RESEARCH ARTICLE Open Access
Neona al die impac s li e mi ochond ial
bioene ge ics in pigle s ed o mula o
human milk
Eugenia Ca alho
1,2,3
, Sean H. Adams
4,5
, Elisabe Bø sheim
1,2,3,5
, Michael L. Blackbu n
4,5
, Kikumi D. Ono-Moo e
4,5
,
Ma hew Co e
2,5
, Anne K. Bowlin
4,5
and Laxmi Ye u a
2,4,5*
Abs ac
Backg ound: Neona al die impac s many physiological sys ems and can modi y isk o de eloping me abolic
disease and obesi y la e in li e. Less well s udied is he e ec o pos na al die (e.g., compa ing human milk (HM) o
milk o mula (MF) eeding) on mi ochond ial bioene ge ics. Such e ec s may be mos p o ound in splanchnic
issues ha would ha e ea ly exposu e o die -associa ed o gu mic obe-de i ed ac o s.
Me hods: To add ess his ques ion, we measu ed ileal and li e mi ochond ial bioene ge ics pheno ypes in male
pigle s ed wi h HM o MF om day 2 o day 21 age. Ileal and li e issue we e p ocessed o mi ochond ial
espi a ion (subs a e only [py u a e, mala e, glu ama e], subs a e + ADP, and p o on “leak”pos -oligomycin;
measu ed by O obo os me hods), mi ochond ial DNA (m DNA) and me abolically- ele an gene exp ession
analyses.
Resul s: No di e ences be ween he die g oups we e obse ed in mi ochond ial bioene ge ics indices in ileal
issue. In con as , ADP-dependen li e Complex I-linked OXPHOS capaci y and Complex I + II-linked OXPHOS
capaci y we e signi ican ly highe in MF animals ela i e o HM ed pigle s. In e es ingly, p53, T ap1, and Ppa β
ansc ip abundances we e highe in MF- ed ela i e o HM- ed pigle s in he li e . Mi ochond ial DNA copy
numbe s (no malized o nuclea DNA) we e simila wi hin- issue ega dless o pos na al die , and we e ~ 2–3 imes
highe in li e s. ileal issue.
Conclusion: While mechanisms emain o be iden i ied, he da a indica e ha neona al die can signi ican ly
impac li e mi ochond ial bioene ge ics pheno ypes, e en in he absence o a change in m DNA abundance. Since
pe meabilized li e mi ochond ial espi a ion was inc eased in MF pigle s only in he p esence o ADP, i sugges s
ha o mula eeding led o a highe ATP u no e . Speci ic mechanisms and signals in ol ed wi h neona al die -
associa ed di e ences in li e bioene ge ics emain o be elucida ed.
Keywo ds: Human milk, Fo mula die , Mi ochond ia, Li e , Gas oin es inal ac
© The Au ho (s). 2020 Open Access This a icle is licensed unde a C ea i e Commons A ibu ion 4.0 In e na ional License,
which pe mi s use, sha ing, adap a ion, dis ibu ion and ep oduc ion in any medium o o ma , as long as you gi e
app op ia e c edi o he o iginal au ho (s) and he sou ce, p o ide a link o he C ea i e Commons licence, and indica e i
changes we e made. The images o o he hi d pa y ma e ial in his a icle a e included in he a icle's C ea i e Commons
licence, unless indica ed o he wise in a c edi line o he ma e ial. I ma e ial is no included in he a icle's C ea i e Commons
licence and you in ended use is no pe mi ed by s a u o y egula ion o exceeds he pe mi ed use, you will need o ob ain
pe mission di ec ly om he copy igh holde . To iew a copy o his licence, isi h p://c ea i ecommons.o g/licenses/by/4.0/.
The C ea i e Commons Public Domain Dedica ion wai e (h p://c ea i ecommons.o g/publicdomain/ze o/1.0/) applies o he
da a made a ailable in his a icle, unless o he wise s a ed in a c edi line o he da a.
* Co espondence: [email p o ec ed]
2
A kansas Child en’s Resea ch Ins i u e, Li le Rock, AR, USA
4
Depa men o Pedia ics, Uni e si y o A kansas o Medical Sciences
(UAMS), Li le Rock, USA
Full lis o au ho in o ma ion is a ailable a he end o he a icle
Ca alho e al. BMC Nu i ion (2020) 6:13
h ps://doi.o g/10.1186/s40795-020-00338-7
Backg ound
B eas eeding has been shown o ha e posi i e impac on
he body’s physiological sys ems, including he immune
sys em and me abolically-impo an issues such as li e ,
adipose, and cogni i e cen e s in he b ain [1,2]. Recen
s udies ha e epo ed ha milk o mula- ed (MF) in an s
p esen mo e apid weigh gain du ing he i s weeks o
li e compa ed o b eas ed in an s, and his appea s o be
associa ed wi h weigh gain la e in li e [3–5]. The nu ien
composi ion o human milk (HM) in compa ison o milk
o mulas may play a signi ican ole in he obse ed me a-
bolic ou comes and he epo ed heal h di e ences when
compa ing hese wo neona al die s [6–11]. Mi ochond ial
unc ion and ene gy homeos asis impinge on all o hese
sys ems, bu he ole o in an die and p og amming o
cellula bioene ge ics emains la gely unexplo ed.
A p e ious s udy in 8 week old a s ed wi h HM o don-
key milk (DM) in compa ison o cow’s milk o 4 weeks
showed al e ed li e and skele al muscle mi ochond ial
unc ion and me abolism [12,13]. Speci ically, in isola ed
li e mi ochond ia, HM and DM- ea ed g oups had in-
c eased succina e o palmi oylca ni ine-associa ed p o on
leak, inc eased s a es 3 and 4 espi a ion, and highe mi o-
chond ial ma ke s (e.g., ca ni ine palmi oyl ans e ase and
ci a e syn hase ac i i ies) when compa ed o mi ochond ia
om un ea ed con ol animals [12]. Mi ochond ia om
animals ed cow’s milk sha ed some simila i ies o HM and
DM, bu he pheno ype was complica ed by signi ican ly
highe adiposi y. In muscle mi ochond ia, leak and s a es 3
and 4 espi a ion we e again highe in samples de i ed
om HM o DM ed a s s. un ea ed con ol a s,
whe eas hese pa ame e s we e equi alen in cow’s milk ed
and un ea ed con ol a s [13]. In addi ion, HM and DM
inc eased li e and muscle le els o N-oleoyle hanolamine
(OEA), a egula o o lipid me abolism [13]. The au ho s
specula ed ha his could con ibu e o bu ning o a and
p o ec he animals om de eloping ce ain obesi y-
associa ed me abolic and in lamma o y sequelae. Fu he -
mo e, hey specula ed ha die -associa ed changes in
mic obio a and inc eased sho chain a y acid (bu y a e)
in HM- and DM- ed animals con ibu ed o he di e ences
in me abolism and mi ochond ial unc ion h ough as-ye
unknown signaling pa hways [12]. We ha e epo ed sig-
ni ican al e a ions in he bio egional gu mic obiome when
compa ing HM- and MF- ed pigle s [14], and se e al s ud-
ies ha e indica ed di e ences in gu mic obio a compa ing
b eas ed o o mula- ed in an s [15–18].
The e is inc easing app ecia ion o he impac o ea ly-
li e die on “p og amming”o physiological sys ems wi h
po en ial me abolic consequences in childhood o adul -
hood. Mo e impo an , he e is g owing consensus ha
nu i ional “p og amming e ec s”pe sis and in luence
isk o alle gies, as hma, obesi y, diabe es, and ca dio as-
cula disease la e in li e [1,19–24]. We hypo hesized ha
neona al die (HM and MF) would di e en ially a ec
mi ochond ial espi a ion in he small in es ine (ileum)
and li e . To add ess ou hypo hesis, we used HM and
MF- ed pigle s unde con olled expe imen al condi ions,
due o inhe en a iabili y associa ed wi h sow- ed pigle s
(e.g., a m housing, mo he ’s skin con ac , and suckling
die ). Tissues we e collec ed om pigle s ed HM and MF
be ween pos na al day 2–21, o de e mine subs a e- and
ADP-d i en espi a ion as well as mi ochond ial DNA
copy numbe . To ou knowledge, his is he i s s udy o
cha ac e ize he impac o pos na al eeding pa adigms on
issue mi ochond ial unc ion in a la ge animal model.
Me hods
S udy design
Animals we e main ained in acco dance wi h he e hical
guidelines o animal esea ch es ablished and app o ed
by he Ins i u ional Animal Ca e and Use Commi ee a
he Uni e si y o A kansas o Medical Sciences. Ani-
mals we e ob ained om Me z Fa m (Russell ille, AR)
ha a e app o ed o esea ch. Two-day old Whi e
Du ch Land ace Du oc male pigle s (Me z Fa m, Rus-
sell ille, AR) we e ans e ed o indi idual housing a
he i a ium in A kansas Child en’s Nu i ion Cen e
(ACNC). The s udy p o ocol and in o ma ion on his co-
ho o animals has been published p e iously [14]. Pig-
le s we e ob ained om 30 di e en sows and housed
indi idually. Based on weigh s pigle s we e andomized
using excel shee o mula o consume ei he human milk
(HM, n= 26) o isocalo ic dai y milk-based o mula die
(MF; n= 26). HM was ob ained om he Mo he s’Milk
Bank o No h Texas (Benb ook, TX). Fo he MF die ,
Similac Ad ance powde was ob ained om Ross P od-
uc s (Abbo Labo a o ies, Columbus, OH). Bo h HM
and MF die s we e modi ied o mee he ene gy and nu-
ien ecommenda ions o he Na ional Resea ch Coun-
cil o g owing pigs [25]. Die composi ion, nu i ional
con en s, and me hods ela ed o he eeding pa adigm
ha e been published p e iously [14]. B ie ly, wi h he
ansi ion o ACNC, pigle s we e ained o d ink om
ubbe nipples and we e p o ided 1.047 MJ·kg
−1
·d
−1
o
ei he HM o MF. Pigle s we e ed wi h wa med die
e e y 2 h in he i s week o he s udy, e e y 4 h in he
second week o he s udy, and e e y 6 h in he hi d
week o he s udy h ough day 21. A day 14, solid
“s a e pig ood”(Teklad die , TD 140608; Ha lan) was
slowly in oduced un il day 21 when 11 andomly se-
lec ed pigle s om each die g oup we e eu hanized. Pig-
le s we e eu hanized wi h a mask a an oxygen low a e
o 2.0 LPM and iso luo ane mix u e o 3–5% a and ca -
dio ascula signs (pulse) we e moni o ed o assu e
comple e unconciousnees p io o exsanguina ion. The
emaining animals we e u ilized o immuniza ion chal-
lenge s udies as p e iously published (n=30) [14], and
Ca alho e al. BMC Nu i ion (2020) 6:13 Page 2 o 10
a e he e o e no included in he cu en pape . No sig-
ni ican di e ence in body weigh s was obse ed be-
ween HM and MF as p e iously published [14].
Tissue p ocessing o mi ochond ial unc ional analysis
Animals we e as ed o 8 h p io o issue collec ion. A
subse o pigle s we e andomly chosen o assess mi o-
chond ial unc ion (HM, n=8–11; MF, n=8–11; see indi-
idual igu es). We measu ed 50 cm om he dis al end o
small in es ine, and a ha ma k issue was cu as a 15 cm
p oximal sample. Ileal and li e samples o analyses o
mi ochond ial unc ion we e p ocessed immedia ely a e
collec ion. A po ion o ileum and li e (∼40 mg) was im-
media ely subme ged in ice-cold p ese a ion bu e
(BIOPS) con aining 10 mM Ca-EGTA bu e , 20 mM
imidazole, 20 mM au ine, 50 mM K-MES, 0.5 mM di hio-
h ei ol, 6.56 mM MgCl
2
, 5.77 mM ATP, and 15 mM c e-
a ine phospha e (pH o 7.1) [26], o mi ochond ial
espi a ion analysis wi hin 1–2 h o issue collec ion.
Ileal and li e samples we e minced (0.1–0.2 mm)
using small and sha p o ceps while on ice, and chem-
ically pe meabilized o 20 min in BIOPS bu e con ain-
ing 50 μg/ml saponin a 4 °C [27–30]. Samples we e
ans e ed o 2 ml o MIR05 bu e (0.5 mM EGTA, 3
mM MgCl
2
, 60 mM K-lac obiona e, 20 mM au ine, 10
mM KH
2
PO
4
, 20 mM HEPES, and 110 mM suc ose, and
1 mg/ml essen ial a y acid- ee bo ine se um albumin
(Sigma Ald ich, S . Louis, MO, USA; Lo SLBF5061V)
ollowed by 10 min mixing on a shake o wash away he
emaining saponin. Pe meabilized issue explan s we e
blo ed on il e pape be o e being weighed on a p eci-
sion mic obalance. Less han 10 mg o we weigh ileum
and abou 3 mg o we weigh li e we e ans e ed o
an Oxyg aph-2 k (O2k) espi ome e chambe (O obo os
Ins umen s, Innsb uck, Aus ia) con aining 2 ml o
MIR05 bu e [28,31,32].
High- esolu ion espi ome y (HRR)
Be o e each expe imen , a backg ound calib a ion was
pe o med on each O2k polyg aphic oxygen senso
(POS). This calib a ion was pe o med in MIR05 bu e
a ai sa u a ion. Ze o oxygen and ins umen al back-
g ound calib a ions we e pe o med a egula in e als
h oughou he da a collec ion pe iod (∼12 mon hs)
using di hioni e i a ions. This ensu ed accep able POS
ins umen al backg ound and s abili y o e ime [26].
Tempe a u e was main ained a 37 ± 0.01 °C by an elec-
onic Pel ie du ing all high- esolu ion espi ome y
(HRR) expe imen s. O
2
concen a ion wi hin he MIR05
bu e was eco ded a 2 o 4 s in e als om which O
2
luxes we e calcula ed in he picomola ange (Da Lab
e sion 6; O obo os Ins umen s, Innsb uck, Aus ia)
[31]. Once issue samples had been placed in he O2k
chambe s, a gas phase was c ea ed. Abou 1 ml o 99%
O
2
was injec ed in o each O2k chambe , and equilib a-
ion o he gas phase and MIR05 O
2
concen a ions was
moni o ed un il an O
2
concen a ion o ∼400 μM was
achie ed in he MIR05 bu e ; O
2
lux measu emen s
we e ypically made when O
2
concen a ions we e in he
ange o 200–400 μM o minimize any O
2
dependency
a e ac s and o a oid po en ial limi a ions in oxygen di -
usion in pe meabilized issue samples.
Mi ochond ial espi a o y capaci y and unc ion we e
e alua ed by he sequen ial addi ion o subs a es and inhib-
i o s. A wide a ie y o subs a e- inhibi o - i a ion p o o-
cols ha e been used o e alua ion o mi ochond ial
espi a ion in di e en samples and unde a ious expe i-
men al condi ions [30,33–35]. He e, we e alua ed he con-
ibu ion o complex I and II o mi ochond ial espi a ion,
as well as he impac o inhibi ion o complex V. A bioene -
ge ics p o ocol was used ha in o ms on speci ic espi a o y
pa hways con e ging a he Q-junc ion o he elec on
anspo chain (Table 1). E ec s o NADH-linked sub-
s a es (N-pa hway), including py u a e (5 mM), mala e (2
mM) and glu ama e (PMG, 10 mM) we e e alua ed o de-
e mine non-ATP-linked espi a ion a Complex I [26].
The p esen p o ocol also e alua ed oxygen consump ion
a e (pmol O
2
·s
−1
·mgwe weigh issue
−1
) o de e mine
he oxida i e phospho yla ion capaci y (“OXPHOS cap-
aci y”(P)) a e adenosine diphospha e (ADP, 5 mM)
addi ion [27,28,32]. Subsequen ly, he “S-pa hway”was
e alua ed using succina e as subs a e (10 mM) o de e -
mine espi a ion a Complex II. Also, p o on leak espi -
a ion a complex I and II was de e mined by adding
oligomycin (OMY; 0.2 μg/ml) a e subs a es and ADP
we e p o ided. The espi a o y oxida i e capaci y esul s
we e co ec ed by he esidual oxygen espi a ion (ROX)
ob ained a e an imycin A (AMA; 12.5 μM) inhibi ion o
elec on anspo chain Complex III (a.k.a. UQ-
cy och ome c oxido educ ase) a he end o he expe imen .
Mi ochond ial DNA copy numbe
DNA was ex ac ed om ~ 25 mg o ozen ileal issue
using QIAamp Fas DNA Tissue Ki (QIAGEN, Ge man-
own, MD) ollowing he manu ac u e ’s p o ocol. Ap-
p oxima ely 500 mg o he li e was homogenized in PBS
(Gibco, The mo Fishe ). DNA was ex ac ed om he
equi alen o ~ 25 mg o li e using QIAamp Fas DNA
Tissue Ki . DNA s anda ds o each a ge we e gene a ed
using p ime s lis ed in Table 2 o ampli y he mi ochon-
d ial genes ND1 (519 base pai (bp) amplicon) and Cox1
(477 bp amplicon), and he nuclea gene β-ac in (496 bp
amplicon) using GoTaq G een Mas e Mix (P omega,
Madison, WI). PCR p oduc s we e sepa a ed on a 1%
aga ose gel and amplicon bands we e excised and ex-
ac ed using QIAquick Gel Ex ac ion Ki (QIAGEN,
Ge man own, MD). Concen a ions we e de e mined
using a NanoD op 1000 Spec opho ome e (NanoD op,
Ca alho e al. BMC Nu i ion (2020) 6:13 Page 3 o 10
Wilming on, DE) and a Qubi 2.0 luo ome e using he
dsDNA HS Assay Ki (In i ogen). Copy numbe pe μlo
DNA was de e mined using he equa ion:
numbe o copies/μl = (amoun (ng/μl) * 6.022 × 10
23
numbe /mole) / (leng h (bp) * 1 × 10
9
ng/g * 650 g/mole
o bp).
S anda ds we e se ially dilu ed 10- old om 1 X 10
8
cop-
ies/μl o1X10
3
copies/μl o cons uc a 6-poin s anda d
cu e. Fo eal- ime PCR, new p ime s loca ed wi hin he
amplicon o ND1, Cox1 and β-ac in (Table 2)we ede-
signed using In eg a ed DNA Technology’s(IDT)P ime -
Ques Tool (www.id dna.com/P ime ques /Home/Index).
DNA (200 pg) was used in a 10 μl PCR eac ion using Fas
SYBR G een Mas e Mix (Applied Biosys ems) on a ViiA 7
Real-Time PCR Sys em (Applied Biosys ems). m DNA
copy numbe was calcula ed using s anda d cu es and
no malized using he abundance o he β-ac in nuclea
gene. All a ailable pigle samples we e used o de e mine
mi ochond ial DNA copy numbe (HM, n= 11; MF, n=
11 pe issue).
Gene exp ession
RNA was ex ac ed om ~ 30 mg o ozen ileum issue
using RNeasy Plus Mini Ki (Qiagen) acco ding o man-
u ac u e ’s p o ocol. Fo li e RNA, ~ 100 mg o ozen
li e s we e homogenized using miRNeasy Mini Ki (Qia-
gen) and homogena e equi alen o ~ 30 mg o li e
om each sample was used o RNA ex ac ion. Concen-
a ion was de e mined using UV abso bance. One μgo
o al RNA was used o c ea e cDNA using iSc ip cDNA
Syn hesis Ki (Bio-Rad, He cules, CA) acco ding o man-
u ac u e ’s p o ocol. cDNA was dilu ed and 10 ng o
cDNA was used in a PCR eac ion using Fas SYBR
G een Mas e Mix (Applied Biosys ems) on a ViiA 7
Real-Time PCR Sys em (Applied Biosys ems). A s and-
a d cu e was gene a ed by pooling undilu ed cDNA
om di e en ea men s o c ea e a mas e pool. The
mas e cDNA mix was se ially dilu ed 5- old a o al o
ou imes, o an a bi a y i e-poin s anda d cu e.
RNA exp ession was no malized o he ileum using he
geome ic mean o h ee (Rps16, Rpl27, and 18S) e e -
ence RNAs and o he li e using he geome ic mean
o wo (Rps16 and 18S) e e ence RNAs ha we e no
al e ed by ea men . All a ailable pigle samples we e
used o de e mine mi ochond ial gene exp ession (HM,
n= 11; MF, n= 11). One MF ed pigle li e sample was
emo ed due o poo RNA quali y (RIN ~ 6.5). P ime s
we e designed using IDT’s P ime Ques and a e lis ed in
Table 3.
S a is ical analyses
All da a a e p esen ed as means ± SEM. The da a we e
analyzed by wo- ailed - es and p< 0.05 was conside ed
o be s a is ically signi ican be ween he g oups.
Resul s
Mi ochond ial espi a ion pheno ypes
A ace o oxygen lux using pe meabilized ileum and li e
samples de i ed om a 21-day old pigle ed wi h HM is
shown in Fig. 1. This p o ocol p o ides assessmen o
Table 1 Mi ochond ial espi a ion p o ocol eagen s lis ed in o de o i a ions and he co esponding pa hway con ols and
espi a o y s a es
Subs a es Abb e ia ions Pa hway con ol/
Respi a o y s a e
Pa hway o Q Explana ion
Py u a e (5 mM),
Mala e (2 mM),
Glu ama e (10 mM)
PMG N/PMG(L) CI LEAK (L) espi a ion,
no adenyla es
ADP (5 mM) ADP N/PMG(P) CI OXPHOS capaci y (P)
Succina e (10 mM) SUC NS/PMGS(P) CI + CII Complex I + II-linked (P)
Oligomycin (0.2 μg/ml) OMY ROX ROX Inhibi ion o CV
An imycin A (12.5 μM) AMA ROX ROX Inhibi ion o CIII
Abb e ia ions: Adenosine diphospha e (ADP), Complex I (CI), Complex II (CII), LEAK (L), NADH- (N) pa hway, OXPHOS capaci y (P), Residual oxygen
consump ion (ROX)
Table 2 P ime s used o mi ochond ial DNA copy numbe measu emen in pigle ileum and li e
Gene Fo wa d P ime 5′-3’Re e se P ime 5′-3’Amplicon (bp) Use
Cox1 CTCTGGGCTTCATCTTCCTATTC GAGGACATCCGTGTAGTCATTC 477 S anda d Cu e
Nd1 GCCTAGCAGTATACTCTATCCT CGTATCGGAATCGTGGGTATG 519 S anda d Cu e
Ac b CTGGCATTGTCATGGACTCT GATCGAGTTGAAGGTGGTCTC 496 S anda d Cu e
Cox1 GTAGTCGCACACTTCCACTATG TGAGTGTGTACCCGGAGAATA 100 Real- ime PCR
Nd1 TTATCTCAACCCTAGCAGAAACC AAAGGTCCGGCTGCATATT 103 Real- ime PCR
Ac b ACCTGACCGACTACCTCAT GCAGAGCTTCTCCTTGATGT 101 Real- ime PCR
Ca alho e al. BMC Nu i ion (2020) 6:13 Page 4 o 10
“ espi a o y leak”(L) suppo ed p ima ily by elec on low
h ough complex I o he espi a o y chain a e addi ion
o py u a e, mala e and glu ama e (PMG-L). The p o ocol
also p o ides he OXPHOS capaci y (P) a e ADP is
added ollowing he py u a e, mala e and glu ama e
(PMG-P); P ep esen s maximal Complex I-linked ADP-
linked OXPHOS capaci y h ough he N-pa hway, elec on
ans e occu s by Complex I. Subsequen ly, succina e
(SUC) is added o induce complex II-linked espi a ion.
We de e mined he con ibu ion o elec on low om
bo h complex I and II espi a ion, ep esen ing he max-
imal ADP-linked OXPHOS capaci y ha was measu ed in
ileum. Nex , OMY was added o assess leak espi a ion
when subs a es and ADP we e p o ided, bu ATP
Table 3 P ime s used o mi ochond ial gene exp ession assays in pigle ileum and li e
Gene Fo wa d P ime 5′-3’Re e se P ime 5′-3’
Cycs CCAAACCTCCATGGTCTCTTT TACTCCATCAGTGTCTCCTCTC
Hspa9 TCAACAGGAACACCACCATT TCTCTCTCACCCTGACATACTT
N 1 CGATGGCACTGTCTCTCTTATC CCATCAGCCACAGCAGAATA
p53 CCGAGTACTTGGATGACAGAAA GTTGTAGTGGATGGTGGTACAG
Pgc1αCCCACAACTCCTCCTCATAAAG TCACTGTACCGGGTCTTCT
Ppa βCATGAAGCTGGAGTACGAGAAG AGCGAATGGCGTTGTAAGA
Sco2 AAGGACGAGGACCAGGATTA TGCCGTAGTAGTCGGTGAA
T am GTGGAGGGAACTTCCTGATTC TGACTTGGAGTTAGCTGTTCTT
T ap1 CAGCTTCGACCACCTCTTC CCAGCAGCCCATCCTTATT
Uqc 10 GAGGTTGTACTCCCTGTTGTTT CCTGGTTGATGTGTTCGTAGAT
Rps16 TGATCCTCGTCGCTGTGAATCCAA ACGCTGATCATCACGATGGGCTTA
Rpl27 AAGTTCATGAAACCCGGGAAGGTG TCGGTCTGAGGTGCCATCATCAAT
18S CCTGTAATTGGAATGAGTCCAATTT ATACGCTATTGGAGCTGGAATTACC
Fig. 1 Illus a i e espi a o y luxes o pe meabilized ileum issue om 21 day old pigle s. aileum and bli e sample o iginal ace om he
O obo os oxyg aph shows esponses o he subs a e- inhibi o i a ion p o ocol as desc ibed in esul s sec ion
Ca alho e al. BMC Nu i ion (2020) 6:13 Page 5 o 10

syn hase inhibi ed, measu ing p o on leak om complex I
and II.
We assessed he impac o neona al die s on mi o-
chond ial espi a ion in pe meabilized ileum on day 21
(Fig. 2a). No signi ican di e ences we e obse ed in he
pe meabilized ileum explan s o all pa ame e s es ed:
PMG espi a o y leak, Complex I-linked OXPHOS cap-
aci y, measu ed a e adding ADP, Complex I- and II-
linked OXPHOS capaci y (CI + II P) measu ed a e
addi ion o succina e (SUC), and Complex I and II-
linked leak (OMY). In he li e (Fig. 2b), highe Complex
I-linked OXPHOS capaci y and highe Complex I- and
II-linked OXPHOS capaci y we e obse ed in MF- ed
pigle s compa ed o HM- ed pigle s.
Mi ochond ial DNA
Mi ochond ial DNA copy numbe , no malized o nu-
clea DNA copy numbe , did no signi ican ly di e on
day 21 be ween he HM and MF die g oups in ileum o
li e (Fig. 3). No ably, m DNA was ~ 2–3 imes highe
in li e compa ed o ileum.
Exp ession o selec genes ele an o me abolism and
mi ochond ial bioene ge ics
We measu ed gene exp ession o selec ansc ip s in-
ol ed in mi ochond ial unc ion and me abolism om
ileum and li e . In ileum, no signi ican di e ences we e
no ed be ween he die g oups wi h espec o
Ubiquinol-Cy och ome C Reduc ase (Uqc 10), Pe oxi-
some P oli e a o -Ac i a ed Recep o Gamma Coac i a-
o 1-Alpha (Pgc1α), Cy och ome C (Cycs), Hea Shock
P o ein Family A, Membe 9 (Hspa9), p53, Nuclea Re-
spi a o y Fac o 1 (N 1), TNF Recep o Associa ed P o-
ein 1 (T ap1), and T ansc ip ion Fac o A mi ochond ia
(T am) ansc ip abundances a day 21 (Fig. 4a).
In e es ingly, in ileum Pe oxisome P oli e a o -Ac i a ed
Recep o Be a (Ppa β) exp ession was signi ican ly lowe
in MF g oup a day 21 ela i e o he HM g oup, while
Cy och ome C Oxidase Assembly P o ein (Sco2) exp es-
sion was signi ican ly highe (Fig. 4a). In li e , p53,
T ap1 and Ppa β ansc ip abundances we e highe in
MF- ed ela i e o HM- ed pigle s (Fig. 4b).
Discussion
The cu en p oo -o -p inciple s udy ocusing on pigle
ileal and li e issue unco e ed no el indings wi h e-
spec o in an die and issue mi ochond ial unc ion,
and sugges ha selec aspec s o li e bioene ge ics a e
al e ed by neona al die .
The a ea o de elopmen al p og amming o bioene ge -
ics, which encompasses sys ems in ol ing he mi ochon-
d ial managemen o uels and me aboli es o ul ima ely
suppo e icien ene gy con e sion o ATP and egula ion
o eac i e oxygen species gene a ion, emains la gely un-
explo ed. I may be expec ed ha one’sdie pa e nsand
mac onu ien a ailabili y would in luence mi ochond ial
unc ion and adap a ions ha would ensu e p ope main-
enance and de elopmen o bioene ge ics sys ems. This
may be especially p o ound in issues ha a e p oximal o
gu -de i ed signals. Signals om he gu mic obiome, o
ha a e changed coinciden wi h mic obiome shi s, e-
duce li e o muscle exp ession o some me abolism genes
(e.g., PGC-1α,SIRT1,andAMPK) and egula e mi ochon-
d ial biogenesis and unc ion ( e iewed in [36]). The mos
ob ious example is bu y a e, which can media e PGC-1α
induc ion in oden muscle. Adminis a ion o he p o-
bio ic Lac obacillus hamnosus CNCMI-4317 o adul ani-
mals appea ed o ac i a e PPAR-αpa hways coinciden
wi h highe oxida i e phospho yla ion capaci y. Se e al
clinical and animal s udies ha e shown gu mic obio a
Fig. 2 Respi a o y luxes o pigle ileum on day 21, om animals consuming human milk (HM) o cow milk-based o mula (MF). aMass-speci ic
espi ome y esul s o pe meabilized ileum issue o 21-day old pigle s ed ei he HM o MF (n= 11/die g oup). bMass-speci ic espi ome y
esul s o pe meabilized li e o 21-day old pigle s ed ei he HM (n=8)o MF(n= 8) o a pe iod o 21 days s a ing on pos na al day 2. PMG:
py u a e, mala e and glu ama e; ADP: adenosine diphospha e; SUC: succina e; OMY: oligomycin; The da a a e p esen ed as mean ± SEM. The da a
we e analyzed by 2- ailed - es and *p< 0.05, **p< 0.01 was conside ed signi ican be ween he die g oups
Ca alho e al. BMC Nu i ion (2020) 6:13 Page 6 o 10
di e ences in b eas - ed e sus o mula- ed neona es [14,
37–41], and o he s udies ha e demons a ed ha gu
mic obio a may inc ease a y acid up ake and oxida ion
h ough seconda y bile acids [42–44]. The gu mic obes
Bac e oides, Eubac e ium, and Clos idium gene a deg ade
he p ima y bile acids o seconda y bile acids [45]. In e -
es ingly, om he same pigle s s udied he ein, we ha e e-
po ed highe abundance o Bac e oides in HM- ed pigle s
ela i e o MF- ed pigle s [14]. In addi ion, a s ed wi h
HM also showed inc eased Bac e oides coloniza ion com-
pa ed o con ol animals along wi h enhanced mi ochon-
d ial ac i i y/p o on leakage [12]. Since he GI ac is in
di ec con ac wi h gu mic obes, and o he splanchnic is-
sues such as li e a e immedia ely downs eam, mi ochon-
d ia and mi ochond ial egula o s in splanchnic issue
cells may be pa icula ly sensi i e o mic obe-de i ed sig-
nals. Such a hypo hesis awai s es ing in u u e s udies.
In addi ion o mic obial signals, he e is he possibili y
ha ood componen s hemsel es in luence mi ochond ial
unc ion. Ra models (pos -weaned, adul animals) indica e
ha mi ochond ial unc ion o li e and skele al muscle can
be modula ed by die a y componen s [13,46–51]. Howe e ,
no hing is known abou he e ec o pos na al die on mi o-
chond ial unc ion, especially in he splanchnic issues ha
would be exposed o die a y componen s and mic obial-
de i ed ac o s ha migh egula e me abolic pa hways. Fo
ins ance, human milk and donkey milk imp o ed glucose
and lipid me abolism, and modi ied mi ochond ia in adul
a skele al muscle when compa ed o un ea ed con ol an-
imals [13], al hough i could no be asce ained i hese di -
e ences we e d i en by ood componen s o o he ac o s
emana ing om he gu mic obes o hos issues. Fu he -
mo e, die componen s ha e been shown o impac mi o-
chond ial bioene ge ics in animal models and cell cul u e
Fig. 3 Mi ochond ial DNA (m DNA) copy numbe in 21 day old pigle ileum and li e issues. aDay 21 m DNA (n= 11/ die g oup) o ileum and
bday 21 m DNA (n= 11/die g oup) o li e . m DNA alues a e no malized o he nuclea DNA a ge gene be a-ac in. The da a a e p esen ed as
mean ± SEM. The da a we e analyzed by 2- ailed - es o de e mine he signi icance be ween he die g oups. HM - Human milk; MF - Cow
milk-based o mula
Fig. 4 Gene exp ession analysis o pigle ileum and li e a day 21, om animals consuming human milk (HM) o cow milk-based o mula (MF). a
lleum (n= 11/ die g oup) and bli e (n=10–11/die g oup) samples exp ession o Uqc 10, Pgc1α, Hspa9, p53, N 1, T ap1, T am, Cycs, Ppa βand
Sco2. No malized a bi a y uni s we e calcula ed using geome ic mean o 2–3 e e ence genes and s anda d cu es gene a ed o each a ge
(see me hods sec ion). The da a a e p esen ed as mean ± SEM. The da a we e analyzed by 2- ailed - es , *p< 0.05, **p< 0.01 was conside ed
signi ican be ween he die g oups
Ca alho e al. BMC Nu i ion (2020) 6:13 Page 7 o 10
( e iewed in [52]). In li e and muscle he e is e idence ha
exposu e o high le els o sa u a ed a y acids p omo es
mi ochond ial ission-like e en s, dec eased p o on leak,
and highe ROS, whe eas ω3 polyunsa u a ed a y acids
ha e heopposi ee ec inanimal models. Whe he o no
a s and o he componen s o he neona al die in luence
mi ochond ial unc ion o p og amming o mi ochond ial
bioene ge ics emains o be e alua ed expe imen ally. Re-
ga dless o speci ic mechanisms, he cu en s udy indica es
ha HM and MF eeding can elici di e en bioene ge ics
pheno ypes in he li e : pigle s ed MF displayed signi i-
can ly highe ADP-linked espi a ion. The inc eased
pe meabilized li e espi a ion was no due o di e ences in
henumbe o mi ochond ia(sincecopynumbe pe gen-
omic be a-ac in was no di e en be ween he die g oups),
and was no due o g oss di e ences in p o on leak. F om
hese obse a ions, i appea s ha highe ATP u no e in
he MF li e d o e highe O
2
consump ion. On he o he
hand, neona al eeding pa adigm did no appea o al e
ileum bioene ge ics compa ed o HM ed pigle s, highligh -
ing a po en ial issue speci ici y in he die -splanchnic issue
bioene ge ics in e play. The cu en s udy design does no
allow us o de e mine he speci ic mechanisms in ol ed,
bu one specula ion is ha in he case o ileum he e is
mo e p oximal exposu e o die - and mic obe-de i ed is-
sue egula o s, whe eas me abolic egula ion in he li e is
an agg ega e o gu -de i ed and sys emic ac o s. Fu u e
s udies a e needed o alida e hese indings in o he
models, and o de e mine i addi ional egions o he gu
display changes in mi ochond ial unc ion in esponse o
neona al eeding pa adigms.
Conclusion
Ou da a demons a e ha neona al die impac s li e
mi ochond ial bioene ge ics pheno ypes. In addi ion, in
he p esence o ADP, mi ochond ial espi a ion was in-
c eased in MF pigle s ela i e o HM- ed pigle s, sug-
ges ing ha o mula eeding led o a highe inna e
hepa ic ATP u no e . Fu u e s udies a e needed o
unde s and how die -associa ed di e ences in gu issue
mi ochond ial espi a ion come abou , and i he e a e
po en ial long- e m ami ica ions wi h espec o ene gy
homeos asis, oxida i e s ess, and o he ou comes.
Clea ly, mo e wo k needs o be done o e alua e his
wo king model o neona al die e ec s on mi ochond ial
unc ion. The speci ic die - o mic obe-de i ed signals,
and/o hos signals, ha egula e mi ochond ial ac i i ies
(and hei empo al ela ionship o he neona al pe iod),
as well as speci ic gu egions impac ed, emain o be
iden i ied. Should in an die e ec s on bioene ge ics de-
sc ibed he ein ecapi ula e in human issues, i would
ha e p o ound implica ions in e ms o unde s anding
undamen al molecula e en s ha di e en ia e physio-
logical esponses o o mula- eeding and b eas eeding.
Abb e ia ions
ACNC: A kansas Child en’s Nu i ion Cen e ; ADP: Adenosine diphospha e;
AMA: An imycin A; DM: Donkey milk; HM: Human milk; HRR: High- esolu ion
espi ome y; OEA: Oleoyle hanolamine; OMY: Oligomycin; PMG-L: Py u a e,
mala e and glu ama e; SUC: Succina e
Acknowledgemen s
We hank Ma Fe guson, Bobby Fay, and T ae Pi man o i a ium help
wi h he pigle s.
Au ho s’con ibu ions
The au ho s’ esponsibili ies we e as ollows - EC, SHA, EB, LY: designed and/
o in e p e ed he esea ch; EC, SHA, EB, and LY: w o e he manusc ip ; EC,
AKB, MC, MLB and KOM: conduc ed echnical aspec s o he esea ch; EC,
SHA, EB, and LY: had p ima y esponsibili y o he inal con en and o
edi ing he manusc ip ; and all au ho s: ead and app o ed he inal
manusc ip .
Funding
This wo k was unded by USDA-ARS P ojec s 6026–51000-010-05S and 6026–
51000-010-06S. EC, MC, and EB a e also pa ly suppo ed by he A kansas Bio-
sciences Ins i u e, he majo esea ch componen o he A kansas Tobacco
Se lemen P oceeds Ac o 2000 and by he NIH (P20GM109096). EC is also
suppo ed by COMPETE 2020: POCI-01-0145-FEDER-007440. In addi ion, LY is
also suppo ed by he NIH P20GM121293 and NIH R21AI146521. The unding
body was no in ol ed in s udy design, da a collec ion, analysis, and in e -
p e a ion and w i ing o he manusc ip .
A ailabili y o da a and ma e ials
All gene a ed o analyzed da a a e included in he a icle. The da ase s used
and/o analyzed du ing he cu en s udy a e a ailable om he
co esponding au ho on easonable eques .
E hics app o al and consen o pa icipa e
Animals we e main ained in acco dance wi h he e hical guidelines o
animal esea ch es ablished and app o ed by he Ins i u ional Animal Ca e
and Use Commi ee a he Uni e si y o A kansas o Medical Sciences. All
animals used we e ob ained om Me z Fa m ha app o ed he use o
animals o esea ch s udy.
Consen o publica ion
No applicable.
Compe ing in e es s
The au ho s decla e ha hey ha e no compe ing in e es s.
Au ho de ails
1
Depa men o Ge ia ics, Uni e si y o A kansas o Medical Sciences
(UAMS), Li le Rock, USA.
2
A kansas Child en’s Resea ch Ins i u e, Li le Rock,
AR, USA.
3
Cen e o Neu oscience and Cell Biology, Uni e si y o Coimb a,
Coimb a, Po ugal.
4
Depa men o Pedia ics, Uni e si y o A kansas o
Medical Sciences (UAMS), Li le Rock, USA.
5
A kansas Child en’s Nu i ion
Cen e , 15 Child en’s Way, Li le Rock, AR 72202, USA.
Recei ed: 30 Oc obe 2019 Accep ed: 26 Feb ua y 2020
Re e ences
1. Owen CG, Ma in RM, Whincup PH, Smi h GD, Cook DG. E ec o in an
eeding on he isk o obesi y ac oss he li e cou se: a quan i a i e e iew o
published e idence. Pedia ics. 2005;115(5):1367–77.
2. Owen CG, Ma in RM, Whincup PH, Da ey-Smi h G, Gillman MW, Cook DG.
The e ec o b eas eeding on mean body mass index h oughou li e: a
quan i a i e e iew o published and unpublished obse a ional e idence.
Am J Clin Nu . 2005;82(6):1298–307.
3. Feldman-Win e L, Bu nham L, G ossman X, Ma lak S, Chen N, Me ewood A:
Weigh gain in he i s week o li e p edic s o e weigh a 2 yea s: A
p ospec i e coho s udy. Ma e n Child Nu 2018, 14(1)..
4. Gale C, Logan KM, San hakuma an S, Pa kinson JR, Hyde MJ, Modi N. E ec
o b eas eeding compa ed wi h o mula eeding on in an body
Ca alho e al. BMC Nu i ion (2020) 6:13 Page 8 o 10
composi ion: a sys ema ic e iew and me a-analysis. Am J Clin Nu . 2012;
95(3):656–69.
5. Sa ino F, Liguo i SA, Bene i S, So en i M, Fisso e MF. Co de o di
Mon ezemolo L: high se um lep in le els in in ancy can po en ially p edic
obesi y in childhood, especially in o mula- ed in an s. Ac a Paedia . 2013;
102(10):e455–9.
6. Liu Z, Neu inge M, E dman JW, J ., Kuchan MJ, Renne L, Johnson EE, Wang
X, K oenke CD: The e ec s o b eas eeding e sus o mula- eeding on
ce eb al co ex ma u a ion in in an hesus macaques. Neu oimage. 2018;
184:372-85.
7. Me ce KE, Bha acha yya S, Diaz-Rubio ME, Piccolo BD, Pack LM, Sha ma N,
Chaudhu y M, Cle es MA, Chin apalli SV, Shanka K, e al. In an o mula
eeding inc eases hepa ic choles e ol 7alpha hyd oxylase (CYP7A1)
exp ession and ecal bile acid loss in neona al pigle s. J Nu . 2018;148(5):
702–11.
8. Lonne dal B. In an o mula and in an nu i ion: bioac i e p o eins o
human milk and implica ions o composi ion o in an o mulas. Am J Clin
Nu . 2014;99(3):712S–7S.
9. Visen in S, Vicen in D, Mag ini G, San and eu F, Disal o L, Sala M, Fasano V,
Gonzalez HF. Red blood cell memb ane a y acid composi ion in in an s
ed o mulas wi h di e en lipid p o iles. Ea ly Hum De . 2016;100:11–5.
10. Gianni ML, Rogge o P, Baud y C, F essange-Mazda C, Galli C, Agos oni C, le
Ruye P, Mosca F. An in an o mula con aining dai y lipids inc eased ed
blood cell memb ane omega 3 a y acids in 4 mon h-old heal hy
newbo ns: a andomized con olled ial. BMC Pedia . 2018;18(1):53.
11. Wu X, Jackson RT, Khan SA, Ahuja J, Peh sson PR. Human Milk Nu ien
Composi ion in he Uni ed S a es: Cu en Knowledge, Challenges, and
Resea ch Needs. Cu De Nu . 2018;2(7):nzy025.
12. T inchese G, Ca alie e G, Canani RB, Ma amo os S, Be gamo P, De Filippo C,
Ace o S, Gai a M, Ce ino P, Neg i R, e al. Human, donkey and cow milk
di e en ly a ec s ene gy e iciency and in lamma o y s a e by modula ing
mi ochond ial unc ion and gu mic obio a. J Nu Biochem. 2015;26(11):
1136–46.
13. T inchese G, Ca alie e G, De Filippo C, Ace o S, P isco M, Chun JT, Penna E,
Neg i R, Mu edda L, Demu as A, e al. Human Milk and donkey Milk,
compa ed o cow Milk, educe in lamma o y media o s and modula e
glucose and lipid me abolism, Ac ing on Mi ochond ial Func ion and
Oleyle hanolamide Le els in Ra Skele al Muscle. F on Physiol. 2018;9:32.
14. Mikla cic JJ, Badge TM, Bowlin AK, Ma azel KS, Cle es MA, LeRoi h T, Sa a
MK, Chin apalli SV, Piccolo BD, Shanka K, Ye u a L. Human B eas -Milk
Feeding Enhances he Humo al and Cell-Media ed Immune Response in
Neona al Pigle s. J Nu . 2018;148(11):1860-70. h ps://doi.o g/10.1093/jn/
nxy170.
15. Balme SE, Wha on BA. Die and aecal lo a in he newbo n: b eas milk
and in an o mula. A ch Dis Child. 1989;64(12):1672–7.
16. Bezi zoglou E, Tsio sias A, Welling GW. Mic obio a p o ile in eces o b eas -
and o mula- ed newbo ns by using luo escence in si u hyb idiza ion
(FISH). Anae obe. 2011;17(6):478–82.
17. Da is EC, Wang M, Dono an SM. The ole o ea ly li e nu i ion in he
es ablishmen o gas oin es inal mic obial composi ion and unc ion. Gu
Mic obes. 2017;8(2):143–71.
18. Fana o S. Vigi V: [in an o mulas supplemen ed wi h p ebio ics: in es inal
mic obio a and immune esponses]. Mine a Pedia . 2008;60(3):327–35.
19. Thompson AL. De elopmen al o igins o obesi y: ea ly eeding
en i onmen s, in an g ow h, and he in es inal mic obiome. Am J Hum
Biol. 2012;24(3):350–60.
20. Few ell MS. B eas - eeding and la e isk o CVD and obesi y: e idence om
andomised ials. P oc Nu Soc. 2011;70(4):472–7.
21. Owen CG, Whincup PH, Cook DG. B eas - eeding and ca dio ascula isk
ac o s and ou comes in la e li e: e idence om epidemiological s udies.
P oc Nu Soc. 2011;70(4):478–84.
22. Yan J, Liu L, Zhu Y, Huang G, Wang PP. The associa ion be ween
b eas eeding and childhood obesi y: a me a-analysis. BMC Public Heal h.
2014;14:1267.
23. Miliku K, Robe son B, Sha ma AK, Subba ao P, Becke AB, Mandhane PJ,
Tu ey SE, Le eb e DL, Sea s MR, In es iga o s CS, e al. Human milk
oligosaccha ide p o iles and ood sensi iza ion among in an s in he CHILD
s udy. Alle gy. 2018;73(10):2070–3.
24. Moossa i S, Miliku K, Sepeh i S, Kha ipou E, Azad MB. The p ebio ic and
p obio ic p ope ies o human Milk: implica ions o in an immune
de elopmen and pedia ic as hma. F on Pedia . 2018;6:197.
25. Council NR. Nu ien equi emen s o swine: ele en h e ised edi ion.
Washing on, DC: The Na ional Academies P ess; 2012.
26. Chicco AJ, Le CH, Schla e A, Nguyen A, Kaye S, Beals JW, Scalzo RL, Bell C,
Gnaige E, Cos a DP, e al. High a y acid oxida ion capaci y and
phospho yla ion con ol despi e ele a ed leak and educed espi a o y
capaci y in no he n elephan seal muscle mi ochond ia. J Exp Biol. 2014;
217(P 16):2947–55.
27. Chu MJ, Phillips AR, Hosking AW, MacDonald JR, Ba le AS, Hickey AJ.
Hepa ic mi ochond ial unc ion analysis using needle li e biopsy samples.
PLoS One. 2013;8(10):e79097.
28. G a agliano I, Po incasa P, Cocco T, Mosche a A, Di Paola M, Palmie i VO,
Palasciano G. E ec o die a y es ic ion and N-ace ylcys eine
supplemen a ion on in es inal mucosa and li e mi ochond ial edox s a us
and unc ion in aged a s. Exp Ge on ol. 2004;39(9):1323–32.
29. Kuzne so AV, S obl D, Ru mann E, Konigs aine A, Ma g ei e R, Gnaige E.
E alua ion o mi ochond ial espi a o y unc ion in small biopsies o li e .
Anal Biochem. 2002;305(2):186–94.
30. Po e C, Hu en NM, Co e MV, Bha a ai N, Reidy PT, Dillon EL, Du ham
WJ, Tu dendo j D, She ield-Moo e M, Volpi E, e al. Mi ochond ial
espi a o y capaci y and coupling con ol decline wi h age in human
skele al muscle. Am J Physiol Endoc inol Me ab. 2015;309(3):E224–32.
31. Pes a D, Gnaige E. High- esolu ion espi ome y: OXPHOS p o ocols o
human cells and pe meabilized ibe s om small biopsies o human muscle.
Me hods Mol Biol. 2012;810:25–58.
32. Koliaki C, Szend oedi J, Kaul K, Jelenik T, Nowo ny P, Jankowiak F, He de C,
Ca s ensen M, K ausch M, Knoe el WT, e al. Adap a ion o hepa ic
mi ochond ial unc ion in humans wi h non-alcoholic a y li e is los in
s ea ohepa i is. Cell Me ab. 2015;21(5):739–46.
33. K umschnabel G, Fon ana-Ayoub M, Sumbalo a Z, Heidle J, Gaupe K,
Fasching M, Gnaige E. Simul aneous high- esolu ion measu emen o
mi ochond ial espi a ion and hyd ogen pe oxide p oduc ion. Me hods Mol
Biol. 2015;1264:245–61.
34. Po e C, He ndon DN, Bo sheim E, Chao T, Reidy PT, Bo ack MS, Rasmussen
BB, Chond onikola M, Sa a MK, Sidossis LS. Uncoupled skele al muscle
mi ochond ia con ibu e o hype me abolism in se e ely bu ned adul s. Am
J Physiol Endoc inol Me ab. 2014;307(5):E462–7.
35. Os M, Doe ie C, Gama-Pe ez P, Mo eno-Gomez S. Analysis o
mi ochond ial espi a o y unc ion in issue biopsies and blood cells. Cu
Opin Clin Nu Me ab Ca e. 2018;21(5):336–42.
36. Cla k A, Mach N. The c oss alk be ween he gu mic obio a and
mi ochond ia du ing exe cise. F on Physiol. 2017;8:319.
37. Azad MB, Konya T, Maughan H, Gu man DS, Field CJ, Cha i RS, Sea s MR,
Becke AB, Sco JA, Kozy skyj AL, e al. Gu mic obio a o heal hy Canadian
in an s: p o iles by mode o deli e y and in an die a 4 mon hs. CMAJ.
2013;185(5):385–94.
38. Po oyko V, Whi e JR, Wang M, Dono an S, Al e dy J, Liu DC, Mo owi z MJ.
Gu mic obial gene exp ession in mo he - ed and o mula- ed pigle s. PLoS
One. 2010;5(8):e12459.
39. Ko pela K, de Vos WM. Ea ly li e coloniza ion o he human gu : mic obes
ma e e e ywhe e. Cu Opin Mic obiol. 2018;44:70–8.
40. Fana o S, Chie ici R, Gue ini P, Vigi V. In es inal mic o lo a in ea ly in ancy:
composi ion and de elopmen . Ac a Paedia Suppl. 2003;91(441):48–55.
41. Hesla HM, S enius F, Jade lund L, Nelson R, Engs and L, Alm J, Dicks ed J.
Impac o li es yle on he gu mic obio a o heal hy in an s and hei mo he s-
he ALADDIN bi h coho . FEMS Mic obiol Ecol. 2014;90(3):791–801.
42. Neis EP, Dejong CH, Rensen SS. The ole o mic obial amino acid
me abolism in hos me abolism. Nu ien s. 2015;7(4):2930–46.
43. Kuipe s F, Bloks VW, G oen AK. Beyond in es inal soap--bile acids in
me abolic con ol. Na Re Endoc inol. 2014;10(8):488–98.
44. Joyce SA, Gahan CG. Bile acid modi ica ions a he mic obe-hos In e ace:
po en ial o Nu aceu ical and pha maceu ical in e en ions in hos heal h.
Annu Re Food Sci Technol. 2016;7:313–33.
45. Ge a d P. Me abolism o choles e ol and bile acids by he gu mic obio a.
Pa hogens. 2013;3(1):14–24.
46. Leduc-Gaude JP, Reynaud O, Chabo F, Me cie J, And ich DE, S -Pie e DH,
Gouspillou G: The impac o a sho - e m high- a die on mi ochond ial
espi a ion, eac i e oxygen species p oduc ion, and dynamics in oxida i e
and glycoly ic skele al muscles o young a s. Physiol Rep 2018, 6(4)..
47. Coud ayC,Fou e G,Lambe K,Fe e iC,Rieusse J,Blachnio-Zabielska
A, Lecom e J, Ebabe Elle R, Badia E, Mu phy MP, e al. A mi ochond ial-
a ge ed ubiquinone modula es muscle lipid p o ile and imp o es
Ca alho e al. BMC Nu i ion (2020) 6:13 Page 9 o 10