EUKARYOTIC CELL, Sep . 2007, p. 1646–1655 Vol. 6, No. 9
1535-9778/07/$08.00⫹0 doi:10.1128/EC.00177-07
Copy igh © 2007, Ame ican Socie y o Mic obiology. All Righ s Rese ed.
EhLimA, a No el LIM P o ein, Localizes o he Plasma Memb ane
in En amoeba his oly ica
䌤
Nomy Wende , Edua do Villalobo,† and Da id Mi elman*
Depa men o Biological Chemis y, Weizmann Ins i u e o Science, Reho o 76100, Is ael
Recei ed 18 May 2007/Accep ed 5 July 2007
The pa asi ic p o ozoan En amoeba his oly ica elies on a e y dynamic cy oskele on in o de o in ade and su i e
in hos issues. Iden i ica ion o cy oskele al elemen s is key o unde s anding hese p ocesses. He e we p esen he
cha ac e iza ion o EhLimA, he i s LIM p o ein o E.his oly ica. EhLimA consis s o a single LIM domain a i s
N e minus and exhibi s he highes deg ee o homology wi h DdLimE om Dic yos elium discoideum. Immuno lu-
o escence localiza ion o EhLimA using an i-EhLimA an ibodies e ealed ha EhLimA is highly concen a ed a he
plasma memb ane o cells. Silencing o o e exp ession o he EhLimA gene did no ha e a signi ican e ec on he
g ow h o mo phology o he pa asi e. EhLimA associa es wi h he cy oskele on as demons a ed by he en ichmen
o he p o ein in cy oskele on ac ions as well as in pull-down assays ha e ealed ha cy oskele on associa ion
in ol es in e ac ion wi h ac in. EhLimA binding o ac in was shown o be dependen on he N- e minal LIM domain
o EhLimA, as emo al o e en hal o he LIM domain esul ed in almos comple e inhibi ion o he binding o ac in.
We also ound ha a po ion o EhLimA loa s o he lowe -densi y egions o a suc ose g adien oge he wi h
po ions o he Gal-lec in ligh subuni and ac in. T ea men o cells wi h he choles e ol-seques e ing agen
digi onin esul ed in inc eased solubili y o EhLimA. These esul s indica e ha in addi ion o cy oskele al asso-
cia ion, EhLimA may also associa e wi h lipid a s in he pa asi e plasma memb ane and sugges ha EhLimA may
be pa o he molecula sys em connec ing he ac in cy oskele on o memb ane a s.
Many cellula unc ions a e dependen on speci ic p o ein-
p o ein in e ac ions. These p o ein-p o ein in e ac ions a e
go e ned by a a ie y o p o ein binding domains one o which
is he LIM domain. Since i s desc ibed nea ly 2 decades ago
(21, 28, 57), LIM domain-con aining p o eins ha e been iden-
i ied in a wide ange o euka yo es, including p o ozoa (16, 30,
45), plan s (5, 20, 40), and yeas (Saccha omyces ce e isiae)
(39), s essing he e olu iona y impo ance o hese p o eins.
In he pa asi ic p o ozoan En amoeba his oly ica, a ew s udies
ha e e ealed he p esence o such p o eins (17, 36), al hough
o da e, no LIM domain-con aining p o eins ha e been cha -
ac e ized in his o ganism. The name LIM is de i ed om he
h ee de elopmen ally egula ed ansc ip ion ac o s, LIN-11
o Caeno habdi is elegans (21), Isl1 o a (28), and MEC-3 o
C.elegans (57) in which he LIM domain was ini ially iden i-
ied. The LIM domain is a cys eine- ich mo i consis ing o wo
zinc inge -like modules and displaying he consensus sequence
CX
2
CX
16-23
HX
2
CX
2
CX
2
CX
16-21
CX
2
(C/H/D/) (31). This do-
main is ound in a a ie y o di e en p o eins wi h di e se
unc ions, including ansc ip ion ac o s and cy oskele on-as-
socia ed p o eins, and may be ound in associa ion wi h o he
unc ional domains, such as homeodomains, p o ein kinase
domains, o o he p o ein binding domains (31, 54). I se es as
a p o ein binding in e ace capable o associa ing wi h a wide
ange o p o eins and media ing p o ein-p o ein in e ac ions.
The a ious binding pa ne s o LIM domains in luence he
subcellula localiza ion and unc ions o he LIM p o eins. I is
he e o e no su p ising ha LIM domain-con aining p o eins
ha e been ound o pa icipa e in a b oad ange o biological
p ocesses, including cy oskele on o ganiza ion, ansc ip ional
egula ion, de elopmen o cell ypes, and signaling (4, 18, 31).
LIM domain-con aining p o eins do no o m a unc ional am-
ily bu ha e been classi ied in o h ee g oups based on he se-
quence ela ionships among he LIM domains and o e all s uc-
u e o he p o eins. G oup 1 p o eins a e ound p ima ily in he
nucleus and include LIM homeodomain p o eins and LIM-only
p o eins ha a e in ol ed in ansc ip ional egula ion. G oup 2
p o eins a e composed p ima ily o LIM domains and include
membe s o he cys eine- ich p o ein amily. G oup 3 p o eins
con ain di e en numbe s o LIM domains loca ed a he C e -
minus and include p o eins such as zyxin and paxillin. G oup 2
and g oup 3 p o eins a e p ima ily cy oplasmic, and many a e
associa ed wi h he ac in cy oskele on (18).
In Dic yos elium discoideum, a numbe o LIM domain-con ain-
ing p o eins ha e been cha ac e ized (16, 30, 45). The known
simila i y be ween se e al p o eins o his amoeba wi h hose o E.
his oly ica p omp ed us o in es iga e whe he analogous LIM
domain-con aining p o eins exis in E.his oly ica. He e we p esen
he cha ac e iza ion o he i s LIM domain-con aining p o ein in
E.his oly ica which we e med E.his oly ica LimA (EhLimA)
(NCBI accession XP_656918.1). We show ha EhLimA associ-
a es wi h he ac in cy oskele on and possibly wi h lipid a do-
mains in he plasma memb ane, sugges ing ha i may se e o
connec he ac in cy oskele on o memb ane a s.
MATERIALS AND METHODS
S ains and cul u e condi ions. T ophozoi es o E.his oly ica s ain HM-1:
IMSS we e g own a 37°C in TYI-S-33 medium (19). T ans ec ion o ophozo-
i es was pe o med as p e iously desc ibed (24). T ans ec an s we e g own in he
p esence o he neomycin de i a i e G418.
* Co esponding au ho . Mailing add ess: Depa men o Biological
Chemis y, Weizmann Ins i u e o Science, P.O. Box 26, Reho o
76100, Is ael. Phone: 972-8-9344511. Fax: 972-8-9344118. E-mail:
[email p o ec ed].
† P esen add ess: Depa amen o de Mic obiologia, Facul ad de
Biologia, Uni e sidad de Se illa, Apdo. 1095, 41080 Se illa, Spain.
䌤
Published ahead o p in on 13 July 2007.
1646
on July 13, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://ec.asm.o g/Downloaded om
Cloning o EhLimA cDNA and sequence analysis. The EhLimA gene sequence
was ob ained om he E.his oly ica Genome P ojec (35) o The Ins i u e o
Genomic Resea ch (TIGR) and The Wellcome T us Sange Ins i u e. The gene
was cloned in o he pBluesc ip II KS ec o ollowing PCR ampli ica ion using
cDNA as he empla e and p ime s A and B (Table 1). These p ime s we e also
used o sequence he gene in bo h o ien a ions. The sequence ob ained was in
comple e acco dance wi h he sequence o he gene appea ing in he E.his oly ica
Genome P ojec (35).
Sequence analysis o EhLimA was pe o med using a ious ools a ailable on
he ExPASy se e (www.expasy.ch/ ools/). Mul iple alignmen was pe o med
using he Clus alW mul iple-sequence alignmen p og am (www.ebi.ac.uk
/clus alw/).
Cons uc ion o plasmids o o e exp ession. All plasmid cons uc s in ended
o o e exp ession we e gene a ed using an in e media e plasmid as ollows. The
sequence o in e es was i s cloned in o he NcoI and SalI es ic ion si es o he
pSA21 in e media e plasmid cons uc (29). The pSA21 plasmid cons uc con-
aining he sequence o in e es was hen diges ed wi h BamHI and SacI, which
eleases a casse e con aining he sequence o in e es lanked by 5⬘and 3⬘ac in
egula o y sequences. This casse e was hen ans e ed o he pEhAc -Neo (38)
ec o , a e emo al o i s casse e by diges ion wi h BamHI and SacI.
A plasmid con aining he ull-leng h EhLimA sequence (438 bp) was i s
p epa ed by PCR ampli ica ion using E.his oly ica cDNA as he empla e and
p ime s C and B (Table 1). This plasmid was hen used as he empla e o
p epa ing he sequence o in e es as desc ibed below. N- e minally and C-
e minally FLAG- agged EhLimA sequences we e ob ained by PCR ampli ica-
ion using he plasmid con aining he ull-leng h EhLimA sequence (desc ibed
abo e) as he empla e. The 24 nucleo ides co esponding o he FLAG epi ope
(Asp-Ty -Lys-Asp-Asp-Asp-Asp-Lys) we e syn hesized as pa o ei he he 5⬘o
3⬘p ime o N- e minally o C- e minally agged EhLimA, espec i ely, and in
such a way ha hey we e in oduced in o he sequence. Fo ull-leng h EhLimA
agged a he N e minus (462 bp), p ime s D and B (Table 1) we e used. Fo
N- e minus- unca ed EhLimA agged a he N e minus (375 bp), p ime s E and
B (Table 1) we e used. Fo C- e minus- unca ed EhLimA agged a he N
e minus (327 bp), p ime s D and F (Table 1) we e used. Fo ull-leng h EhLimA
agged a he C e minus (465 bp), p ime s G and H (Table 1) we e used.
Cons uc ion o a plasmid o ansc ip ional silencing. T ansc ip ional si-
lencing o EhLimA was achie ed as p e iously desc ibed o o he genes (7) in
he G3 s ain o E.his oly ica ha is al eady silenced in he exp ession o he E.
his oly ica amoebapo e gene (Ehap-a) (8). The ull-leng h EhLimA sequence was
ob ained by PCR ampli ica ion using he plasmid con aining he ull-leng h
EhLimA (desc ibed abo e) as he empla e and p ime s I and B (Table 1)
con aining NcoI and SalI si es, espec i ely. The 5⬘ups eam segmen (473 bp)
o he Ehap-a gene was ob ained by PCR ampli ica ion using plasmid psAP-1 (7)
as he empla e and p ime s J and K (Table 1) con aining SacII and NcoI si es,
espec i ely. Bo h o hese PCR p oduc s we e diges ed wi h NcoI and liga ed o
each o he wi h T4 DNA ligase. The liga ion p oduc was ampli ied by PCR using
p ime s J and B (Table 1). The PCR p oduc ob ained was diges ed wi h SacII
and SalI and liga ed o he 3⬘Ehac in lanking egion ha was ob ained by
diges ion o he pSA21 (29) plasmid wi h SalI and BamHI. This casse e con-
aining he 5⬘ups eam segmen o he Ehap-a gene, he ull-leng h EhLimA
sequence, and he 3⬘Ehac in lanking egion was cloned in o he pEhAc -Neo
(38) ec o diges ed a SacII and BamHI. The esul ing plasmid was ans ec ed
in o he G3 s ain, and ans ec an s we e selec ed as p e iously desc ibed (7).
Re e se ansc ip ion-PCR (RT-PCR). To al RNA was p epa ed using he
TRI eagen RNA isola ion ki (Sigma). Fi e mic og ams o o al RNA was
e e se ansc ibed using an oligo(dT) adap o p ime (Table 1, p ime N) and
a ian myeloblas osis i us e e se ansc ip ase (P omega) acco ding o he man-
u ac u e ’s p o ocol. The cDNA p oduc was dilu ed 25 imes and used as he
empla e o subsequen PCRs.
P oduc ion and pu i ica ion o polyclonal an ibodies. In o de o p oduce
speci ic an ibodies agains EhLimA, he gene was cloned in o a pET bac e ial
exp ession ec o downs eam o he highly exp essed bac e ial xylanase p o ein
used o an amino- e minal hexahis idine ag (a kind gi om Yoa Ba ak).
EhLimA was ampli ied by PCR using E.his oly ica cDNA as he empla e and
p ime s L and M (Table 1). The PCR p oduc ob ained was diges ed wi h KpnI
and BamHI and cloned in o he co esponding si es o he pET ec o . The
His- agged xylanase-EhLimA usion p o ein was exp essed in Esche ichia coli
(Fig. 1A) and pu i ied by a ini y ch oma og aphy using Ni-ni ilo iace ic acid
aga ose (QIAGEN). The pu i ied usion p o ein was sepa a ed on a polyac yl-
amide gel, and he band ep esen ing xylanase-EhLimA was sliced om he gel
and agmen ed by passing i epea edly h ough a sy inge. Two abbi s we e
injec ed i e imes wi h 100 ␮g o p o ein pe injec ion and an in e al o 3 weeks
be ween each injec ion. Fo he i s injec ion, he gel was emulsi ied wi h com-
ple e F eund’s adju an , and o he second injec ion, he gel was emulsi ied wi h
incomple e F eund’s adju an . Fo he emaining injec ions, phospha e-bu e ed
saline (PBS) was used. Pu i ied an i-EhLimA an ibodies we e ob ained by am-
monium sul a e p ecipi a ion ollowed by passing he an ibody mix u e h ough
a column o Sepha ose beads (a kind gi om Talia Mi on) coupled o he
pu i ied xylanase p o ein (a kind gi om Yoa Ba ak). The an ixylanase an i-
bodies bound o he column, while he an i-EhLimA an ibodies we e elu ed. The
speci ici y o he an i-EhLimA an ibodies is shown in Fig. 1B. Pu i ied an i-
EhLimA an ibodies we e di ided in o aliquo s and s o ed a ⫺20°C un il being
u ilized o Wes e n blo ing and immuno luo escence labeling.
P epa a ion o p o ein ac ions. To al cell lysa es o E.his oly ica ophozoi es
we e ob ained by suspending PBS-washed ophozoi es in lysis bu e (50 mM
T is-Cl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% T i on X-100, and p o ease
inhibi o s 0.2 mM leupep in, 5 mM iodoace amide, 5 mM 1,10-phenan h oline
monohyd a e, and 2 mM phenylme hylsul onyl luo ide) and incuba ing o 30
min on ice. The lysa es we e subjec ed o cen i uga ion a 13,000 ⫻gin a
mic ocen i uge a 4°C, and a e emo al o he supe na an , he pelle was
esuspended in lysis bu e . The p o ein concen a ion o each ac ion was
de e mined by he B ad o d assay (9), and 5 o 10 ␮g o p o ein was aken o
sodium dodecyl sul a e-polyac ylamide gel elec opho esis (SDS-PAGE) and
Wes e n blo s.
SDS-PAGE and Wes e n blo s. Samples we e p epa ed by he addi ion o
sample bu e and boiling o 3 min. Samples we e sepa a ed on a 15% poly-
ac ylamide gel unde educing condi ions. Gels we e ei he s ained o o al
p o ein wi h GelCode blue s ain eagen (Pie ce) o blo ed on o ni ocellulose
memb anes. Memb anes we e s ained o o al p o ein wi h Ponceau S be o e
incuba ion wi h an ibodies. The dilu ions o p ima y an ibodies used in his s udy
we e as ollows: polyclonal an i-EhLimA, 1:500; monoclonal an i-FLAG, 1:2,000
(Sigma); monoclonal an iac in, 1:1,000 (ICN Biomedicals, Inc.); and polyclonal
FIG. 1. (A) Analysis o he His- agged xylanase-EhLimA by gel
elec opho esis ollowing exp ession and pu i ica ion in E.coli. Lane 1,
o al lysa e o bac e ial cells o e exp essing he His- agged xylanase-
EhLimA usion p o ein; lane 2, pu i ied xylanase-EhLimA usion p o-
ein. (B) A Wes e n blo analysis demons a ing he speci ici y o he
pu i ied an i-EhLimA an ibodies. The pu i ied xylanase-EhLimA u-
sion p o ein (lane 1) and a pu i ied glu a hione S- ans e ase (GST)-
EhLimA usion p o ein (lane 2) a e ecognized by he an ibodies,
while pu i ied GST (lane 3) is no .
TABLE 1. P ime s used o cons uc ion o plasmids
P ime P ime sequence O ien a ion
a
A5⬘-ACGGATCCAATGTCTGCTAAGAAGTGTT S
B5⬘-TTAAGTCGACTTAAAAACCTTCTTCTTCTTC AS
C5⬘-AAGGTCTCCCATGTCTGCTAAGAAGTGTTTTGCT S
D5⬘-CATGCCATGGATTATAAAGATGATGATGATAAA
TCTGCTAAGAAGTGTTTTGCT
S
E5⬘-CATGCCATGGATTATAAAGATGATGATGATAAA
TTCAAATGTAAAGAATGTGGTC
S
F5⬘-GCGTGTCGACTTAATGTGGTTTTCCTCCAGCTC AS
G5⬘-CATGCCATGGCTTCTGCTAAGAAGTGTTTTG S
H5⬘-GCGTGTCGACTTATTTATCATCATCATCTTTATA
ATCAAAACCTTCTTCTTCTTCATG
AS
I5⬘-CATGCCATGGCGTCTGCTAAGAAGTGTTTTG S
J5⬘-TCCCCGCGGCTTGCTGCACCCTTTG S
K5⬘-CATGCCATGGTCATGATTGTTTGTAAGATATG AS
L5⬘-CGGGGTACCTATGTCTGCTAAGAAGTGTTTTG S
M5⬘-CGCGGATCCTTAAAAACCTTCTTCTTCTTC AS
N5⬘-GACTCGAGTCGACATCGATT(T16) AS
a
S, sense; AS, an isense.
VOL. 6, 2007 CHARACTERIZATION OF A NOVEL LIM PROTEIN 1647
on July 13, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://ec.asm.o g/Downloaded om
an i-Gal-lec in ligh subuni , 1:1,000 (3). These we e ollowed by incuba ions wi h
ei he a ho se adish pe oxidase-conjuga ed goa an i- abbi an ibody (1:10,000;
Jackson) o a ho se adish pe oxidase-conjuga ed goa an i-mouse an ibody (1:
5,000; Jackson). Blo s we e de eloped wi h an enhanced chemiluminescence ki
(ECL; Ame sham).
Immuno luo escence and con ocal mic oscopy. E.his oly ica cells we e esus-
pended in wa m TYI-S-33 medium, se on co e slips in a pe i dish, and le o
adhe e o 10 min a 37°C. A e emo al o he medium, cells we e ixed wi h
p ewa med PBS con aining 3.7% o maldehyde (3.7% o maldehyde-PBS) o
30 min. The co e slips we e washed wi h PBS and pe meabilized wi h PBS
con aining 0.1% T i on X-100 o 3 min. Co e slips we e washed wi h PBS and
blocked wi h PBS con aining 5% BSA (5% BSA-PBS) o 1 h. Pu i ied polyclonal
an i-EhLimA an ibodies we e added a a dilu ion o 1:10 in 5% BSA-PBS and
incuba ed o 1 h. The co e slips we e washed wi h PBS and incuba ed o 30 min
wi h luo escein iso hiocyana e-conjuga ed goa an i- abbi an ibodies (Sigma) a
a dilu ion o 1:200 in 5% BSA-PBS. Fo ac in s aining, cells we e g own o e -
nigh on co e slips and ixed wi h p ewa med 3.7% pa a o maldehyde-PBS.
Blocking was pe o med o 30 min wi h 1% BSA-PBS ollowed by 40 min o
incuba ion wi h phalloidin- e ame hyl hodamine isocyana e (TRITC) (1 mg/
ml; Sigma) a a dilu ion o 1:200 in 1% BSA-PBS. Co e slips we e washed in PBS
and moun ed on a glass slide using VECTASHIELD moun ing medium
(VECTOR Labo a o ies). The co e slips we e sealed in place wi h nail polish.
Fluo escen samples we e iewed on a con ocal lase -scanning mic oscope using
ei he a 40⫻o 60⫻objec i e.
P epa a ion o cy oskele al ac ions. E.his oly ica ophozoi es we e ha es ed,
washed, esuspended in lysis bu e (60 mM PIPES, 25 mM HEPES, 125 mM KCl,
2 mM MgCl
2,
5 mM EGTA, 0.5 mM ATP, pH 7.2, 1% T i on X-100, and p o ease
inhibi o s 0.2 mM leupep in, 5 mM iodoace amide, 5 mM 1,10-phenan h oline
monohyd a e, and 2 mM phenylme hylsul onyl luo ide) and incuba ed o 30 min
on ice. Lysa es we e cen i uged a 4°C o 15 min a 500 ⫻g. The supe na an was
subjec ed o ul acen i uga ion a 4°C o 1ha 100,000 ⫻g. The supe na an , which
con ained he cy oplasmic p o eins as well as memb ane p o eins ha we e solubi-
lized, was ans e ed o a new ube. The pelle , which con ained he cy oskele on
and associa ed p o eins, as well as o he T i on X-100-insoluble p o eins, such as
hose associa ed wi h lipid a s, was esuspended in he abo e bu e . The p o ein
concen a ion was de e mined by he B ad o d assay (9).
Immunop ecipi a ion o FLAG- agged usion p o eins and immunode ec ion
o ac in. E.his oly ica cells o e exp essing he a ious FLAG- agged EhLimA
usion p o eins as well as con ol cells we e lysed, and lysa es we e cen i uged a
4°C o 10 min a 13,000 ⫻g. The supe na an s we e incuba ed wi h an i-FLAG
M2 a ini y gel (Sigma) on a olle shake a 4°C o 2 h. Resin-bound FLAG-
agged usion p o eins we e pelle ed, and FLAG- agged p o eins we e elu ed by
he addi ion o 0.1 M glycine HCl. Pu i ied FLAG- agged usion p o eins we e
isualized ollowing SDS-PAGE and o al p o ein s aining as desc ibed abo e.
SDS-PAGE, ollowed by immunoblo ing wi h an iac in an ibodies as desc ibed
abo e, was pe o med in o de o de ec coimmunop ecipi a ion o ac in.
T ea men o cells wi h me hyl-␤-cyclodex in o digi onin. Fo choles e ol
deple ion, amoeba cells we e incuba ed wi h ei he 20 mM me hyl-␤-cyclodex in
o wi h 0.2% digi onin in PBS o 30 min on ice. Following incuba ion, cells we e
lysed wi h lysis bu e con aining T i on X-100, and soluble and insoluble ac-
ions we e ob ained as desc ibed abo e.
Suc ose g adien lo a ion. E.his oly ica ophozoi es we e lysed in 1 ml o cold
mo pholinee hanesul onic acid (MES)-bu e ed saline (25 mM MES, pH 6.5, 150
mM NaCl, 1% T i on X-100, and p o ease inhibi o s 0.2 mM leupep in, 5 mM
iodoace amide, 5 mM 1,10-phenan h oline monohyd a e, 2 mM phenylme hyl-
sul onyl luo ide, 1 mM sodium o ho anada e, and 1 mM sodium py ophos-
pha e) and incuba ed o 30 min on ice. To al cell lysa es we e adjus ed o 40%
suc ose by adding an equal olume o 80% suc ose and placed a he bo om o
an ul acen i uge ube. A discon inuous suc ose g adien was gene a ed by
o e laying his wi h 30% suc ose and 5% suc ose. Tubes we e cen i uged a 4°C
o 20 h a 260,000 ⫻g(39,000 pm) in an SW41 o o . Following cen i uga ion,
12 ac ions o 1 ml each we e collec ed om he op o he g adien . P o eins
we e p ecipi a ed by he addi ion o ichlo oace ic acid. P o ein pelle s we e
esuspended in sample bu e and subjec ed o SDS-PAGE and immunoblo ing
as desc ibed abo e. The pe cen age o suc ose in each ac ion was de e mined
using a e ac ome e (Bausch & Lomb).
RESULTS
Cloning and sequence analysis o a LIM domain-con aining
p o ein in E.his oly ica.The gene encoding a LIM domain-
con aining p o ein in E.his oly ica was cloned, and he co e-
sponding p o ein was e med EhLimA (NCBI accession no.
XP_656918.1). The sequence o he EhLimA gene is 438 nu-
cleo ides in leng h and codes o a p o ein o 145 amino acids
wi h a calcula ed molecula mass o 16 kDa. Sequencing da a
ob ained we e in comple e acco dance wi h he sequence o
he gene ha appea s in he E.his oly ica genome (35). Anal-
ysis o he deduced amino acid sequence o EhLimA e ealed
a single LIM domain a i s N e minus spanning amino acid
esidues 6 o 59 (Fig. 2A). The C e minus o he EhLimA
p o ein is ich in glu amic acid, and 18 o he 22 glu amic acid
esidues a e ound in he C e minus. EhLimA exhibi s he
highes deg ee o homology (37% iden i y and 47% simila i y)
o DdLimE (Fig. 2B and C), a Dic yos elium discoideum LIM
domain p o ein ha also has a single LIM domain a i s N
e minus (45, 48). The LIM domains o EhLimA and DdLimE
a e 44% iden ical. The glycine- ich domain ha ollows he
FIG. 2. (A) Nucleo ide sequence and deduced amino acid se-
quence o EhLimA. The conse ed cys eine and his idine esidues o
he N- e minal LIM domain a e shown (bold le e s). The glu amic
acid- ich C e minus o he p o ein is indica ed by b acke s. Pa o he
epea mo i ha appea s wice in Dic yos elium DdLimE is unde -
lined. (B) Alignmen o he EhLimA amino acid sequence wi h he
amino acid sequences o Dic yos elium DdLimE and LimD. Iden ical
esidues a e ep esen ed by black boxes, and simila esidues a e ep-
esen ed by g ay boxes. Sequences we e aligned using he Clus alW
mul iple-sequence alignmen p og am (www.ebi.ac.uk/clus alw/). Gen-
Bank accession numbe s a e as ollows: EhLimA, XP_656918; Dd-
LimE, U97699; LimD, AF348467. (C) Schema ic ep esen a ion o
EhLimA and Dic yos elium p o eins DdLimE and LimD. The single
N- e minal LIM domain p esen in all p o eins is indica ed. The glu-
amic acid- ich egion o EhLimA is ep esen ed by a whi e box. The
glycine- ich egion (GLY) and coiled-coil egion (shaded o al) o
DdLimE a e shown.
1648 WENDER ET AL. EUKARYOT.CELL
on July 13, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://ec.asm.o g/Downloaded om
LIM domain and he C- e minal coiled-coil egion ound in
DdLimE a e no p esen in he EhLimA sequence. Howe e ,
EhLimA con ains pa o a epea mo i , ALNAPKK, ha
appea s wice in DdLimE. EhLimA was also ound o be some-
wha homologous o Dic yos elium LimD (19% iden i y and
28% simila i y), ha also consis s o a single LIM domain a i s
N e minus (30). Bo h DdLimE and LimD o Dic yos elium
ha e been classi ied wi h g oup 2 o LIM domain-con aining
p o eins. Simila ly, we p opose ha EhLimA be classi ied wi h
his g oup o p o eins as well.
Exp ession o EhLimA in E.his oly ica.T ansc ip ion o
EhLimA was e i ied in an RT-PCR analysis o o al RNA.
Ampli ica ion o a band o he expec ed size o 438 bp (Fig.
3A) was ob ained, indica ing ha EhLimA is ansc ibed in E.
his oly ica. P o ein exp ession was analyzed in a Wes e n blo
using pu i ied polyclonal an ibodies p epa ed agains ecom-
binan EhLimA (Fig. 3B). The an i-EhLimA an ibodies spe-
ci ically ecognize ou bands a ound 16 kDa in size in amoeba
o al cell lysa es.
T ansc ip ional silencing o he EhLimA gene. T ansc ip-
ional silencing o he EhLimA gene was achie ed using a
p e iously published echnique gene a ed in ou lab (7). This
echnique allows us o induce he silencing o a second gene in
he G3 subs ain which is al eady silenced in he amoebapo e
gene (Ehap-a) and has an a i ulen pheno ype. Ou aim in
supp essing he exp ession o he EhLimA p o ein was o see
whe he his will ha e any e ec on pa asi e g ow h o mo -
phology. Silencing o EhLimA in he G3 s ain was con i med
by an RT-PCR analysis ha e ealed an absence o EhLimA
mRNA exp ession in he EhLimA-silenced amoeba (Fig. 3C).
Simila ly, in a Wes e n blo analysis, no p o ein was de ec ed in
o al lysa es o he EhLimA-silenced amoeba (Fig. 3D). Silenc-
ing o EhLimA esul ed in he absence o all ou bands de-
ec ed wi h he an i-EhLimA an ibodies, indica ing ha all a e
de i a i es o speci ic a ian s o EhLimA. Silencing was also
con i med in he localiza ion s udies (see below and see Fig. 4).
The g ow h and mo phology o he EhLimA-silenced amoeba
did no appea o be a ec ed.
Cellula localiza ion o EhLimA. The an i-EhLimA an ibod-
ies p oduced agains ecombinan EhLimA we e also used o
de e mine he cellula localiza ion o EhLimA by indi ec immu-
no luo escence. In almos all cells examined, EhLimA was highly
FIG. 3. mRNA and p o ein exp ession o EhLimA. (A) An RT-PCR
analysis o o al RNA using p ime s speci ic o EhLimA esul s in am-
pli ica ion o a band o he expec ed size o 438 bp (lane 1). No ampli i-
ca ion is a ained when he e e se ansc ip ion eac ion is pe o med
wi hou e e se ansc ip ase (lane 2). Ampli ica ion o ac in is shown in
lane 3. (B) De ec ion o EhLimA in a Wes e n blo analysis o o al cell
lysa es using pu i ied an i-EhLimA an ibodies e eals ou bands a ound
16 kDa. (C) An RT-PCR analysis o o al RNA o G3 ans ec ed o-
phozoi es in which EhLimA is ansc ip ionally silenced (lane 2) and o
non ans ec ed G3 cells exp essing EhLimA (lane 1). Ampli ica ion o
EhLimA (lanes I) is a ained only wi h he non ans ec ed G3 cells bu no
wi h he EhLimA-silenced cells. No ampli ica ion is a ained when he
e e se ansc ip ion eac ion is pe o med wi hou e e se ansc ip ase
(lanes II). Ampli ica ion o ac in (lanes III) is a ained wi h bo h he
non ans ec ed G3 cells and wi h he EhLimA-silenced cells. (D) Wes e n
blo analysis o o al cell lysa es o G3 ans ec ed ophozoi es in which
EhLimA is ansc ip ionally silenced. The an i-EhLimA an ibodies do no
de ec any p o ein in hese cells (lane 2), whe eas he p o ein is de ec ed
in he non ans ec ed G3 cells exp essing EhLimA (lane 1).
FIG. 4. Immuno luo escence localiza ion o EhLimA in whole pa asi es. T ophozoi es we e ixed and s ained o immuno luo escence wi h an i-EhLimA
an ibodies ollowed by luo escein iso hiocyana e-conjuga ed an i- abbi seconda y an ibodies and iewed unde a con ocal mic oscope. The di e en ial
in e e ence con as images a e shown on he op, and he co esponding luo escence images a e shown on he bo om. EhLimA localizes mainly o he plasma
memb ane o cells (a and b). No s aining was de ec ed in he EhLimA-silenced G3 amoeba cells (c). S aining cells wi h phalloidin-TRITC e eals and en ichmen
o ac in in he cell co ex and in cellula p o usions (d). Ba s, 10 ␮m in panel a and 20 ␮m in panels b, c, and d.
VOL. 6, 2007 CHARACTERIZATION OF A NOVEL LIM PROTEIN 1649
on July 13, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://ec.asm.o g/Downloaded om
en iched a he plasma memb ane o he cells wi h some ligh
s aining in he cy oplasm (Fig. 4). A simila s aining pa e n was
obse ed wi h bo h he pa en al HM-1:IMSS cells (Fig. 4a) as well
as wi h he G3 subs ain (Fig. 4b). The s aining obse ed was e y
speci ic, as only a e y ain signal was de ec ed in he cy oplasm
o he EhLimA-silenced amoeba (Fig. 4c). Amoeba cells we e
also s ained wi h phalloidin ha s ains ac in ilamen s (Fig. 4d).
An en ichmen o F-ac in a he plasma memb ane o cells e-
sul ing om s aining o he unde lying co ical ac in was obse ed.
F-ac in was also highly en iched in cellula p o usions.
EhLimA associa es wi h he cy oskele on and in e ac s wi h
ac in. Many LIM domain-con aining p o eins ha e been shown
o associa e wi h he ac in cy oskele on (31), including he
Dic yos elium homologs DdLimE (45, 48) and LimD (30)
which we e ound o localize o he cell co ex. Localiza ion o
EhLimA o he plasma memb ane led us o examine whe he
EhLimA associa es wi h he unde lying ac in cy oskele on. The
p esence o EhLimA in cy oskele al ac ions was i s exam-
ined. To al cell lysa es p epa ed wi h he addi ion o T i on
X-100 we e subjec ed o ul acen i uga ion, esul ing in a pel-
le ac ion con aining he T i on X-100-insoluble cy oskele on
and a supe na an ac ion con aining he soluble p o eins.
P o eins om hese ac ions we e sepa a ed by SDS-PAGE
ollowed by Wes e n blo ing wi h an i-EhLimA an ibodies
(Fig. 5). The esul s show ha a signi ican po ion o EhLimA
is ound in he T i on X-100-insoluble cy oskele on ac ion.
The majo i y o ac in was de ec ed in his ac ion, also con-
i ming he speci ici y o his ac ion. These esul s indica e
ha EhLimA is associa ed wi h he cy oskele on.
The cy oskele on associa ion o EhLimA was u he exam-
ined by assaying whe he ac in binding is in ol ed. A cons uc
was p epa ed ha encoded ull-leng h EhLimA (amino acid
esidues 1 o 145) agged a he N e minus wi h he 24 nucle-
o ides (8 amino acids) co esponding o he FLAG epi ope
(FLAG-EhLimA; Fig. 6A, panel a). This cons uc was cloned
in o an amoeba o e exp ession ec o unde he con ol o he
Ehac in gene p omo e and ans ec ed in o amoeba cells. P o-
ein exp ession o FLAG-EhLimA was con i med by Wes e n
blo ing wi h bo h an i-EhLimA an ibodies as well as an i-
FLAG monoclonal an ibodies (Fig. 6B). In e es ingly, in
FLAG-EhLimA-o e exp essing cells, he an i-EhLimA an i-
bodies de ec ed in addi ion o he bands ep esen ing endog-
enous EhLimA a sligh ly la ge band p obably ep esen ing he
FLAG-EhLimA usion p o ein, while he an i-FLAG an ibod-
ies ecognized his la ge band bu no addi ional bands. The
FIG. 5. EhLimA associa es wi h he cy oskele on. To al cell lysa es
(T) p epa ed wi h he addi ion o T i on X-100 we e subjec ed o
ul acen i uga ion esul ing in a pelle ac ion (P) con aining he
T i on X-100-insoluble cy oskele on and a supe na an ac ion
(S) con aining soluble p o eins. A Wes e n blo analysis o hese ac-
ions using an i-EhLimA an ibodies shows ha a signi ican po ion o
EhLimA is ound in he T i on X-100-insoluble cy oskele on ac ion.
Monoclonal an iac in an ibodies e eal ha he majo i y o ac in is
de ec ed in his ac ion as well.
FIG. 6. (A) Schema ic ep esen a ion o cons uc s encoding ull-
leng h and unca ed FLAG- agged EhLimA. (a) N- e minus- agged
ull-leng h EhLimA (FLAG-EhLimA); (b) N- e minus- agged
EhLimA lacking hal o he N e minus LIM domain (N-TRUNC); (c)
N- e minus- agged EhLimA lacking he glu amic acid- ich C e minus
(C-TRUNC); (d) C- e minus- agged ull-leng h EhLimA (C-FLAG).
(B) P o ein exp ession o FLAG-EhLimA is con i med in a Wes e n
blo analysis using an i-EhLimA an ibodies (lanes I) and an i-FLAG
monoclonal an ibodies (lanes II). Lane 1 and 2 con ain o al cell lysa es
o wild- ype cells and FLAG-EhLimA-o e exp essing cells, espec-
i ely. (C) Di e en amoun s o o al cell lysa es o FLAG-EhLimA-
o e exp essing cells (lanes 1 o 3) and wild- ype cells (lane 5) we e incu-
ba ed wi h an i-FLAG monoclonal an ibodies co alen ly a ached o
aga ose. Immunop ecipi a ed FLAG-EhLimA was analyzed by gel elec-
opho esis ollowed by o al p o ein s aining o he gel ( op gel). Coim-
munop ecipi a ion o ac in was analyzed in a Wes e n blo o immuno-
p ecipi a ed p o ein p oduc s using an iac in an ibodies (bo om gel).
Lane 1, 250 ␮g o al lysa e; lane 2, 100 ␮g o al lysa e; lane 3, 50 ␮g o al
lysa e; lane 5, 500 ␮g o al lysa e. P o ein amoun s a e con i med in lanes
4 and 6 o FLAG-EhLimA-o e exp essing cells and wild- ype cells, e-
spec i ely, each con aining 10 ␮g o o al lysa e.
1650 WENDER ET AL. EUKARYOT.CELL
on July 13, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://ec.asm.o g/Downloaded om

FLAG-EhLimA usion p o ein was immunop ecipi a ed om
cells using an i-FLAG monoclonal an ibodies co alen ly a -
ached o aga ose. Pu i ied FLAG-EhLimA was analyzed by
SDS-PAGE, ollowed by o al p o ein s aining o he gel (Fig.
6C, op gel). As can be seen, he amoun o pu i ied p o ein
de ec ed in he gel was in di ec co ela ion o he amoun o
o al cell lysa e used in he assay. Immunop ecipi a ed p o ein
p oduc s we e analyzed in a Wes e n blo using an iac in an-
ibodies in o de o de e mine whe he ac in is coimmunop e-
cipi a ed oge he wi h EhLimA (Fig. 6C, bo om gel). Indeed,
ac in was de ec ed in he lanes co esponding o cells o e ex-
p essing FLAG-EhLimA, and he amoun o ac in de ec ed
was di ec ly ela ed o he amoun o pu i ied FLAG-EhLimA
p o ein in each lane. No ac in was de ec ed in he lane co e-
sponding o wild- ype cells. These esul s clea ly show ha
EhLimA associa es wi h ac in and ha his associa ion is spe-
ci ic. In e es ingly, we no iced ha while he an iac in an ibod-
ies iden i y wo bands in o al cell lysa es, only he uppe band
appea s in he lanes con aining he pu i ied FLAG-EhLimA
p o ein. The lowe band may ep esen a deg aded o m o
ac in ha does no associa e wi h EhLimA. A smalle ac in
agmen was ecen ly iden i ied in a wo-dimensional gel elec-
opho esis analysis o he E.his oly ica p o eome (34). Taken
oge he , i is easonable o assume ha plasma memb ane
localiza ion o EhLimA is due a leas in pa o an associa ion
o EhLimA wi h he unde lying co ical ac in cy oskele on.
Ac in binding is dependen on he N e minus bu no he C
e minus o EhLimA. In o de o iden i y he egion o he
p o ein in ol ed in ac in binding, wo cons uc s we e p epa ed
encoding EhLimA unca ed a ei he he N e minus (amino
acid esidues 31 o 145) o C e minus (amino acid esidues 1
o 100) agged a he N e minus wi h he FLAG epi ope. The
N- e minus- unca ed and FLAG- agged EhLimA (N-TRUNC)
is lacking hal o he LIM domain (Fig. 6A, panel b), while he
C- e minus- unca ed FLAG- agged EhLimA (C-TRUNC) is
lacking he glu amic acid- ich egion o he p o ein (Fig. 6A,
panel c). Bo h cons uc s we e cloned in o an amoeba o e ex-
p ession ec o unde he con ol o he Ehac in gene p o-
mo e and ans ec ed in o amoeba cells. P o ein exp ession o
he unca ed FLAG- agged EhLimA p o eins was e i ied by
Wes e n blo ing using an i-FLAG monoclonal an ibodies
(Fig. 7A). The unca ed p o eins we e immunop ecipi a ed
using an i-FLAG an ibodies co alen ly a ached o aga ose.
PAGE o he immunop ecipi a ed p o ein p oduc s e ealed
nice amoun s o bo h unca ed p o eins (Fig. 7B, op gel). The
abili y o he unca ed EhLimA p o eins o associa e wi h
ac in was e i ied in a Wes e n blo analysis o immunop ecipi-
a ed p o ein p oduc s using an iac in an ibodies (Fig. 7B, bo -
om gel). While he in ensi y o he band de ec ed in he lane
con aining pu i ied C-TRUNC was simila o ha o he band
de ec ed in he con ol lane con aining he pu i ied ull-leng h
FLAG-EhLimA usion p o ein, a e y ligh band was de ec ed
in he lane con aining pu i ied N-TRUNC. These esul s show
ha he associa ion be ween EhLimA and ac in is dependen
on he N e minus o EhLimA, which con ains he LIM do-
main, and ha emo al o e en hal o he LIM domain sig-
ni ican ly inhibi s he abili y o EhLimA o associa e wi h ac in.
The C e minus o EhLimA, on he o he hand, does no
appea o be in ol ed in ac in binding, as emo al o his
egion o he p o ein does no a ec he abili y o he p o ein
o associa e wi h ac in.
N- e minal clea age o EhLimA. The obse a ion ha he
an i-EhLimA an ibodies de ec ou bands in Wes e n blo s o
amoeba o al cell lysa es sugges ed ha his p o ein unde goes
some ype o clea age o modi ica ion esul ing in a numbe o
p o ein a ian s. Though we conside ed he possibili y ha
hese bands we e he esul o unspeci ic deg ada ion, he gel
mig a ion pa e n o he bands was highly ep oducible and
was obse ed in all Wes e n blo s analyzed. In addi ion, i he e
was unspeci ic deg ada ion, i would mos likely also a ec
o he p o eins analyzed and his was no he case. As shown in
Fig. 6B, in FLAG-EhLimA-o e exp essing cells, he an i-
EhLimA an ibodies de ec in addi ion o hese bands, a sligh ly
la ge band ep esen ing he FLAG-EhLimA usion p o ein.
Howe e , he an i-FLAG an ibodies ecognize only he
FLAG-EhLimA p o ein in hese cells. The inabili y o he
an i-FLAG an ibodies o ecognize any addi ional bands sug-
FIG. 7. (A) Exp ession o N- e minus- and C- e minus- unca ed
FLAG- agged EhLimA. P o ein exp ession o N- e minus- unca ed
FLAG- agged EhLimA (N-TRUNC, lane 2) and C- e minus- un-
ca ed FLAG- agged EhLimA (C-TRUNC, lane 3) is con i med in a
Wes e n blo analysis wi h an i-FLAG an ibodies. In lane 1, exp ession
o he ull-leng h FLAG-EhLimA usion p o ein is shown. Lane 4
con ains a o al cell lysa e o wild- ype cells. (B) Immunop ecipi a ion
and ac in binding o N- e minus- and C- e minus- unca ed FLAG-
agged EhLimA. To al cell lysa es o cells o e exp essing FLAG-
EhLimA (lane 1), N-TRUNC (lane 2), o C-TRUNC (lane 3) and
wild- ype cells (lane 4) we e incuba ed wi h an i-FLAG monoclonal
an ibodies co alen ly a ached o aga ose. Immunop ecipi a ed p o-
eins we e analyzed by gel elec opho esis, ollowed by o al p o ein
s aining o he gel ( op gel). A Wes e n blo analysis o immunop e-
cipi a ed p o ein p oduc s using an iac in an ibodies e eals ha N-
TRUNC has almos comple ely los he abili y o bind ac in (bo om
gel). P o ein amoun s a e con i med in lanes 5 o 8 o lanes 1 o 4,
espec i ely, each con aining 10 ␮g o o al lysa e. (C) N- e minal
clea age o EhLimA. An i-FLAG an ibodies de ec ou bands in a
Wes e n blo o o al cell lysa es o cells o e exp essing FLAG- agged
ull-leng h EhLimA in which he FLAG epi ope is loca ed a he C
e minus o he p o ein (C-FLAG, lane 2) as opposed o only one band
ha is de ec ed in o al cell lysa es o he N- e minus- agged FLAG-
EhLimA-o e exp essing cells (lane 1).
VOL. 6, 2007 CHARACTERIZATION OF A NOVEL LIM PROTEIN 1651
on July 13, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://ec.asm.o g/Downloaded om
ges s ha hese bands a e he esul o N- e minal clea age o
EhLimA. Such clea age would esul in emo al o he FLAG
epi ope ha is loca ed a he N e minus o he p o ein, and
N- e minally clea ed a ian s o EhLimA would no be de-
ec ed by he an i-FLAG an ibodies. N- e minal clea age o
EhLimA was u he con i med by o e exp essing a cons uc
encoding ull-leng h EhLimA agged a he C e minus wi h
he FLAG epi ope (C-FLAG; Fig. 6A, panel d). In lysa es o
cells o e exp essing C- e minus- agged ull-leng h EhLimA,
ou bands we e de ec ed by he an i-FLAG an ibodies as
opposed o only one band ha is de ec ed in lysa es o cells
o e exp essing he N- e minus- agged FLAG-EhLimA usion
p o ein (Fig. 7C). Taken oge he , hese da a indica e ha
EhLimA unde goes N- e minal clea age.
E idence ha a po ion o EhLimA associa es wi h lipid
a s in he pa asi e memb ane. Lipid a s a e memb ane
domains ha ha e been ound o play a ole in a ious cellula
unc ions, including memb ane a icking, endocy osis, sec e-
ion, and signal ansduc ion (13, 52, 53). Recen ly, a -like
mic odomains we e iden i ied in E.his oly ica and we e ound
o be in ol ed in pinocy osis and adhesion (33). Insolubili y in
T i on X-100, which is a p ope y common o cy oskele on-
associa ed p o eins, can also se e as an indica ion ha he
p o ein associa es wi h lipid a s (25, 49) ha a e insoluble in
T i on X-100 due o hei high choles e ol and sphingolipid
con en (14, 52). Insolubili y o EhLimA in T i on X-100 was
obse ed ollowing ul acen i uga ion as shown in Fig. 5, o
when cell lysa es we e ac iona ed a lowe speed cen i uga-
ion (13,000 ⫻g) in o supe na an (soluble) and pelle (insol-
uble) ac ions (Fig. 8A). In his case also, a signi ican po ion
o EhLimA was ound in he T i on X-100-insoluble pelle
ac ion. In e es ingly, a simila dis ibu ion o he amoebic
Gal-lec in ligh subuni (Ehlgl), which was epo ed o be
p esen in a -like ac ions (33), was obse ed in hese ac-
ions as well.
The associa ion o EhLimA wi h lipid a s was assayed by
suc ose g adien cen i uga ion, a me hod commonly used o
isola ing lipid a s (13, 53). To al cell lysa es p epa ed wi h
cold T i on X-100 we e loaded a he bo om o a suc ose
g adien and subjec ed o suc ose g adien lo a ion. F ac ions
we e collec ed om he op o he g adien , and he dis ibu-
ion o EhLimA as well as o Ehlgl and ac in was analyzed in
he collec ed ac ions by SDS-PAGE ollowed by immuno-
blo ing (Fig. 8B). Following suc ose g adien lo a ion, a po -
ion o EhLimA was de ec ed in he lowe -densi y egions o
he g adien . EhLimA was also de ec ed in o he egions, in-
cluding he high-densi y egions o he g adien . This was ex-
pec ed, since we ha e shown ha EhLimA associa es wi h he
ac in cy oskele on ha i sel dis ibu es o he high-densi y
egions o he g adien , as seen he e by he p edominance o
ac in in hese ac ions. Ehlgl, which as al eady men ioned has
been shown o in e ac wi h lipid mic odomains in E.his oly ica
(33), was used as a ma ke o a -like domains and was
indeed ound o be en iched in he lowe -densi y egions o he
g adien , hough i also appea ed in he highe -densi y egions.
Resul s ob ained in h ee independen expe imen s e ealed
some di e ences in he dis ibu ion o EhLimA, bu in all
expe imen s, a po ion o EhLimA was ound in associa ion
wi h he lowe -densi y egions o he g adien .
Deple ion o seques a ion o choles e ol om he mem-
b ane many imes ende s a -associa ed p o eins de e gen
soluble as a esul o a dis up ion. The choles e ol-deple ing
agen me hyl-␤-cyclodex in has been shown o inc ease he
de e gen solubili y o a ious a -associa ed p o eins (32, 47).
Digi onin ha dis up s a s by seques e ing memb ane s e ols
has esul ed in inc eased solubili y o a p o ein associa ed wi h
he T i on X-100-insoluble loa ing ac ion in Dic yos elium
(26). Amoeba cells we e incuba ed on ice wi h ei he me hyl-
␤-cyclodex in o digi onin in o de o de e mine whe he he
T i on X-100 insolubili y o EhLimA is dependen on he p es-
ence o choles e ol. The cells we e hen lysed wi h T i on
FIG. 8. A po ion o EhLimA associa es wi h lipid a s. (A) To al
cell lysa es p epa ed wi h he addi ion o cold T i on X-100 we e
subjec ed o cen i uga ion esul ing in soluble (S) and insoluble
(P) ac ions. A Wes e n blo analysis using an i-EhLimA an ibodies
shows ha a signi ican po ion o EhLimA is ound in he T i on
X-100-insoluble ac ion. A simila p o ein dis ibu ion o he amoebic
Gal-lec in ligh subuni (Ehlgl) was de ec ed using polyclonal an i-
Ehlgl an ibodies. (B) To al cell lysa es p epa ed wi h cold T i on X-100
we e subjec ed o suc ose g adien lo a ion. Twel e ac ions we e
collec ed om he op o he g adien and p o eins we e p ecipi a ed
wi h ichlo oace ic acid. Following SDS-PAGE and immunoblo ing,
he dis ibu ion o EhLimA, Ehlgl, and ac in in he ac ions was
analyzed. A po ion o EhLimA as well as o Ehlgl and ac in was
de ec ed in he lowe -densi y egions o he g adien . The p esence o
EhLimA in he lowe -densi y egions was obse ed in h ee indepen-
den expe imen s. The pe cen age o suc ose in each ac ion is indi-
ca ed. (C) Deple ion o choles e ol. Cells we e incuba ed o 30 min
wi h ei he digi onin o me hyl-␤-cyclodex in on ice ollowed by lysis
in T i on X-100 and cen i uga ion. Wes e n blo ing e eals ha he
dis ibu ion o EhLimA be ween soluble (S) and insoluble (P) ac ions
was g ea ly a ec ed by digi onin bu no by me hyl-␤-cyclodex in.
1652 WENDER ET AL. EUKARYOT.CELL
on July 13, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://ec.asm.o g/Downloaded om
X-100 and ac iona ed by cen i uga ion in o soluble and in-
soluble ac ions (Fig. 8C). Analysis o hese ac ions e ealed
ha ea men o cells wi h me hyl-␤-cyclodex in did no ap-
pea o ha e any e ec on he solubili y o EhLimA, as he
dis ibu ion o he p o ein be ween soluble and insoluble ac-
ions was no a ec ed. Simila esul s we e ob ained when
me hyl-␤-cyclodex in- ea ed cells we e incuba ed a 37°C in-
s ead o on ice (no shown). When cells we e ea ed wi h
digi onin, howe e , he solubili y o EhLimA inc eased d a-
ma ically, as mos o he p o ein was de ec ed in he supe na-
an and only a e y small amoun was de ec ed in he insoluble
pelle . The almos comple e solubiliza ion o EhLimA by di-
gi onin indica es ha he T i on X-100 insolubili y o EhLimA
is due o an associa ion o EhLimA wi h choles e ol- ich lipid
a s in he memb ane. I has been epo ed ha he e a e
cases whe e me hyl-␤-cyclodex in does no solubilize a -as-
socia ed p o eins (44). The eason o he lack o solubiliza ion
o EhLimA by me hyl-␤-cyclodex in in E.his oly ica opho-
zoi es may also be due o di e ences in memb ane lipid com-
posi ion o his pa asi e.
DISCUSSION
Va ious cellula ac i i ies, including mo ili y and chemo-
axis, adhesion, endocy osis, phagocy osis, and cy okinesis, a e
dependen on he cy oskele on o he cell. In o de o in ade
and su i e in hos issues, E.his oly ica ophozoi es ely on a
highly dynamic cy oskele on o pe o m such p ocesses as
phagocy osis, mo ili y, o adhesion ha a e equi ed o he
pa hogenesis o E.his oly ica (23). Va ious componen s o he
cy oskele on ha e been iden i ied in E.his oly ica (37), and a
numbe o p o eins ha e been shown o bind ac in, including
myosin IB (56), calcium binding p o ein 1 (46), and he ac in
binding p o ein ABP-120 (55). In a wide a ie y o euka yo ic
o ganisms, LIM domain-con aining p o eins ha e been shown
o in e ac di ec ly o indi ec ly wi h he ac in cy oskele on (27,
31). The ecen comple ion o he E.his oly ica Genome
P ojec (35) e ealed he p esence o se e al LIM domain-
con aining p o eins p esen in he E.his oly ica genome. O
hese, 12 a e anno a ed as LIM domain p o eins o p o eins
con aining LIM domains, bu he o al numbe o LIM do-
main-con aining p o eins is appa en ly highe , as some LIM
domain-con aining p o eins ha e been anno a ed as p o eins
o which hey a e homologous.
He e we ha e cha ac e ized he i s LIM domain-con aining
p o ein o E.his oly ica which we ha e e med EhLimA.
EhLimA con ains a single LIM domain a i s N e minus and
sha es he highes deg ee o homology wi h he Dic yos elium
DdLimE LIM domain p o ein. DdLimE localizes o he cell
co ex and egula es cell mo ili y and cy okinesis (45, 48). We
ound ha EhLimA associa es wi h he cy oskele on and ha
cy oskele on associa ion in ol es ac in binding. This is shown
by he de ec ion o a signi ican po ion o EhLimA in he
ac in-en iched cy oskele on ac ion o cells. In addi ion, im-
munop ecipi a ion o a FLAG-EhLimA usion p o ein om
cells esul ed in coimmunop ecipi a ion o ac in, indica ing
ha EhLimA is associa ed wi h ac in. Ou esul s show ha he
N- e minal LIM domain o EhLimA is necessa y o ac in
binding, which is consis en wi h he ole o he LIM domain in
media ing p o ein-p o ein in e ac ions. We ound ha emo al
o e en hal o he LIM domain om he p o ein almos com-
ple ely p e en ed ac in binding. On he o he hand, we did no
ind ha he glu amic acid- ich C e minus plays a ole in ac in
binding as emo al o his egion o he p o ein had no e ec
on ac in binding.
Ou esul s also sugges a possible associa ion be ween
EhLimA and a -like mic odomains in he E.his oly ica
plasma memb ane. Fi s o all, a signi ican po ion o EhLimA
was no solubilized by cold T i on X-100. T i on X-100 insol-
ubili y is a p ope y cha ac e is ic o cy oskele on-associa ed
p o eins bu may also indica e ha he p o ein associa es wi h
lipid a s (25, 49). In he case o EhLimA, T i on X-100
insolubili y may be he esul o associa ions wi h bo h he
cy oskele on and lipid a s. Associa ion o EhLimA wi h lipid
a s was shown by he dis ibu ion o a po ion o EhLimA o
he lowe -densi y egions o a suc ose g adien . Since a -like
mic odomains ha e only ecen ly been iden i ied in E.his o-
ly ica (33), a p esen he e is no well-accep ed a ma ke o
his o ganism. We used he ligh subuni o he amoebic Gal-
lec in (Ehlgl) ha was shown o in e ac wi h lipid mic odo-
mains in E.his oly ica (33) and ound ha i was indeed en-
iched in he lowe -densi y egions o he suc ose g adien .
Inc eased solubili y o many a -associa ed p o eins is
achie ed by choles e ol deple ion (6, 15, 32, 47). We ound ha
ea men o cells wi h he choles e ol-deple ing agen me hyl-
␤-cyclodex in had no e ec on he solubili y o EhLimA, while
he choles e ol-complexing agen digi onin esul ed in almos
comple e solubiliza ion o EhLimA. In a p e ious s udy (50), i
was epo ed ha me hyl-␤-cyclodex in was e ec i e in disas-
socia ing p o eins om de e gen - esis an memb anes only
when used on homogena es o MDCK cells bu no when used
on in ac cells. In e es ingly, in ano he s udy (1), he amoun
o p oae olysin, an inac i e p ecu so o he bac e ial oxin
ae olysin, in he de e gen -insoluble pelle and in he solubi-
lized ac ion o BHK cells was only sligh ly a ec ed by me hyl-
␤-cyclodex in, while saponin ea men esul ed in edis ibu-
ion o mos o he p o ein o he de e gen -soluble ac ion.
These indings indica e ha he abili y o choles e ol-a ec ing
agen s o dis up a s may be highly dependen on he s a e o
he cells du ing ea men wi h hese agen s and ha no all
a s whose in eg i y depends on choles e ol will be equally
a ec ed by di e en choles e ol-a ec ing agen s. In addi ion,
a ia ions in he lipid composi ion o di e en a s may a ec
he p o ein solubiliza ion p ope ies o choles e ol-deple ing
agen s. Taken oge he , he esul s ob ained in he suc ose
g adien lo a ion assay oge he wi h he obse a ion ha he
choles e ol-seques e ing agen digi onin almos comple ely
abolishes he T i on X-100 insolubili y o EhLimA indica e
ha in addi ion o being associa ed wi h he ac in cy oskele on,
a po ion o EhLimA may also associa e wi h a -like mic odo-
mains in he plasma memb ane.
The obse ed localiza ion o EhLimA o he plasma mem-
b ane o cells can be a ibu ed o bo h an associa ion o
EhLimA wi h he unde lying co ical ac in cy oskele on and o
some deg ee wi h memb ane a s. While associa ion o
EhLimA wi h he cy oskele on is media ed h ough ac in bind-
ing and in ol es he N- e minal LIM domain o EhLimA, he
mechanism esponsible o he associa ion o EhLimA wi h
a s is no as clea . EhLimA does no possess any known
s uc u al ea u es, such as a glycosylphospha idylinosi ol an-
VOL. 6, 2007 CHARACTERIZATION OF A NOVEL LIM PROTEIN 1653
on July 13, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://ec.asm.o g/Downloaded om
cho , acyl ails, o a ansmemb ane domain, ha could ac-
coun o a associa ion (52). We ha e no es ablished
whe he he in e ac ion be ween EhLimA and ac in akes
place di ec ly o indi ec ly, and i is possible ha hei in e -
ac ion occu s indi ec ly wi h an addi ional p o ein o p o eins
media ing he in e ac ion be ween he LIM domain o
EhLimA and bo h ac in and lipid a s. Such p o eins may
include ac in binding p o eins ha ha e he abili y o bind
phosphoinosi ide lipids, such as phospha idylinosi ol 4,5-
bisphospha e [P dIns(4,5)P
2
] (51), and a e hough o link he
ac in cy oskele on wi h he plasma memb ane and in some
cases wi h a s. Examples include ERM (ez in/ adixin/moesin)
p o eins ha can bind o phosphoinosi ides (41) and a e con-
side ed media o s o in e ac ions be ween he ac in cy oskele-
on and plasma memb ane (2, 11, 12). Gelsolin, an ac in-
capping and -se e ing p o ein ha binds o phosphoinosi ides
has been shown o associa e wi h a s (22). A di e en exam-
ple in ol es he memb ane a p o ein PAG, which was ound
o bind o he cy oplasmic adap o p o ein EBP50 (10) ha is
known o in e ac wi h he ERM- amily p o eins ha bind o
he ac in cy oskele on. In his case, a numbe o p o eins pa -
icipa e in connec ing memb ane a s o he ac in cy oskele-
on. Simila ly, ou esul s sugges ha EhLimA may be pa o
he molecula sys em connec ing he ac in cy oskele on o
memb ane a s. Since ou esul s show ha EhLimA is
clea ed a he N e minus, N- e minal clea age may se e as a
egula o y mechanism ende ing EhLimA unable o associa e
wi h p o ein pa ne s and he eby a ec ing i s abili y o in e ac
wi h he cy oskele on and memb ane a s.
In ag eemen wi h he ole o he LIM domain as a p o ein
binding in e ace, i is concei able ha he LIM domain o
EhLimA se es as a pla o m o he o ma ion o a mul ip o-
ein complex ha includes p o eins possessing bo h ac in bind-
ing capabili ies and lipid binding capabili ies and ha associa-
ion o EhLimA wi h ac in and lipid a s akes place as pa o
his mul ip o ein complex. While iden i ica ion o such p o-
eins will be he subjec o u u e wo k, p elimina y esul s
ha e iden i ied he glycoly ic enzyme enolase as a pu a i e
binding pa ne o EhLimA. Though gene ally ound in he
cy oplasm, a numbe o s udies ha e iden i ied ␣-enolase on
he su aces o many cell ypes (43). Fu he mo e, in a ecen
s udy, a small ac ion o enolase om he mala ial pa asi e
Plasmodium yoeli was ound o be associa ed wi h cell mem-
b anes and cy oskele al elemen s (42). This makes enolase an
in e es ing candida e o media ing he in e ac ions be ween
EhLimA and he cy oskele on and/o lipid a s.
Ou esul s also show ha silencing o o e exp ession o
EhLimA did no cause any signi ican e ec on he g ow h o
mo phology o he pa asi e. Since he E.his oly ica genome
con ains se e al pu a i e LIM p o eins (35), i is possible ha
in he absence o EhLimA, o he LIM p o eins compensa e o
i s unc ion. In addi ion, because he amoeba subs ain G3 in
which he silencing o a second gene can be induced is al eady
a i ulen , i was no possible o in es iga e whe he EhLimA
plays any ole in pa asi e i ulence.
ACKNOWLEDGMENTS
This in es iga ion was suppo ed by a g an om he D ake Family
Founda ion. The s ipend o N.W. was unded by a g an om Hen y H.
Meye , J .
We hank Talia Mi on o he help wi h he pu i ica ion o he
an i-EhLimA an ibodies. We also hank Ri ka B acha and Yael
Nuchamowi z o hei sugges ions and assis ance.
REFERENCES
1. Ab ami, L., and F. G. an De Goo . 1999. Plasma memb ane mic odomains
ac as concen a ion pla o ms o acili a e in oxica ion by ae olysin. J. Cell
Biol. 147:175–184.
2. Alg ain, M., O. Tu unen, A. Vahe i, D. Lou a d, and M. A pin. 1993. Ez in
con ains cy oskele on and memb ane binding domains accoun ing o i s
p oposed ole as a memb ane-cy oskele al linke . J. Cell Biol. 120:129–139.
3. Ank i, S., F. Padilla-Vaca, T. S ola sky, L. Koole, U. Ka z, and D. Mi elman.
1999. An isense inhibi ion o exp ession o he ligh subuni (35 kDa) o he
Gal/GalNac lec in complex inhibi s En amoeba his oly ica i ulence. Mol.
Mic obiol. 33:327–337.
4. Bach, I. 2000. The LIM domain: egula ion by associa ion. Mech. De .
91:5–17.
5. Bal z, R., C. Domon, D. T. Pillay, and A. S einme z. 1992. Cha ac e iza ion
o a pollen-speci ic cDNA om sun lowe encoding a zinc inge p o ein.
Plan J. 2:713–721.
6. Beche , A., J. H. Whi e, and R. A. McIlhinney. 2001. The ␥-aminobu y ic acid
ecep o B, bu no he me abo opic glu ama e ecep o ype-1, associa es
wi h lipid a s in he a ce ebellum. J. Neu ochem. 79:787–795.
7. B acha, R., Y. Nuchamowi z, M. Anba , and D. Mi elman. 2006. T ansc ip-
ional silencing o mul iple genes in ophozoi es o En amoeba his oly ica.
PLoS Pa hog. 2:e48.
8. B acha, R., Y. Nuchamowi z, and D. Mi elman. 2003. T ansc ip ional silenc-
ing o an amoebapo e gene in En amoeba his oly ica: molecula analysis and
e ec on pa hogenici y. Euka yo . Cell 2:295–305.
9. B ad o d, M. M. 1976. A apid and sensi i e me hod o he quan i a ion o
mic og am quan i ies o p o ein u ilizing he p inciple o p o ein-dye bind-
ing. Anal. Biochem. 72:248–254.
10. B dicko a, N., T. B dicka, L. Ande a, J. Spicka, P. Angeliso a, S. L. Milg am,
and V. Ho ejsi. 2001. In e ac ion be ween wo adap e p o eins, PAG and
EBP50: a possible link be ween memb ane a s and ac in cy oskele on. FEBS
Le . 507:133–136.
11. B e sche , A. 1999. Regula ion o co ical s uc u e by he ez in- adixin-
moesin p o ein amily. Cu . Opin. Cell Biol. 11:109–116.
12. B e sche , A., D. Reczek, and M. Be yman. 1997. Ez in: a p o ein equi ing
con o ma ional ac i a ion o link mic o ilamen s o he plasma memb ane in
he assembly o cell su ace s uc u es. J. Cell Sci. 110:3011–3018.
13. B own, D. A., and E. London. 1998. Func ions o lipid a s in biological
memb anes. Annu. Re . Cell De . Biol. 14:111–136.
14. B own, D. A., and J. K. Rose. 1992. So ing o GPI-ancho ed p o eins o
glycolipid-en iched memb ane subdomains du ing anspo o he apical cell
su ace. Cell 68:533–544.
15. Ce neus, D. P., E. Ue ing, G. Pos huma, G. J. S ous, and A. an de Ende.
1993. De e gen insolubili y o alkaline phospha ase du ing biosyn he ic
anspo and endocy osis. Role o choles e ol. J. Biol. Chem. 268:3150–
3155.
16. Chien, S., C. Y. Chung, S. Sukuma an, N. Osbo ne, S. Lee, C. Ellswo h,
J. G. McNally, and R. A. Fi el. 2000. The Dic yos elium LIM domain-
con aining p o ein LIM2 is essen ial o p ope chemo axis and mo phogen-
esis. Mol. Biol. Cell 11:1275–1291.
17. Da is, P. H., X. Zhang, J. Guo, R. R. Townsend, and S. L. S anley, J . 2006.
Compa a i e p o eomic analysis o wo En amoeba his oly ica s ains wi h
di e en i ulence pheno ypes iden i ies pe oxi edoxin as an impo an com-
ponen o amoebic i ulence. Mol. Mic obiol. 61:1523–1532.
18. Dawid, I. B., J. J. B een, and R. Toyama. 1998. LIM domains: mul iple oles
as adap e s and unc ional modi ie s in p o ein in e ac ions. T ends Gene .
14:156–162.
19. Diamond, L. S., D. R. Ha low, and C. C. Cunnick. 1978. A new medium o
he axenic cul i a ion o En amoeba his oly ica and o he En amoeba. T ans.
R. Soc. T op. Med. Hyg. 72:431–432.
20. Eliasson, A., N. Gass, C. Mundel, R. Bal z, R. K au e , J. L. E a d, and A.
S einme z. 2000. Molecula and exp ession analysis o a LIM p o ein gene
amily om lowe ing plan s. Mol. Gen. Gene . 264:257–267.
21. F eyd, G., S. K. Kim, and H. R. Ho i z. 1990. No el cys eine- ich mo i and
homeodomain in he p oduc o he Caeno habdi is elegans cell lineage gene
lin-11. Na u e 344:876–879.
22. Funa su, N., H. Kumanogoh, Y. Sokawa, and S. Maekawa. 2000. Iden i ica-
ion o gelsolin as an ac in egula o y componen in a i on insoluble low
densi y ac ion ( a ) o newbo n bo ine b ain. Neu osci. Res. 36:311–317.
23. Guillen, N. 1996. Role o signalling and cy oskele al ea angemen s in he
pa hogenesis o En amoeba his oly ica. T ends Mic obiol. 4:191–197.
24. Hamann, L., R. Nickel, and E. Tannich. 1995. T ans ec ion and con inuous
exp ession o he e ologous genes in he p o ozoan pa asi e En amoeba his-
oly ica. P oc. Na l. Acad. Sci. USA 92:8975–8979.
25. Ha de , T., and K. Simons. 1997. Ca eolae, DIGs, and he dynamics o
sphingolipid-choles e ol mic odomains. Cu . Opin. Cell Biol. 9:534–542.
26. Ha is, T. J., D. E. Aw ey, B. J. Cox, A. Ra andi, A. Tsang, and C. H. Siu.
1654 WENDER ET AL. EUKARYOT.CELL
on July 13, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://ec.asm.o g/Downloaded om