scieee AI-readable full text Open interactive document viewer

Pharmacological effects of mitraphylline from Uncaria tomentosa in primary human monocytes: Skew toward M2 macrophages

Montserrat de la Paz, Sergio; Puerta Vázquez, Rocío de la; Fernández Arche, María de los Ángeles; Quílez Guerrero, Ana María; García Muriana, Francisco José; García Giménez, María Dolores; Bermúdez Pulgarín, Beatriz

Abstract

Ethnopharmacological relevance Uncaria tomentosa (Willdenow ex Roemer & Schultes) DC. (Rubiaceae) is a Peruvian thorny liana, commonly known as "cat's claw", and traditionally used in folk medicine to deal with several inflammatory diseases. Mitraphylline (MTP) is the most abundant pentacyclic oxindolic alkaloid (POA) from U. Tomentosa and has been reported to modify the inflammatory response. Herein, we have sought to identify the mechanisms underlying this modulatory effect of MTP on primary human monocytes and its ability to regulate differentiation processes on human primary monocyte and monocyte-derived macrophages. Material and methods In vitro studies with human primary monocytes and monocyte-derived macrophages were performed. Monocytes and M0 macrophages were exposed to MTP (25 μM) and LPS (100 ng/mL). M0 macrophages were polarized to M1 and M2 phenotypes in the absence or presence of MTP. The activation state of monocytes/macrophages was assessed by flow cytometry, gene expression and protein analysis of different specific markers. Results In human primary monocytes, the incubation of MTP for 24 h reduced the number of classical (CD14++CD16-) and intermediate (CD14++CD16+) subsets when compared to untreated or LPS-treated cells. MTP also reduced the chemotactic capacity of human primary monocytes. In addition, MTP promoted the polarization of M0 macrophages toward an anti-inflammatory M2 phenotype, the abrogation of the release of pro-inflammatory cytokines such as TNFα, IL-6 or IL-1β, as well as the restoration of markers for M2 macrophages in LPS-treated M1 macrophages. Conclusions Our results suggest that MTP may be a key modulator for regulating the plasticity of monocytes/macrophages and the attenuation of the inflammatory response.

Full text

! 1! Pharmacological effects of mitraphylline from Uncaria tomentosa in primary human monocytes: Skew toward M2 macrophages S Montserrat-de la Paz1,2, R de la Puerta1, A Fernandez-Arche1, A M Quilez1, F J G Muriana2, M D Garcia-Gimenez1, B Bermudez1,* 1 Department of Pharmacology. School of Pharmacy. University of Seville, Spain 2 Laboratory of Cellular and Molecular Nutrition. Instituto de la Grasa, CSIC, Seville, Spain *Corresponding autor: Beatriz Bermudez. E-mail address: [email protected] Department of Pharmacology, School of Pharmacy, Seville University C/ Profesor Garcia Gonzalez 2, 41012, Seville, Spain. Tel.: +34 954557443 Original Research Article Running title: Anti-inflammatory effects of Mitraphylline Funding Sources: None Authorship: The authors’ responsibilities were as follows—MS, and BB: participated in the study design and performed the data analysis; MS, PR, FAA, QA, MFJG, GGM and BB: assisted with the editing of the manuscript; MS, PR, FAA, QA, MFJG, GGM and BB: acquired the data; and BB: wrote the first draft and finalized the manuscript. All authors participated in the analytic discussion of the results and approved the final version of the manuscript. Postprint of Journal of Ethnopharmacology Volume 170, 21 July 2015, Pages 128–135 ! 2! Abstract Ethnopharmacological relevance Uncaria tomentosa (Willdenow ex Roemer & Schultes) DC. (Rubiaceae) is a Peruvian thorny liana, commonly known as “cat's claw”, and traditionally used in folk medicine to deal with several inflammatory diseases. Mitraphylline (MTP) is the most abundant pentacyclic oxindolic alkaloid (POA) from U.Tomentosa and has been reported to modify the inflammatory response. Herein, we have sought to identify the mechanisms underlying this modulatory effect of MTP on primary human monocytes and its ability to regulate differentiation processes on human primary monocyte and monocyte-derived macrophages. Material and methods In vitro studies with human primary monocytes and monocyte-derived macrophages were performed. Monocytes and M0 macrophages were exposed to MTP (25 µM) and LPS (100 ng/mL). M0 macrophages were polarized to M1 and M2 phenotypes in the absence or presence of MTP. The activation state of monocytes/macrophages was assessed by flow cytometry, gene expression and protein analysis of different specific markers. Results In human primary monocytes, the incubation of MTP for 24 h reduced the number of classical (CD14++CD16-) and intermediated (CD14++CD16+) subsets when compared to untreated or LPS-treated cells. MTP also reduced the chemotactic capacity of human primary monocytes. In addition, MTP promoted the polarization of M0 macrophages toward an anti-inflammatory M2 phenotype, the abrogation of the release of pro-inflammatory cytokines such as TNFα, IL6 or IL-1β, as well as the restoration of markers for M2 macrophages in LPS-treated M1 macrophages. ! 3! Conclusions Our results suggest that MTP may be a key modulator for regulating the plasticity of monocytes/macrophages and the attenuation of the inflammatory response. Chemical compounds studied in this article Mitraphylline (Pubchem CID: 94160) KEYWORDS Uncaria tomentosa mitraphylline, monocytes, macrophages, polarization and inflammatory diseases. ABBREVIATIONS MTP: mitraphylline, POA: pentacyclic oxindolic alkaloid, U. tomentosa: Uncaria tomentosa, LPS: lipopolysaccharide, TNFα: Tumor Necrosis Factor Alpha, IL: Interleukin, IFNγ: Interferon gamma, CCR2: chemokine (C-C motif) receptor 2, CCL2: Chemokine (C-C motif) ligand 2, MCSF: Macrophage colony-stimulating factor. ! 4! 1. Introduction Uncaria tomentosa (Willdenow ex Roemer and Schultes) DC and its relative Uncaria guanensis (Aublet) Gmell. (Rubiaceae) are plants widely used in folk and complementary medicine under the names of “Cat’s claw”. Uncarias are vines naturally growing in Peru and some other countries of South and Central America, and have there numerous applications in both human and animal medicine. U. tomentosa has been previously reported to deal with several inflammatory diseases (Müller et al., 2011; Rosenbaum et al., 2011), modulating the immune system and antitumor activities (Garcia-Gimenez., et al 2010; Rojas-Duran et al., 2012; Dietrich et al., 2014). Owing to the systematically growing applications of U. tomentosa in therapy, it is important to better recognize its pharmacological properties and safety of using. Cat’s claw contains more than 50 chemical constituents, including oxindole and indole alkaloids, polyphenols, among others (Heitzman et al., 2005). The majority alkaloids of Uncaria are indole and oxindole families (Laus et al., 2004), which are well recognized as phytochemical markers of this species with relevant pharmacological activities (Heitzman et al., 2005). Mitraphylline (MTP) is an oxindole alkaloid and the most ubiquitous alkaloid being present in 20 of 34 Uncaria species (Heitzman et al., 2005). Most of pharmacological studies have been focused on the fractions of either a plant species or a “crude drug”, considered as a preparation from either a single or a mixture of Uncaria plants. However, fewer studies, if any, have paid attention to the bioactivity of isolated compound(s) such as MTP. Our research team have previously reported the isolation of MTP from the dried inner bark of U. tomentosa, the elucidation of its structure by NMR spectroscopy analysis and its antitumor properties on human sarcoma and breast cancer cells (García-Prado et al., 2007). However, little is known on the potential of MTP to mitigate the inflammatory response. Monocytes are particularly involved in inflammatory processes (Shi et al., 2011). They are ! 5! classified into three subsets: classical CD14++CD16–, intermediate CD14++CD16+, and non-classical CD14+CD16++ monocytes (Ziegler-Heitbrock et al., 2010). So far, classical monocytes represent the major fraction, about 85% of total monocytes that highly express the migratory chemokine receptor CCR2 (Ingersoll et al., 2010; Wong et al., 2011). They are professional phagocytes giving rise to classical M1 macrophages, which generate reactive oxygen species and secrete cytokines (TNFα, IL-1β, IL-6) in response to LPS during infection or inflammation (Mossig et al., 2009; Wong et al., 2011; Zwada et al., 2011). Intermediate monocytes display highest levels of CCR5, TLR4, CD163, and HLA-DR during activation and also secrete pro-inflammatory cytokines (Wong et al., 2011; Shantsila et al., 2011). Nonclassical monocytes are less granular and smaller in size, with lower expression of CCR2 than classical or intermediate subsets (Cross et al., 2010; Wong et al., 2011; Shantsila et al., 2011). These monocytes rich in CD16 are functionally involved in tissue repairing, patrolling, wound healing, and have the tendency to be polarized into non-classically M2 macrophages with an anti-inflammatory phenotype in response to a variety of stimuli, including IL-4 (Benoit et al., 2008; Gordon et al., 2010). In the present study, we further investigated whether MTP may act as an immune-modulator and anti-inflammatory effector on human primary monocytes and monocyte-derived macrophages. 2. Material and methods 2.1. Bark extract The plant material was collected in the Peruvian forest and was provided by Dr Carlos S González and was identified in the Botanic Department of the San Lorenzo Chemical Science School from the Asuncion University in Paraguay. The plant extract was obtained and the compound mitraphylline identified as previously described in (Garcia Prado et al., 2007). ! 6! Briefly, 500 g of Uncaria tomentosa dried inner bark were treated with ammonium hydroxide and extracted with 500 ml of dichloromethane for 3 times. After filtration, the obtained solution was concentrated in vacuo to afford a residue, which was dissolved in a hydrochloric acid solution (3%). Ammonium hydroxide and dichloromethane were added again. After concentration in vacuo, the purified alkaloid fraction was obtained as a brown residue and the yield was 0.1%. 2.2. Isolation and identification of Mitraphylline The dried residue of alkaloid fraction (0.5 g) was subjected to a silica gel column chromatography, compacted with silica gel 0.063-0.2 mm (0.8x25 cm), followed by a gradient elution with various mixtures of n-hexane, dichloromethane, and methanol. Twentyfive fractions of about 15 mL each were collected. 200 mg of white crystal (Mitraphylline) were obtained in the fractions 14-16 (eluted with CH2Cl2/MeOH) that corresponded to 87.2% of the total alkaloids. EIMS and 1H and 13C NMR experiments were carried out for its identification using an AVANCE 500 spectrophotometer. The following 2D NMR experiments COSY-DQF, (1H-13C)-HSQC, (1H-13C)-HMBC, and NOESY correlation were used to elucidate its structure. Furthermore, the 15N chemical shift of the isomeric oxindole alkaloids, (1H-15N)-HMBC, was necessary to facilitate its characterization. The solvent used for NMR spectra was CDCl3 (Garcia Prado et al., 2007). 2.3. Blood collection and monocyte isolation This study was conducted according to the guidelines of good clinical practice. Peripheral venous blood was isolated from healthy adult volunteers (< 35 years old) from the Hospital Virgen del Rocio at Seville. The investigation conformed to the principles outlined in the Helsinki Declaration of the World Medical Association. Donors declared that they were non- ! 7! smokers and were not taking any medication. Blood samples were immediately collected into K3EDTA-containing Vacutainer tubes (Becton Dickinson, NJ, USA) and peripheral blood mononuclear cells (PBMCs) were isolated by centrifugation over Ficoll Histopaque gradient (Sigma-Aldrich Chem, MO, USA). Monocytes were then isolated from PBMCs using positive selection with CD14 MicroBeads according to the manufacturer’s instructions (MACS, Myltenyi Biotec, Madrid, Spain). Monocytes were tested for purity by CD14 fluorescein isothiocyanate labelling and fluorescence-activated cell sorter (FACS) analysis using a FACScanto II flow cytometer and FACSDiva software (Becton Dickinson Immunocytometry Systems, CA, USA) (Varela et al., 2011). Following isolation, the cells were suspended in a RPMI 1640 medium supplemented with L-glutamine, penicillin, streptomycin, and 1% heatinactivated FCS. The monocytes were used within 24 h after isolation for the experiments. 2.4. Monocyte differentiation and polarization into M1 and M2 macrophages Monocytes were induced to differentiate for 6 days in the presence of recombinant human MCSF (25 ng/mL) to obtain M0 macrophages. These cells were then cultured in RPMI 1640 supplemented with L-glutamine, penicillin, streptomycin, and 10% heat-inactivated FCS. For M1 and M2 polarization, M0 macrophages were exposed to LPS (100 ng/mL) plus IFNγ (20 ng/mL) and to IL-4 (20 ng/mL), respectively, for additional 24 h. MTP (25 µM) was also added to the medium as indicated. 2.5. Cell viability Monocytes and macrophages seeded in 96-well plates (1x105 cells/well) were incubated in the presence (or absence) of different MTP concentrations for 24 h. At the end of the exposure time, cell viability was analysed by Annexin V binding and using a FACScanto II flow cytometer with a CellQuest software (BD). ! 8! 2.6. Nitrite and cytokine production Cells in 24-well plates were treated (or untreated) with MTP (25 µM), and 30 min later stimulated with LPS (100 ng/mL) for 24 h. The culture supernatants (100 µL) were transferred to a 96-well assay plate mixed with Griess reagent (Sigma-Aldrich Chem) and incubated for 15 min at room temperature. The amount of nitrite, as an index of NO generation (Csonka et al 2014), was determined by the absorbance at 540 nm in an ELISA reader (BioTek, Bad Friedrichshall, Germany). After the extrapolation from a standard curve with sodium nitrite, the results were expressed as the percentage of nitrite compared with that of cells treated with only LPS. Dexamethasone (1 µM, Sigma-Aldrich Chem) was used as positive control. The cytokines levels of IL-1β, IL-6, and TNFα, which were released into cell supernatants, were measured by ELISA, following the indications of the manufacturer (Diaclone). 2.7. Immunostaining analysis by FACS Membrane surface expression of CD16 (PE anti-human CD16, Miltenyi Biotec), CD14 (APC-Cy7 anti-human CD14, Miltenyi Biotec), and CCR2 (APC anti-human CCR2, BD) in monocytes was assessed by FACS. According to the manufacturer's instructions, 5x105 of purified monocytes, after in vitro stimulation with (or without) LPS (100 ng/mL), were incubated with the above antibodies in the dark, at room temperature for 15 min. Thereafter, cells were fixed and erythrocytes were lysed with a volume (20×) of FACS lysing solution (BD). Fluorescence intensity was measured in a FACSCanto II flow cytometer with a CellQuest software (BD). Results were analysed using the Win-List software package (Verity Software House, ME, USA). Mean fluorescence intensity (MFI) of 104 counted cells was measured in each sample. Monocytes were gated as forward scatterhigh (FSChigh)-side ! 9! scatterhigh (SSChigh) cells. Expression levels were presented as MFI corrected for nonspecific binding of isotype control antibodies. 2.8. RNA isolation and qRT-PCR analysis Total RNA was extracted from cells by using Trisure Reagent (Bioline), as instructed by the manufacturer. RNA quality was assessed by A260/A280 ratio in a NanoDrop ND-1000 Spectrophotometer (Thermo Scientific). RNA (1 µg) was subjected to reverse transcription (iScript, Bio-Rad, CA, USA) according to the manufacturers’ protocol. An amount of 20 ng of the resulting cDNA was used as a template for real-time PCR amplifications. The mRNA levels for specific genes were determined in a MX3000P system (Stratagene). For each PCR reaction, cDNA template was added to Brilliant SYBR green QPCR Supermix (Bio-Rad) containing the primer pairs for either gene or for glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and hypoxanthine phosphoribosyltransferase (β-actine) as housekeeping genes (Table 1). All amplification reactions were performed in triplicate and average threshold cycle (Ct) numbers of the triplicates were used to calculate the relative mRNA expression of candidate genes. The magnitude of change of mRNA expression for candidate genes was calculated by using the standard 2-(ΔΔCt) method. All data were normalized to endogenous reference (GAPDH and β-actine) gene content and expressed as percentage of controls. 2.9. Immunoblotting detection Macrophages derived from primary monocytes (1×106 cells/mL) were treated (or untreated) with MTP (25 µM) and LPS (100 ng/mL) for 18 h. After incubation, cells were rinsed, scraped off, and collected in ice-cold PBS containing a cocktail of protease and phosphatase inhibitors and processed to isolate cytoplasmic proteins. Protein concentration was measured for each sample using a protein assay reagent (Bio-Rad) according to the Bradford´s method ! 16! inflammation (Rojas-Duran et al., 2012). The additional effect of MTP to abolish nitric oxide production during macrophage polarization to M1 expands the current knowledge on antioxidant effects of other chemicals from Uncaria such as tannins and condensed tannins (Desmarchelier et al., 1997). Collectively, we showed for the first time that MTP, one of the major alkaloids of U. tomentosa, is able to immuno-modulate the phenotype and function of innate immune cells that are intimately involved in inflammation. Our results indicate unknown qualities of MTP, which are partly responsible for the anti-inflammatory activity of Uncaria´s extracts. These properties arise from its potency to switch pro-inflammatory state through immune system modulation, precisely, by skewing human monocytes to less inflammatory populations. Indeed, Uncaria´s extracts have been already shown to inhibit antiinflammatory responses via nuclear factor-kB (NF-kB), which regulates proinflamatory cytokines secretion (Aguilar et al.,2002). However, anti-inflamtory Uncaria´s activity is not solely due to MTP, certainly, the presence of this major alkaloid provides many of the antiinflammatory properties conferred on U. tomentosa. 5. Conclusion In conclusion, we are the first to show that MTP might confer protection against inflammatory processes by skewing macrophage polarization to M2. This natural compound from U. tomentosa could be considered as a new player for therapy against inflammatory disorders. Nevertheless, further investigation must be conducted to approach this new therapeutic horizon. Acknowledgements This work was supported by the University of Seville, “V Own Research Plan” contract to BB and QA. MS has the benefit of a FPI fellowship (BES-2012-056104) of MICINN. ! 17! Conflicts of interest We declare that we do not have any financial or other relationships that might lead to a conflict of interest. Reference Aguilar, J.L., Rojas, P., Marcelo, A., Plaza, A., Bauer, R., Reininger, E., Klaas, C.A., Merfort, I., 2002. Anti-inflammatory activity of two different extracts of Uncaria tomentosa (Rubiaceae). J. Ethnopharmacol. 81, 271-/276. Allen-Hall, L., Arnason, J.T., Cano, P., Lafrenie, R.M., 2009. Uncaria tomentosa acts as a potent TNF-alpha inhibitor through NF-kappaB. J. Ethnopharmacol. 127(3), 685-693. Benoit, M., Desnues, B., Mege, J.L., 2008. Macrophage polarization in bacterial infections. J Immunol. 181, 3733-3739. Cros. J., Cagnard, N., Woollard, K., Patey, N., Zhang, S.Y., Senechal, B., Puel, A., Biswas, S.K., Moshous, D., Picard, C., Jais, J.P., D'Cruz, D., Casanova, J.L., Trouillet, C., Geissmann, F., 2010. Human CD14dim monocytes patrol and sense nucleic acids and viruses via TLR7 and TLR8 receptors. Immunity. 33, 375-386. Csonka, C., Páli, T., Bencsik, P., Görbe, A., Ferdinandy, P., Csont, T., 2015. Measurement of nitric oxide in biological samples. Br J Pharmacol. Br. J. Pharmacol. 172(6), 1620-1632. Dietrich, F., Kaiser, S., Rockenbach, L., Figueiró, F., Bergamin, L.S., da Cunha, F.M., Morrone, F.B., Ortega, G.G., Battastini, A.M., 2014. Quinovic acid glycosides purified fraction from Uncaria tomentosa induces cell death by apoptosis in the T24 human bladder cancer cell line. Food. Chem. Toxicol. 67, 222-229. ! 18! Domingues, A., Sartori, A., Valente, L.M., Golim, M.A., Siani, A.C., Viero, R.M., 2011. Uncaria tomentosa aqueous-ethanol extract triggers an immunomodulation toward a Th2 cytokine profile. Phytother. Res. 25(8), 1229-1235. Fadini, G.P., Simoni, F., Cappellari, R., Vitturi, N., Galasso, S., Vigili de Kreutzenberg, S., Previato, L., Avogaro, A., 2014. Pro-inflammatory monocyte-macrophage polarization imbalance in human hypercholesterolemia and atherosclerosis. Atherosclerosis. 237(2), 805808. Farias, I.L., Araújo, M.C., Farias, J.G., Rossato, L.V., Elsenbach, L.I., Dalmora, S.L., Flores, N.M., Durigon, M., Cruz, I.B., Morsch, V.M., Schetinger, M.R., 2012. Uncaria tomentosa for Reducing Side Effects Caused by Chemotherapy in CRC Patients: Clinical Trial. Evid. Based. Complement. Alternat. Med. 2012:892182. García-Gimenez, M.D., Garcia-Prado, E., Saenz-Rodríguez, T., Fernandez-Arche, A., De la Puerta, R., 2010. Cytotoxic effect of the pentacyclic oxindole alkaloid mitraphylline isolated from Uncaria tomentosa bark on human Ewing's sarcoma and breast cancer cell lines. Planta. Med. 76(2): 133-136. García-Prado, E., García-Gimenez, M.D., De la Puerta-Vázquez, R., Espartero-Sánchez, J.L., Sáenz-Rodríguez, M.T., 2007. Antiproliferative effects of mitraphylline, a pentacyclic oxindole alkaloid of Uncaria tomentosa on human glioma and neuroblastoma cell lines. Phytomedicine. 14(4), 280-284. Gordon, S., Martinez, F.O., 2010. Alternative activation of macrophages: mechanism and functions. Immunity. 32, 593-604. Gordon, S., Taylor, P.R., 2005. Monocyte and macrophage heterogeneity. Nat. Rev. Immunol. 5, 953–964. ! 19! Grivennikov, S.I., Karin, M., 2011. Inflammatory cytokines in cancer: tumour necrosis factor and interleukin 6 take the stage. Ann. Rheum. Dis. 70 Suppl 1:i104-8. Hansson, G.K., Hermansson, A., 2011. The immune system in atherosclerosis. Nat. Immunol 2: 204–212. Heesen, M., Renckens, R., de Vos, A.F., Kunz, D., van der Poll, T., 2006. Human endotoxemia induces down-regulation of monocyte CC chemokine receptor 2. Clin. Vaccine. Immunol. 13(1), 156–159. Heitzman, M.E., Neto, C.C., Winiarz, E., Vaisberg, A.J., Hammond, G.B., 2005. Ethnobotany, phytochemistry and pharmacology of Uncaria (Rubiaceae). Phytochemistry. 66, 5-29. Hotamisligil, G.S., 2006. Inflammation and metabolic disorders . Nature. 444, 860-867. Ingersoll, M.A., Spanbroek, R., Lottaz, C., Gautier, E.L., Frankenberger, M., Hoffmann, R., 2010. Comparison of gene expression profiles between human and mouse monocyte subsets. Blood. 115(3), e10-9. Izumi, K., Fang, L.Y., Mizokami, A., Namiki, M., Li, L., Lin, W.J. Chang, C., 2013. Targeting the androgen receptor with siRNA promotes prostate cancer metastasis through enhanced macrophage recruitment via CCL2/CCR2-induced STAT3 activation. EMBO. Mol. Med. 5(9), 1383-1401. Keplinger, K., Laus, G., Wurm, M., Dierich, M.P., Teppner, H., 1999. Uncaria tomentosa (Willd.) DC.--ethnomedicinal use and new pharmacological, toxicological and botanical results. Ethnopharmacol. 64(1), 23-34. Laus, G., 2004. Advances in chemistry and bioactivity of the genus Uncaria. Phytother. Res. ! 20! 18(4), 259-274. Mantovani, A., Sica, A., Locati, M., 2005. Macrophage polarization comes of age. Immunity 23, 344–346. Müller, A.C., Kanfer, I., 2011. Potential pharmacokinetic interactions between antiretrovirals and medicinal plants used as complementary and African traditional medicines. Biopharm. Drug. Dispos. 32(8), 458-470. Murray, P.J., Wynn, T.A., 2011. Protective and pathogenic functions of macrophage subsets. Nat. Rev. Immunol. 11(11), 723-737. Rogacev, K.S., Zawada, A.M., Emrich, I., Seiler, S., Böhm, M., Fliser, D., Woollard, K.J., Heine, G.H., 2014. Lower Apo A-I and lower HDL-C levels are associated with higher intermediate CD14++CD16+ monocyte counts that predict cardiovascular events in chronic kidney disease. Arterioscler. Thromb. Vasc. Biol. 34(9), 2120-2127. Rojas-Duran, R., González-Aspajo, G., Ruiz-Martel, C., Bourdy, G., Doroteo-Ortega, V.H., Alban-Castillo, J., Robert, G., Auberger, P., Deharo, E., 2012. Anti-inflammatory activity of Mitraphylline isolated from Uncaria tomentosa bark. J. Ethnopharmacol. 143, 801-804. Rosenbaum, C.C., O'Mathúna, D.P., Chavez, M., Shields, K., 2010. Antioxidants and antiinflammatory dietary supplements for osteoarthritis and rheumatoid arthritis. Altern. Ther. Health. Med. 16(2), 32-40. Shantsila, E., Wrigley, B., Tapp, L., Apostolakis, S., Montoro-Garcia, S., Drayson, M.T., Lip, G.Y., 2011. Immunophenotypic characterization of human monocyte subsets: possible implications for cardiovascular disease pathophysiology. J. Thromb. Haemost. 9(5), 10561066. ! 21! Sheng, Y., Pero, R.W., Wagner. H., 2000. Treatment of chemotherapy-induced leukopenia in a rat model with aqueous extract from Uncaria tomentosa. Phytomedicine. 7(2), 137–143. Shi, C., Eric, G., Pamer, E.G., 2011. Monocyte recruitment during infection and inflammation. Nature Reviews Immunology. 11, 762-774. Valera, L.M., Ortega, A., Bermudez, B., Lopez, S., Pacheco, Y.M., Villar, J., Abia, R., Muriana, F.J., 2011. A high-fat meal promotes lipid-load and apolipoprotein B-48 receptor transcriptional activity in circulating monocytes. Am. J. Clin. Nutr. 93, 918–925. Wong, K.L., Yeap, W.H., Tai, J.J., Ong, S.M., Dang, T.M., Wong, S.C., 2012. The three human monocyte subsets: implications for health and disease. Immunol. Res. 53(1-3), 41-57. Yang, J., Zhang, L., Caijia, Y., Yang, X.F., Wang, H., 2014. Monocyte and macrophage differentiation: circulation inflammatory monocyte as biomarker for inflammatory diseases. Biomarker Research. 2,1. Zawada, A.M., Rogacev, K.S., Rotter, B., Winter, P., Marell, R.R., Fliser, D., Heine GH., 2011. SuperSAGE evidence for CD14++CD16+ monocytes as a third monocyte subset. Blood. 118(12), e50-61. Zawada, A.M., Rogacev, K.S., Schirmer, S.H., Sester, M., Böhm, M., Fliser, D., Heine, G.H., 2012. Monocyte heterogeneity in human cardiovascular disease. Immunobiology. 217(12), 1273-1284. Ziegler-Heitbrock, L., Ancuta, P., Crowe, S., Dalod, M., Grau, V., Hart, D.N., Leenen, P.J., Liu, Y.J., MacPherson, G., Randolph, G.J., Scherberich, J., Schmitz, J., Shortman, K., Sozzani, S., Strobl, H., Zembala, M., Austyn, J.M., Lutz, M.B., 2010. Nomenclature of monocytes and dendritic cells in blood. Blood. 116(16), e74-80. ! 22! Table 1. Sequences of qRT-PCR primers for gene expression analysis. Target GenBank accession number Direction Sequence (5’→3’) CD80 NM_005191.3 Forward Reverse GGGAAAGTGTACGCCCTGTA GCTACTTCTGTGCCCACCAT CD200R NM_138940.2 Forward Reverse GTTGCCCTCCTATCGCATTA TGGAAATTCCCATCAGGTGT MR NM_002438.3 Forward Reverse GGCGGTGACCTCACAAGTAT ACGAAGCCATTTGGTAAACG CD64 NM_000566.3 Forward Reverse GTCCAAATCTCCAAGTGCGG CCCAAGTATGAGAGCAGCGT CD163 NM_203416.3 Forward Reverse TTGCCAGCAGCTTAAATGTG AGGACAGTGTTTGGGACTGG IL-1β NM_000576 Forward Reverse GGGCCTCAAGGAAAAGAATC TTCTGCTTGAGAGGTGCTGA TNFα NM_000594 Forward Reverse TCCTTCAGACACCCTCAACC AGGCCCCAGTTTGAATTCTT IL-6 NM_000600 Forward Reverse TACCCCCAGGAGAAGATTCC TTTTCTGCCAGTGCCTCTTT IL-10 NM_000572 Forward Reverse GCCTAACATGCTTCGAGATC TGATGTCTGGGTCTTGGTTC CCR2 NM_001123396.1 Forward Reverse TGCCTGACTCACACTCAAGG GGCTTCTCAGCAACTGAACC MCP-1 NM_002982.3 Forward CCCCAGTCACCTGCTGTTAT ! 23! Reverse ACGAAGCCATTTGGTAAACG GAPDH NM_001289746 Forward Reverse CACATGGCCTCCAAGGAGTA AG CCAGCAGTGAGGGTCTCTCT β-Actin NM_001101 Forward Reverse CGCAAAGACCTGTATGCCAA CACACAGAGTACTTGCGCTC ! 24! FIGURES LEGENDS Figure 1. (A) Apoptosis and necrosis representative pictures of flow cytometry analysis from human monocytes isolated from PBMCs (primary monocytes) after 24 h incubation with MTP (25 µM) or Staurosporine (1 µM). (B) FACS analysis of monocyte surface markers CD14 and CD16 after 24 h incubation with LPS (1 nM) in the absence or presence of MTP (25 µM). (C) CCR2 quantification and representative pictures of monocyte flow cytometry analysis after 24 h incubation with LPS (1 nM) in the absence or presence of MTP (25 µM). Values marked with different letters are significantly different (P < 0.05). Figure 2. (A) Mean fluorescence intensity (MFI) of CD68 in M0 macrophages obtained from primary monocytes. CD163 (B), CD64 (C), CD80 (D), CD200r (E), and MR (F) mRNA relative expression in M0, M1, and M2 macrophages. (G) Production of NO2in M0 and M1 macrophages. MTP (25 µM) was added to the medium for 24 h as indicated. Values marked with different letters are significantly different (P < 0.05). Figure 3. (A) CCR2, (B) CCL2 mRNA relative expression, and (C) migration index in M0, M1, and M2 macrophages. MTP (25 µM) and CCL2 (10 nM) were added to the medium for 24 h as indicated. Values marked with different letters are significantly different (P < 0.01). Figure 4. (A) TNFα, (B) IL-1β, (C) IL-6 mRNA relative expression; (D) TNFα, (E) IL-1β densitometry analysis of immunoblotting detection; (F) TNFα, (G) IL-1β, and (H) IL-6 levels in the medium of M0 macrophages after 24 h incubation with LPS (1 nM) in the absence or presence of MTP (25 µM). Values marked with different letters are significantly different (P < 0.05). ! 25! FIGURE 1 A B 0 50 100 150 200 b f c e d Control f f a g LPS/MTP LPS CD14++ CD16CD14++ CD16+ CD14+ CD16++ MFI 0 40 80 Control LPS/MTP LPS CD14++ CD16a b c CCR2 MFI C Control MTP Staurosporine CD16 CD14 Control MTP/LPS LPS CCR2 Control MTP/LPS LPS