Ci a ion: Máˇcalo á, D.;
Janalíko á, M.; Sedlaˇ íko á, J.;
Rek oˇ íko á, I.; Kou ný, M.; Ple a, P.
Geno ypic and Pheno ypic De ec ion
o Polyhyd oxyalkanoa e P oduc ion
in Bac e ial Isola es om Food. In . J.
Mol. Sci. 2023,24, 1250. h ps://
doi.o g/10.3390/ijms24021250
Academic Edi o : Da io Puppi
Recei ed: 30 No embe 2022
Re ised: 22 Decembe 2022
Accep ed: 5 Janua y 2023
Published: 8 Janua y 2023
Copy igh : © 2023 by he au ho s.
Licensee MDPI, Basel, Swi ze land.
This a icle is an open access a icle
dis ibu ed unde he e ms and
condi ions o he C ea i e Commons
A ibu ion (CC BY) license (h ps://
c ea i ecommons.o g/licenses/by/
4.0/).
In e na ional Jou nal o
Molecula Sciences
A icle
Geno ypic and Pheno ypic De ec ion o Polyhyd oxyalkanoa e
P oduc ion in Bac e ial Isola es om Food
Daniela Máˇcalo á1, Magda Janalíko á1, Jana Sedlaˇ íko á2, I e a Rek oˇ íko á1, Ma ek Kou ný1
and Pa el Ple a 1,*
1Depa men o En i onmen al P o ec ion Enginee ing, Facul y o Technology, Tomas Ba a Uni e si y in Zlin,
275 Va ecko a, 76001 Zlin, Czech Republic
2Depa men o Fa , Su ac an and Cosme ics Technology, Facul y o Technology, Tomas Ba a Uni e si y in
Zlin, 275 Va ecko a, 76001 Zlin, Czech Republic
*Co espondence: [email p o ec ed]
Abs ac :
Polyhyd oxyalkanoa es (PHAs) a e widely used in medical and po en ially in o he applica-
ions due o hei biocompa ibili y and biodeg adabili y. Unde s anding PHA biosyn he ic pa hways
may lead o he de ec ion o app op ia e condi ions (subs a es) o p oducing a pa icula PHA ype
by a speci ic mic obial s ain. The aim o his s udy was o es ablish a me hod enabling po en ially
in e es ing PHA bac e ial p oduce s o be ound. In he s udy, all ou classes o PHA syn hases and
o he genes in ol ed in PHA o ma ion ( abG,phaA,phaB,phaG, and phaJ) we e de ec ed by PCR in
64 bac e ial collec ion s ains and ood isola es. Acine obac e ,Bacillus,Cup ia idus,Esche ichia,Kleb-
siella,Lellio ia,Lysinibacillus,Mammaliicoccus,Oceanobacillus,Pan oea,Pe ibacillus,P ies ia,Pseudomonas,
Rahnella,S aphylococcus, and S eno ophomonas gene a we e ound among hese s ains. F uc ose,
glucose, sun lowe oil, and p opionic acid we e u ilized as ca bon sou ces and PHA p oduc ion was
de ec ed by Sudan black s aining, Nile blue s aining, and FTIR me hods. The class I syn hase and
phaA genes we e he mos equen ly ound, indica ing he s ains’ abili y o syn hesize PHA om
ca bohyd a es. Among he es ed bac e ial s ains, he Pseudomonas genus was iden i ied as able o
u ilize all es ed ca bon sou ces. The Pseudomonas ex emo ien alis s ain was de e mined as a p ospec
o bio echnology applica ions.
Keywo ds: bioma e ial; bac e ial s ains; biosyn he ic pa hways; polyhyd oxyalkanoa e; sc eening
1. In oduc ion
Polyhyd oxyalkanoa es (PHAs) a e a g oup o biodeg adable, biocompa ible polyes e s
ha some mic oo ganisms can syn hesize in inclusions as ene gy s o age molecules. Based
on he numbe o ca bons, PHAs a e classi ied as sho -chain-leng h (scl) PHAs wi h
3–5 ca bons
, medium-chain-leng h (mcl) PHAs wi h 6–14 ca bons, and long-chain-leng h
(lcl) PHAs wi h mo e han 15 ca bons [
1
]. Due o hese monome composi ion a ia ions,
hese polyme s can ha e a ious p ope ies, e.g., mechanical cha ac e is ics. Scl PHAs
a e inelas ic and agile polyme s, which is due o hei highe c ys allini y. The elas ici y
o PHAs inc ease wi h he numbe o ca bons in he monome s. To ob ain ideal p ope -
ies o a gi en applica ion, copolyme s wi h di e en monome s can be o med. Due
o hei biodeg adabili y, PHAs ha e he po en ial o use as a packaging ma e ial and
in he p oduc ion o ag icul u al ilms [
2
,
3
]. I is likely ha o e ime, PHAs will e en
pa ially eplace ypical packaging ma e ials such as polye hylene, polyp opylene, and
polye hylene e eph hala e [
4
]. Ano he ad an age is he biocompa ibili y o PHAs wi h
blood and issues [
5
]. As a esul , PHAs can be used in a wide ange o comme cial and
biomedical applica ions [
6
,
7
]. Howe e , he cos o PHA is s ill subs an ially highe han
ha o commonly used polyme s o common applica ions such as packaging, so he e
is an e o o educe he cos o hese ma e ials [
8
]. Op ions o he p ice educ ion in-
clude using was e ma e ials and sea ching o new, mo e capable mic obial p oduce s [
9
].
In . J. Mol. Sci. 2023,24, 1250. h ps://doi.o g/10.3390/ijms24021250 h ps://www.mdpi.com/jou nal/ijms
In . J. Mol. Sci. 2023,24, 1250 2 o 13
Unde s anding biosyn he ic pa hways can also help o educe he cos and o op imize
applica ion-speci ic PHAs [10].
Se e al biosyn he ic pa hways o PHA ha e been desc ibed [
11
]. Only he pa hways
in es iga ed he e a e desc ibed in he ollowing ex and Figu e 1. The esul ing me abolism
and he o ma ion o a gi en ype o PHA depends on he nu i ional s a us o he gi en
mic oo ganism [12].
PHAs can be syn he ized om ela ed subs a es ha se e as monome p ecu so s.
The esul ing PHA hen, in gene al, co esponds o he o iginal subs a e. Mos o hese
p ecu so s a e di e en a ian s o a y acids p ocessed by PHA p oduce s in o PHA
monome s using he
β
-oxida ion enzyma ic pa hway. This PHA syn hesis pa hway is
impo an o p oducing mcl PHAs [
13
]. In e media e p oduc s o
β
-oxida ion (enoyl-CoA
and 3-ke oacyl-CoA) can be used o o m PHA by o he enzymes. In b anch A (Figu e 1),
3-ke oacyl-CoA is used o p oduce PHA ia 3-ke oacyl educ ase (FabG), o ming R-3-
hyd oxyacyl-CoA PHA monome s [
14
]. Pa hway B (Figu e 1) shows he use o enoyl-CoA
by he R-speci ic enoyl hyd a ase (phaJ) o o m PHA monome s [15].
In .J.Mol.Sci.2023,24,xFORPEERREVIEW3o 14



Figu e1.PHAbiosyn he icpa hways:(A,B)P oduc iono PHAs om ela edca bonsou ces iaβ‐
oxida ion;(C,D)p oduc iono sclPHAs omun ela edca bonsou ces;(E)p oduc iono mclPHAs
ia a yacidsyn hesis.(FabG:3‐ke oacyl educ ase;PhaA:3‐ke o hialase;PhaB:NADPHace oace‐
yl‐CoA educ ase;PhaC:PHAsyn hase;PhaG:hyd oxyacyl‐ACPspeci ic hioes e ase;PhaJ:R‐spe‐
ci icenoylhyd a ase;PHA:polyhyd oxyalkanoa e;P(3HB):poly(3‐hyd oxybu y a e);andP(3HV):
poly(3‐hyd oxy ale a e).)(Adap ed om[14–18].)
Theaimo  hiss udywas oiden i yPHAsyn hasesando he genesin ol edin
PHAp oduc ion( abG,phaA,phaB,phaG,andphaJ)inbac e ialisola es om ood odis‐
inguishs ains ha canp oducePHA omce ainsubs a es.PHAp oduc ionwas e ‐
i iedusingglucose, uc ose,sun lowe oil,andp opionicacidassubs a es.
2.Resul s
Six ys ainswe eob ainedbyisola ion om ui s, ege ables,mea ,anddai yp od‐
uc s.Theseisola eswe eiden i iedbyMALDI‐TOFo 16S RNAsequencing(TableS1).
Theiden i ica ion e ealed ha a o alo se en amilieswe ede ec ed,o which he e
we e ou eens ainso Bacillaceae, wen y‐sixs ainso En e obac e iaceae,sixs ainso 
Mo axellaceae,nines ainso Pseudomonadaceae, wos ainso S aphylococcaceae,and h ee
s ainso Xan homonadaceae.Sc eeningo geneswaspe o medwi hdesignedg oupso 
p ime sin h eedi e en mul iplexPCRs(2.2).Cup ia idusneca o ATCC17699,Pseudo‐
monasae uginosaATCC27853,andPseudomonasmendocinaATCC25411we eposi i e o 
somede ec edgenes,and heses ainswe e henusedascon ols(Table3).Acco ding o
Mon eneg oe al.[28],Esche ichiacoliDH5αwasusedasanega i econ ol.
Table3.Thelis o s ains(collec ionand oodisola es)wi hde ec edgenesusedasposi i econ ols
o mul iplexPCRs.
S ainGenesRela edRe e ences
Cup ia idusneca o ATCC17699phaA,phaB,phaC(classI)[29]
PseudomonasmendocinaATCC25411phaC(classII)[30]
Pseudomonasae uginosaATCC27853phaJ, abG[22,31]
S eno ophomonasmal ophiliaphaE(classIII)[32]
Figu e 1.
PHA biosyn he ic pa hways: (
A
,
B
) P oduc ion o PHAs om ela ed ca bon sou ces ia
β
-oxida ion; (
C
,
D
) p oduc ion o scl PHAs om un ela ed ca bon sou ces; (
E
) p oduc ion o mcl
PHAs ia a y acid syn hesis. (FabG: 3-ke oacyl educ ase; PhaA: 3-ke o hialase; PhaB: NADPH
ace oace yl-CoA educ ase; PhaC: PHA syn hase; PhaG: hyd oxyacyl-ACP speci ic hioes e ase;
PhaJ: R-speci ic enoyl hyd a ase; PHA: polyhyd oxyalkanoa e; P(3HB): poly(3-hyd oxybu y a e); and
P(3HV): poly(3-hyd oxy ale a e)). (Adap ed om [14–18]).
Ca bohyd a es, i.e., glucose, a e ano he subs a e ha can p oduce scl PHAs. A he
beginning o he pa hway, glucose is me abolized in glycolysis o o m py u a e. Du -
ing he ae obic g ow h, py u a e is con e ed o ace yl-CoA. In pa hway C (Figu e 1),
wo molecules o ace yl-CoA a e hen condensed by 3-ke o hialase (PhaA) o o m ace oace yl-
CoA, which is subsequen ly educed by NADPH ace oace yl-CoA educ ase (PhaB) o o m
hyd oxybu y yl-CoA. The inal s ep is he polyme iza ion o hyd oxybu y yl-CoA by PHA
syn hase (PhaC) o o m poly(3-hyd oxybu y a e) (P(3HB)) [
16
]. Pa hway D (Figu e 1) shows
a way o p oduce poly(3-hyd oxy ale a e) (P(3HV)) om succinyl-CoA o med in he i-
ca boxylic acid cycle. Succinyl-CoA is con e ed o 2-(R)-me hylmalonyl-CoA by coenzyme
In . J. Mol. Sci. 2023,24, 1250 3 o 13
B12-dependen me hylmalonyl CoA mu ase (Sbm), which is subsequen ly con e ed o
p opionyl-CoA by me hylmalonyl-CoA deca boxylase (Yg G). P opionyl-CoA is hen con-
e ed o 3-ke o ale yl-CoA and subsequen ly o (R)-3-hyd oxy ale yl-CoA by PhaB, which
subsequen ly p oduces P(3HV) [17].
The e a e se e al pa hways o mcl PHA biosyn hesis om a ious ca bon sou ces
based on a y acid syn hesis. Unlike
β
-oxida ion, which sho ens a y acyl subs a es by
wo ca bons o elease ace yl-CoA in each cycle and whe e all in e media es a e linked o
CoA, a y acid syn hesis elonga es he molecules by wo ca bons pe cycle ia in e me-
dia es linked o acyl ca ie p o ein (ACP). Pa hway E (Figu e 1) u ilizes he in e media e
(R)-3-hyd oxyacyl-ACP, which is ans o med by hyd oxyacyl-ACP speci ic hioes e ase
(PhaG) o elease (R)-3-hyd oxyalkanoic acid. This hyd oxy acid can be ac i a ed by
acyl-CoA syn hase (AlkK) o o m (R)-3-hyd oxyacyl-CoA, which is subsequen ly used in
PHA polyme iza ion [18].
Fo he o ma ion o PHA, a necessa y enzyme in all men ioned pa hways is PHA
syn hase, which polyme izes he monome uni s and eleases CoA. PHA syn hases a e
di ided in o ou classes, dis inguished by hei p ima y sequences, subs a e speci ici y,
and subuni composi ion [
19
]. Class I and II syn hases a e o med om one PhaC subuni ,
class III o ms a he e odime om PhaC–PhaE subuni s, and class IV o ms a he e odime
om PhaC–PhaR subuni s [
20
]. Class I, III, and IV syn hases a o sho -chain monome s,
hus p e e en ially p oducing scl PHAs. In e es ingly, class II p e e s medium leng h
monome s, hus p oducing mcl PHAs [21].
The aim o his s udy was o iden i y PHA syn hases and o he genes in ol ed in PHA
p oduc ion ( abG,phaA,phaB,phaG, and phaJ) in bac e ial isola es om ood o dis inguish
s ains ha can p oduce PHA om ce ain subs a es. PHA p oduc ion was e i ied using
glucose, uc ose, sun lowe oil, and p opionic acid as subs a es.
2. Resul s
Six y s ains we e ob ained by isola ion om ui s, ege ables, mea , and dai y p od-
uc s. These isola es we e iden i ied by MALDI-TOF o 16S RNA sequencing (Table S1).
The iden i ica ion e ealed ha a o al o se en amilies we e de ec ed, o which he e
we e ou een s ains o Bacillaceae, wen y-six s ains o En e obac e iaceae, six s ains o
Mo axellaceae, nine s ains o Pseudomonadaceae, wo s ains o S aphylococcaceae, and h ee
s ains o Xan homonadaceae. Sc eening o genes was pe o med wi h designed g oups
o p ime s in h ee di e en mul iplex PCRs (2.2). Cup ia idus neca o ATCC 17699, Pseu-
domonas ae uginosa ATCC 27853, and Pseudomonas mendocina ATCC 25411 we e posi i e o
some de ec ed genes, and hese s ains we e hen used as con ols (Table 1). Acco ding o
Mon eneg o e al. [22], Esche ichia coli DH5αwas used as a nega i e con ol.
Table 1.
The lis o s ains (collec ion and ood isola es) wi h de ec ed genes used as posi i e con ols
o mul iplex PCRs.
S ain Genes Rela ed Re e ences
Cup ia idus neca o ATCC 17699 phaA,phaB,phaC (class I) [23]
Pseudomonas mendocina ATCC 25411 phaC (class II) [24]
Pseudomonas ae uginosa ATCC 27853 phaJ, abG [25,26]
S eno ophomonas mal ophilia phaE (class III) [27]
P ies ia mega e ium phaR (class IV) [28]
Pseudomonas pu ida phaG [29]
The esul s o he iden i ica ion, geno ypic, and pheno ypic de ec ion o PHA p oduc-
ion a e shown in Tables 2,3and S1. Twen y-six s ains we e classi ied in o he amily
En e obac e iaceae (gene a Esche ichia,Klebsiella,Lellio ia,Pan oea, and Rahnella) om ood o
plan o igin. Howe e , only Esche ichia coli s ains we e ound in oods o animal o igin.
Fou een s ains o he amily Bacillaceae we e assigned in o gene a Bacillus,Lysinibacillus,
Oceanobacillus,Pe ibacillus, and P ies ia. All six s ains om he amily Mo axellaceae belong
In . J. Mol. Sci. 2023,24, 1250 4 o 13
o he Acine obac e calcoace icus species. They we e isola ed om le uce, cele y s alk, and
whi e cabbage. Nine s ains isola ed om ui and ege ables we e classi ied in o he
amily Pseudomonadaceae as gene a Pseudomonas, e.g., P. ex emo ien alis and P. o yzihabi-
ans. Two S eno ophomonas mal ophilia s ains we e isola ed om whi e adish and dai y
p oduc s and S. hizophila was isola ed om bee oo . Two s ains we e assigned in o he
amily S aphylococcaceae, and axons S aphylococcus succinus and Mammaliicoccus sciu i we e
iden i ied om whi e cabbage and cucumbe .
Table 2.
Geno ypic de ec ion o ou classes o PHA syn hases and o he genes in ol ed in PHA
o ma ion (%) in ood isola es and collec ion s ains om se en amilies.
% * n phaSyn1 phaSyn2 phaSyn3 phaSyn4 phaA phaB phaG abG phaJ
To al 64 42.2 4.7 10.9 15.6 45.3 18.8 4.7 12.5 10.9
En e obac e iaceae
27 51.9 0.0 0.0 18.5 74.1 11.1 3.7 3.7 3.7
Bacillaceae 14 14.3 0.0 7.1 28.6 21.4 14.3 0.0 7.1 0.0
Pseudomonadaceae
11 45.5 27.3 27.3 0.0 36.4 27.3 18.2 36.4 27.3
Mo axellaceae 6 33.3 0.0 16.7 0.0 16.7 33.3 0.0 16.7 16.7
Xan homonadaceae
3 33.3 0.0 66.7 33.3 0.0 33.3 0.0 33.3 33.3
S aphylococcaceae
2 100.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 50.0
Bu kholde iaceae
1 100.0 0.0 0.0 0.0 100.0 100.0 0.0 0.0 0.0
* Pe cen age o posi i e s ains om each amily.
Table 3.
Pheno ypic de ec ion o PHA p oduc ion (%) om ou di e en ca bon sou ces ( eeds ock)
in ood isola es and collec ion s ains om se en amilies.
% * nFeeds ock
F uc ose Glucose Sun lowe Oil P opionic Acid
To al 64 29.7 28.1 9.4 26.6
En e obac e iaceae 27 3.7 3.7 0.0 22.2
Bacillaceae 14 42.9 35.7 0.0 28.6
Pseudomonadaceae 11 72.7 90.9 36.4 36.4
Mo axellaceae 6 16.7 0.0 16.7 16.7
Xan homonadaceae 3 33.3 0.0 0.0 0.0
S aphylococcaceae 2 50.0 50.0 50.0 50.0
Bu kholde iaceae 1 100.0 100.0 0.0 100.0
* Pe cen age o posi i e s ains om each amily.
The mos equen ly ound PHA syn hase genes we e o class I (phaSyn1), which was
de ec ed in 42% o he es ed bac e ia (Table 2).
O he o he genes in ol ed in PHA p oduc ion, phaA was ound in 45% o he
moni o ed s ains. This equen occu ence indica es ha he es ed bac e ia mos o en
u ilized he suga subs a es o o m scl PHAs, which was subsequen ly con i med by he
pheno ype es s. Con e sely, class II o he PHA syn hase gene (phaSyn2) and phaG we e
he leas p esen ; hey we e p esen only in 5% o s ains. Class II o he PHA syn hase
gene was only ound in he Pseudomonadaceae amily; he e o e, i is likely ha s ains o
his amily will be able o p oduce mcl PHA.
The u iliza ion o subs a es (glucose, uc ose, p opionic acid, and sun lowe oil) o
PHA p oduc ion was es ed by Sudan black s aining, Nile blue s aining, and FTIR de ec ion.
Figu e 2shows he esul s o he Sudan black s aining, whe e he dye binds s ongly o he
PHA g anules and should emain linked e en a e he subsequen e hanol wash. As a
esul , he colonies o p oduce s a e da k and non-p oducing colonies a e decolo ed. The
s aining wi h Nile blue (Figu e 2) is based on he same p inciple, bu PHA p oduc ion is
de e mined unde ul a iole ligh , whe e PHA-p oducing colonies a e luo escen . As
s aining migh be un eliable, PHA p oduc ion was also de ec ed by FTIR. Figu e 2shows
he FTIR spec a om in si u PHA de ec ion. In he spec a o PHA p oduce s, he main
abso p ion peak a 1735 cm
−1
co esponds o a C=O g oup, and cha ac e is ic peaks in he
In . J. Mol. Sci. 2023,24, 1250 5 o 13
ange o 1200 o 900 cm
−1
can be assigned o C-O-C. Due o he possible de iciencies o he
pheno ypic de ec ion me hods, s ains we e conside ed posi i e o PHA p oduc ion by
using a ce ain subs a e only i i was con i med by a leas wo me hods.
In .J.Mol.Sci.2023,24,xFORPEERREVIEW5o 14



Figu e2.Pheno ypicde ec iono PHAp oduc ion:Nileblues aining;Sudanblacks aining;and
de ec ionbyFTIR(A)Cup ia idusneac o ATCC17699,(B)Pseudomonasex emo ien alisa ePHA+
and(C)Esche ichiacoliDH5αisPHA−.
Table5shows he esul s om hepheno ypicde ec iono PHAp oduc ionin ood
isola esandcollec ions ains.Ascanbeseen,abou 30%o  he es eds ainswe eable o
u ilizeca bohyd a es( uc oseandglucose) o PHAp oduc ion.Con e sely,sun lowe 
oilwasu ilizedby helowes numbe o  es eds ains(10%).Among ep esen a i eso 
he amiliesPseudomonadaceaeandS aphylococcaceae, heabili y op oducePHAwasal‐
waysde ec edwi ha leas one omall es edsubs a es.Howe e ,only h ees ains
om hePseudomonadaceae amilycouldu ilizeall ou  es edsubs a es.Among32 ep‐
esen a i es om heBacillaceae,En e obac e iaceae,Mo axellaceae,andXan homonadaceae
amilies, heabili y ousea leas oneo  he es edsubs a es o PHAp oduc ionwasno 
de ec ed.Despi e his inding,someo  hemmaybecapableo p oduc ion omo he 
subs a es ha we eno includedin he es sin hiss udy.
AscanbeseeninTable4,geneso PHAsyn haseclassI,III,andIV(phaSyn1,phaSyn3,
andphaSyn4),phaA,phaB,and abG,we ede ec edin heBacillaceae amily.These esul s
indica e heabili y op oducesclPHAs omca bohyd a esaswellas om ela edca bon
sou ces iaβ‐oxida ion.Howe e ,pheno ypicde ec ion(Table5) e ealedonly heabili y
ou ilize uc ose,glucose,andp opionicacid.Mo e hanone‐ hi do Bacilluss ains
we eable op oducePHAonly omsaccha ides.
F om heBu kholde iaceae amily,only hecollec ions ainCup ia idusneca o ATCC
17699wasin es iga edin hiss udy.ClassIPHAsyn hasegenes,phaA,andphaBwe e
de ec edin hiss ain(Table4),indica ing heabili y ouseca bohyd a es,whichwasalso
p o enpheno ypically(Table5).Unlike hemino i ys ains om heBu kholde iaceae
amily, hes ains om heEn e obac e iaceae amilywe e hemos nume ous,i.e.,27
s ains.Ne e heless,onlynines ainscoulduseoneo  he es edsubs a es(Table5).All
Figu e 2.
Pheno ypic de ec ion o PHA p oduc ion: Nile blue s aining; Sudan black s aining; and
de ec ion by FTIR (A) Cup ia idus neac o ATCC 17699, (B) Pseudomonas ex emo ien alis a e PHA+ and
(C) Esche ichia coli DH5αis PHA−.
Table 3shows he esul s om he pheno ypic de ec ion o PHA p oduc ion in ood
isola es and collec ion s ains. As can be seen, abou 30% o he es ed s ains we e able o
u ilize ca bohyd a es ( uc ose and glucose) o PHA p oduc ion. Con e sely, sun lowe
oil was u ilized by he lowes numbe o es ed s ains (10%). Among ep esen a i es o he
amilies Pseudomonadaceae and S aphylococcaceae, he abili y o p oduce PHA was always
de ec ed wi h a leas one om all es ed subs a es. Howe e , only h ee s ains om he
Pseudomonadaceae amily could u ilize all ou es ed subs a es. Among 32 ep esen a i es
om he Bacillaceae,En e obac e iaceae,Mo axellaceae, and Xan homonadaceae amilies, he
abili y o use a leas one o he es ed subs a es o PHA p oduc ion was no de ec ed.
Despi e his inding, some o hem may be capable o p oduc ion om o he subs a es ha
we e no included in he es s in his s udy.
As can be seen in Table 2, genes o PHA syn hase class I, III, and IV (phaSyn1,phaSyn3,
and phaSyn4), phaA,phaB, and abG, we e de ec ed in he Bacillaceae amily. These esul s
indica e he abili y o p oduce scl PHAs om ca bohyd a es as well as om ela ed ca bon
sou ces ia
β
-oxida ion. Howe e , pheno ypic de ec ion (Table 3) e ealed only he abili y
o u ilize uc ose, glucose, and p opionic acid. Mo e han one- hi d o Bacillus s ains we e
able o p oduce PHA only om saccha ides.
F om he Bu kholde iaceae amily, only he collec ion s ain Cup ia idus neca o ATCC
17699 was in es iga ed in his s udy. Class I PHA syn hase genes, phaA, and phaB we e
de ec ed in his s ain (Table 2), indica ing he abili y o use ca bohyd a es, which was

In . J. Mol. Sci. 2023,24, 1250 6 o 13
also p o en pheno ypically (Table 3). Unlike he mino i y s ains om he Bu kholde iaceae
amily, he s ains om he En e obac e iaceae amily we e he mos nume ous, i.e., 27 s ains.
Ne e heless, only nine s ains could use one o he es ed subs a es (Table 3). All six
ep esen a i es om he Mo axellaceae amily we e iden i ied as Acine obac e calcoace icus
(Table S1). The p obable abili y o p oduce scl PHAs om ela ed and un ela ed ca bon
sou ces was gene ically demons a ed o his species (Table 2). Pheno ypic es s con i med
his sugges ion; PHA p oduc ion was also e i ied om all es ed sou ces excep o
glucose (Table 3). All sc eened genes, excep PHA syn hase class IV, we e ound in he
Pseudomonadaceae amily (Table 2). Due o he p esence o hese genes, Pseudomonadaceae
p oduced PHA om all es ed ca bon sou ces (Table 3). The mos de ec ed genes and he
abili y o p oduce PHA om all sou ces we e p o en in he Pseudomonas ex emo ien alis
s ain, which has emendous po en ial o use in bio echnology. The p oduc ion o PHA
om each subs a e was equally p o en in he amily S aphylococcaceae (Table 3), al hough
only class I o PHA syn hase and phaJ genes we e de ec ed (Table 2). Pe haps hese p oduc s
we e p oduced by a di e en biosyn he ic pa hway han hose obse ed. Unlike s ains
om he S aphylococcaceae amily, membe s o he amily Xan homonadaceae could only
u ilize uc ose o PHA p oduc ion (Table 3).
When compa ing he esul s o he molecula de ec ion wi h he pheno ypic de ec ion
in indi idual s ains, PHA p oduc ion was co ec ly p edic ed by PCR in almos 60% o
s ains. The p edic ion e iciency could be imp o ed by inc easing he numbe o es ed
subs a es and moni o ing mo e biosyn he ic pa hways.
3. Discussion
The molecula de ec ion and subsequen pheno ypic e i ica ion o he p oduc ion o
PHA can lead o he unde s anding o he biosyn he ic pa hways and hus o he p edic ion
o he app op ia e subs a e and he esul ing ype o PHA o med. As a esul , new
p oducing s ains may be disco e ed p esen ing a cheape and mo e a ailable subs a e,
leading o lowe p oduc ion cos s o PHAs [10,30].
In his s udy, he genes o all ou classes o PHA syn hases: phaC (class I and II),
phaE (class III), and phaR (class IV), which ca alyze he polyme iza ion o monome ic uni s,
we e sc eened [
19
]. Fu he mo e, sc eening o o he genes in ol ed in he biosyn hesis o
PHA was pe o med. Speci ically, genes we e in ol ed in he p oduc ion o scl PHAs om
un ela ed sou ces such as suga s (phaA and phaB) [
16
,
17
], in he p oduc ion o PHAs om
ela ed sou ces by
β
-oxida ion ( abG and phaJ) [
14
], and in he p oduc ion o mcl PHAs om
un ela ed sou ces ia he a y acid syn hesis pa hway (phaG) [
18
]. Subsequen ly, he abili y
o p oduce PHA om glucose, uc ose, sun lowe oil, and p opionic acid was moni o ed.
PHA can be syn hesized om p opionic acid by he pa hway om bo h ela ed ( abG and
phaJ) and un ela ed (phaA and phaB) sou ces [31].
A o al o 64 s ains om se en amilies we e in es iga ed. A class IV PHA syn hase
gene was de ec ed in he Bacillaceae amily; as has also been shown in o he s udies [
28
,
32
].
The abili y o use lignocellulosic biological was e and suga s o c ea e homopolyme s and
copolyme s was demons a ed [
33
] in Bacillus spp. This abili y o c ea e homopolyme s
and copolyme s is p obably due o he p o en p esence o phaA,phaB, and abG genes
and he u iliza ion o bo h suga s and p opionic acid. This esul was con i med by he
esea ch o Mohandas e al. [
34
], who demons a ed he abili y o p oduce P(3HB-co-3HV)
in Bacillus ce eus. The esul ing copolyme con ained 12 mol.% o P(3HV) when using
c ude glyce ol; howe e , p opionic acid inc eased he p oduc ion o P(3HV) by 30 mol.%.
I seems ha he syn hesis o an applica ion-speci ic polyme , including homopolyme
P(3HB), can be achie ed wi h a sui ably chosen subs a e composi ion. The p oduc ion
o P(3HB) homopolyme by Bacillus hu ingiensis and Bacillus ce eus om glucose was
demons a ed in a s udy by Ray and Kalia [
35
]. The abili y o use inexpensi e subs a es
om was e ans o me oil, was e-de i ed ola ile a y acids, and o he ypes o was e
we e epo ed [
30
,
36
]. P ies ia mega e ium was iden i ied among he isola es which p oduced
PHA om suga s and p opionic acid. This in e es ing s ain is use ul o p oducing small
In . J. Mol. Sci. 2023,24, 1250 7 o 13
molecules such as i amin B12, polyme s such as P(3HB), and e en p o ein, and is sui able
o bio echnological applica ions [
37
]. A majo ad an age o he Bacillaceae amily is he
absence o endo oxins in he ou e memb ane and ha PHAs ob ained om hem a e
sui able o medical applica ions [38].
As wi h he Bacillaceae amily, a ep esen a i e o he Bu kholde iaceae amily (Cup i-
a idus neac o ATCC 17699) was demons a ed o u ilize uc ose, glucose, and p opionic
acid. Cup ia idus neac o is one o he mos s udied PHA p oduce s. P e ious s udies ha e
demons a ed he p esence o all ound genes (PHA syn hase class I, phaA, and phaB) in
his bac e ium [
39
]. Va ious subs a es such as ood was e-de i ed ola ile a y acids,
polye hylene om was e Te a Pak packaging, and s a chy was e we e used in he low-cos
PHA p oduc ion [40,41].
The la ges es ed amily was En e obac e iaceae, in which genes in ol ed in PHA
p oduc ion we e de ec ed in almos 90% o he s ains; howe e , only o e 30% we e phe-
no ypically p o en o p oduce PHA. Esche ichia coli is conside ed a non-PHA-p oducing
bac e ium; he e o e, i is used o c ea e ecombinan PHA-p oducing s ains [
42
,
43
]. How-
e e , PHA p oduc ion was de ec ed in he species in ol ed in his s udy. Al hough ecen
pape s ha e no demons a ed he p oduc ion abili y o Esche ichia coli, some wild s ains
may p oduce PHA in esponse o s ess ul condi ions. In u he s udies, i would be app o-
p ia e o ocus on hese s ains, e i y he p oduc ion by o he me hods, and cha ac e ize
he e en ual p oduc s. None o he sea ched genes we e de ec ed in Klebsiella oxy oca;
howe e , he abili y o u ilize p opionic acid was demons a ed. P e ious wo ks showed
he abili y o p oduce PHA om xylose in he genus Klebsiella [
44
]. Fu he mo e, membe s
o he genus Klebsiella p oduced P(3HB-co-3HV) om ha dwood sul i e [
45
]. Consequen ly,
he genus Klebsiella seems o p oduce PHA by a di e en pa hway han hose desc ibed
in his s udy. O he gene a om his amily we e Pan oea and Rahnella, which could no
use he es ed subs a es. Ne e heless, his genus anks among he documen ed PHA
p oduce s [
46
,
47
]. The e o e, he p oduc ion is p obably s ain-dependen . On he o he
hand, Lellio ia amnigena p oduced PHA om p opionic acid; howe e , his s ain has no
been in es iga ed in ea lie s udies.
In Acine obac e calcoace icus, he genes ha p edic ed he abili y o syn hesize PHA
om ela ed and un ela ed sou ces we e ound, and p oduc ion om uc ose, sun lowe
oil, and p opionic acid was con i med. The p oduc ion o scl and mcl PHAs om oil and
suga s has p e iously been de ec ed in Acine obac e sp. [
48
]. Mos o he moni o ed genes
we e ound in he Pseudomonadaceae amily. The membe s o his amily u ilize a a ie y
o subs a es [
49
]. Class II o PHA syn hase, de ec ed in se e al s ains, is ypical o he
genus Pseudomonas and can gene a e mcl PHAs [
50
]. Fo example, Rai e al. [
51
] p oduced
poly(3-hyd oxyoc anoa e) (P(3HO)) om sodium oc anoa e using Pseudomonas mendocina.
The membe s o his amily can ad an ageously use was e ca bohyd a es and oils, which
can lead o a educ ion in PHA p oduc ion cos s [
52
]; addi ionally, hey can e en u ilize
pollu an s (e.g., phenol) o p oduce PHA [53].
The S aphylococcaceae amily p oduced PHA om all subs a es es ed. U iliza ion o
di e se subs a es was ound by Wong e al. [
9
], in which S aphylococcus epide mis p oduced
P(3HB) om mal , milk, sesame oil, soybean was e, and inega . Class I o he PHA
syn hase gene demons a ed in his s udy may allow hem o make his p oduc . The
las amily included in his s udy was Xan homonadaceae, in which genes in ol ed in PHA
p oduc ion om bo h ca bohyd a es and a s we e e ealed. Howe e , he PHA p oduc ion
was pheno ypically obse ed only om uc ose. Ne e heless, he abili y o p oduce PHA
om glucose, wood chips, ca dboa d cu ou s, plas ic bo le cu ou s, sh edded polys y ene
cups, plas ic bags, and po a o s a ch has been desc ibed in he li e a u e [
54
]. The e o e, i
is possible ha he p oduc ion is again s ain dependen .
As PHA p oduc ion om di e se subs a es was de ec ed in his s udy and hei
biosyn he ic pa hways we e e ealed, u u e expe imen s would be app op ia e o cha -
ac e ize hese p oduc s and moni o he e ec o subs a e combina ions on he esul ing
mechanical p ope ies and he eby es ablish condi ions o applica ion-speci ic PHA p o-
In . J. Mol. Sci. 2023,24, 1250 8 o 13
duc ion. Addi ionally, he u iliza ion o was e sou ces by p o en p oduce s could be es ed,
which would educe p oduc ion cos s.
4. Ma e ials and Me hods
4.1. Ma e ials and Chemicals
The collec ion s ains—Cup ia idus neca o ATCC 17699, Pseudomonas ae uginosa ATCC
27853, and Pseudomonas mendocina ATCC 25411—we e p o ided by he Czech Collec ion o
Mic oo ganisms (CCM, B no, Czech Republic). Esche ichia coli DH5
α
was ob ained om
Taka a Bio Eu ope SAS, Pa is, F ance.
S eno ophomonas mal ophilia s ain was isola ed om a dai y p oduc and p o ided
by he Dai y Resea ch Ins i u e in P ague (P ague, Czech Republic). The o he 59 bac e ial
s ains we e isola ed om ui s, ege ables, and mea bough a he local ma ke in he
Czech Republic (Table S1). Ten g ams o ood sample was homogenized in 90 mL o s e ile
saline solu ion and sp ead on he pla es wi h he selec i e media: Bai d-Pa ke Aga , Endo
Aga , Pseudomonas Selec i e Aga (Sigma-Ald ich, S . Louis, MO, USA), Clos idium
Aga , M17 Aga , Manni ol Sal Aga , Viole Red Bile Aga (HiMedia Labo a o ies GmbH,
Mumbai, Maha ash a, India), and MRS aga (Oxoid, Basings oke, UK) and incuba ed a
30 o 37 ◦C o 24 h.
Selec ed isola es we e iden i ied by Mic o lex MALDI-TOF MS mass spec opho ome-
e y (B uke Dal onics, B emen, Ge many). Samples o MALDI-TOF iden i ica ion we e
p epa ed by mixing he bac e ial cul u e wi h 150
µ
L o s e ile dis illed wa e and 450
µ
L o
96% e hanol (Lach-Ne , Ne a o ice, Czech Republic). Then, he samples we e cen i uged
o 2 min a 14,000 pm. A e cen i uga ion, he supe na an was sepa a ed, and he pelle s
we e e-cen i uged. The emains o he supe na an we e emo ed and he pelle s we e
d ied. The pelle s we e mixed wi h 10
µ
L o 70% o mic acid (Me ck KGaA, Da ms ad ,
Ge many) and 10
µ
L o ace oni ile (Sigma-Ald ich, S . Louis, MO, USA). The suspensions
we e cen i uged a 14,000 pm o 2 min and 1
µ
L o he supe na an s was applied o he
MALDI pla e. Following d ying, e e y sample was o e laid wi h 1
µ
L o HCCA (2-Cyano-
3-(4-hyd oxyphenyl) ac ylic acid) (B uke Dal onics, B emen, Ge many) ma ix and d ied
again. The esul ing samples we e ionized wi h a ni ogen lase (wa eleng h o 337 nm and
equency o 20 Hz). The esul s we e e alua ed by he MALDI Bio ype 3.0 iden i ica ion
da abase (B uke Dal onics, Bille ica, MD, USA) [
55
]. Bac e ial s ains wi h a sco e alue
lowe han 2.000 we e subjec ed o 16S RNA sequencing.
S ains we e cul i a ed in b ain hea in usion aga o M17 aga media (bo h HiMedia
Labo a o ies GmbH, Mumbai, Maha ash a, India). Mine al aga media con aining 20 g/L
o ca bon (glucose, uc ose, p opionic acid, o sun lowe oil (Sigma-Ald ich, S . Louis,
MO, USA)) was used o pheno ypic sc eening. The composi ion o he mine al aga media
was 3 g (NH
4
)
2
SO
4
, 11.1 g Na
2
HPO
4·
12H
2
O, 1.05 g KH
2
PO
4
, 0.2 g MgSO
4·
7H
2
O, 1 mL
solu ion o ace elemen s, and 15 g aga (Sigma-Ald ich, S . Louis, MO, USA) pe li e o
dis illed wa e . One li e o solu ion o ace elemen s con ained 9.7 g FeCl
3·
6H
2
O, 7.8 g
CaCl
2·
2H
2
O, 0.156 g CuSO
4·
5H
2
O, 0.119 g CoCl
2·
6H
2
O, 0.118 g NiCl
2·
6H
2
O, and 0.1 g
ZnSO
4·
7H
2
O in 0.1 M HCl. Tween 80 (Sigma-Ald ich, S . Louis, MO, USA) (5 g/L) was
added in o a mine al aga media wi h sun lowe oil as an emulsi ie . Le els o he mine al
aga media pH we e adjus ed o 7.
P ime s we e designed o de ec genes in ol ed in PHA p oduc ion using P ime 3
( . 0.4.0, Singapo e). Gene sequences we e ob ained om he Eu opean Nucleo ide A chi e
( o genes phaJ and phaG) and he Na ional Cen e o Bio echnology In o ma ion ( o he
emaining p ime s) we e used o design he p ime s. In addi ion, abGF and abGR p ime s
we e used o de ec he abG gene [
25
]. All p ime s and he size o PCR p oduc s a e lis ed
in Table 4.
In . J. Mol. Sci. 2023,24, 1250 9 o 13
Table 4. Used p ime s and sizes o hei PCR p oduc s.
P ime Gene P ime Sequence (50–30) P oduc Size (bp) Re .
phaAF phaA CCATGACCATCAACAAGGTG 262 This s udy
phaAR TATTCCTTGGCCACGTTCTC
phaBF phaB AATGTGGCTGACTGGGACTC 164 This s udy
phaBR GAGGTCAGGTTGGTGTCGAT
phaSyn1F phaC
(Class I)
TGCGCAACATGATGGAAGAC 204 This s udy
phaSyn1R AGTACTTGTTGATGCACGGC
phaSyn2F phaC
(Class II)
TACATCGAGGCGCTCAAGGA 594 This s udy
phaSyn2R GCCGAACAGATGAGCCGATT
phaSyn3F phaE
(Class III)
CAGTGGATGCTGCAGGGC 463 This s udy
phaSyn3R GCAGGCCGATACGTTCACTC
phaSyn4F phaR
(Class IV)
AAATGAAGTAACGGGGCGCT 326 This s udy
phaSyn4R CCTGAAGCTGCTCACCTTGA
phaJF phaJ CGAGTACACCAGCAGCATCG 287 This s udy
phaJR GGTTCTTCGGCAGCTTCTCG
abGF abG
TGGCTCGAGAGAGAGAAAGGAGA
750 [25]
abGR TTCCGCAACGAATTCTAGAC
phaGF phaG AGAAGGCAGTGGTGAGTTCG 425 This s udy
phaGR ACAGGCGGTCTTGTTTTCCA
4.2. Molecula De ec ion
Isola ion o DNA was pe o med using a NucleoSpin Tissue ki (Mache ey-Nagel,
Dü en, Ge many). The pu i y and concen a ion o he isola ed DNA we e e i ied spec-
opho ome ically a 260 and 280 nm by a Tecan In ini e
®
200 PRO (Tecan, Männedo ,
Swi ze land). A e isola ion, 1
µ
L ( o he de ec ion o one o wo genes) o 2
µ
L ( o he
de ec ion o h ee o mo e genes) o DNA was mixed wi h 10
µ
L GoTaq
®
Ho S a G een
Mas e Mix (P omega, Madison, WI, USA) and 25
µ
M o each p ime (Eas po –Me abion,
P ague, he Czech Republic). The PCR eac ion was pe o med in Ae is
™
he mocycle
(ESCO, Singapo e). The PCR p og am is shown in Table 5.
Table 5. The PCR p og am.
S ep Name Tempe a u e (◦C) Time (min) Numbe o Cycles
Ini ial dena u a ion 95 5 1
Dena u a ion 95 0.5
40
Annealing 65 0.5
Elonga ion 72 1
Final elonga ion 72 10 1
Cooling 4 ∞1
An op imal annealing empe a u e o 65
◦
C was de e mined by g adien PCR, and
sui able g oups o p ime s we e c ea ed: ou pai s o p ime s de ec ing PHA syn hases
(phaSyn1,phaSyn2,phaSyn3, and phaSyn4), h ee pai s o p ime s o phaB,phaG, and phaJ
genes and wo pai s o p ime s o abG and phaA genes. Subsequen gene sc eening o
bac e ial isola es was ca ied ou using his op imized mul iplex PCR me hod.
Following he PCR eac ion, PCR p oduc s we e esol ed by aga ose gel elec opho e-
sis on 1.5% aga ose gel (Lonza, Rockland, ME, USA) and isualized wi h GelRed
™
(Bio ium,
F emon , CA, USA; 10
µ
L/100 mL o gel). PeqGOLD 100 bp Plus (VWR Peqlab, E langen,
Ge many) was used as a DNA ma ke .
4.3. Pheno ypic De ec ion
4.3.1. Nile Blue S aining
The es ed bac e ia we e cul i a ed in mine al aga media con aining 20 g/L o he
ca bon sou ce (glucose, uc ose, p opionic acid, o sun lowe oil) o 72 h. Then, he
bac e ial colonies we e s ained wi h 0.05% Nile blue (Sigma-Ald ich, S . Louis, MO,