scieee AI-readable full text Open interactive document viewer

Metformin-mediated increase in DICER1 regulates microRNA expression and cellular senescence

Noren Hooten, Nicole; Martín Montalvo, Alejandro; Dluzen, Douglas F.; Zhang, Yongqing; Bernier, Michel; Zonderman, Alan B.; Becker, Kevin G.; Gorospe, Myriam; Cabo, Rafael de

Abstract

Metformin, an oral hypoglycemic agent, has been used for decades to treat type 2 diabetes mellitus. Recent studies indicate that mice treated with metformin live longer and have fewer manifestations of age-related chronic disease. However, the molecular mechanisms underlying this phenotype are unknown. Here, we show that metformin treatment increases the levels of the microRNA-processing protein DICER1 in mice and in humans with diabetes mellitus. Our results indicate that metformin upregulates DICER1 through a post-transcriptional mechanism involving the RNA-binding protein AUF1. Treatment with metformin altered the subcellular localization of AUF1, disrupting its interaction with DICER1 mRNA and rendering DICER1 mRNA stable, allowing DICER1 to accumulate. Consistent with the role of DICER1 in the biogenesis of microRNAs, we found differential patterns of microRNA expression in mice treated with metformin or caloric restriction, two proven life-extending interventions. Interestingly, several microRNAs previously associated with senescence and aging, including miR-20a, miR-34a, miR-130a, miR-106b, miR-125, and let-7c, were found elevated. In agreement with these findings, treatment with metformin decreased cellular senescence in several senescence models in a DICER1- dependent manner. Metformin lowered p16 and p21 protein levels and the abundance of inflammatory cytokines and oncogenes that are hallmarks of the senescence-associated secretory phenotype (SASP). These data lead us to hypothesize that changes in DICER1 levels may be important for organismal aging and to propose that interventions that upregulate DICER1 expression (e.g., metformin) may offer new pharmacotherapeutic approaches for age-related disease.

Full text

Metformin-mediated increase in DICER1 regulates microRNA expression and cellular senescence Nicole Noren Hooten, 1 Alejandro Martin-Montalvo, 2,3 Douglas F. Dluzen, 1 Yongqing Zhang, 4 Michel Bernier, 2 Alan B. Zonderman, 1 Kevin G. Becker, 4 Myriam Gorospe, 4 Rafael de Cabo 2 and Michele K. Evans 1 1 Laboratory of Epidemiology and Population Sciences, 2 Translational Gerontology Branch, 3 Pancreatic Islet Development and Regeneration Unit, Department of Stem Cells, CABIMER-Andalusian Center for Molecular Biology and Regenerative Medicine, Avenida Americo Vespucio, Parque Cient ıfico y Tecnologico Cartuja 93, 41092 Sevilla, Spain 4 Laboratory of Genetics, National Institute on Aging, National Institutes of Health, 251 Bayview Boulevard, Baltimore, MD 21224, USA Summary Metformin, an oral hypoglycemic agent, has been used for decades to treat type 2 diabetes mellitus. Recent studies indicate that mice treated with metformin live longer and have fewer manifestations of age-related chronic disease. However, the molecular mechanisms underlying this phenotype are unknown. Here, we show that metformin treatment increases the levels of the microRNA-processing protein DICER1 in mice and in humans with diabetes mellitus. Our results indicate that metformin upregulates DICER1 through a post-transcriptional mechanism involving the RNA-binding protein AUF1. Treatment with metformin altered the subcellular localization of AUF1, disrupting its interaction with DICER1 mRNA and rendering DICER1 mRNA stable, allowing DICER1 to accumulate. Consistent with the role of DICER1 in the biogenesis of microRNAs, we found differential patterns of microRNA expression in mice treated with metformin or caloric restriction, two proven life-extending interventions. Interestingly, several microRNAs previously associated with senescence and aging, including miR-20a, miR-34a, miR-130a, miR-106b, miR-125, and let-7c, were found elevated. In agreement with these findings, treatment with metformin decreased cellular senescence in several senescence models in a DICER1dependent manner. Metformin lowered p16 and p21 protein levels and the abundance of inflammatory cytokines and oncogenes that are hallmarks of the senescence-associated secretory phenotype (SASP). These data lead us to hypothesize that changes in DICER1 levels may be important for organismal aging and to propose that interventions that upregulate DICER1 expression (e.g., metformin) may offer new pharmacotherapeutic approaches for age-related disease. Key words: aging; AUF1; caloric restriction; diabetes mellitus; microRNA; RNA-binding proteins. Introduction Metformin has been used to treat type 2 diabetes mellitus since the 1950s. Metformin enhances insulin sensitivity and lowers blood glucose levels by inhibiting gluconeogenesis in the liver. Metformin elicits these effects by inhibiting the mitochondrial respiratory-chain complex I and glycerophosphate dehydrogenase (mGPD) and also by activating adenosine monophosphate-activated protein kinase (AMPK) (Foretz et al., 2014; Madiraju et al., 2014). Activation of AMPK, in turn, leads to a plethora of signaling cascades that regulate energy homeostasis and metabolism (Hardie et al., 2012). However, AMPK-independent pathways activated by metformin have also been described (Pollak, 2012; Foretz et al., 2014) and recent data also suggest that systemic effects of metformin may have different mechanisms of action in different tissues (Duca et al., 2015). Gaps in our knowledge about the mechanisms that underlie its therapeutic effects persist. Numerous epidemiologic studies show that in addition to its role in modulating metabolic pathways, metformin also influences factors associated with cancer incidence and cancer mortality among diabetics treated with the drug (Pollak, 2012). These retrospective epidemiologic studies have led to intensive focus on the potential use of metformin as an anticancer therapeutic agent. Although many studies have focused on uncovering how metformin elicits anticancer effects, the exact mechanism of tumor inhibition remains unknown (Foretz et al., 2014). Studies using cancer cells in culture and murine tumor xenografts have found that metformin inhibits tumorigenesis by upregulating DICER1 (Blandino et al., 2012), a key enzyme that processes microRNAs (miRNAs). Therefore, it is possible that upregulation of DICER1 may in part mediate metformin’s antitumorigenic effects. In general with few exceptions, cancer cells have decreased global miRNA expression (Lu et al., 2005; Kumar et al., 2007), leading to the hypothesis that upregulation of DICER1 may lead to increased miRNA expression, which would then contribute to lowering tumorigenic activity. Consistent with this idea, DICER1 expression is decreased in several types of human cancers (Bahubeshi et al., 2011; Foulkes et al., 2014). Conditional loss of mouse Dicer1 in skin or adipocytes induces DNA damage and activates a p19 Arf -p53 signaling pathway leading to increased cellular senescence (Mudhasani et al., 2008; Mori et al., 2012), indicating that modulation of DICER1 levels may influence agingrelated pathways. Additionally, dicer loss-of-function mutations in Caenorhabditis elegans reduce lifespan and homeostatic stress responses (Mori et al., 2012). We reported that miRNA levels decrease with advancing age in human peripheral blood mononuclear cells (PBMCs) and primate skeletal muscle, while others have found decreased levels of miRNAs with age in mouse brain and in C. elegans (Noren Hooten et al., 2010, 2013; Smith-Vikos & Slack, 2012; Mercken et al., 2013). Given the conservation of miRNAs across species, and that a single miRNA can regulate C. elegans lifespan and predict the mortality of individual C. elegans (Smith-Vikos & Slack, 2012), it is likely that miRNAs play an important role in regulating lifespan in humans and other species. The fact that modulating DICER1 and miRNAs may be important for regulating lower organismal aging and our recent findings that metformin significantly increases the longevity of mice (Martin-Montalvo et al., 2013) led us to examine mechanisms by which DICER1 expression Correspondence Michele K. Evans, MD, National Institute on Aging, National Institutes of Health, Baltimore, MD 21224, USA. Tel.: +1 410 558 8573; fax: +1 410 558 8268; e-mail: [email protected] Accepted for publication 21 February 2016 572Published 2016. This article is a U.S. Government work and is in the public domain in the USA. Aging Cell published by Anatomical Society and John Wiley & Sons Ltd. This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited. Aging Cell (2016) 15, pp572–581 Doi: 10.1111/acel.12469 Aging Cell is altered by metformin and the possible role of DICER1 in aging. As gene expression is affected post-transcriptionally by noncoding RNAs and RNA-binding proteins (RBPs), we hypothesized that post-transcriptional mechanisms may play a role in modulating levels of DICER1 in response to metformin. Previous evidence indicated that the RBP AU-rich elementbinding factor 1 (AUF1), also known as hnRNPD (heterogeneous nuclear ribonucleoprotein D), lowers the stability of DICER1 mRNA through binding to multiple regions in the coding region and 30-untranslated region (UTR) of DICER1 mRNA (Abdelmohsen et al., 2012). AUF1 comprises 4 isoforms (p37, p40, p42, and p45) all of which contain two RNA-recognition motifs (RRMs) (White et al., 2013; Yoon et al., 2014). In general, cytoplasmic AUF1 promotes the decay of target mRNAs (White et al., 2013). However, new data using the PAR-CLIP (photoactivatable ribonucleoside-enhanced cross-linking and immunoprecipitation) method indicate that AUF1 also affects mRNA translation and enhances the stability of a subset of transcripts (Yoon et al., 2014). Through these activities, AUF1 regulates cellular processes such as senescence, proliferation, and stress and immune responses that impact upon aging and age-related diseases. Here, we explored the role of DICER1 in mice chronically treated with metformin or dietary caloric restriction, two interventions that extend mouse lifespan. We found higher levels of DICER1 in mice treated with metformin or caloric restriction as well as in humans with diabetes mellitus on metformin. In contrast, DICER1 mRNA levels decreased with age in untreated human subjects. We present evidence that metformin treatment prevents the interaction of the decay-promoting RBP AUF1 with DICER1 mRNA, resulting in increased expression of DICER1. Given that metformin inhibits cellular senescence only in the presence of DICER1, our results highlight a possible mechanism that may explain in part the anti-aging effects of metformin and identify relevant pathways and targets for further investigation. Results Age and metformin treatment alter DICER1 levels We hypothesized that changes in DICER1 levels may contribute to the age-associated decline in miRNAs (Noren Hooten et al., 2010). Therefore, we examined DICER1 mRNA levels by reverse transcription (RT) followed by real-time quantitative (q)PCR analysis from PBMCs from young (~30 year old) and older (~64 year old) individuals and found a significant decrease in DICER1 mRNA levels with human age (Fig. 1A; Table 1A). In contrast, the levels of DROSHA mRNA, encoding another key protein in miRNA biosynthesis, were not significantly different with human age (Fig. 1A). Therefore, we focused on investigating whether changes in DICER1 levels may explain alterations in miRNA expression with age. Previously, metformin was found to increase the healthspan and longevity of mice (Martin-Montalvo et al., 2013). Given that metformin elevates DICER1 in cultured cancer cells (Blandino et al., 2012), we wanted to examine whether changes in DICER1 expression occur in mice chronically treated with metformin and to compare these findings with those of mice on dietary caloric restriction, an intervention that extends lifespan in mice. In response to metformin and dietary caloric restriction, there is an upregulation in Dicer1 mRNA levels in the livers of treated mice compared with control mice on standard diet (Fig. 1B), and livers of metformin-treated mice had higher DICER1 protein levels than control mice (Fig. 1C). Given that DICER1 mRNA levels decreased in human PBMCs from older individuals compared with younger individuals (Fig. 1A, first panel) and that DICER1 levels increased by metformin treatment in mice, we investigated whether individuals being treated for diabetes with metformin also had higher levels of DICER1. Individuals in the Healthy Aging in Neighborhoods of Diversity across the Lifespan (HANDLS) study Fig. 1 DICER1 levels are altered by human age and by metformin treatment in mice and humans. (A) DICER1 and DROSHA mRNA levels were quantified from PBMCs from young (~30 years) and old (~64 years) individuals (n=14/group) from the HANDLS study using RT–qPCR. (B) DICER1 mRNA and DICER protein (C) levels were quantified by RT–qPCR and immunoblotting, respectively, from livers of mice on standard diet (SD), metformin-treated (Met), or on calorie restriction (CR). For protein levels in C, a representative immunoblot is shown and Dicer levels from 8 mice per group were quantified from immunoblots and normalized to actin. (D) DICER1 mRNA levels were quantified from PBMCs of nondiabetics, diabetics taking sulfonylureas, and diabetics taking metformin (n=20/group). Demographic information for cohorts in (A) and (D) is in Table 1. The histograms represent the mean +SEM. *P<0.05, **P≤0.01. Table 1 Demographic information for human cohorts used in Fig. 1 A. Age cohort Young Old N14 14 Age (mean (SD)) 30.1 (0.3) 64.2 (0.4) Sex =Men (%) 6 (42.8) 6 (42.8) Race =AA (%) 6 (42.8) 6 (42.8) PovStat =Below (%) 6 (42.8) 5 (35.7) BMIcut =Obese (%) 6 (42.8) 4 (28.6) B. Diabetics cohort Nondiabetics Diabetics taking Sulfonylureas Diabetics taking Metformin n20 20 20 Age (mean (SD)) 49.45 (10.30) 52.15 (8.65) 50.50 (8.13) Sex =Men (%) 7 (35.0) 7 (35.0) 7 (35.0) Race =AA (%) 13 (65.0) 13 (65.0) 13 (65.0) PovStat =Below (%) 7 (35.0) 9 (45.0) 6 (30.0) BMIcut =Obese (%) 19 (95.0) 19 (95.0) 19 (95.0) AA, African American; BMIcut, below or above obesity cut-off of ≥30 kg m 2 ; PovStat, Poverty status, above or below the 125% Poverty line as defined by the Department of Health and Human Services in 2003. Metformin modulates DICER and senescence, N. Noren Hooten et al. 573 Published 2016. This article is a U.S. Government work and is in the public domain in the USA. Aging Cell published by Anatomical Society and John Wiley & Sons Ltd. (Evans et al., 2010) were chosen based on the following criteria. The participants were either euglycemic normal controls (i), diabetics treated with sulfonylurea (ii), or diabetics treated with metformin (iii) (Table 1B). The sulfonylurea group was added in the study because diabetic individuals treated with metformin have increased survival compared with nondiabetics and with diabetics on sulfonylurea (Bannister et al., 2014). All groups were matched based on age, sex, race and body mass index (BMI) (n=20 per group; Table 1B). After isolation of RNA from participant PBMCs and RT–qPCR analysis, diabetics treated with metformin were found to have significantly higher levels of DICER1 mRNA compared with nondiabetics; diabetics taking sulfonylureas also had higher levels of DICER1 mRNA, but this difference was not significant (Fig. 1D). Metformin regulates the RBP AUF1 localization and binding to DICER1 mRNA Given that chronic metformin treatment in mice increased DICER1 levels, we hypothesized that metformin may alter post-transcriptional processes that would affect the stability and/or turnover of Dicer1 mRNA. In response to changes in the environment, RNA-binding proteins (RBP) regulate gene expression by affecting the turnover and/or translation of bound mRNAs (Moore, 2005). Previous studies showed that the RBP AUF1 binds DICER1 mRNA and negatively regulates DICER1 protein levels by lowering the stability of DICER1 mRNA (Abdelmohsen et al., 2012). Therefore, we hypothesized that metformin may enhance DICER1 expression by altering the binding of AUF1 to DICER1 mRNA. To test this possibility, we performed a ribonucleoprotein immunoprecipitation (RIP) assay to examine the effect of metformin on the AUF1-DICER1 mRNA complex. While AUF1 was found to bind DICER1 mRNA under basal conditions, metformin treatment dramatically reduced this interaction (Fig. 2A). As AUF1 binding degrades DICER1 mRNA, these data suggest that by triggering the dissociation of AUF1-DICER1 mRNA complexes, metformin treatment may stabilize DICER1 mRNA. To further test this possibility, small interfering RNAs were used to downregulate AUF1 levels in cells. Lowering AUF1 increased DICER1 mRNA and protein levels (Fig. 2B–D). DICER1 mRNA levels further increased by metformin treatment, which may reflect an effect on DICER1 at the transcriptional level (Fig. 2B). Conversely, AUF1 overexpression decreased DICER1 protein levels (Fig. 2E). These findings suggest that metformin treatment enhances DICER1 expression at least in part by dissociating AUF1 from DICER1 mRNA. The abundance of AUF1 was not altered by metformin treatment of mice or cells in tissue culture (Fig. S1A,B); however, metformin affected AUF1 subcellular localization. Although AUF1 was found in both the cytoplasm and nucleus under basal conditions, by 1 h after addition of metformin, AUF1 had redistributed to a predominantly nuclear localization (Fig. 3A,B). This redistribution to the nucleus in response to metformin was confirmed by fractionating cells into the nuclear and cytoplasmic compartments in both HeLa and WI-38 cells (Figs 3C, S1D). Given that AMPK is activated in response to metformin, we tested whether AMPK activation is important for the effects of metformin on AUF1 subcellular localization. Treatment with the AMPK inhibitor Compound C blocked AUF1 redistribution to the nucleus in response to metformin (Figs 3A, S1D), suggesting that the effects of metformin on AUF1 localization are influenced by AMPK. Furthermore, lowering AMPK levels using siRNA inhibited AUF1 redistribution from the cytoplasm to the nucleus in response to metformin (Fig. 3D). This translocation of AUF1 from the cytoplasm to the nucleus was associated with the release of AUF1-DICER1 mRNA complex, facilitating DICER1 mRNA stabilization and translation. Fig. 2 Metformin stabilizes DICER1 expression through modulating the binding of the RNA-binding protein AUF1. (A) Serum-starved HepG2 cells were treated with 500 lM metformin or PBS for 1 h and ribonucleoprotein (RNP) immunoprecipitation (RIP) assays followed by RT–qPCR analysis was used to measure the enrichment of DICER1 mRNA in AUF1 immunoprecipitates. Each IP was compared to control IgG IP and normalized to GAPDH mRNA levels. (B) HeLa cells were transfected with either AUF1 or Control (Con) siRNA and 24 h later, cells were treated with metformin for 24 h. The levels of HNRNPD mRNA (which encodes AUF1) and DICER1 mRNA were measured by RT–qPCR analysis and normalized to GAPDH mRNA levels. (C–E) Cells were transfected with either AUF1 siRNA-1 (Qiagen), AUF1 siRNA-2 (Santa Cruz) or the indicated FLAG-tagged plasmids were treated as in (B), and lysates were analyzed by immunoblotting to assess protein levels of DICER1, AUF1 and actin using specific antibodies. Histograms represent the mean +SEM from three independent experiments. ***P<0.001 or *P<0.05 by Student’s t-test. Metformin modulates DICER and senescence, N. Noren Hooten et al. 574 Published 2016. This article is a U.S. Government work and is in the public domain in the USA. Aging Cell published by Anatomical Society and John Wiley & Sons Ltd. The stoichiometry of the various AUF1 isoforms differed in their subcellular localization in response to metformin. Specifically, the localization of p45 was most affected by metformin, although p42/ p40 isoforms (typically found together as a single band) were moderately affected as well. PAR-CLIP data showed that the p40, p42, and p45 isoforms bind to DICER1 mRNA; p45 in particular bound to multiple regions within DICER1 mRNA (Table S1). Given this evidence, we tested whether metformin affected AUF1 isoform binding to DICER1 mRNA. Each FLAG-tagged AUF1 isoform was individually transfected into cells, and RIP assays were performed in control and metformin-treated cells. As shown (Fig. 3E), metformin treatment did not affect p37 or p40 binding to DICER1 mRNA, but it dramatically decreased DICER1 mRNA bound to the p42 and p45 isoforms, supporting the notion that AUF1 translocation to the nucleus is associated with the dissociation of DICER1 mRNA from AUF1. We next investigated whether AUF1 is phosphorylated in response to metformin. Metformin treatment increased AUF1 phosphorylation as detected using antibodies that recognize the phosphorylated AMPK substrate motif and with phospho-serine/threonine antibodies (Fig. 3F). Interestingly, several other proteins were prominent in AUF1 Fig. 3 Metformin induces AUF1 nuclear retention. (A) Serum-starved HeLa cells were treated with 500 lMmetformin for 1 h. Cells were fixed and stained with an AUF1 antibody and DAPI. (B) AUF1 staining in the nucleus and cytoplasm was quantified and normalized to DAPI-stained nuclei. (C) HeLa cells were pretreated with Compound C for 1 h or vehicle and were then subsequently treated with 500 lMmetformin for 1 h. Cells were fractionated into cytoplasmic and nuclear fractions and analyzed by immunoblotting with anti-AUF1, anti-HSP70, anti-Lamin B1 (nuclear marker), and anti-GAPDH antibodies (cytoplasmic marker). (D) HeLa cells were transfected with AMPK siRNA or control and treated with metformin as described above. (E) HeLa cells transfected with individual isoforms of AUF1 were treated with or without metformin, and RIP assays were performed to measure the enrichment of DICER1 mRNA in FLAG immunoprecipitates. Each IP was compared to control FLAG IP, normalized to GAPDH mRNA levels, and then normalized to mock-treated cells. (F) AUF1 immunoprecipitates from HeLa cells treated with 500 lMmetformin for the indicated time points were probed with anti-phospho-AMPK substrate, anti-phospho-serine/threonine, anti-HSP70, and anti-AUF1 antibodies. Black arrows indicate AUF1 phosphorylation, and red arrow indicates HSP70 phosphorylation. Histograms in B and E represent the mean +SEM from three independent experiments. *P<0.05, **P<0.01, ***P<0.001 by Student’s t-test. Metformin modulates DICER and senescence, N. Noren Hooten et al. 575 Published 2016. This article is a U.S. Government work and is in the public domain in the USA. Aging Cell published by Anatomical Society and John Wiley & Sons Ltd. immunoprecipitates, among them a ~70-kDa band. It was previously reported that AUF1 binds to HSP70 and that HSP70 shuttles AUF1 to the nucleus in response to heat shock (Laroia et al., 1999). Western blot analysis of HSP70 in the AUF1 immunoprecipitated material revealed that the AUF1-HSP70 interaction was enhanced in the presence of metformin (Fig. 3F). Finally, HSP70 increased in the nucleus after metformin treatment (Fig. 3C). These data suggest that AUF1 translocation to the nucleus may be modulated by HSP70 binding in response to metformin. Metformin inhibits cellular senescence through DICER1 As the functional role of DICER1 in cells is to process miRNAs from precursors to mature miRNAs, it is likely that changes in DICER1 expression would ultimately alter miRNA expression. To test this idea, we analyzed global miRNA profiles using microarrays. Many miRNAs were significantly altered after metformin treatment or calorie restriction (Fig. 4A; Table S2). Consistent with the higher DICER1 levels in the liver of metformin-treated mice, many miRNAs were found to be upregulated by metformin (Figs 4A,B, S2). To assess whether the increases in mature miRNAs were due to elevated transcription, we quantified the primary miRNA (pri-miRNA, the initial unprocessed transcript of miRNAs) transcripts of two miRNAs observed to be differentially expressed in the presence of metformin, miR-130a-3p and miR-92a-3p (Fig. 4B,C). As shown, neither pri-miR-130a nor pri-miR-92a levels were significantly increased by metformin or CR (Fig. 4C). These data suggest that the increase in mature miRNAs in mice treated with metformin was not primarily a result of increased transcriptional activity. Several of the miRNAs upregulated by metformin (miR-20a, miR-30, miR-34a, miR-106b, miR-130a/b, let-7, miR-125) are important for regulating cellular senescence or organismal aging (Fig. 4B). Furthermore, many of the targets of these miRNAs are important for regulating senescence (Table S3), and some have opposite expression patterns in response to metformin compared with senescence, suggesting that metformin may affect lifespan by inhibiting cellular senescence. To investigate this possibility, we examined whether metformin affects cellular senescence in culture using several different senescence models: WI-38 human fetal lung diploid fibroblasts, IMR-90 human skin fibroblasts, and IDH4 fibroblasts. We chose doses of metformin that were comparable to circulating drug levels of mice treated with 0.1% metformin (~0.45 mM; 74.3 mg L 1 ) and the therapeutic range in humans (1.64 0.13 mg L 1 to 6.57 0.61 mg L 1 ) (Sum et al., 1992). Metformin inhibited replicative senescence in WI-38 and IMR-90 cells (Fig. 5A,B,F). In IDH4 cells, senescence is induced by removal of dexamethasone (dex) (Wright et al., 1989). Dex was removed, and cells were cultured in the presence of metformin for 7 days; metformin treatment reduced the number of SA-b-gal-positive IDH4 cells (Fig. 5C). Additionally, we induced senescence by exposing WI-38 and IMR-90 cells to ionizing radiation (IR). Treatment of cells with metformin delayed IRinduced senescence, as assessed initially by SA-b-gal-positive cells A B C Fig. 4 miRNA expression changes in mice treated with metformin or caloric restriction. (A) miRNAs were isolated from livers of mice on standard diet (SD), metformin (Met; 0.1%), or on caloric restriction (CR). Using total liver RNA, miRNA microarray analysis was performed. Heat map indicating miRNAs significantly changed in any of the indicated comparisons (z ratio). (B) RNA was isolated from livers from mice on standard diet (SD), treated with metformin (Met), or on caloric restriction (CR). Mature miRNA (B) or pri-miRNA levels (C) were quantified by RT– qPCR analysis. The histograms represent the mean +SEM for SD (n=5), Met (n=5), and CR (n=6). *P<0.05 and **P<0.01 compared with SD by Student’s t-test. Metformin modulates DICER and senescence, N. Noren Hooten et al. 576 Published 2016. This article is a U.S. Government work and is in the public domain in the USA. Aging Cell published by Anatomical Society and John Wiley & Sons Ltd. (Fig. 5D) and subsequently confirmed by examination of two well-established protein markers of senescence, p16 and p21. All of these markers of senescence were decreased by metformin treatment (Fig. 5F). A further hallmark trait of senescent cells is the secretion of inflammatory cytokines, chemokines, and oncogenes (the senescenceassociated secretory phenotype or SASP) (Coppe et al., 2008). We quantified the levels of several mRNAs encoding SASP factors in WI-38 cells, in IDH4 cells grown without dex, and WI-38 and IMR-90 cells exposed to IR. The levels of IL6, IL8, CXCL1 (which encodes GRO-a), and CXCL2 (which encodes GRO-b) mRNAs decreased by metformin treatment (Fig. 6). Fig. 5 Inhibition of cellular senescence by metformin requires DICER1. Presenescent WI-38 or IMR-90 cells were transfected with either the indicated siRNAs or transfected with pDEST-DICER1 and then either treated with PBS or with 500 lM metformin (Met) for 48 h and stained for SA-b-gal activity (A,B,D). (C) IDH4 cells cultured without dex were incubated with metformin. (D) WI-38 and IMR-90 cells exposed to ionizing radiation (IR) were treated with metformin. SA-b-gal-positive cells were counted and normalized to the total number of cells. Representative phasecontrast images from WI-38 cells from (B) are shown, and the histograms represent the mean +SEM from 3 independent experiments. *P<0.05, **P<0.01 and **P<0.01 by Student’s t-test. (F) Lysates from the indicated cell lines and treatments were analyzed for protein levels of senescence markers and actin for a protein loading control. Metformin modulates DICER and senescence, N. Noren Hooten et al. 577 Published 2016. This article is a U.S. Government work and is in the public domain in the USA. Aging Cell published by Anatomical Society and John Wiley & Sons Ltd. We next addressed whether the effects of metformin on senescence were dependent on DICER1. SiRNA-mediated downregulation of DICER1 levels increased cellular senescence and blocked the ability of metformin to lower the number of SA-b-gal-positive cells in both WI-38 and IMR-90 cells (Fig. 5A,B). Conversely, overexpression of DICER1 decreased cellular senescence (Fig. 5E). To determine whether AMPK is required for the senescence-inducing effects of metformin, we silenced AMPK levels. This intervention blocked the metformin-mediated decrease in SA-b-galpositive cells, and this effect was reversed with DICER1 overexpression. Collectively, these data indicate that metformin may reduce cellular senescence by promoting DICER1 expression and that AMPK is important for these effects. Discussion Previously, we reported that chronic metformin treatment increases both healthspan and lifespan in mice (Martin-Montalvo et al., 2013). Here, we have found that DICER1 levels are upregulated by metformin treatment in both mice and humans in part through a post-transcriptional mechanism involving the RBP AUF1. Upregulation of DICER1 by metformin leads to higher levels of a subset of miRNAs important for regulating senescence and aging-associated pathways. Furthermore, metformin treatment inhibits cellular senescence through a DICER1dependent mechanism. Our data suggest that DICER1 levels may contribute to aging. Consistent results have been observed in a limited number of studies that have examined the role of DICER1 in aging. A study in primary rat cerebromicrovascular endothelial cells (CMVECs) found a decrease in DICER1 levels with age, with concomitant reduction in miRNA expression (Ungvari et al., 2013). Furthermore, aged mouse adipocytes also have lower DICER1 levels (Mori et al., 2012). Here, we found that DICER1 mRNA levels decreased with age in human PBMCs, which may provide a mechanism for lower miRNA levels we previously observed in this cell population in the same cohort of individuals (Noren Hooten et al., 2010). Compelling evidence suggests that alterations in DICER1 levels or activity may be important for other age-associated diseases, especially cancer. In general, DICER1 levels are decreased in different types of human tumors and germline mutations in DICER1 are associated with a rare type of childhood cancer called pleuropulmonary blastoma (PPB) (Bahubeshi et al., 2011; Foulkes et al., 2014). Point mutations in DICER1 have also been described leading to tumor predisposition and referred to as DICER1 syndrome (Bahubeshi et al., 2011; Foulkes et al., 2014). However, the role of DICER1 in cancer is complicated as mouse cancer models suggest that loss of one copy of the Dicer1 gene increases tumorigenesis, whereas loss of both copies inhibits it, leading to the idea that DICER1 functions as a haploinsufficient tumor suppressor (Bahubeshi et al., 2011; Foulkes et al., 2014). These pieces of evidence may reflect the importance of DICER1 on cell survival and/or indicate that a subset of miRNAs is important for cancer progression. Nevertheless, these studies point to the importance of DICER1 and the need to fully understand the consequences of altering DICER1 levels and/or activity. We found increased levels of miRNAs in livers of metformin-treated mice, consistent with the fact that DICER1 processes precursor miRNAs to mature miRNAs. As DICER1 also plays other important roles in the RNA-induced silencing complex (RISC) and in RNA metabolism (Burger & Gullerova, 2015), we cannot exclude the possibility that these other functions of DICER1 may be altered by metformin and contribute to metformin signaling. In addition, upregulation of DICER1 by metformin may also be regulated, in part, at the transcriptional level (Blandino et al., 2012); a comprehensive view of the spectrum of DICER1 functions influenced by metformin is beyond the scope of this investigation. By examining the miRNAs that were upregulated by metformin treatment, we observed that several of these miRNAs have been Fig. 6 SASP mRNA levels are decreased by metformin. RNA was isolated from the indicated cell lines and treatments as detailed in Experimental procedures. mRNA levels of the indicated genes were quantified by RT–qPCR. IR, ionizing radiation; (), mock-treated (+), metformin-treated. Metformin modulates DICER and senescence, N. Noren Hooten et al. 578 Published 2016. This article is a U.S. Government work and is in the public domain in the USA. Aging Cell published by Anatomical Society and John Wiley & Sons Ltd. implicated in regulating cellular senescence or aging (Table S3). Notably, we found that metformin treatment upregulated miR-125, a putative homolog of the C. elegans miRNA lin-4, which is a well-established regulator of lifespan in worms (Boehm & Slack, 2005; Ib a~ nez-Ventoso et al., 2008). Mutation of dicer decreases C. elegans longevity in response to heat stress, an effect that can be rescued by overexpression of lin-4 (Mori et al., 2012). Here, the increase in miR-125-5p levels coincided with lifespan extension in mice in response to metformin (Boehm & Slack, 2005; Martin-Montalvo et al., 2013). It will be interesting in future studies to examine whether miR-125 has lifeextending properties, similar to those conferred to C. elegans by its homolog lin-4. Other miRNAs upregulated by metformin have also been linked to aging in model systems, including miR-34. An age-associated alteration in miR-34 occurs in the mouse and overexpression of miR-34 in Drosophila extends lifespan (Li et al., 2011; Liu et al., 2012). miR-34 may play an important role in responding to DNA damage and also in protecting against osteoporosis and neurodegeneration (Kato et al., 2009; Liu et al., 2012; Krzeszinski et al., 2014). Metformin has been shown to upregulate miR-34a in cancer cells in culture (Do et al., 2014). In addition to miR-125 and miR-34a, compelling evidence also suggests that other miRNAs including miR-20a, miR-30, miR-106b, miR130a/b, and let-7 family members are important regulators of cellular senescence (Table S3) (Abdelmohsen & Gorospe, 2015). With advancing age, the number of senescent cells increases and contributes to age-related physiology and pathologies (van Deursen, 2014). We propose that one potential mechanism by which metformin increases lifespan is through inhibition of cellular senescence. Metformin decreases senescence in several different cell lines and senescence model systems. We provide evidence that metformin lowers protein levels of p16 and/or p21 and also decreases levels of IL6, IL8, CXCL1 and CXCL2 mRNAs, all encoding critical SASP factors. A previous report found that metformin enhances cellular senescence using different cell model systems and high doses of metformin (1–5m M) with possible value in cancer therapy (Cufi et al., 2012). Here, we chose a lower range of concentrations (100–500 lM) that reflects the physiological circulating levels of metformin in mice and in diabetic patients treated with metformin (Sum et al., 1992). We describe a post-transcriptional mechanism whereby metformin treatment causes the redistribution of the RBP AUF1 from the cytoplasm to the nucleus, associated with a disruption of its interaction with DICER1 mRNA that causes increased DICER1 mRNA and protein levels. Cellular glucose levels also regulate AUF1 shuttling to the nucleus and AMPK is important for this effect (Gao et al., 2014). Here, we found that AMPK is also important in mediating the effects of metformin on AUF1 redistribution to the nucleus. Furthermore, metformin increased the phosphorylation of AUF1 and enhanced AUF1 binding to HSP70, an interaction that shuttles AUF1 to the nucleus in response to heat-shock (Laroia et al., 1999). We found evidence that metformin enhanced AUF1 binding to HSP70 and increased HSP70 localization in the nucleus. Interestingly, a ~70 kDa band that was serine–threonine-phosphorylated in AUF1 immunoprecipitates might represent HSP70, recently identified as a substrate of AMPK (Schaffer et al., 2015). It has been observed that phosphorylation of AUF1 has been reported to regulate AUF1 protein stability and binding to target mRNAs (Wilson et al., 2003; Li et al., 2013). AUF1 has also been implicated in regulating cellular senescence and also targets p16 INK4a , a potent regulator of senescence (Guo et al., 2010; Pont et al., 2012). It will be interesting to determine whether other AUF1 targets are also affected by metformin. Although the actions of metformin have been extensively studied for decades, the underlying mechanisms remain unclear. Here, we have extended our mouse lifespan studies by showing that chronic metformin treatment affects DICER1 levels both in mice and humans. This new insight will hopefully aid both in identifying novel targets for development of agents that could be important in the primary or secondary prevention of cancer and increasing healthspan in older individuals. Currently, the FDA is considering a clinical trial called Targeting Aging with Metformin (TAME), which aims to assess whether metformin can delay aging and age-related diseases. Our studies provide timely insight into the molecular mechanisms through which metformin elicits antiaging effects in mice and humans. Experimental procedures Human study participants and mouse models For Fig. 1A, a subcohort of young (30 years) and older (64 years) participants from the Healthy Aging in Neighborhoods of Diversity across the Life Span study (HANDLS) (Evans et al., 2010) were chosen for examination of DICER1 and DROSHA mRNA levels with age. Clinical information on this subcohort has been described previously and is also listed in Table 1A (n=14/group) (Noren Hooten et al., 2010) and explained in the Supporting Information. DICER1 levels were quantified from PBMCs by RT–qPCR analysis as described below and in Supporting Information. Frozen tissue from Martin-Montalvo et al. was used for the current study (Animal protocol #: 352-TGB-2015). Livers from C57BL/6 mice on metformin (0.1% w/w in diet), calorie restriction (60% daily food, AIN93G, allotment compared with ad lib animals) or standard diet (AIN-93G diet) used for these studies were described previously (Martin-Montalvo et al., 2013). Global microRNA expression from livers of the same cohort of mice (n=5 per group) whose global gene expression profile was previously reported (Accesssion Number: GSE40936) (Martin-Montalvo et al., 2013). Total RNA including miRNAs was isolated using the Absolutely RNA miRNA Kit (Agilent) and analyzed using the Agilent Mouse miRNA Microarray 15.0. Microarray was performed and analyzed as previously described (Noren Hooten et al., 2013). Individual miRNAs with pairwise z-test Pvalue ≤0.05, absolute value of Zratio ≥1.5, with fdr ≤0.3 were considered significantly changed. The microRNA microarray data can be accessed at GEO (Accession Number: GSE73393). miRNA expression information from heat map is in Table S2. Cell lines, reagents, and transfections HepG2 cells were maintained in Minimal Essential Media containing 10% fetal bovine serum (FBS) and HeLa, IMR-90 and IDH4 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FBS. IDH4 cells were further supplemented with 1 lgmL 1 dexamethasone (Wright et al., 1989). WI-38 human fetal lung diploid fibroblasts (HDFs, Coriell Cell Repositories) were grown in DMEM supplemented with 10% FBS and 1% nonessential amino acids. All media contained penicillin/streptomycin. Metformin (Farmhispania S.A., Barcelona, Spain) was made fresh as a 100 mMstock solution in PBS. PBS was used as a vehicle control in all experiments. Compound C (Dorsomorphin) was purchased from Sigma-Aldrich, St. Louis, MO, USA. Cells were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) with siRNAs directed to AUF1 (Qiagen, Hilden, Germany; AAGATCCTATCACAGGGCGAT), AUF1 (Santa Cruz; Metformin modulates DICER and senescence, N. Noren Hooten et al. 579 Published 2016. This article is a U.S. Government work and is in the public domain in the USA. Aging Cell published by Anatomical Society and John Wiley & Sons Ltd. sc-37028), DICER1 (Santa Cruz Biotechnologies, Dallas, Texas, USA; sc-40489), PRKAA1, and PRKAA2 (AMPKa1 and AMPKa2; both SMARTpools from Dharmacon) or a control siRNA (Qiagen; All Stars Negative Control). FLAG-tagged plasmids containing p37, p40, p42, or p45 AUF1 isoforms were transfected together in equal concentrations (Fig. 2E) or individually for RIP experiments. Twenty-four hours after transfection, HeLa cells were treated with 500 lMmetformin or PBS in low serum media (0.1% FBS) for 24 h. HeLa cells were fractionated as described in Supporting Information. WI-38 and IMR-90 cells were pretreated for 1 h with 500 lMmetformin and then exposed to 10 Gy of ionizing radiation. Media and metformin was changed every 48 h, and RNA, protein, and SA-b-gal staining (described in Supporting Information) were performed 7 days after IR. To induce senescence in IDH4 cells, dexamethasone was removed and media changed to charcoal-stripped FBS with or without 500 lMmetformin. Media was changed every 48 h and after 7 days, RNA and protein were isolated, and SA-b-gal staining was performed. Reverse transcription (RT) followed by real-time, quantitative (q)PCR analysis RNA was reverse-transcribed using the QuantiMir cDNA kit (System Biosciences, Mountain View, CA, USA) according to the manufacturer’s instructions and real-time, quantitative (q)PCR amplification of mRNA, rRNA, pri-microRNA, and microRNA was carried out as explained in the Supporting Information. Immunoprecipitation, immunoblotting, and immunofluorescence Mouse livers were homogenized in RIPA buffer containing protease and phosphatase inhibitors. Lysates were centrifuged, and equal protein concentrations of the supernatant were analyzed using SDS-PAGE. For immunoprecipitation experiments, HeLa cells were serum-starved in 0.1% FBS-containing media for 18 h then treated for the indicated times with 500 lMmetformin or PBS. Cells were lysed in a buffer containing TBS, 1% Triton-X100, 2 mMEDTA, and phosphatase and protease inhibitors, clarified, and incubated with Gamma bind beads precoated with anti-AUF1 antibodies (Cell Signaling, Danvers, MA, USA) for 1.5 h. After extensive washing, immunoprecipitations were analyzed by SDSPAGE. The antibodies used for immunoblotting are described in the Supporting Information. AUF1 immunofluorescence in HeLa cells was analyzed as described in Supporting Information, using a Zeiss Observer D1 microscope with an AxioCam1Cc1 camera at a set exposure time. Immunoprecipitation of ribonucleoprotein (RNP) complexes HepG2 cells were starved for 18 h and then treated in serum-free media for 1 h with 500 lMmetformin or PBS, and ribonucleoprotein (RNP) immunoprecipitation (RIP) assays were carried out as described previously (Yoon et al., 2014). To test AUF1 isoform binding to DICER1 mRNA, HeLa cells were transfected with individual plasmids encoding FLAG-tagged p37, p40, p42, or p45 AUF isoforms. RIP analysis is described in Supporting Information. Acknowledgments This study was supported by the Intramural Research Program of the National Institutes of Health, National Institute on Aging. The authors wish to thank Kotb Abdelmohsen for valuable discussions and critical reading of the manuscript, the HANDLS staff for care of participants and sample acquisition, and William H. Wood III, Yoonseo Kim, and Althaf Lohani for technical assistance. Funding info No funding information provided. Author contributions NNH and MKE designed the study. NNH performed the experiments. AM-M, MB, and RdC performed the metformin mouse study. MG provided reagents, PAR-CLIP, and advice. ABZ and MKE are coprincipal investigators of HANDLS. DFD isolated RNA and performed primary miRNA RT–qPCR and target prediction analysis. YZ and KGB performed microarray analysis. NNH wrote the paper with input from all authors. Conflict of interest The authors declare that they have no conflict of interest. References Abdelmohsen K, Gorospe M (2015). Noncoding RNA control of cellular senescence. Wiley Interdiscip. Rev. RNA 6, 615–629. Abdelmohsen K, Tominaga-Yamanaka K, Srikantan S, Yoon JH, Kang MJ, Gorospe M (2012) RNA-binding protein AUF1 represses Dicer expression. Nucleic Acids Res. 40, 11531–11544. Bahubeshi A, Tischkowitz M, Foulkes WD (2011). miRNA processing and human cancer: DICER1 cuts the mustard. Sci. Transl. Med. 3, 111 ps146. Bannister CA, Holden SE, Jenkins-Jones S, Morgan CL, Halcox JP, Schernthaner G, Mukherjee J, Currie CJ (2014). Can people with type 2 diabetes live longer than those without? A comparison of mortality in people initiated with metformin or sulphonylurea monotherapy and matched, non-diabetic controls. Diabetes Obes. Metab. 16, 1165–1173. Blandino G, Valerio M, Cioce M, Mori F, Casadei L, Pulito C, Sacconi A, Biagioni F, Cortese G, Galanti S, Manetti C, Citro G, Muti P, Strano S (2012) Metformin elicits anticancer effects through the sequential modulation of DICER and c-MYC. Nat. Commun. 3, 865. Boehm M, Slack F (2005) A developmental timing microRNA and its target regulate life span in C. elegans.Science 310, 1954–1957. Burger K, Gullerova M (2015) Swiss army knives: non-canonical functions of nuclear Drosha and Dicer. Nat. Rev. 16, 417–430. Coppe JP, Patil CK, Rodier F, Sun Y, Munoz DP, Goldstein J, Nelson PS, Desprez PY, Campisi J (2008) Senescence-associated secretory phenotypes reveal cellnonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biol. 6, 2853–2868. Cufi S, Vazquez-Martin A, Oliveras-Ferraros C, Quirantes R, Segura-Carretero A, Micol V, Joven J, Bosch-Barrera J, Del Barco S, Martin-Castillo B, Vellon L, Menendez JA (2012) Metformin lowers the threshold for stress-induced senescence: a role for the microRNA-200 family and miR-205. Cell Cycle 11, 1235–1246. van Deursen JM (2014) The role of senescent cells in ageing. Nature 509, 439–446. Do MT, Kim HG, Choi JH, Jeong HG (2014) Metformin induces microRNA-34a to downregulate the Sirt1/Pgc-1alpha/Nrf2 pathway, leading to increased susceptibility of wild-type p53 cancer cells to oxidative stress and therapeutic agents. Free Radic. Biol. Med. 74,21–34. Duca FA, Cote CD, Rasmussen BA, Zadeh-Tahmasebi M, Rutter GA, Filippi BM, Lam TK (2015) Metformin activates a duodenal Ampk-dependent pathway to lower hepatic glucose production in rats. Nat. Med. 21, 506–511. Evans MK, Lepkowski JM, Powe NR, LaVeist T, Kuczmarski MF, Zonderman AB (2010) Healthy aging in neighborhoods of diversity across the life span (HANDLS): overcoming barriers to implementing a longitudinal, epidemiologic, urban study of health, race, and socioeconomic status. Ethn. Dis. 20, 267–275. Foretz M, Guigas B, Bertrand L, Pollak M, Viollet B (2014) Metformin: from mechanisms of action to therapies. Cell Metab. 20, 953–966. Foulkes WD, Priest JR, Duchaine TF (2014) DICER1: mutations, microRNAs and mechanisms. Nat. Rev. Cancer 14, 662–672. Metformin modulates DICER and senescence, N. Noren Hooten et al. 580 Published 2016. This article is a U.S. Government work and is in the public domain in the USA. Aging Cell published by Anatomical Society and John Wiley & Sons Ltd.