosa um R 24.2 and se e al de i a i es ha bo ing gusA epo e gene encoding β-
glucu onidase. The images show 21-dpi nodules occupied by R 24.2 (A), R 297(pPL1) (B), and
R 24.2(pPL1) (C). (D–I) Nodules o med a e inocula ion wi h R 297: (D–F) 7–dpi nodules; (G,H) 14-
dpi nodules; and (I) a 21-dpi nodule.
Simila ly wi h wild- ype nodules, nodules elici ed by R 297 (Figu e 14) we e su ounded by a
co ex con aining la ge, loosely a anged cells and by an endode mis. Howe e , in con as wi h he
wild- ype nodules, semi- hin sec ioning o he mu an nodules e ealed ha a g ea majo i y o hei
cen al issue con ained unin ec ed pa enchyma ous cells wi h s a ch g ains and only ew o hese
cells we e in ec ed by bac e ia (Figu e 14A). The nodules con ained he me is em and he ascula
bundle connec ed wi h he oo s ele, oo epide mal cells (in con ac wi h he R 297 cells) had
hickened walls, which s ained in ensely wi h azu A and me hylene blue. The o med ITs we e wide
and o en b anched, wi h many mu an cells igh ly packed inside hem; he shape and size o hese
bac e ia we e highly a iable (Figu e 14B). IT walls we e a ypically hick, i egula ly o med, wi h
knobs and p o usions (Figu e 14C). Ano he al e ed mo phological ea u e o hese mu an -induced
ITs was he lack o h ead ma ix (Figu e 14D), which is ypically p esen in la ge amoun s wi hin he
wild- ype ITs. Plan cell in ec ion was also abno mal; i sugges ed a simul aneous endocy osis o
many mu an cells in o he plan oo cell cy oplasm, e med “explosion-like” mass endocy osis
(Figu e 14E). Al hough symbiosomes o med in hese cells usually con ained only a single bac e oid,
and hose wi h mo e han one bac e oid we e ound only spo adically (simila ly o wild- ype
nodules) (Figu e 14F), di e en ia ion o he mu an bac e oids was essen ially di e en om ha o
he wild- ype bac e oids and se e al dis u bances o his p ocess we e obse ed. Only some
Figu e 12.
Ligh mic oscopy o clo e (T i olium p a ense) oo nodules elici ed by he wild- ype
s ain R. leguminosa um R 24.2 and se e al de i a i es ha bo ing gusA epo e gene encoding
β
-glucu onidase. The images show 21-dpi nodules occupied by R 24.2 (
A
), R 297(pPL1) (
B
),
and R 24.2(pPL1) (
C
). (
D
–
I
) Nodules o med a e inocula ion wi h R 297: (
D
–
F
) 7–dpi nodules;
(G,H) 14-dpi nodules; and (I) a 21-dpi nodule.
Nex , we cha ac e ized he s uc u e o nodules elici ed by he R 297 mu an on clo e oo s
in mo e de ail. We p e iously desc ibed he s uc u e o wild- ype nodules induced by he R 24.2
s ain on his hos plan [
25
,
56
]. As shown on Figu e 13, wild- ype clo e nodules exhibi a ypical
s uc u e wi h all zones cha ac e is ic o inde e mina e- ype nodules, including a la ge ni ogen
ixa ion (NF) zone wi h nume ous ma u e in ec ed plan cells con aining p ope ly di e en ia ed
bac e oids (Figu e 13A,B,E,F). ITs exhibi ed a no mally o med h ead wall and la ge amoun s o h ead
ma ix (Figu e 13C,D).
Simila ly wi h wild- ype nodules, nodules elici ed by R 297 (Figu e 14) we e su ounded by a
co ex con aining la ge, loosely a anged cells and by an endode mis. Howe e , in con as wi h
he wild- ype nodules, semi- hin sec ioning o he mu an nodules e ealed ha a g ea majo i y
o hei cen al issue con ained unin ec ed pa enchyma ous cells wi h s a ch g ains and only ew
o hese cells we e in ec ed by bac e ia (Figu e 14A). The nodules con ained he me is em and he
ascula bundle connec ed wi h he oo s ele, oo epide mal cells (in con ac wi h he R 297 cells) had
hickened walls, which s ained in ensely wi h azu A and me hylene blue. The o med ITs we e wide
and o en b anched, wi h many mu an cells igh ly packed inside hem; he shape and size o hese
bac e ia we e highly a iable (Figu e 14B). IT walls we e a ypically hick, i egula ly o med, wi h
knobs and p o usions (Figu e 14C). Ano he al e ed mo phological ea u e o hese mu an -induced
ITs was he lack o h ead ma ix (Figu e 14D), which is ypically p esen in la ge amoun s wi hin
he wild- ype ITs. Plan cell in ec ion was also abno mal; i sugges ed a simul aneous endocy osis
Genes 2018,9, 369 18 o 27
o many mu an cells in o he plan oo cell cy oplasm, e med “explosion-like” mass endocy osis
(Figu e 14E). Al hough symbiosomes o med in hese cells usually con ained only a single bac e oid,
and hose wi h mo e han one bac e oid we e ound only spo adically (simila ly o wild- ype nodules)
(Figu e 14F), di e en ia ion o he mu an bac e oids was essen ially di e en om ha o he wild- ype
bac e oids and se e al dis u bances o his p ocess we e obse ed. Only some bac e oids di e en ia ed,
while a g ea majo i y o bac e oids degene a ed p ecociously. These bac e oids we e la ge han
no mal, abno mally swollen, o en de o med, and unde wen apid deg ada ion. As a consequence
o de e io a ion, hei homogenous cy oplasm became elec on-dense, ma bled, o comple ely da k
(black) (Figu e 14G).
Genes 2018, 9, x FOR PEER REVIEW 19 o 28
bac e oids di e en ia ed, while a g ea majo i y o bac e oids degene a ed p ecociously. These
bac e oids we e la ge han no mal, abno mally swollen, o en de o med, and unde wen apid
deg ada ion. As a consequence o de e io a ion, hei homogenous cy oplasm became elec on-dense,
ma bled, o comple ely da k (black) (Figu e 14G).
Figu e 13. Semi- hin sec ion o a 21-dpi clo e oo nodule elici ed by he wild- ype s ain R.
leguminosa um R 24.2 (A), OC: ou e co ex; IC: inne co ex; RS: oo s ela; VB: nodule ascula
bundle; M: me is em; IZ: in ec ion zone; II/III: in e zone; NF: ni ogen ixa ion zone; black as e isks:
in ec ed cells; a owheads: nodule endode mis. (B), ni ogen ixa ion zone wi h ma u e in ec ed plan
cells; NF: ni ogen ixa ion zone; OC: ou e co ex; IC: inne co ex; black as e isks: in ec ed cells;
Figu e 13.
Semi- hin sec ion o a 21-dpi clo e oo nodule elici ed by he wild- ype s ain
R. leguminosa um R 24.2 (
A
), OC: ou e co ex; IC: inne co ex; RS: oo s ela; VB: nodule ascula
bundle; M: me is em; IZ: in ec ion zone; II/III: in e zone; NF: ni ogen ixa ion zone; black as e isks:
in ec ed cells; a owheads: nodule endode mis. (
B
), ni ogen ixa ion zone wi h ma u e in ec ed plan
cells; NF: ni ogen ixa ion zone; OC: ou e co ex; IC: inne co ex; black as e isks: in ec ed cells;
a owheads: nodule endode mis. (
C
,
D
), Ul as uc u e o an in ec ion h ead (IT) con aining R 24.2
cells; TM: h ead ma ix; BA: bac e ia; B: bac e oids; S: s a ch g anules. (
E
,
F
), Ma u e in ec ed cells;
IC: in ec ed cell; B: bac e oids; S: s a ch g anules.
Genes 2018,9, 369 19 o 27
Genes 2018, 9, x FOR PEER REVIEW 20 o 28
a owheads: nodule endode mis. (C,D), Ul as uc u e o an in ec ion h ead (IT) con aining R 24.2
cells; TM: h ead ma ix; BA: bac e ia; B: bac e oids; S: s a ch g anules. (E,F), Ma u e in ec ed cells;
IC: in ec ed cell; B: bac e oids; S: s a ch g anules.
Figu e 14. Semi- hin sec ion o a 21-dpi clo e oo nodule elici ed by he R. leguminosa um mu an
R 297 (A), M: me is em; OC: ou e co ex; RS: oo s ela; VB: nodule ascula bundle; whi e as e isks:
in ec ed cells; a ow head: nodule endode mis. (B), Ul as uc u e o he IT con aining R 297 cells: BA:
bac e ia, TW: h ead wall; a ows: ma e ial deposi ed be ween osmiophilic laye s o he h ead wall.
(C), Deposi s o elec on-dense ma e ial on he co ical oo cell wall (a ow heads) (CRC: he co ical
oo cell). (D), A co ical oo cell which unde goes au olysis; N: nucleus; IT: in ec ion h ead; S: s a ch
g anules; V: acuoles. (E), “Explosion-like” mass endocy osis o bac e ia by he plan cell cy oplasm;
ID: in ec ion d ople . (F), A ma u e in ec ed cell; S: s a ch g anules; ose e: abno mally di e en ia ed
bac e oids; iangle: p ecociously degene a ed bac e oids. (G), an in ec ed cell con aining deg ading
bac e oids (s a s); S: s a ch g anules.
Figu e 14.
Semi- hin sec ion o a 21-dpi clo e oo nodule elici ed by he R. leguminosa um mu an
R 297 (
A
), M: me is em; OC: ou e co ex; RS: oo s ela; VB: nodule ascula bundle; whi e as e isks:
in ec ed cells; a ow head: nodule endode mis. (
B
), Ul as uc u e o he IT con aining R 297 cells: BA:
bac e ia, TW: h ead wall; a ows: ma e ial deposi ed be ween osmiophilic laye s o he h ead wall.
(
C
), Deposi s o elec on-dense ma e ial on he co ical oo cell wall (a ow heads) (CRC: he co ical
oo cell). (
D
), A co ical oo cell which unde goes au olysis; N: nucleus; IT: in ec ion h ead; S: s a ch
g anules; V: acuoles. (
E
), “Explosion-like” mass endocy osis o bac e ia by he plan cell cy oplasm;
ID: in ec ion d ople . (
F
), A ma u e in ec ed cell; S: s a ch g anules; ose e: abno mally di e en ia ed
bac e oids; iangle: p ecociously degene a ed bac e oids. (
G
), an in ec ed cell con aining deg ading
bac e oids (s a s); S: s a ch g anules.
In conclusion, all hese da a indica e ha he lack o PssZ leads o p onounced dis u bances in
he symbiosis be ween R 297 and clo e , bo h in ea ly (i.e., hos oo in ec ion) and la e (i.e., bac e oid
de elopmen ) s eps. The mu an in ec ed only ew nodule cells and he bac e oids degene a ed
p ema u ely, esul ing in he inabili y o hese nodules o ix ni ogen.
Genes 2018,9, 369 20 o 27
4. Discussion
In he cu en s udy, we showed ha inac i a ion o he R. leguminosa um b . i olii pssZ gene
esul s in a d ama ic impai men in EPS p oduc ion. Cell g ow h and mo ili y o he pssZ mu an was
also a ec ed, wi h he cells p esen ing al e ed su ace p ope ies and clea ly impai ed in symbio ic
in e ac ion wi h clo e . Mos p obably, a leas some o hese al e a ions we e caused by he lack o
EPS p oduc ion, as has been p e iously demons a ed by ou g oup o a ious R. leguminosa um b .
i olii mu an s wi h impai ed biosyn hesis o his su ace polysaccha ide [
17
,
26
,
56
,
63
]. As ecen ly
epo ed [
13
–
15
], hizobial EPS plays a c ucial ole as a signal molecule in he ea ly s ages o symbiosis.
Fu he mo e, his polysaccha ide is impo an o adhesion and bio ilm o ma ion on bo h abio ic
su aces and plan oo s, as well as o he p o ec ion o bac e ial cells agains se e al en i onmen al
condi ions [17,64,65].
The syn hesis o hizobial EPS is a mul i-s ep p ocess which in ol es he ac i i y o many enzymes
and egula o y p o eins. A g ea majo i y o p o eins ha pa icipa e in his biosyn he ic pa hway in
R. leguminosa um a e encoded by genes om he la ge ch omosomal clus e Pss-I [
24
,
25
,
66
,
67
]. To da e,
he only excep ion is pssA, loca ed a long dis ance away om he Pss-I egion [
6
,
9
]. This gene
encodes an enzyme ha ini ia es he EPS syn hesis. PssA ans e s glucose-1-phospha e om
UDP-glucose o he lipid ancho und-PP in he bac e ial IM [
23
]. Ea lie s udies showed ha mu a ions
in se e al genes encoding glycosyl ans e ases in ol ed in he addi ion o suga esidues o he
g owing EPS subuni abolish EPS p oduc ion. This was con i med by he EPS-de icien pheno ypes
o R. leguminosa um s ains ha bo ing mu a ions in pssA,pssDE,pssC, and pssS, which encode
glycosyl ans e ases pa icipa ing in he i s ou s eps o he EPS subuni assembly [
6
,
7
,
9
,
24
–
26
].
Mo eo e , he R. leguminosa um exo344::Tn5s ain, ca ying a mu a ion in pssJ, which encodes a p o ein
in ol ed in he las s ep o he subuni assembly, syn hesized only esidual amoun s o EPS, whose
uni s lack he e minal D-galac ose [
21
,
22
]. Simila ly, mu a ions in genes esponsible o he syn hesis
o suga nucleo ide p ecu so s exe s ong nega i e e ec s on his p ocess. Fo example, a mu a ion
in he exo5 gene loca ed adjacen o pssZ in he Pss-I clus e esul s in pleio opic e ec s. The exo5
mu an s ain o R. leguminosa um RBL5523 is de ec i e in UDP-glucose dehyd ogenase, which con e s
UDP-glucose o UDP-glucu onic acid [
68
,
69
]. This mu an is unable o syn hesize wo suga p ecu so s,
UDP-glucu onic acid and UDP-galac u onic acid. Consequen ly, i is unable o syn hesize EPS and
capsula polysaccha ide, i s LPS lacks galac u onic acid, and is de ec i e in symbiosis wi h i s hos
plan , Vicia sa i a subsp. nig a. Simila e ec s ha e been desc ibed o he S. melilo i and S. edii
mu an s a ec ed in he exo5 o hologue, kpK [
70
,
71
]. In bo h hizobia, he exoK mu an s p oduce
al e ed LPS, al hough he EPS p oduc ion is only a ec ed in he S. edii kpK mu an because o he
p esence o glucu onic acid in S. edii EPS.
Mu a ion o pssZ, which is loca ed adjacen o exo5, also abolished EPS syn hesis in
R. leguminosa um, indica ing ha he p o ein encoded by pssZ plays an essen ial ole in his p ocess.
Howe e , in spi e o simila i ies be ween he pleio opic e ec s o mu a ions in he pssZ and exo5
genes, he exo44 mu a ion mos p obably does no di ec ly a ec he exo5 exp ession since hese wo
genes a e ansc ibed in opposi e di ec ions. I seems mo e p obable ha he p o ein p oduc o
pssZ unc ions a a pos - ansla ional le el, di ec ly and/o indi ec ly a ec ing enzyma ic ac i i y
o some p o ein/p o eins in ol ed in EPS syn hesis. Mo eo e , he high sequence iden i y sha ed
by PssZ and bac e ial STPs sugges s ha he unc ion o his p o ein in R. leguminosa um migh be
mo e global ha simply in luencing he EPS biosyn he ic pa hway (being an elemen o hizobial
signal egula o y cascade). To he bes o ou knowledge, his is he i s -e e epo ega ding he
cha ac e iza ion o a p o ein o his ype in hizobia. We showed ha he pssZ mu a ion no only
inhibi ed EPS syn hesis, bu also nega i ely a ec ed bac e ial beha io and cell-su ace p ope ies.
This was obse ed as signi ican ly educed g ow h kine ics (leading o inc eased gene a ion ime),
su ace mo ili y, cell hyd ophobici y, and bio ilm o ma ion, and al e ed cell mo phology and su ace
p ope ies. The abili y o R 297(exo44) o in e ac wi h clo e was d ama ically impai ed mos p obably
because o he absence o EPS p oduc ion: he educed abili y o in ec clo e oo s led o he delayed
Genes 2018,9, 369 21 o 27
o ma ion o a educed numbe o non-p ope ly in ec ed nodules ha we e ine icien in ni ogen
ixa ion. The in oduc ion o plasmid pPL1 ha bo ing he pssZ gene in o R 297 es o ed he mucoid
colony pheno ype and o he bac e ial p ope ies o alues ha we e simila o hose o he wild- ype
cells (al hough some cha ac e is ics such as g ow h, bio ilm o ma ion, and nodula ion e ec i eness
pa ame e s we e sligh ly lowe han hose o R 24.2). On he o he hand, al hough R 24.2(pPL1)
ha bo ing addi ional pssZ copies also g ew sligh ly slowe han he wild ype, mos p obably because
o he p esence o he ha bo ed ec o and an ibio ic in he cul u e medium, his s ain exhibi ed
highe EPS and bio ilm p oduc ion, inc eased ole ance o some s ess ac o s, and enhanced symbio ic
e ec i eness han R 24.2.
A cen al ques ion in bac e ial physiology is how bac e ia sense and espond o hei en i onmen .
In gene al, wo-componen signaling sys ems, composed o a senso p o ein his idine kinase ha
ac i a es a ansc ip ion ac o esponse egula o in esponse o a speci ic signal, play a dominan
ole in bac e ial signaling [
72
]. Howe e , bac e ia also possess signaling sys ems composed o
euka yo ic-like Se /Th kinases (STKs) and STPs. E en hough hese sys ems do no ha e dedica ed
ansc ip ion ac o s, hey a e capable o a ec ing gene exp ession [
73
–
75
]. P e iously, egula o y
Se /Th phospho yla ion has been assumed o be la gely absen in p oka yo es. Howe e , based on
ecen phosphop o eomic analyses, nume ous (~70) p o eins wi h phospho yla ed Se o Th esidues
we e iden i ied in bo h G am-posi i e and G am-nega i e bac e ia [
76
,
77
]. Among hem, we e se e al
p o eins o ca aly ic, anspo ing, and egula o y unc ions, ela ed o di e en p ocesses ( eplica ion,
ansc ip ion, ansla ion and pos ansla ional modi ica ions; anspo and me abolism o amino
acids, ca bohyd a es, and ino ganic ions; polysaccha ide syn hesis) [
78
–
80
]. As was shown o
Bacillus sub ilis, a G am-posi i e model bac e ium widely used in bo h basic esea ch and indus ial
applica ions, Se /Th kinase P kC and phospha ase P pC a e in ol ed in spo e de elopmen and
bio ilm o ma ion [
81
,
82
]. P kC and P pC phospho yla es and dephospho yla es oxido educ ase
YkwC, espec i ely, and Se 281 phospho yla ion abolishes he ac i i y o his enzyme. In he case o
S aphylococcus au eus, a ole o STK and STP in modula ion o cell wall s uc u e was con i med [
83
].
Simila ly, STK and STP enzymes a ec g ow h, cell seg ega ion, and i ulence o S ep ococcus
agalac iae and S. pyogenes [
84
,
85
]. In con as , conside ably less da a a e a ailable o hese p o eins
in G am-nega i e bac e ia, al hough he p esence o STK and STP p o eins has been desc ibed in
Pseudomonas ae uginosa [
86
]. All hese obse a ions con i m he no ion ha p o ein phospho yla ion is
impo an in con olling a a ie y o biological p ocesses in bac e ia, such as cell di e en ia ion and
p oli e a ion, me abolism, and cell wall biogenesis.
In gene al, STPs belong o PPP om he MPP supe amily (MPP_PPP amily, Cd00144).
The PPP amily is ancien wi h membe s ound in all euka yo es, and in mos bac e ial and
a cheal genomes [
73
–
75
]. The ca aly ic domain o hese PPP usually con ains h ee conse ed
mo i s (-GDXHG-, -GDXVDRG-, and -GNHE-). The p esence o hese mo i s was iden i ied in he
amino acid sequence o PssZ p o ein, cha ac e ized in his s udy. The MPP supe amily con ains
unc ionally di e se enzymes bu all sha e a conse ed domain wi h an ac i e si e consis ing o wo
me al ions (usually, manganese, i on, o zinc) coo dina ed wi h oc ahed al geome y by a cage o
his idine, aspa a e, and aspa agine esidues [
73
–
75
]. STPs a e classi ied in o wo dis inc s uc u al
amilies: PP1/PP2A/PP2B, and PP2C, acco ding o hei subs a e speci ici y, me al-ion dependence,
and sensi i i y o phospha ase inhibi o s, he phospha ase ca aly ic subuni s, and iso o ms [
87
].
PP1 and PP2A a e ac i e independen ly o he p esence o me al ions, whe eas PP2B is Ca
2+
-calmodulin
dependen and PP2C is me al-dependen [
88
–
90
]. A ew his idine, aspa a e, and aspa agine esidues
as a ge si es o me al-binding ac i i y we e iden i ied in he PssZ sequence, sugges ing ha his
p o ein belongs o he PP2C- ype amily. Among bac e ial homologs o euka yo ic- ype Se /Th
phospha ases, se e al enzymes, such as SppA in S ep omyces coelicolo and Pph1 in Micococcus xan hus,
a e PP2C- ype STPs ha a e impo an o ege a i e g ow h and de elopmen o hese bac e ia [
91
,
92
].
Simila ly o ou obse a ions o he R. leguminosa um pssZ mu an , i was epo ed ha mu a ions
inac i a ing euka yo ic- ype Se /Th kinase (S k1) and phospha ase (S p1) exhibi pleio opic e ec s on

Genes 2018,9, 369 22 o 27
g ow h, cell seg ega ion, and i ulence o S. agaliac ae, sugges ing an impo an ole o hese enzymes
in he egula ion o a ious cellula p ocesses in his bac e ium [90].
Thus, ecen s udies ha e shown ha p oka yo es con ain signaling enzymes commonly ound
in euka yo es, such as STKs and STPs, which con ibu e o he egula ion o gene exp ession ha is
impo an o se e al cellula p ocesses, such as g ow h, i ulence, seconda y me aboli e p oduc ion,
and cell en elope biogenesis [
93
]. Al hough hey a e no DNA-binding p o eins, STKs and STPs
media e p oka yo ic gene exp ession h ough pos - ansla ional modi ica ion o a a ie y o a ge s,
including wo-componen s esponse egula o s o c i ical componen s o he p oka yo ic ansc ip ional
and ansla ional machine y [94].
In ela ion o he de iciency o EPS p oduc ion exhibi ed by he R. leguminosa um pssZ mu an ,
mos p obably i could be associa ed wi h he absence o modula ion o he ac i i y o some Pss
p o eins in ol ed in EPS syn hesis. Many di e en p o eins could cons i u e a ge s o PssZ ac ion,
including enzymes in ol ed in suga p ecu so syn hesis, glycosyl ans e ases, p o eins engaged in
EPS polyme iza ion and expo , and/o egula o y p o eins. The p o ein p oduc o he exo5 gene migh
be a a ge o PssZ, because o he high simila i y o he pleio opic e ec s o mu a ions in exo5 and
pssZ. Mo eo e , PssA, which plays an essen ial ole in he o ma ion o he enzyma ic machine y in he
bac e ial IM and ini ia es he EPS biosyn he ic p ocess, could also be a a ge o his ype o egula ion.
In ac , his p o ein con ains an unusually high numbe o Se and Th esidues [
9
]. Recen ly, Ma czak
and o he s [
4
] pos ula ed ha he mechanisms o EPS syn hesis and ansloca ion ou o he cell mus be
empo ally and spa ially coo dina ed. Fu he , di ec in e ac ions be ween p o eins o his mul i-p o ein
complex mus occu o hei e ec i e ac i i y, in which phospho yla ion/dephospho yla ion eac ions
mus play c ucial oles. In addi ion, he possibili y ha PssZ could modula e he ac i i y o o he
p o eins no ela ed o EPS biosyn hesis canno be disca ded. Sequence iden i y sha ed by PssZ and
STPs, which play an impo an ole in bac e ial signaling, sugges s ha he unc ion o his p o ein in
R. leguminosa um migh be global and in luences o he cellula p ocesses in addi ion o pa icipa ing in
he EPS biosyn hesis. Clea ly, u he and comp ehensi e esea ch a he ansc ip omic and p o eomic
le els is needed o cla i y his issue.
We ha e iden i ied h ee genes (BAE36_16215, BAE36_06965, and BAE36_31125) in he R 24.2
genome (acc. nos. MAMO01000032, MAMO01000009, and MAMO01000168) coding o p o eins
(150 aa, 247 aa, and 697 aa, espec i ely) wi h pu a i e STK ac i i y [
58
]. Mo eo e , he p esence o gene
BAE36_26360 coding o an 1843-aa long mul i-senso signal ansduc ion mul i-kinase, which con ains
se e al unc ional domains (i.e., his idine kinase domain, Se /Th kinase domain, ATP-binding domain,
and Mg
2+
-binding domain), was also con i med in he R 24.2 genome (MAMO01000151) [
58
]. I is
p obable ha he PssZ p o ein cha ac e ized in his s udy migh unc ion oge he wi h some o hese
STKs in phospho yla ion/dephospho yla ion eac ions, in luencing se e al physiological p ocesses in
hizobial cells.
5. Conclusions
The R. leguminosa um b . i olii genome ha bo s he pssZ gene, which codes o a pu a i e
Se /Th phosphop o ein phospha ase. This gene is loca ed in he la ge Pss-I polysaccha ide syn hesis
clus e . Inac i a ion o pssZ a ec ed se e al physiological and symbio ic p ope ies o his bac e ium,
esul ing in he loss o EPS syn hesis, educed g ow h kine ics and mo ili y, al e ed su ace p ope ies,
and dis u bed symbiosis wi h clo e . These obse a ions con i m ha he p o ein encoded by he pssZ
gene is equi ed o bo h EPS syn hesis and p ope unc ioning o R. leguminosa um b . i olii cells.
Au ho Con ibu ions:
Concep ualiza ion, M.J. and P.L.; Me hodology, M.J. and P.L.; So wa e, P.L.; Valida ion,
M.J.; Fo mal Analysis, M.J. and P.L.; In es iga ion, P.L., M.J., J.K., and A.Z.-B.; Resou ces, M.J. and P.L.;
Da a Cu a ion, P.L. and M.J.; W i ing–O iginal D a P epa a ion, M.J. and J.-M.V.; W i ing–Re iew and Edi ing,
M.J. and J.-M.V.; Visualiza ion, P.L.; Supe ision, M.J.; P ojec Adminis a ion, M.J.; Funding Acquisi ion, M.J.
Genes 2018,9, 369 23 o 27
Funding:
This wo k was pa ially suppo ed by he Polish Na ional Science Cen e (g an no.
DEC-2012/07/B/NZ1/00099). The ounding sponso s had no ole in he design o he s udy; in he collec ion,
analyses, o in e p e a ion o da a; in he w i ing o he manusc ip , and in he decision o publish he esul s.
Con lic s o In e es : The au ho s decla e no con lic o in e es .
Re e ences
1.
Haag, A.F.; A nold, M.F.F.; Myka, K.K.; Ke sche , B.; Dall’Angelo, S.; Zanda, M.; Me gae , P.; Fe guson, G.P.
Molecula insigh s in o bac e oid de elopmen du ing Rhizobium-legume symbiosis. FEMS Mic obiol. Re .
2013,37, 364–383. [C ossRe ] [PubMed]
2.
Jiménez-Gue e o, I.; Acos a-Ju ado, S.; Del Ce o, P.; Na a o-Gómez, P.; López-Baena, F.J.; Olle o, F.J.;
Vina dell, J.M.; Pé ez-Mon año, F. T ansc ip omic s udies o he e ec o nod gene-inducing molecules in
hizobia: Di e en weapons, one pu pose. Genes 2018,9, 1. [C ossRe ] [PubMed]
3.
Jancza ek, M.; Rachwał, K.; Ma zec, A.; G z ˛adziel, J.; Palusi´nska-Szysz, M. Signal molecules and cell-su ace
componen s in ol ed in ea ly s ages o he legume- hizobium in e ac ions. Appl. Soil Ecol.
2015
,85, 94–113.
[C ossRe ]
4.
Ma czak, M.; Mazu , A.; Kope , P.; ˙
Zeb acki, K.; Sko upska, A. Syn hesis o hizobial exopolysaccha ides
and hei impo ance o symbiosis wi h legume plan s. Genes 2017,8, 360. [C ossRe ] [PubMed]
5.
Jancza ek, M.; Sko upska, A. Modula ion o osR exp ession and exopolysaccha ide p oduc ion in Rhizobium
leguminosa um b . i olii by phospha e and clo e oo exuda es. In . J. Mol. Sci.
2011
,12, 4132–4155.
[C ossRe ] [PubMed]
6.
I ashina, T.V.; Khmelni sky, M.I.; Shlyapniko , M.G.; Kanapin, A.A.; Ksenzenko, V.N. The pss4 gene om
Rhizobium leguminosa um bio a iciae VF39: Cloning, sequence and he possible ole in polysaccha ide
p oduc ion and nodule o ma ion. Gene 1994,50, 111–116. [C ossRe ]
7.
Van Wo kum, W.A.; Can e C eme s, H.C.; Wij jes, A.H.; an de Kolk, C.; Wij elman, C.A.; Kijne, J.W.
Cloning and cha ac e iza ion o ou genes o Rhizobium leguminosa um b . i olii in ol ed in exopolysaccha ide
p oduc ion and nodula ion. Mol. Plan Mic obe In e ac . 1997,10, 290–301. [C ossRe ] [PubMed]
8.
Cheng, H.P.; Walke , G.C. Succinoglycan is equi ed o ini ia ion and elonga ion o he in ec ion h eads
du ing nodula ion o al al a by Rhizobium melilo i.J. Bac e iol. 1998,180, 5183–5191. [PubMed]
9.
Jancza ek, M.; U banik-Sypniewska, T. Exp ession o he Rhizobium leguminosa um b . i olii pssA gene
in ol ed in exopolysaccha ide syn hesis is egula ed by RosR, phospha e and he ca bon sou ce. J. Bac e iol.
2013,195, 3412–3423. [C ossRe ] [PubMed]
10.
Ma ga e -Oli e , I.; Lei, W.; Pa ada, M.; Rod íguez-Ca ajal, M.A.; C espo-Ri as, J.C.; Hidalgo, Á.;
Gil-Se ano, A.; Mo eno, J.; Rod íguez-Na a o, D.N.; Buendía-Cla e ía, A.; e al. Sino hizobium edii HH103
does no s ic ly equi e KPS and/o EPS o nodula e Glycy hiza u alensis, an inde e mina e nodule- o ming
legume. A ch. Mic obiol. 2012,194, 87–102. [C ossRe ] [PubMed]
11.
C espo-Ri as, J.C.; Gue achi, I.; Mok, K.C.; Villaécija-Aguila , J.A.; Acos a-Ju ado, S.; Pie e, O.;
Ruiz-Sainz, J.E.; Taga, M.E.; Me gae , P.; Vina dell, J.M. Sino hizobium edii HH103 bac e oids a e no
e minally di e en ia ed and show al e ed O-an igen in nodules o he IRLC legume Glycy hiza u alensis.
En i on. Mic obiol. 2016,8, 2392–2404. [C ossRe ] [PubMed]
12.
Rod íguez-Na a o, D.N.; Rod íguez-Ca ajal, M.A.; Acos a-Ju ado, S.; So o, M.J.; Ma ga e , I.;
C espo-Ri as, J.C.; Sanjuan, J.; Temp ano, F.; Gil-Se ano, A.; Ruiz-Sainz, J.E.; e al. S uc u e and biological
oles o Sino hizobium edii HH103 exopolysaccha ide. PLoS ONE 2014,18, e115391. [C ossRe ] [PubMed]
13.
Kelly, S.J.; Muszy´nski, A.; Kawaha ada, Y.; Hubbe , A.M.; Sulli an, J.T.; Sandal, N.; Ca lson, R.W.;
S ougaa d, J.; Ronson, C.W. Condi ional equi emen o exopolysaccha ide in he Meso hizobium-Lo us
symbiosis. Mol. Plan Mic obe In e ac . 2013,26, 319–329. [C ossRe ] [PubMed]
14.
Muszy´nski, A.; Heiss, C.; Hjule , C.T.; Sulli an, J.T.; Kelly, S.J.; Thygesen, M.B.; S ougaa d, J.; Azadi, P.;
Ca lson, R.W.; Ronson, C.W. S uc u es o exopolysaccha ides in ol ed in ecep o -media ed pe cep ion o
Meso hizobium lo i by Lo us japonicus.J. Biol. Chem. 2016,291, 20946–20961. [C ossRe ] [PubMed]
15.
Kawaha ada, Y.; Kelly, S.; Nielsen, M.W.; Hjule , C.T.; Gysel, K.; Muszy´nski, A.; Ca lson, R.W.; Thygesen, M.B.;
Sandal, N.; Asmussen, M.H.; e al. Recep o -media ed exopolysaccha ide pe cep ion con ols bac e ial
in ec ion. Na u e 2015,523, 308–312. [C ossRe ] [PubMed]
Genes 2018,9, 369 24 o 27
16.
B oos, K.; Beyens, H.; Smolde s, E. Su i al o hizobia in soil is sensi i e o ele a ed zinc in he absence o
he hos plan . Soil Biol. Biochem. 2005,37, 573–579. [C ossRe ]
17.
Jancza ek, M.; Rachwał, K.; Cie´sla, J.; Ginalska, G.; Bieganowski, A. P oduc ion o exopolysaccha ide by
Rhizobium leguminosa um b . i olii and i s ole in bac e ial a achmen and su ace p ope ies. Plan Soil
2015
,
388, 211–227. [C ossRe ]
18.
Robe sen, B.K.; Aman, P.; Da ill, A.G.; McNeil, M.; Albe sheim, P. Hos -symbion in e ac ions: V.
The s uc u e o acidic ex acellula polysaccha ides sec e ed by Rhizobium leguminosa um and Rhizobium
i olii.Plan Physiol. 1981,67, 389–400. [C ossRe ] [PubMed]
19.
O’Neill, M.A.; Da ill, A.G.; Albe sheim, P. The deg ee o es e i ica ion and poin s o subs i u ion by
O-ace yl and O-(3-hyd oxybu anoyl) g oups in he acidic ex acellula polysaccha ides sec e ed by Rhizobium
leguminosa um bio a s iciae, i olii, and phaseoli a e no ela ed o hos ange. J. Biol. Chem.
1991
,266,
9549–9555. [PubMed]
20.
Philip-Hollingswo , S.; Hollingswo h, R.I.; Dazzo, F.B. Hos - ange ela ed s uc u al ea u es o he acidic
ex acellula polysaccha ides o Rhizobium i olii and Rhizobium leguminosa um.J. Biol. Chem.
1989
,264, 1461–1466.
21.
B eed eld, M.W.; C eme s, H.C.; Ba ley, M.; Pos humus, M.A.; Ze enhuizen, L.P.; Wij elman, C.A.;
Zehnde , A.J. Polysaccha ide syn hesis in ela ion o nodula ion beha io o Rhizobium leguminosa um.
J. Bac e iol. 1993,175, 750–757. [C ossRe ] [PubMed]
22.
B eed eld, M.W.; Ze enhuizen, L.P.; Can e C eme s, H.C.; Zehnde , A.J. In luence o g ow h condi ions on
p oduc ion o capsula and ex acellula polysaccha ides by Rhizobium leguminosa um.An onie Leeuwenhoek
1993,64, 1–8. [C ossRe ] [PubMed]
23.
Pollock, T.J.; an Wo kum, W.A.; Tho ne, L.; Mikolajczak, M.J.; Yamazaki, M.; Kijne, J.W.; A men ou , R.W.
Assignmen o biochemical unc ions o glycosyl ans e ase genes which a e essen ial o biosyn hesis o
exopolysaccha ides in Sphingomonas s ain S88 and Rhizobium leguminosa um.J. Bac e iol.
1998
,180, 586–593.
[PubMed]
24.
I ashina, T.V.; Ksenzenko, V.N. Exopolysaccha ide biosyn hesis in Rhizobium leguminosa um om genes o
unc ions. In The Complex Wo ld o Polysaccha ides; Ka una a ne, D.N., Ed.; InTech: Rijeka, C oa ia, 2012;
pp. 99–127, ISBN 978-953-51-0819-1.
25.
Jancza ek, M.; Rachwał, K.; Kopci´nska, J. Gene ic cha ac e iza ion o he Pss egion and he ole o PssS in
exopolysaccha ide p oduc ion and symbiosis o Rhizobium leguminosa um b . i olii wi h clo e . Plan Soil
2015,396, 257–275. [C ossRe ]
26.
Jancza ek, M.; Rachwał, K.; Tu ska-Szewczuk, A. A mu a ion in pssE a ec s exopolysaccha ide syn hesis by
Rhizobium leguminosa um b . i olii, i s su ace p ope ies, and symbiosis wi h clo e . Plan Soil
2017
,417,
331–347. [C ossRe ]
27.
I ashina, T.V.; Fedo o a, E.E.; Ashina, N.P.; Kalinchuk, N.A.; D uzhinina, T.N.; Shashko , A.S.; Shibae , V.N.;
Ksenzenko, V.N. Mu a ion in he pssM gene encoding ke al py u a e ans e ase leads o dis up ion o Rhizobium
leguminosa um b . iciae-Pisum sa i um symbiosis. J. Appl. Mic obiol. 2010,109, 731–742. [C ossRe ] [PubMed]
28.
Mazu , A.; Ma czak, M.; K ól, J.E.; Sko upska, A. Topological and ansc ip ional analysis o pssL gene
p oduc : A pu a i e Wzx-like exopolysaccha ide anslocase in Rhizobium leguminosa um b . i olii TA1.
A ch. Mic obiol. 2005,184, 1–10. [C ossRe ] [PubMed]
29.
Ma czak, M.; D´zwie zy´nska, M.; Sko upska, A. Homo- and he e o ypic in e ac ions be ween Pss p o eins
in ol ed in he exopolysaccha ide anspo sys em in Rhizobium leguminosa um b . i olii.Biol. Chem.
2013
,
394, 541–559. [C ossRe ] [PubMed]
30.
Ma czak, M.; Ma ysiak, P.; Ku kowska, J.; Sko upska, A. PssP2 is a polysaccha ide co-polyme ase in ol ed
in exopolysaccha ide chain-leng h de e mina ion in Rhizobium leguminosa um.PLoS ONE
2014
,9, e109106.
[C ossRe ] [PubMed]
31.
Islam, S.T.; Lam, J.S. Syn hesis o bac e ial polysaccha ides ia he Wzx/Wzy-dependen pa hway.
Can. J. Mic obiol. 2014,60, 697–716. [C ossRe ] [PubMed]
32.
Schmid, J.; Siebe , V.; Rehm, B. Bac e ial exopolysaccha ides: Biosyn hesis pa hways and enginee ing
s a egies. F on . Mic obiol. 2015,6, 496. [C ossRe ] [PubMed]
33.
G angeasse, C.; Te eux, R.; Nessle , S. Bac e ial y osine-kinases: S uc u e– unc ion analysis and he apeu ic
po en ial. Biochim. Biophys. Ac a 2010,1804, 628–634. [C ossRe ] [PubMed]
Genes 2018,9, 369 25 o 27
34.
Niemeye , D.; Becke , A. The molecula weigh dis ibu ion o succinoglycan p oduced by Sino hizobium
melilo i is in luenced by speci ic y osine phospho yla ion and ATPase ac i i y o he cy oplasmic domain o
he ExoP p o ein. J. Bac e iol. 2001,183, 5163–5170. [C ossRe ] [PubMed]
35.
Tocilj, A.; Munge , C.; P o eau, A.; Mo ona, R.; Pu ins, L.; Ajamian, E.; Wagne , J.; Papadopoulos, M.;
Van Den Bosch, L.; Rubins ein, J.L.; e al. Bac e ial polysaccha ide co-polyme ases sha e a common
amewo k o con ol o polyme leng h. Na . S uc . Mol. Biol. 2008,15, 130–138. [C ossRe ] [PubMed]
36.
Ma czak, M.; Mazu , A.; K ól, J.E.; G uszecki, W.I.; Sko upska, A. Lipop o ein PssN o Rhizobium
leguminosa um b . i olii: Subcellula localiza ion and possible in ol emen in exopolysaccha ide expo .
J. Bac e iol. 2006,188, 6943–6952. [C ossRe ] [PubMed]
37. Whi ield, C. Biosyn hesis and assembly o capsula polysaccha ides in Esche ichia coli.Annu. Re . Biochem.
2006,75, 39–68. [C ossRe ] [PubMed]
38.
Jancza ek, M.; Sko upska, A. The Rhizobium leguminosa um b . i olii RosR: T ansc ip ional egula o in ol ed in
exopolysaccha ide p oduc ion. Mol. Plan Mic obe In e ac . 2007,20, 867–881. [C ossRe ] [PubMed]
39.
Jancza ek, M.; Ja oszuk-´
Sciseł, J.; Sko upska, A. Mul iple copies o osR and pssA genes enhance
exopolysaccha ide p oduc ion, symbio ic compe i i eness and clo e nodula ion in Rhizobium leguminosa um
b . i olii.An onie Leeuwenhoek 2009,96, 471–486. [C ossRe ] [PubMed]
40.
Samb ook, J.; F i sch, E.F.; Mania is, T. Molecula Cloning: A Labo a o y Manual; Cold Sp ing Ha bo
Labo a o y P ess: New Yo k, NY, USA, 1989; pp. 11–26, 94–144, 162–186. ISBN 1936113422.
41.
Simon, R.; Quand , J.; Klipp, W. New de i a i es o ansposon Tn5sui able o mobiliza ion o eplicons,
gene a ion o ope on usions and induc ion o genes in G am-nega i e bac e ia. Gene
1989
,80, 161–169. [C ossRe ]
42.
Wilson, K.J.; Sessi sch, A.; Co bo, J.C.; Gille , K.E.; Akke mans, A.D.; Je e son, R.A. Be a-Glucu onidase
(GUS) ansposons o ecological and gene ic s udies o hizobia and o he g am-nega i e bac e ia.
Mic obiology 1995,141, 1691–1705. [C ossRe ] [PubMed]
43.
Ko ach, M.E.; Elze , P.H.; Hill, D.S.; Robe son, G.T.; Fa is, M.A.; Roop, R.M.; Pe e son, K.M. Fou new
de i a i es o he b oad-hos - ange cloning ec o pBBR1MCS, ca ying di e en an ibio ic- esis ance
casse es. Gene 1995,166, 175–176. [C ossRe ]
44.
Wielbo, J.; Sko upska, A. Cons uc ion o imp o ed ec o s and casse es con aining gusA and an ibio ic
esis ance genes o s udies o ansc ip ional ac i i y and bac e ial localiza ion. J. Mic obiol. Me hods
2001
,
45, 197–205. [C ossRe ]
45.
Kowalczuk, E.; Lo kiewicz, Z. T ans e o RP4 and R68.45 ac o s o Rhizobium.Ac a Mic obiol. Pol.
1979
,28,
221–229. [PubMed]
46. FASTA. A ailable online: h ps://www.ebi.ac.uk/Tools/sss/ as a/ (accessed on 8 May 2018).
47. BLAST. A ailable online: h p://blas .ncbi.nlm.nih.go / (accessed on 8 May 2018).
48.
BDGP Neu al Ne wo k P omo e P edic ion. A ailable online: h p://www. ui ly.o g/ (accessed on
8 May 2018).
49. Malign P og am. A ailable online: h p://www.genebee.msu.su/se ices/malign/ (accessed on 8 May 2018).
50. Fuzznuc P og am. A ailable online: h p://emboss.ch.embne .o g/Pise/ (accessed on 8 May 2018).
51.
MacLellan, S.R.; MacLean, A.M.; Finan, T.M. P omo e p edic ion in he hizobia. Mic obiology
2006
,152,
1751–1763. [C ossRe ] [PubMed]
52.
Mille , J.H. Expe imen s in Molecula Gene ics; Cold Sp ing Ha bo Labo a o y P ess: New Yo k, NY, USA,
1972; ISBN 0879691069.
53.
Vande linde, E.M.; Yos , C.K. Mu a ion o he senso kinase ch G in Rhizobium leguminosa um nega i ely
impac s cellula me abolism, ou e memb ane s abili y, and symbiosis. J. Bac e iol.
2012
,194, 768–777.
[C ossRe ] [PubMed]
54.
Loewus, F.A. Imp o emen in he an h one me hod o de e mina ion o ca bohyd a es. Anal. Chem.
1952
,
24, 219–220. [C ossRe ]
55.
Lesse, A.J.; Campagna i, A.A.; Bi ne , W.E.; Apicella, M.A. Inc eased esolu ion o lipopolysaccha ides and
lipooligosaccha ides u ilizing icine-sodium dodecyl sul a e-polyac ylamide gel elec opho esis. J. Immunol.
Me hods 1990,126, 109–117. [C ossRe ]
56.
Rachwał, K.; Boguszewska, A.; Kopci´nska, J.; Ka a´s, M.; Tchó zewski, M.; Jancza ek, M. The egula o y
p o ein RosR a ec s Rhizobium leguminosa um b . i olii p o ein p o iles, cell su ace p ope ies, and symbiosis
wi h clo e . F on . Mic obiol. 2016,7, 1302. [C ossRe ] [PubMed]