S em cell diffe en ia ion on conduc ing polyaniline
P. Humpol´
ı
ˇ
cek,*
ab
K. A. Radaszkiewicz,
c
V. Kaˇ
sp´
a ko ´
a,
bd
J. S ejskal,
e
M. T cho ´
a,
e
Z. Kuceko ´
a,
b
H. Viˇ
ca o ´
a,
c
J. Pache n´
ık,
c
M. Lehock´
y
b
and A. Minaˇ
´
ık
bg
Polyaniline is a p omising conduc ing polyme wi h b oad applica ion po en ial in biomedicine. I s medical
use, howe e , equi es bo h biocompa ibili y and sui able physico-chemical and su ace p ope ies. The
mic os uc u e, elec ical p ope ies, and su ace cha ac e is ics o polyaniline sal , polyaniline base, and
polyaniline deposi ed wi h biologically ac i e poly(2-ac ylamido-2-me hyl-1-p opanesul onic acid) we e
e ealed using a omic o ce mic oscopy, con ac angle measu emen s, and Raman spec oscopy. As
conduc ing polyme s can be p e e en ially applied in issue enginee ing o hea and ne ous issues, he
ca diomyogenesis in pu e ca diomyocy es de i ed om emb yonic s em cells and neu ogenesis in
neu al p ogeni o s isola ed om emb yonal 13 dpc b ain we e u he in es iga ed. The esul s show ha
nei he ca diomyogenesis no neu ogenesis we e influenced by any o he es ed polyaniline films.
Howe e , he mos a o able cell beha iou was obse ed on p is ine polyaniline base; he e o e,
polyaniline in p is ine o ms wi hou any u he modifica ion can be applied in a a ie y o biomedical fields.
1. In oduc ion
I is well known ha diffe en polyaniline o ms (eme aldine
sal and base) and hei copolyme s o blends exhibi diffe en
a ou able p ope ies such as elec ical conduc i i y and i s
pe sis ence a a ious pH. The unique p ope ies o polyaniline
make i possible o apply his polyme in biosenso s o ma e-
ials inuencing cell beha io h ough elec ical elds.
1
An
elec ical eld can, o example, s imula e he egene a ion o
ne ous and muscle issues,
2
wound healing in skin,
3
o bone
epai .
4
Mo e ecen ly, he impac o elec ical s imuli on cell
diffe en ia ion and molecula cell pa ame e s has also been
e ealed. Fo example, Hsiao e al.
5
desc ibed he applica ion o
composi e nanobe s o polyaniline and poly(lac ic-co-glycolic
acid) as an elec ically ac i e scaffold o coo dina ing he
bea ing o ca diomyocy es. Ano he exci ing use o conduc ing
polyme s in he elec ical s imula ion o cells is o induce he
p e-commi men o b oblas s in o ca diomyocy es,
6
neu i e
g ow h, and he mig a ion o oden neu al s em cells,
7
as well
as he s imula ion o myoblas diffe en ia ion.
8
Recen ly,
nanobe s ab ica ed h ough he elec ospinning o polyani-
line blended wi h poly(L-lac ic acid) we e epo ed o show
po en ial o adipose-de i ed s em cell p oli e a ion.
9
I is
he e o e ob ious ha conduc ing polyme s in gene al and
polyaniline in pa icula a e p omising ma e ials o issue
enginee ing and egene a i e medicine. Howe e , in o ma ion
abou cell compa ibili y o polyaniline is s ill insufficien and
only a limi ed pic u e o he biological pe o mance o his
polyme exis s. Al hough he e a e a numbe o in i o s udies
which ha e ocused on he implan abili y and pos -implan
e alua ion o polyaniline copolyme s (mainly wi h biodeg ad-
able polyme s), he e a e only a ew examples o in i o s udies
ocusing on he cell compa ibili y o polyaniline in p is ine
o m. In addi ion, diffe en cells and me hods o polyaniline
p epa a ion we e used in hese s udies. Fo example, he
compa ibili y o hin lms p epa ed om sa u a ed solu ions o
polyaniline in N-me hyl-2-py olidone wi h H9c2 ca diac
myoblas s was s udied by Bidez e al.
10
In wo o he wo ks
published by Wang e al.,
11
PC-12 pheoch omocy oma cells we e
used. Polyaniline doped wi h diffe en acids was s udied by
Wang e al.
11
while polyaniline lm ab ica ed ia elec oless
su ace polyme iza ion was employed in he s udy o Liu e al.
12
Finally, Baye e al.
13
used he NIH/3T3 cell line o in es iga e
cy o oxici y and p oli e a ion o cells on a polyaniline empla e
syn hesized wi h poly(2-ac ylamido-2-me hyl-1-p opanesul onic
acid) (PAMPSA).
One o he conside able ad an ages o polyaniline consis s in
i s abili y o easily o m hin lms on e.g. nanos uc u e ma e-
ials,
14
which can be u he modied using a ious dopan s
a
Polyme Cen e, Facul y o Technology, Tomas Ba a Uni e si y in Zlin, T.G.M. Sq.
5555, 760 01 Zlin, Czech Republic. E-mail: humpolicek@.u b.cz
b
Cen e o Polyme Sys ems, Tomas Ba a Uni e si y in Zlin, 760 01 Zlin, Czech
Republic
c
Ins i u e o Expe imen al Biology, Facul y o Science, Masa yk Uni e si y, 625 00
B no, Czech Republic
d
Depa men o Fa , Su ac an and Cosme ics Technology, Facul y o Technology,
Tomas Ba a Uni e si y in Zlin, Zlin, Czech Republic
e
Ins i u e o Mac omolecula Chemis y, Academy o Sciences o he Czech Republic,
162 06 P ague 6, Czech Republic
Ins i u e o Biophysics, Academy o Sciences o he Czech Republic, . .i.,
K ´
alo opolsk´
a 135, 612 65 B no, Czech Republic
g
Depa men o Physics and Ma e ials Enginee ing, Facul y o Technology, Tomas Ba a
Uni e si y in Zlin, T.G.M. Sq. 5555, 760 01 Zlin, Czech Republic
Ci e his: RSC Ad .,2015,5, 68796
Recei ed 24 h June 2015
Accep ed 5 h Augus 2015
DOI: 10.1039/c5 a12218j
www. sc.o g/ad ances
68796 |RSC Ad .,2015,5,68796–68805 This jou nal is © The Royal Socie y o Chemis y 2015
RSC Ad ances
PAPER
Open Access A icle. Published on 06 Augus 2015. Downloaded on 09/09/2015 12:35:16.
This a icle is licensed unde a
C ea i e Commons A ibu ion 3.0 Unpo ed Licence.
View A icle Online
View Jou nal
| View Issue
wi h he aim o changing hei su ace p ope ies. Among such
dopan subs ances, syn he ic polyanions ha e been obse ed o
exhibi in e es ing biological p ope ies. Namely, PAMPSA was
shown o ac agains blood clo ing in a simila way o hepa in,
ei he alone
15
o inco po a ed in copolyme s.
16
Se oyama e al.
17
also epo ed ha PAMPSA is capable o inhibi ing he ac i a-
ion o se um complemen ac i i y. Humpol´
ı
ˇ
cek e al.
18
e ealed
ha PANI-PAMPSA possesses signican impac on blood
coagula ion and pla ele adhesion. As ega ds conduc i i y, a
alue o abou 10
2
Scm
1
was epo ed o PANI-PAMPSA,
19
which is wi hin he ypical ange o conduc i i ies epo ed o
PANI sal and PANI base, being o he o de s 10
0
and 10
11
S
cm
1
, espec i ely.
20
These PAMPSA p ope ies a e p omising
o he modica ion o polyanilines sui able o biomedical
applica ions. The elec ochemically polyme ized PANI-PAMPSA
was p e iously de ec ed o allow o selec i e s em cells
adhesion.
21
F om he abo e-p o ided summa y i can be seen ha none
o he published s udies used p is ine polyaniline p epa ed by
he oxida i e polyme iza ion acco ding o S ejskal and Gilbe
20
in combina ion wi h s em cells o e eal complex cell beha io
on hese lms. Hence, a s udy desc ibing s em cell adhesion
and diffe en ia ion on p is ine polyaniline was conduc ed and
he esul s we e compa ed o co esponding es s un on poly-
aniline lms modied wi h PAMPSA.
2. Expe imen al
2.1. P epa a ion o polyaniline lms
Tissue cul u e dishes (TPP; Swi ze land) we e coa ed in si u wi h
lms o polyaniline sal (PANI-S) p epa ed ia he oxida ion o
aniline hyd ochlo ide wi h ammonium pe oxydisul a e. Aniline
hyd ochlo ide (2.59 g; Lach-ne ; Czech Republic) was dissol ed
in wa e o a 50 mL solu ion; ammonium pe oxydisul a e (5.71
g; Sigma-Ald ich; US) was simila ly dissol ed o a 50 mL solu-
ion. Bo h solu ions we e mixed a oom empe a u e and
immedia ely pou ed in o he cul u e dishes.
22
Ae 1 h, he
dishes we e emp ied and he lms o g een conduc ing PANI-S
deposi ed on hei walls we e insed wi h 0.2 M hyd ochlo ic
acid, ollowed by me hanol, and le o d y in ai . Some lms
we e dep o ona ed by imme sion in 1 M ammonium hyd oxide
o 12 h and hus con e ed o blue, non-conduc ing lms o
polyaniline base (PANI-B).
In o de o p epa e PANI doped wi h poly(2-ac ylamido-2-
me hyl-1-p opanesul onic acid) (PANI-PAMPSA), he e-
p o ona ion o PANI-B wi h a 7.5% ( / ) aqueous solu ion o
PAMPSA ( ypical molecula weigh M¼210
6
g mol
1
; Sigma-
Ald ich; US) was pe o med by pou ing he PAMPSA solu ion
on o he su ace o he PANI-B lm. The eac ion was le o
p oceed o 24 h, hen he esidual PAMPSA solu ion was
pou ed ou and he lm was insed wi h me hanol and le o
d y in ai .
2.2. Su ace ene gy
Con ac angle measu emen s and de e mina ion o su ace
ene gy we e conduc ed wi h he aid o he “SEE sys em”(su ace
ene gy e alua ion sys em) (Ad ex Ins umen s, Czech Republic).
Fo polyaniline samples, deionized wa e , e hylene glycol, and
diiodome hane (Sigma-Ald ich; US) we e used as es ing
liquids. The d ople olume o he es ing liquids was se o 2 mL
in all expe imen s. Ten sepa a e eadings we e a e aged o
ob ain one ep esen a i e con ac angle alue. Using hese da a,
he subs a e su ace ee ene gy was de e mined by he “acid–
base”me hod.
2.3. A omic o ce mic oscopy
Fo de e mina ion o opog aphic and su ace elec ical p op-
e ies, unneling a omic o ce mic oscopy (AFM) was pe o med
using he PeakFo ce TUNA module on Dimension ICON (B uke
Co po a ion; US). Measu emen s we e conduc ed unde labo-
a o y condi ions ( empe a u e and a mosphe e). The PFTUNA
p obe (B uke Co po a ion; US) wi h a sp ing cons an o 0.4 N
m
1
, co e ed on bo h sides wi h a conduc i e P /I laye , was
used. The scanning a e was 0.3 Hz and he peak cu en s we e
measu ed wi h a 200 mV bias ol age applied o all he exam-
ined samples. The peak cu en signal was de e mined by Poin
analysis using NanoScope Analysis sowa e .1.5. The esul ing
peak cu en signal was calcula ed om he poin measu e-
men s and exp essed as he cu en alue de ec ed a mo e han
90% o he measu ing poin s. The su ace oughness was
de e mined using bo h he a i hme ic a e age o he absolu e
alues o su ace heigh de ia ions measu ed om he mean
plane (R
a
) and he image su ace a ea diffe ence, which is he
diffe ence be ween he images o a h ee-dimensional su ace
a ea and a wo-dimensional p ojec ed su ace a ea. The esul s
we e analyzed acco ding o he ASME B46.12 s anda d.
2.4. Raman spec oscopy
Raman spec a o he lms deposi ed on silicon windows we e
measu ed wi h a Renishaw InVia Reex Raman mic o-
spec ome e . The spec a we e exci ed wi h a HeNe 633 nm
lase . A esea ch-g ade Leica DM LM mic oscope wi h an
objec i e magnica ion 50was used o ocus he lase beam
on he sample placed on an X–Y mo o ized sample s age. The
sca e ed ligh was analyzed by he spec og aph wi h holo-
g aphic g a ing 1800 lines. A Pel ie -cooled CCD de ec o (576
384 pixels) egis e ed he dispe sed ligh . To a oid deg ada ion
o he samples by he lase beam, a educed beam powe has
always been used.
2.5. Ca diomyocy es adhesion
P io o in i o es ing, he samples we e disin ec ed by 30 min
o exposu e o a UV- adia ion sou ce ope a ing a a wa eleng h
o 258 nm emi ed om a low-p essu e me cu y lamp. The
adhesion o in i o p epa ed ca diomyocy es was assessed
using he ollowing p ocedu e. Fo he p epa a ion o a ca -
diomyocy e popula ion o high pu i y, R1 ESC cells
23
we e
ans ec ed by an MHC p omo o -dependen selec ion ec o
dened by Klug e al.
24
(kind gio D Field, L. J.). Selec ed
clones wi h success ully ans ec ed selec ion ec o , we e
sc eened o he possibili y o ca diomyogenesis and ca -
diomyocy e isola ion. Dulbecco's Modied Eagle's Medium
This jou nal is © The Royal Socie y o Chemis y 2015 RSC Ad .,2015,5,68796–68805 | 68797
Pape RSC Ad ances
Open Access A icle. Published on 06 Augus 2015. Downloaded on 09/09/2015 12:35:16.
This a icle is licensed unde a
C ea i e Commons A ibu ion 3.0 Unpo ed Licence.
View A icle Online
( e e ed as “comple e DMEM media”) con aining 15% e al cal
se um, 100 U mL
1
penicillin, 0.1 mg mL
1
s ep omycin, 100
mM non-essen ial amino acids (all om Gibco-In i ogen; US),
0.05 mM b-me cap oe hanol (Sigma-Ald ich; US) and 1000 U
mL
1
o leukemia inhibi o y ac o (Chemicon; US) was used o
he cul i a ion. Selec ed clone HG8 was used o p epa a ion o
ca diomyocy e. Ca diomyogenesis o HG8 was induced by
elimina ion o leukemia inhibi o y ac o om cul i a ion
media and by he o ma ion o emb yoid bodies (EBs) p epa ed
in suspension cul u e o ESC cells using aga -coa ed bac e io-
logical dishes.
25,26
F om day 14 o diffe en ia ion, G418 an ibi-
o ics we e added o he cul u e media o a pe iod o six days o
selec pu e ca diomyocy e popula ion. Ca diomyocy e iden i y
was p o ed by de ec ion he p esence o myob ils using mouse
monoclonal an ibodies agains sa come ic a-ac inin, (Sigma-
Ald ich), and ollowed by seconda y an ibody (an i-mouse
conjuga ed o FITC, Sigma-Ald ich; Fig. 4). In he nex s ep,
he cul u e was ea ed by 0.1% collagenase II o 30 minu es a
37 C. The cell suspension was mixed by in ensi e pipe ing,
and ca diomyocy e clus e s we e pu ied om dead cell deb is
by spon aneous sedimen a ion, washed, e-suspended in
media, and seeded in o e e ence issue cul u e dishes and on o
all es ed polyaniline su aces. Fou diffe en condi ions o
HG8 cell adhesion we e es ed: (A) adhesion on he polyaniline
su aces wi hou coa ing; (B) adhesion on he polyaniline
su aces coa ed wi h 0.1% gela in; and (A) and (B) cul i a ed
ei he in (C) se um- ee medium (wi hou e al cal se um) o
(D) DMEM-F12 media supplemen ed by insulin– ans e in–
selenium (Gibco-In i ogen; US) e e ed o he e as “ITS media”.
Cell beha io was con inuously obse ed o 14 days ae
seeding.
2.6. S em cell diffe en ia ion
S em cell diffe en ia ion in e ms o ca diomyogenesis and
neu ogenesis was s udied o e eal he abili y o polyaniline o
ac as a bioma e ial o s em cell echnologies.
2.6.1. Ca diomyogenesis. ESC R1 line
23
was p opaga ed in
an undiffe en ia ed s a e by cul u ing on gela inized issue
cul u e dishes in comple e DMEM media. Ca diomyogeneses o
ESC we e hen ealized by elimina ion o leukemia inhibi o y
ac o om cul i a ion media and by he o ma ion o EBs using
he hanging d op echnique. Fi e-day-old EBs we e ans e ed
Fig. 1 AFM mic og aphs o oughness and conduc i i y o es ed polyaniline su aces. Roughness: (a1) PANI-S; (b1) PANI-B; (c1) PANI-PAMPSA.
Peak cu en signal: (a2) PANI-S; (b2) PANI-B; (c2) PANI-PAMPSA.
Fig. 2 Raman spec a o he in si u deposi ed PANI-S, PANI-B and
PANI-PAMPSA on silicon window. Spec um o pu e PAMPSA is shown
o compa ison.
68798 |RSC Ad .,2015,5,68796–68805 This jou nal is © The Royal Socie y o Chemis y 2015
RSC Ad ances Pape
Open Access A icle. Published on 06 Augus 2015. Downloaded on 09/09/2015 12:35:16.
This a icle is licensed unde a
C ea i e Commons A ibu ion 3.0 Unpo ed Licence.
View A icle Online
o issue cul u e dishes coa ed wi h gela in (0.1% aqueous
solu ion, e e ence), PANI-S, PANI-B and PANI-PAMPSA, and
cul i a ed ei he in comple e DMEM media o se um- ee ITS
media. The de ailed cul i a ion condi ions a e desc ibed by
Vesela e al.
25
and Ko aso a e al.
26
Ae 15 days, when clea ly
bea ing clus e s wi hin expanding EBs we e ecognized, cells
we e lysed o RNA isola ion.
To al RNA was isola ed by Ul aClean RNA isola ion ki (MO
BIO, US). Complemen a y DNA was syn hesized acco ding o
he manu ac u e 's ins uc ions o M-MLV e e se ansc ip-
ase (Sigma-Ald ich, US). qRT-PCR was pe o med in a Roche
Ligh -Cycle using TaqMan PCR (Roche, Swi ze land). The
ollowing p og am was used: ini ial ac i a ion s ep a 95 C o
5 min, ollowed by 40 cycles a 95 C o 10 s, annealing
empe a u e (Table 1) o 10 s, and 72 C o 10 s. The gene
exp ession o each o he samples was exp essed in e ms o he
h eshold cycle no malized o he mean o he e e ence genes
(Ribosomal p o ein L13 gene, Rpl13a) as desc ibed p e iously
by Ko aso a e al.
26
P ime s, p obes, app op ia e annealing
empe a u es, and PCR p oduc leng hs o he de e mined
ansc ip s a e lis ed in Table 1. The myosin hea y chain a
(Myh6), myosin hea y chain b(Myh7), sa come ic aak inin
Fig. 3 Op ical mic og aphs o he film o (a) PANI-B and (b) PANI-PAMPSA on silicon window.
Fig. 4 Ca diomyocy e iden i y p o ed by he p esence o myofib ils (a) using ca diomyocy e specific sa come e alpha ac inin an ibody and
coun e s ain by an i-mouse IgG an ibody labelled by FITC; (b) he cell nucleus coun e s ain by DAPI.
Table 1 P ime sequences o a ge and e e ence genes o ca diomyogenesis used in qRT-PCR assays
Gene Sequence P oduc size (bp) Annealing (C) P obe
Re e ence gene
Rpl13a CATGAGGTCGGGTGGAAGTA, GCCTGTTTCCGTAACCTCAA 116 60 # 25
Ca diomyocy e genes
Myh6 CGCATCAAGGAGCTCACC, CCTGCAGCCGCATTAAGT 61 60 # 6
Myh7 CGCATCAAGGAGCTCACC, CTGCAGCCGCAGTAGGTT 60 60 # 6
Ac n 2 CCGGATTCTGGCTTCTGAT, GAGGCAGCTCTCGACGAA 62 60 # 53
Nkx2.5 GACGTAGCCTGGTGTCTCG, GTGTGGAATCCGTCGAAAGT 70 59 # 53
This jou nal is © The Royal Socie y o Chemis y 2015 RSC Ad .,2015,5,68796–68805 | 68799
Pape RSC Ad ances
Open Access A icle. Published on 06 Augus 2015. Downloaded on 09/09/2015 12:35:16.
This a icle is licensed unde a
C ea i e Commons A ibu ion 3.0 Unpo ed Licence.
View A icle Online
(Ac n 2), and NK2 homeobox 5 (Nkx2.5) genes we e chosen o
de ec he ca diomyogenesis.
2.6.2. Neu ogenesis in neu osphe es. B ain o a 13.5 dpc
mouse emb yo was p epa ed and e-suspended in neu ogenic,
sel - enewing media con aining DMEM F12 1 : 1, 1N2 and
B27 supplemen s, 100 U mL
1
penicillin, 0.1 mg mL
1
s ep-
omycin (Gibco-In i ogen; US), 5 ng mL
1
o FGF-2 and 20 ng
mL
1
o EGF (Pep oTech; US).
27
Fou -day-old neu osphe es
we e seeded in o issue cul u e dishes coa ed wi h gela in,
PANI-S, PANI-B o PANI-PAMPSA, and cul i a ed in ITS media
con aining 3% e al cal se um.
Ae u he ou days, cells we e lysed o gene exp ession
analyses. Gene exp ession was de e mined using qRT-PCR.
To al RNA was isola ed by MO BIO Ul aClean RNA isola ion
ki (US). Complemen a y DNA was syn hesized acco ding o he
manu ac u e 's ins uc ions o M-MLV e e se ansc ip ase
(Sigma-Ald ich; US). qRT-PCR was pe o med in a Roche Ligh -
Cycle using he SYBRE G een me hod (Roche, Swi ze land).
The ollowing p og am was employed: ini ial ac i a ion s ep a
95 C o 5 min, ollowed by 40 cycles a 95 C o 10 s, annealing
empe a u e (Table 2) o 10 s, and 72 C o 10 s. The gene
exp ession o each sample was exp essed in e ms o he
h eshold cycle no malized o he mean o he e e ence genes
as desc ibed p e iously.
26
P ime s, p obes, app op ia e anneal-
ing empe a u e, and p oduc leng hs o he de e mined
ansc ip s a e lis ed in Table 2. Be a ac in and TATA-binding
p o ein (TBP) we e selec ed as he e e ence genes. Neu o-
sphe e adhesion was also de e mined by assessmen o mic o-
pho og aphs aken 4 days ae seeding, be o e collec ion o
mRNA isola ion o qRT-PCR.
3. Resul s and discussion
The composi es and copolyme s o polyaniline wi h biocom-
pa ible ma e ials ha e p e iously been s udied and hei p op-
e ies epo ed. Biological p ope ies o p is ine polyaniline
lms (PANI-S and PANI-B) ha e, howe e , been almos igno ed
despi e hei simple p epa a ion p ocedu e and possibili y o
being easily deposi ed on almos any ma e ial. The p esen
s udy, he e o e, ocused on his opic. In addi ion, he impac
o su ace modica ion o polyaniline by biologically ac i e
polyme ic acid PAMPSA is in oduced. The beha io o s em
cells on p is ine and PAMPSA modied polyaniline su aces is
discussed wi h espec o hei ma e ial p ope ies.
3.1. Su ace ene gy
The esul s om su ace ene gy measu emen s ob ained o
PANI-S and PANI-B indica e almos he same alues o he o al
su ace ene gy (g
o
) as well as o i s componen s ep esen ing
bo h he dispe se (g
LW
) and pola (g
AB
) pa s (Table 3). A
signican dec ease was obse ed o g
o
on PANI-PAMPSA. In
nume ical alues, he o al su ace ene gy dec eased om g
o
¼
53 mN m
1
(PANI-S) o 40 mN m
1
(PANI-PAMPSA). This is a
simple p oo o he p esence o PAMPSA on he polyaniline
su ace.
3.2. A omic o ce mic oscopy
Feasibili y o he cells o adhe e and p oli e a e is commonly
epo ed o depend on he su ace oughness and opog-
aphy.
28,29
In he p esen s udy, he AFM measu emen s we e
pe o med o e eal wo impo an ma e ial p ope ies inu-
encing cell/polyaniline in e ac ion: oughness and elec ical
p ope ies. Conside ing oughness in e ms o he R
a
pa ame e
(Fig. 1), he esul s show ha only small, insignican diffe -
ences can be de ec ed among PANI-B (25 nm) and PANI-
PAMPSA (21 nm). In con as , PANI-S exhibi ed a signican ly
oughe su ace (45 nm) compa ed o he p e iously men ioned
samples and also he highes image su ace a ea diffe ence,
which was 42%. The image su ace a ea diffe ences o emain-
ing samples, co espondingly o R
a
alues, we e lowe , ha is
24% o PANI-B and 15% o PANI-PAMPSA. P e iously, Wang
Table 2 P ime sequences o a ge and e e ence genes o neu ogenesis used in qRT-PCR assays
Gene Sequence P oduc size (bp) Annealing (C)
Re e ence genes
bAc in GATCAAGATCATTGCTCCTCCT, TAAAACGCAGCTCAGTAACAG 177 61
TBP GCACAGGAGCCAAGAGTGAAG, ACACGTGGATAGGGAAGGCA 397 58
Neu al genes
Sox2 GCGCCCTGCAGTACAACTCC, TTCGCAGTCCAGCCCTCACA 362 66
Pax6 TGCCCTTCCATCTTTGCTTG, TCTGCCCGTTCAACATCCTTAG 178 57
Nes in CATACAGGACTCTGCTGGAGG, GAGAAGGATGTTGGGCTGAG 169 62
GSX2 TGGGAGGCTCCGATACCAG, TGTCGCGATTCTGATTCTCC 140 60
Mash1 GGTCTCGTCCTACTCCTCCG, GCTGCCATCCTGCTTCCAAA 137 61
GFAP GGAGGCACTTGCTCGGCTGG, TGGTGCTTTTGCCCCCTCGG 212 63.5
Table 3 To al su ace ene gy (g
o
) and i s dispe se (g
LW
) and pola
(g
AB
) pa s de e mined on es ed polyaniline su aces
Su ace ene gy componen s (mN m
1
)
Sample g
o
g
LW
g
AB
PANI-S 52.54 46.05 6.49
PANI-B 50.88 46.54 4.35
PANI-PAMPSA 39.96 37.05 2.91
68800 |RSC Ad .,2015,5,68796–68805 This jou nal is © The Royal Socie y o Chemis y 2015
RSC Ad ances Pape
Open Access A icle. Published on 06 Augus 2015. Downloaded on 09/09/2015 12:35:16.
This a icle is licensed unde a
C ea i e Commons A ibu ion 3.0 Unpo ed Licence.
View A icle Online
e al.
11
hypo hesized ha he nano-scale mo phology o poly-
aniline lms migh ha e an impac on cell adhesion; howe e
he diffe ences in cell adhesion de e mined in he cu en wo k
do no co obo a e hei assump ion. The su ace oughness
obse ed on PANI-S, PANI-B and PANI-PAMPSA lms in his
s udy was oo uni o m o ha e any signican impac on cell
adhesion. Conside ing he uni o mi y o all polyaniline lms in
e ms o hei hickness (125 9 nm), which o igina es om
hei chemical s uc u e,
22
i can be assumed ha su ace
opog aphy is no a key ac o con olling cell adhesion o
p oli e a ion on hese su aces. Su ace chemis y can he e o e
be ega ded as a mo e impo an ac o in polyaniline/cell
in e ac ions.
In con as o oughness, bigge diffe ences be ween he
samples we e de ec ed in e ms o hei elec ical p ope ies.
The peak cu en signal a a bias ol age o 200 mV showed ha
mo e han 90% o measu ed alues we e ound o be highe
han 1120 10 o PANI-S, 0.38 0.01 o PANI-B and 210 1
o PANI-PAMPSA (in pA). Thus PANI-B possessed he lowes
cu en signal and o he emaining samples he cu en signal
u he inc eased in he o de PANI-PAMPSA and PANI-S.
Al hough he AFM based elec ical p ope ies a e no , in
nume ical alues, possible o compa e wi h he conduc i i y
alues measu ed on he co esponding ma e ials by he an de
Pauw me hod, hey a e in good ag eemen wi h espec o hei
classi ying in e ms o he mos and less conducing samples.
3.3. Raman spec a
The Raman spec um o PANI-PAMPSA is e y close o he
spec um o PANI-S (Fig. 2). I s spec um exhibi s he ypical
bands o he eme aldine sal .
30,31
The peak a 1589 cm
1
is
connec ed wi h C]C s e ching ib a ions in a quinonoid ing,
he peak wi h maximum a abou 1506 cm
1
is assigned o he
N–H de o ma ion ib a ions associa ed wi h he semiquinonoid
s uc u es, con ibu ion o he C]N s e ching ib a ions in
quinonoid uni s a 1480 cm
1
is expec ed. The band a 1337
cm
1
belongs o he C N
+
c ib a ions o delocalized pola onic
s uc u es. Benzene- ing de o ma ion ib a ions a 1260 cm
1
and he band a 1171 cm
1
o he C–H in-plane bending
ib a ions o he semi-quinonoid o benzenoid ings a e well
obse ed in he spec um, o PANI-S. The band a 810 cm
1
is
linked o benzene- ing de o ma ions and he band a 578 cm
1
o he amine de o ma ion ib a ions (in-plane) o he eme -
aldine sal s uc u e. Ou -o -plane de o ma ions o he ing a e
connec ed wi h he bands a 520 cm
1
and 423 cm
1
. The s is
o e lapped by a s ong band si ua ed a abou 519 cm
1
comes
om silicon subs a e.
The spec um o PANI-B co esponds o he spec um o a
ypical eme aldine base (Fig. 2).
30,31
The in ensi y o he peak o
he ib a ions in a quinonoid ing anished he band assigned
o C]N ib a ions in he quinonoid uni s si ua ed a 1470 cm
1
domina es he spec um. The peak si ua ed a 1417 cm
1
con-
nec ed wi h c oss-linked phenazine-like s uc u es appea s in
he spec um. The in ensi y o he band o C N
+
cs e ching
ib a ions obse ed a 1335 cm
1
and o he band a 1260 cm
1
dec eased. The band o C–N s e ching ib a ions obse ed a
1220 cm
1
and he band a 1161 cm
1
o C–H bending ib a-
ions o quinonoid ings a e p esen in he spec um o he
PANI-B. A b oad s uc u al band wi h local maxima a 838 cm
1
,
780 cm
1
, and 746 cm
1
eec s benzene- ing de o ma ions o
a iously subs i u ed a oma ic ings. The peaks belonging o
he spec um o PAMPSA a e no de ec ed in he spec a o PANI-
S o PANI-B. The op ical images o he lms o PANI-B and PANI-
PAMPSA (Fig. 3) demons a e ha modica ion o he lm o
PANI-B wi h PAMPSA also leads o he changes o colo om
b own o yellow-g eenish in case o sample PANI-PAMPSA,
which suppo he p o ona ion o he lm.
3.4. Ca diomyocy es adhesion
The po en ial o ca diomyocy es p epa ed in i o om ESC o
colonize on PANI-S, PANI-B and PANI-PAMPSA su aces was
de e mined unde diffe en expe imen al condi ions. Isola ed
ca diomyocy es ep esen clus e s o bea ing cells consis ing o
app oxima ely 5–20 cells pe clus e . The esul s show ha
ca diomyocy es we e no able o adhe e when cul i a ed in ITS
media (wi hou FCS), ei he on na i e o gela in-coa ed poly-
aniline su aces. Ae changing he cell cul u e medium o
comple e DMEM (wi h FCS), he cells success ully adhe ed on
bo h a gela inized o na i e polyaniline su aces and he s
clus e s we e obse ed 24 h ae seeding on he gela in coa ed
su ace. The inuence o he FCS p esence in he g ow h
medium on adhesion o ca diomyocy es was also epo ed by
Cu is and Fo es e
32
who desc ibed hei iden ical beha io .
Mic og aphs (Fig. 5) o ca diomyocy es on he gela in-coa ed
su aces illus a e success ul adhesion o he cells on he
e e ence, PANI-S, and PANI-B and i s absence on PANI-
PAMPSA. I can be concluded ha he abili y o cells o
adhe e o polyaniline su aces depended on he p esence o
e al cal se um in he medium and su ace coa ing by gela in.
In he case o he e e ence, he p esence o e al cal se um
caused i o pe o m mo e a o ably compa ed o gela in
coa ing.
Fo he s 48 h ae seeding, cells adhe ed o all es ed
su aces; howe e , only on he e e ence hei mo phology
changed in he expec ed manne , while on he o he su aces
cells emained sphe oidal. In addi ion, he sp eading o ca -
diomyocy es occu ed on he e e ence, and cells we e compac ly
adhe ed. La e on, such sp eading was also obse ed on PANI-B
(day 9 ae seeding). Al hough du ing he wo-week cul i a ion
pe iod many ca diomyocy es also adhe ed o PANI-S and PANI-
PAMPSA, no sp eading o cells was obse ed on hese su aces.
The adhesion and p oli e a ion o H9c2 ca diac myoblas s on
polyaniline lms p epa ed om sa u a ed solu ions o polyani-
line in N-me hyl-2-py olidone we e s udied by Bidez e al.
10
I espec i e o he ac ha he ini ial cell adhesion was some-
wha educed, i was epo ed ha he o e all a e o cell p oli -
e a ion was simila o a con ol and, ae six days, he cells on he
polyaniline su ace o med a uni o m, homogenous monolaye .
Al hough, i is difficul o gene alize esul s om one cell ype o
ano he , he esul s o Bidez e al.
10
suppo he ndings o he
p esen wo k ega ding PANI-B sample. Polyaniline is a ma e ial
whose biocompa ibili y can c ucially depend on he used dopan
This jou nal is © The Royal Socie y o Chemis y 2015 RSC Ad .,2015,5,68796–68805 | 68801
Pape RSC Ad ances
Open Access A icle. Published on 06 Augus 2015. Downloaded on 09/09/2015 12:35:16.
This a icle is licensed unde a
C ea i e Commons A ibu ion 3.0 Unpo ed Licence.
View A icle Online
acids, as hey can inuence he leaching o oxic subs ances, and
he su ace cha ac e is ics o he sample. In es iga ion o his
ac o was conduc ed by Wang e al.
11
In hei wo k, polyaniline
lms we e p epa ed by polyme izing deposi ion in si u wi h ou
diffe en acids ollowed by cas ing on o he su ace o a poly-
e auo oe hylene subs a e. Pe chlo ic, hyd ochlo ic, malic,
and ci ic acids we e s udied. These polyaniline lms we e es ed
o adhesion and p oli e a ion wi h PC-12 pheoch omocy oma
cells and i was ound ou ha all lms enabled cell adhesion and
p oli e a ion. Simul aneously, i was concluded ha he effec o
dopan acid on cell p oli e a ion is negligible. Ce ain s udies
also e ealed ha cell adhesion was posi i ely inuenced by
coa ing he diffe en ca ie ma e ials wi h polyaniline. Fo
example, Si wa e su aces deposi ed wi h polyaniline we e
s udied by Liu e al.
12
using PC-12 cells de i ed om pheoch o-
mocy oma o he a ad enal medulla. Al hough he es ing p o-
ceeded o only ou days, i was ob ious ha he polyaniline-
coa ed su ace allowed be e cell adhesion and p oli e a ion
compa ed o ba e Si su aces. In he ligh o he abo e men ioned
wo ks and he esul s o his s udy, i is clea ha polyaniline
lms can be use ul as subs a es o issue enginee ing.
These ndings a e consis en wi h ESC adhesion on ma e ials
combining polyaniline wi h a ious biocompa ible polyme s, e.g.
human mesenchymal s em cells on chi in/polyaniline nano-
be s,
33
bone ma ow mesenchymal s em cells on polyaniline
con aining hyd ogel,
34
o ne e s em cells on poly-L-lac ide/
polyaniline nanobe s.
35
3.5. S em cell diffe en ia ion
The conduc ing polyme s a e mos ly conside ed o applica-
ions in he bio-enginee ing o elec o-sensi i e issues.
2,5
The e o e he in es iga ion o complex na u e o polyaniline
beha io wi h espec o neu ogenesis and ca diomyogenesis o
ESC is o eno mous in e es .
3.5.1. Ca diomyogenesis in ESC. To analyze he possible
effec o es ed polyaniline lms on cell de elopmen p ocesses,
a p o ocol enabling he diffe en ia ion o ca diomyocy es om
ESC was employed.
25,36
P ima y e idence o he p esence o
ca diomyocy es is he obse a ion o bea ing cells in cul u e.
Unde he s udied condi ions, bea ing oci we e obse ed on
su aces om day 11 o diffe en ia ion (da a no shown). qRT-
PCR analyses o he exp essions o gene ansc ip s ypical
o ca diomyocy es ( ansc ip ion ac o Nkx2.5 and compo-
nen s o con ac ile appa a us, such as sa come ic aac inin
(ACTN2) and myosine hea y chains aMyh6) and b(Myh7), did
no show any signican diffe ence be ween he e e ence and
es ed polyaniline su aces (Fig. 6). Thus, i can be concluded
ha unde he es ed condi ions ca diomyogenesis in ESC
p oceeds in he same manne on all su aces. In he p esen
s udy, whe e no ex e nal elec ical eld was applied, he bea ing
Fig. 5 Ca diomyocy e adhesion on polyaniline (selec ed om ESC clone HG8). Adhesion o ca diomyocy e on: (a) e e ence ( issue cul u e
plas ic coa ed wi h gela in); (b) PANI-B; (c) PANI-S and (d) PANI-PAMPSA a e 14 days cul i a ion on su aces coa ed by gela in in p esence o
DMEM con aining e al cal se um.
68802 |RSC Ad .,2015,5,68796–68805 This jou nal is © The Royal Socie y o Chemis y 2015
RSC Ad ances Pape
Open Access A icle. Published on 06 Augus 2015. Downloaded on 09/09/2015 12:35:16.
This a icle is licensed unde a
C ea i e Commons A ibu ion 3.0 Unpo ed Licence.
View A icle Online
o ca diomyocy es obse ed on he es ed conduc ing lms was
compa able o ha on he e e ence. The synch oniza ion o
he bea ing o ca diomyocy e clus e s induced by elec ical
impulses, as desc ibed by Hsiao e al.,
5
can he e o e be
expec ed. De elopmen al p ocesses a e e y sensi i e o en i-
onmen effec s.
37
Ca diomyogenesis in ESC is, o example,
s anda dized me hod o he es ing o emb yo oxici y,
38
hus, i
can be also concluded ha he es ed su aces possess no oxic
o emb yo oxic effec .
3.5.2. Neu ogenesis in neu osphe es. The biocompa ibili y
o polyaniline su aces was also es ed wi h espec o neu al
p ogeni o s. Neu al p ogeni o s we e isola ed om mouse b ain
o 13.5 dpc and expanded in sel - enewing media in he p es-
ence o g ow h ac o s inhibi ing hei diffe en ia ion.
Fig. 6 Rela i e mRNA exp ession o ca diomyocy es ma ke s gene.
Fig. 7 Neu o adhesion. Adhesion o neu osphe es on: (a) e e ence ( issue cul u e plas ic); (b) PANI-B; (c) PANI-S and (d) PANI-PAMPSA.
Absence o cell deb is indica ing cy o oxici y is no obse ed.
This jou nal is © The Royal Socie y o Chemis y 2015 RSC Ad .,2015,5,68796–68805 | 68803
Pape RSC Ad ances
Open Access A icle. Published on 06 Augus 2015. Downloaded on 09/09/2015 12:35:16.
This a icle is licensed unde a
C ea i e Commons A ibu ion 3.0 Unpo ed Licence.
View A icle Online
Expanding neu al p ogeni o s o ming neu osphe es we e
seeded on o he polyaniline and e e ence su aces in diffe -
en ia ing media deple ed o sel - enewing g ow h ac o s. As can
be seen in Fig. 7, neu osphe es adhe ed o, and sp ead well on
he e e ence and PANI-B su aces, less well on he PANI-S
su ace, and only in a limi ed way on he PANI-PAMPSA
su ace. Ae he nex 4 days o cul u e, cells we e collec ed
and he exp ession o he neu al specic ansc ip s was
de e mined. No signican diffe ences in hese exp essions
we e obse ed. Simila ly o esul s eco ded wi h ca diomyo-
genesis, i can be concluded ha PANI-S and PANI-B ha e no
signican effec on he de elopmen o neu onal p ogeni o s.
In he case o he PANI-PAMPSA, he cells did no con o m o
hei s anda d beha io ; howe e , diffe en ia ion seemed o be
unaffec ed (Fig. 8).
Gene ally, he s em cell g ow h on he es ed su aces co -
esponded o cell adhesion, and i can be concluded ha , in
e ms o cell compa ibili y, p is ine polyaniline (PANI-S and
PANI-B) possesses mo e a o able p ope ies compa ed o PANI-
PAMPSA. The ca diomyogenesis and neu ogenesis on all es ed
su aces we e no diffe en om hose obse ed on he e e -
ence. The absence o a nega i e impac o polyaniline on ESC
diffe en ia ion, which was o iginally con med in ou s udy,
sugges s ha his polyme , e en in p is ine o m, can be sa ely
used in ad anced biomedical applica ions. As ESC in e ac ion
wi h polyaniline has no p e iously been s udied in e ms o
ca diomyogenesis and neu ogenesis, hese ou comes can be
conside ed as no el and o iginal.
4. Conclusions
The o iginal s udy p esen ed he e explo es he beha io o
emb yonic s em cells on he su aces o p is ine and modied
polyaniline lms. The esul s e ealed ha cell beha iou on
p is ine polyaniline, mainly polyaniline base, is compa able o
ha obse ed on e e ence issue cul u e plas ic. The modi-
ca ion o p is ine polyanilines wi h PAMPSA dec eases emb y-
onic s em cell adhesion and disabled sp eading on his su ace.
In addi ion, emb yonic s em cell diffe en ia ion on polyaniline
su aces is p esen ed o he s ime. I was e ealed ha
p is ine polyaniline has no nega i e inuence on
ca diomyogenesis o neu ogenesis and is ee o emb yo oxici y,
which opens up he possibili y o de ising a wide ange o
po en ial applica ions o his conduc ing polyme in he eld
o biomedical enginee ing.
Au ho con ibu ions
Pe Humpol´
ı
ˇ
cek and Ka a zyna Anna Radaszkiewicz con ib-
u ed equally o he manusc ip . The manusc ip was w i en
h ough con ibu ions o all au ho s. Sample p epa a ion was
ca ied ou by VK and JS. MT pe o med Raman Spec oscopy,
ML and AM pe o med AFM and Su ace Ene gy e alua ion. The
cell s udies was ca ied ou by PH, JP, KAR, HV and ZK. All
au ho s ha e gi en app o al o he nal e sion o he
manusc ip .
Acknowledgemen s
The nancial suppo o he Czech Science Founda ion (13-
08944S) is g a e ully acknowledged. This wo k was suppo ed by
he Minis y o Educa ion, You h and Spo s o he Czech
Republic –P og am NPU I (LO1504).
Re e ences
1 T. H. Qazi, R. Rai and A. R. Boccaccini, Bioma e ials, 2014, 35,
9068–9086, DOI: 10.1016/j.bioma e ials.2014.07.020.
2 P.H.PeckhamandJ.S.Knu son,Annu. Re . Biomed. Eng., 2005,
7,327–360, DOI: 10.1146/annu e .bioeng.6.040803.140103.
3 L. C. Klo h, The In e na ional Jou nal o Lowe Ex emi y
Wounds, 2005, 4,23–44, DOI: 10.1177/1534734605275733.
4 D. M. Ciombo and R. K. Aa on, Foo Ankle Clin., 2005, 10,
579–593, DOI: S1083-7515(05)00077-X.
5 C. W. Hsiao, M. Y. Bai, Y. Chang, M. F. Chung, T. Y. Lee,
C. T. Wu, B. Mai i, Z. X. Liao, R. K. Li and H. W. Sung,
Bioma e ials, 2013, 34, 1063–1072, DOI: 10.1016/
j.bioma e ials.2012.10.065.
6 J. A. Geno ese, C. Spadaccio, J. Lange , J. Habe, J. Jackson
and A. N. Pa el, Biochem. Biophys. Res. Commun., 2008, 370,
450–455, DOI: 10.1016/j.bb c.2008.03.115.
Fig. 8 Rela i e mRNA exp ession o neu osphe es ma ke s gene.
68804 |RSC Ad .,2015,5,68796–68805 This jou nal is © The Royal Socie y o Chemis y 2015
RSC Ad ances Pape
Open Access A icle. Published on 06 Augus 2015. Downloaded on 09/09/2015 12:35:16.
This a icle is licensed unde a
C ea i e Commons A ibu ion 3.0 Unpo ed Licence.
View A icle Online