nanoma e ials
A icle
Pep ide-Ca bon Quan um Do s Conjuga e,
De i ed om Human Re inoic Acid Recep o
Responde P o ein 2, agains An ibio ic-Resis an
G am Posi i e and G am Nega i e
Pa hogenic Bac e ia
Aninda Mazumda 1,2,* , Yazan Haddad 1,2 , Ved an Milosa lje ic 1,2 , Hana Michalko a 1,
Roman Gu an 1,2 , Sukanya Bhowmick 1,2 and Ami a a Moulick 1,2,*
1Depa men o Chemis y and Biochemis y, Mendel Uni e si y in B no, Zemedelska 1,
CZ-613 00 B no, Czech Republic; [email p o ec ed] (Y.H.); [email p o ec ed] (V.M.);
[email p o ec ed] (H.M.); [email p o ec ed] (R.G.); [email p o ec ed] (S.B.)
2Cen al Eu opean Ins i u e o Technology, B no Uni e si y o Technology, Pu kyno a 123,
CZ-612 00 B no, Czech Republic
*Co espondence: [email p o ec ed] o [email p o ec ed] (A.M.);
[email p o ec ed] (A.M.)
Recei ed: 29 Janua y 2020; Accep ed: 11 Feb ua y 2020; Published: 14 Feb ua y 2020
Abs ac :
An ibio ic- esis an bac e ial in ec ions ha e become global issues o public heal h,
which inc eases he u e need o de elop al e na i es o an ibio ics. He e, he HSER (Homo sapiens
e inoic acid ecep o ) pep ide was designed om e inoic acid ecep o esponde p o ein 2 o
Homo sapiens, and was conjuga ed wi h syn hesized CQDs (ca bon quan um do s) o enhanced
an ibac e ial ac i i y in combina ion, as indi idually hey a e no highly e ec i e. The HSER–CQDs
we e cha ac e ized using spec opho ome e , HPLC coupled wi h elec osp ay-ioniza ion quad upole
ime-o - ligh mass spec ome e (ESI–qTOF) mass spec ome e , ze a po en ial, ze a size, and FTIR.
The ea e , he an ibac e ial ac i i y agains Vancomycin-Resis an S aphylococcus au eus (VRSA)
and Esche ichia coli (ca bapenem esis an ) was s udied using g ow h cu e analysis, u he suppo ed
by mic oscopic images showing he p esence o cell deb is and dead bac e ial cells. The an ibac e ial
mechanism o HSER–CQDs was obse ed o be ia cell wall dis up ion and also in e ac ion wi h
gDNA (genomic DNA). Finally, oxici y es agains no mal human epi helial cells showed no oxici y,
con i med by mic oscopic analysis. Thus, he HSER–CQDs conjuga e, ha ing high s abili y and low
oxici y wi h p ominen an ibac e ial ac i i y, can be used as a po en ial an ibac e ial agen .
Keywo ds: bac e ial in ec ions; an ibio ic- esis an ; ca bon quan um do s; an ibac e ial ac i i y; oxici y
1. In oduc ion
The e olu ion o bac e ia wi h e e y gene a ion o acqui e esis ance owa ds new an ibio ics
ha e made i a challenge o ea pa hogenic bac e ia, as hei pa e n o esis ance di e s [
1
]. Thus,
bac e ial in ec ions due o he apid inc ease in an ibio ic esis ance ha e become a majo h ea o
global heal h. An ibio ic esis ance occu s due o incomple e cou se o an ibio ic dose and i s misuse [
2
],
exposu e o cons an s ess, changes in genomic le el, and ho izon al gene ans e . The numbe o
mul id ug- esis an pa hogenic bac e ia is inc easing e e y day, c ea ing wo se si ua ions o he clinical
se ings o deal wi h i [3,4].
The Wo ld Heal h O ganiza ion in he yea 2017 lis ed he an ibio ic- esis an bac e ia in h ee di e en
ca ego ies depending on he h ea le el p io i ies: c i ical, high, and medium [
5
]. The Vancomycin-Resis an
Nanoma e ials 2020,10, 325; doi:10.3390/nano10020325 www.mdpi.com/jou nal/nanoma e ials
Nanoma e ials 2020,10, 325 2 o 19
S aphylococcus au eus (VRSA) is a he highes h ea le el and he ca bapenem- esis an En e obac e iaceae
(CRE) is in he c i ical le el. The las eso o he g am posi i e and nega i e bac e ia is ancomycin
and ca bapenem, bu hese a e also becoming esis an , c ea ing global epidemiological and clinical bu den.
The VRSA is esis an due o i s abili y o ejec he en y o ancomycin in o i s own sys em and p e en
i s own al e ed au olysis, along wi h gene ansc ip ion al e a ion [
6
]. Whe eas, he En e obac e iaceae a e
esis an due o he de elopmen o ca bapenemase [
7
,
8
]. An imic obial agen s like os omycin, polymyxin,
colis in, and ni o u an oin ha e become ine ec i e due o plasmid-media ed esis ance in CRE. Whe eas
combina o ial ea men using di e en an ibio ics can be used bu i has some oxici y, limi a ions, and side
e ec s [
9
,
10
]. Thus, he e is an u gen need o de elop a be e ea men me hod agains he VRSA and CRE
in ec ions [
5
,
11
]. This highligh s he eme gency o de eloping al e na i es o an ibio ics ha ha e high
an imic obial ac i i y wi h less o negligible oxici y.
An imic obial pep ides (AMPs) can be an in e es ing al e na i e o adi ional an ibio ics due
o i s na u al occu ence in almos all species, hei amphipa hic na u e, and hei assis inna e
immuni y. They ha e he abili y o p o ide highly e ec i e and non-speci ic de ensi e ac i i y
agains in ading pa hogens [
12
–
14
]. Few AMPs ha e been es ed clinically ha showed some
an imic obial ac i i y [
15
]. Though, he e a e ew limi a ions o hese an imic obial pep ides as hey
can be uns able, in e ac non-speci ically, and ha e a oxic na u e [
16
]. Some o hem a e highly
e ec i e agains bac e ia and ungi, and ew also impa an icance ac i i y. The p oblem wi h
solubili y is mos ly negligible, and he p esence o seconda y s uc u es (like helices and be a shee s),
wi h he possibili y o modi y hem, ele a e hei alue o e en be e ea men . The nanopa icles help
in he ad ancemen o nanomedicine, which in u n ha e helped in a ge ed d ug deli e y, low dosage,
and high ac i i y wi h he limi a ion o oxici y, solubili y, and s abili y [
17
]. Ca bon nanopa icles,
like g aphene quan um do s, g aphene oxide, and CQDs, ha e ecei ed g ea a ac ion due o hei
an imic obial p ope ies [
18
]. CQDs a e eme ging wi h wide applica ions in senso s, ca alysis, medicine,
and bio-imaging. Thenanosized CQDsp o ide ad an agewi h hei wide su acea ea, physiochemical,
andop icalp ope ies[
19
]. Thei pho o-induced edoxcha ac e is icsandin insicop icalp ope iescan
be enhanced and exploi ed o in oduce a new pla o m o na u al/ isible ligh -ac i a ed an imic obial
agen s [
20
]. Thus, hey can be used as an an imic obial agen wi h he scope o modi y hei su ace
cha ge and unc ional g oups o be e pe o mance. They in e ac wi h he bac e ial su ace causing
cell wall damage and an inc ease in endogenous eac i e oxygen species (ROS), leading o cy oplasmic
leakage and cell dea h. S udies showed ha some CQDs we e biocompa ible in
in i o
and
in i o
se up [
19
,
21
]. Though hey ha e some limi a ions, like sho exci a ion/emission wa eleng h wi h poo
pene a ion capabili y, unclea pho oluminescence, no an ibac e ial ac i i y in ew cases, and poo
mul i-colo emissions. Consequen ly, CQDs can be modi ied and conjuga ed wi h pep ides o
ob ain an imic obial ac i i y. Thus, an eligible al e na i e o an ibio ics a e an imic obial pep ides
and nanopa icles.
The o ma ion o conjuga es using pep ides wi h nanoma e ials o o he chemicals is possible
and p o ides a wide ange o p oduce new pa icles wi h medical applica ions [
17
]. HSER (Homo sapiens
e inoic acid ecep o ) is a 22-amino acid esidue pep ide de i ed om e inoic acid ecep o esponde
p o ein 2 o Homo sapiens. Re inoic acid ecep o esponde p o ein 2 was known o exhibi de ensi e
esponse agains g am posi i e and nega i e bac e ia [
22
]. The pep ide was syn hesized and he
an ibac e ial ac i i y agains VRSA and E. coli was seen o be poo . Fu he mo e, he ca bon quan um
do s (CQDs) we e syn hesized based on ou p e ious s udies [
23
]. Then, conjuga ion o he pep ide
was done using CQDs o inc ease he an ibac e ial ac i i y o HSER a e he o ma ion o HSER–CQDs
as a whole.
The p esen expe imen is mainly based on he molecula dynamics (MD) simula ion o
he designed HSER pep ide o unde s and he s uc u e o he pep ide, which was accompanied by
he syn hesis and cha ac e iza ion o he HSER-CQDs conjuga e. The ea e , he an imic obial ac i i ies
o HSER–CQDs we e es ed agains VRSA, and E. coli wi h he de e mina ion o hei espec i e
MIC (minimum inhibi o y concen a ion). Fu he , he luo escence li e/dead cell imaging and phase
Nanoma e ials 2020,10, 325 3 o 19
con as mic oscope imaging agains VRSA and E. coli was s udied. The ea e , he mechanism o
he HSER–CQDs we e s udied. Finally, he oxici y es s like hemoly ic assay and MTT assay we e
pe o med. Thus, he HSER–CQDs showed an ibac e ial ac i i y ha can be used as a be e ea men
s a egy agains mul id ug- esis an bac e ial in ec ions and a po en ial subs i u e o an ibio ics wi h
medicinal alues.
2. Expe imen al
2.1. Molecula Dynamics (MD) Simula ion
The pep ide was de i ed om he e inoic acid ecep o esponde p o ein 2 o Homo sapiens due
o i s de ensi e esponse agains g am posi i e and nega i e bac e ia. The s uc u e was cons uc ed
di ec ly om sequence (CCVRLEFKLQQTSCRKRDWKKP) using he build s uc u e ool in UCSF
Chime a 1.10.2, wi h s anda d
Φ
/
Ψ
angle alues o alpha helix (
−
57
◦
and
−
47
◦
, espec i ely)
and Dunb ack o ame lib a y o side-chains, hen hyd ogens we e added. Molecula dynamics
(MD) simula ion was p epa ed and un on GPU (NVIDIA GTX1080Ti) using G omacs 2018 wi h
Ambe 99SB o ce ield. The s anda d leap- og in eg a o was used o calcula ion o ajec o ies in
s eps o 2 s. The Ve le scheme was used o neighbo sea ching, while he cu -o me hod was used
o Van de Waals in e ac ions a 1.2 nm. Pa icle mesh Ewald (PME) was used wi h all elec os a ics
calcula ions a 1.2 nm cu o . B ie ly, he pep ide was sol a ed in SPC wa e model in dodecahed on
pe iodic box and neu alized wi h Cl
−
ions. Only 335 s eps o s eepes descen minimiza ion we e
equi ed o achie e con e gence wi h maximum o ce <1000 kJ/mol/nm. NVT equilib a ion was done
o du a ion o 1 ns using LINCS cons ain s o H-bonds, and modi ied Be endsen he mos a coupling
(300 K) in wo g oups (p o ein and non-p o ein). NPT equilib a ion was done o du a ion o 1 ns
using LINCS cons ain s o H-bonds, modi ied Be endsen he mos a coupling (300 K), and iso opic
B endsen p essu e coupling (1 ba ). MD P oduc ion was pe o med in NPT o 1000 ns using LINCS
cons ain s o H-bonds, modi ied Be endsen he mos a coupling (300 K), and Pa inello-Rahman
iso opic p essu e coupling (1 ba ). T ajec o ies and ene gies we e sa ed e e y 10 ps and he o al
numbe o ajec o y ames was 100,000. Pos MD analysis was done by cen e ing he p o einin he box,
ollowed by i ing o backbone and emo al o all wa e molecules om he sys em. Time e olu ion o
seconda y s uc u e was pe o med acco ding o he s anda d DSSP me hod. Visualiza ion and u he
analysis was done in UCSF Chime a. Clus e ing analysis o minimal backbone in s eps o 50 ames
was used o iden i y he mos s able con o ma ion (la ges clus e ). Roo mean squa e de ia ions
(RMSD) o he backbone (87 a oms) and o all a oms in pep ide (191 a oms) we e calcula ed wi h
e e ence o he i s ame (α-helix) and o he ep esen a i e ame o op clus e .
2.2. Chemicals and Syn hesis o he HSER-CQDs Conjuga e
All he chemicals, eagen s o pep ide syn hesis, CQDs syn hesis, and s anda ds we e pu chased
om Sigma-Ald ich (S . Louis, MO, USA) in ACS pu i y, unless no ed o he wise. All he expe imen s
we e done main aining s e ile condi ion o ob ain he bes esul s.
Acco ding o ou p e ious s udies he p epa a ion o he wa e soluble CQDs we e done and b ie ly
he syn hesis o CQDs is desc ibed [24]. To he solu ion o ci ic acid (2.1 g), and Mili-Q wa e 0.8 mL
o e hylenediamine was added in a 100 mL h ee-necked lask in s i ing condi ion o a couple o
minu es (min). Then he olume was made o 50 mL. Then he solu ion was subjec ed o mic owa e
i adia ion o 10 mins (Mul iwa e 3000, An on Paa GmbH, G az, Aus ia). The solu ion was
pu i ied by dialysis agains Mili-Q wi h a D-Tube maxi dialyze o e nigh o emo e he unbound
e hylenediamine [
23
]. Fmoc solid phase syn hesis was used o syn hesize HSER on Libe y Blue pep ide
syn hesize (CEM, Ma hews, NC, USA). The sequence o HSER is CCVRLEFKLQQTSCRKRDWKKP,
a s e ch o 22 amino acids. Equal p opo ion (1:1 a io) o he HSER and CQDs was added in a ial
and kep in o a o Mul i Bio RS-24 (Biosan, Riga, La ia) o 24 h a a cons an o a ion and ime
Nanoma e ials 2020,10, 325 4 o 19
in e al ib a ion. The solu ion was pu i ied again by dialysis agains Mili-Q wi h a D-Tube maxi
dialyze o 24 h o emo e he unbound pep ide om he solu ion.
2.3. Cha ac e iza ion o he HSER-CQDs Conjuga e
The HSER-CQDs we e p epa ed and isualized unde a UV ansillumina o a exci a ion
wa eleng hs (
λex
) o 270 and 312 nm (T ansillumina o Mul iband TFX-35.MC(Vilbe Lou ma ,
Coll
é
gien, F ance). A mul i unc ional mic opla e eade Tecan In ini e m200 PRO (Tecan g oup L d.,
Männedo , Swi ze land) was used o measu e he abso bance and luo escence o CQDs, HSER,
and HSER -CQDs [
25
]. Samples we e sepa a ed using he KNAUER PLATINblue V6900A HPLC
sys em, which consis ed o wo P–1 pumps and an au o-sample AS–1 (Knaue , Be lin, Ge many).
Mobile phase A and B consis ed o ace oni ile 0.1% o mic acid and wa e wi h 0.1% o mic acid.
G adien mode had a low a e o 0.5 mL/minu e. Injec ed sample olume was 20
µ
L. P io o injec ion,
he samples we e dilu ed wi h mobile phase A o ge a inal concen a ion o 10
µ
g/mL. HPLC was
coupled wi h elec osp ay-ioniza ion quad upole ime-o - ligh mass spec ome e (ESI–qTOF–MS)
B uke Maxis Impac (B uke Dal onik GmbH, B emen, Ge many). The ollowing pa ame e s o mass
spec ome e we e used: End pla e o se po en ial, 500 V; capilla y po en ial, 4500 V; nebulize gas
(N2) p essu e, 4 ba ; d ying gas (N2) low a e, 6 L/min
−1
; d ying empe a u e, 300
◦
C. Mass ange was
se om 50 o 3000 m/z. Posi i e ion mode was used. P io o HPLC-MS analysis, a mass spec ome e
was calib a ed using ESI-TOF uning mix.
The size dis ibu ion and he a e age size o he nanopa icles we e de e mined using Mal e n
Ze asize (NANO-ZS; Mal e n Ins umen s L d., Wo ces e shi e, UK), which has quasielas ic
lase ligh sca e ing. The 1.5 mL o he CQDs solu ion, HSER, and HSER–CQDs we e added
o he polys y ene la ex cell and measu ed a an de ec o angle o 173
◦
a 633 nm wa eleng h,
wi h empe a u e
o 25 ◦C,
he e ac i eindex o 0.30and eal e ac i eindexo 1.59. Fou ie ans o m
in a ed spec oscopy (FTIR) analysis was done by ilm o each eeze d ied samples using
an FTIR spec opho ome e MATTSON 3000 FT-IR (Madison, WI, USA) wi h a wa enumbe ange
o 400–4000 cm−1, wi h 4 cm−1 esolu ions.
2.4. Cul i a ion o Bac e ia
Bac e ial s ain, ancomycin- esis an S aphylococcus au eus (VRSA) CCM 1767, was ob ained
om he Czech Collec ion o Mic oo ganisms, Facul y o Science, Masa yk Uni e si y, B no, Czech
Republic, and Esche ichia coli ATCC BAA 2340 was ob ained om Ame ican Type Cul u e Collec ion
(ATCC), Uni ed S a es. The media used o he g ow h o he bac e ia was Muelle Hin on (MH)
media o 15 mL in E lenmeye lasks and he bac e ia was inocula ed and cul u es we e kep in shake
a 37
◦
C a 130 pm o 24 h. Fu he , dilu ion o he cul u e was done using he MH b o h o ob ain
0.1 Abso bance (0.5 MacFa land s anda ds) a OD600 nm and used o consecu i e expe imen s [26].
2.5. Minimum Inhibi o y Concen a ion (MIC) De e mina ion
The s anda d b o h mic o-dilu ion me hod (Eu opean Commi ee on An imic obial Suscep ibili y
Tes ing) was used o de e mine he suscep ibili y o bac e ial cul u es agains HSER-CQDs and i s
indi idual componen , wi h he de ec ion done by he unaided eye. MIC was calcula ed using
he solu ions om high o low concen a ion g adually. The di e en concen a ion o HSER–CQDs
(250, 125, 75, 50, 25, and 10
µ
g/mL) was added o he mic opla e wells and mixed wi h he bac e ial
cul u es (0.5 MacFa land wi h inal dilu ion 1:100 using MH medium). Then he pla e was incuba ed
a 37
◦
C o 24 h. The well wi h lowes concen a ion o an ibac e ial agen wi h almos no bac e ial
g ow h was conside ed he MIC and he con ol was bac e ia wi hou any ea men [26].
2.6. G ow h Cu es and Viabili y Pe cen age
The g ow h cu e was ob ained using he Mul iskan EX
(The mo Fishe Scien i ic, Wal ham, MA, USA)
bymeasu ing heabso bance ode e mine hean ibac e ialac i i y. Di e en concen a ionso heHSER–CQDs,
Nanoma e ials 2020,10, 325 5 o 19
HSER, and CQDs we e used o check he an ibac e ial e ec s on g am posi i e and nega i e bac e ia.
The posi i e con ol was only bac e ia wi hou any ea men . To compa e he ac i i y o HSER–CQDs,
he bac e ia was ea ed wi h di e en concen a ion o HSER and CQDs, espec i ely. Fu he , he iabili y
pe cen age was calcula ed om he abso bance alue a e 24 h, compa ing i wi h he abso bance alue o
he posi i e con ol [27].
2.7. Mic oscopy o An ibac e ial Agen s agains Bac e ia in Ambien Ligh and Li e/Dead Cell Assay
Ini ially he samples we e incuba ed wi h bac e ia and HSER–CQDs conjuga e ( espec i e MIC)
o 4 h a 37
◦
C in shaking incuba o . The op ical Olympus BX51 luo escence mic oscope equipped wi h
a 40
×
phase con as lens was used o s udy he an ibac e ial ac i i y o he HSER–CQDs agains VRSA
and E. coli. The numbe o cells obse ed pe sample was obse ed om 10 andomized mic oscopic
g id ields.
The li e/dead cell assay is based on wo luo escen dyes, namely, SYTO9, which pe mea es
bo h damaged and in ac cell memb anes, and p opidium iodide (PI), o s ain only he cells wi h
damaged cell memb anes [
16
]. A o al o 1
µ
L o bo h he s ains we e added a e he ea men o
hebac e ialcells o luo escencemic oscopy. Anin e edOlympusIX71S8F-3 luo escencemic oscope
(Olympus Co po a ion, Tokyo, Japan) equipped wi h Olympus UIS2 se ies objec i e LUCPlanFLN 40
×
(N.A. 0.6, WD 2.7–4 mm, F.N. 22), a me cu y a c lamp X-ci e 12
(120 W; Lumen Dynamics,
Mississauga, ON, Canada),
and a Came a Olympus DP73 was used o ob ain he mic oscopic image
o s udy he ou comes o li e/dead bac e ial cells assay. The numbe o cells obse ed pe sample was
obse ed om 10 andomized mic oscopic g id ields. The images we e p ocessed using he S eam
Basic 1.7 So wa e.
2.8. Cell Memb ane B eak and Leakage Assay and In e ac ion wi h DNA
Ini ially, VRSA was ea ed wi h HSER–CQDs (25
µ
g/mL) and incuba ed a 37
◦
C o 4 h
in shaking condi ion. Fu he , he bac e ial cell memb ane damage and cell cy oplasmic leakage
a e he ea men by HSER–CQDs was s udied by cen i uging he samples, and he supe na an
was used as he empla e o PCR and he ampli ica ion was done using 16S RNA gene p ime s
(16S Fo wa d- ACTGGGATAACTTCGGGAAAC, and 16S e e se- CAGCGCGGATCCATCTATAA),
and con i ma ion was done using aga ose gel elec opho esis. The con ol was he supe na an o VRSA
cul u e wi hou ea men and he 100 bp ladde was used. The gels we e isualized and documen ed
unde Azu e c600 (Azu e Biosys ems Inc., USA).
Simila ly, he genomic DNA (gDNA) om VRSA was isola ed and hen incuba ed wi h
HSER–CQDs and kep o 1 h. Then, he samples we e used as he empla e o PCR eac ion
and he ampli ica ion was done using 16S RNA gene p ime s, and con i ma ion was done using
aga ose gel elec opho esis wi h espec o he 100 bp ladde . The con ol was he gDNA o
VRSA cul u e wi hou ea men . The gels we e isualized and documen ed unde Azu e c600
(Azu e Biosys ems Inc., Dublin, CA, USA).
2.9. In luence and Toxici y o HSER–CQDs on Euka yo ic Cells (Cy o oxici y Assay and Hemolysis Assay)
The PNT1A (p os a e epi helial cells), HBL-100 (mamma y gland epi helial cells), MDA-MB-468
(mamma y gland adenoca cinoma cells), and Du-145 (p os a e adenoca cinoma cells) human cell line
we e cul u ed and used. The MTT (3-(4,5-dime hyl hiazol-2-yl)-2,5-diphenyl e azolium b omide)
assay was used o check he iabili y. B ie ly, in 50
µ
L medium, he suspension o 5000 cells was
added o each well o mic o i e pla es, ollowed by incuba ion o 24 h a 37
◦
C wi h 5% CO
2
.
A e 24 h ea men ,
10
µ
L o MTT (5 mg/mL in phospha e bu e ed saline (PBS)) was added o he cells
and incuba ed o 4 h a 37
◦
C. A e ha , MTT-con aining medium was eplaced by 100
µ
L o 99.9%
dime hyl sul oxide (DMSO) and incuba ed o 5 min, he abso bance o he samples was de e mined
a 570 nm using In ini e m200 PRO (Tecan, Männedo , Swi ze land) [28].
Nanoma e ials 2020,10, 325 6 o 19
Fu he , esh human blood was collec ed om he olun ee , wi h signed in o med consen ,
by a enipunc u e om an an ecubi al ein. RBCs we e isola ed om blood and he suspensions we e
washed wi h 150 mM NaCl solu ion h ee o i e imes. RBCs was incuba ed wi h he HSER-CQDs
o 1 h a 37
◦
C. The posi i e and he nega i e con ol was 0.1% T i on X-100 and PBS, espec i ely.
The deg ee o hemolysis was de e mined by measu ing he abso bance o he supe na an a 540 nm,
a e cen i uga ion, and calcula ed acco ding o he ollowing equa ion:
h=
A −Ac
A100% −Ac
×100, (1)
whe e his pe cen age o hemolysis; A
c
is he abso bance o he supe na an om nega i e con ol
(PBS, pH 7.4);
A
is he abso bance o he supe na an om he samples incuba ed wi h he HSER-CQDs;
and A
100%
is he abso bance o he supe na an o posi i e con ol (0.1% T i on X-100), which causes
comple e lysis o RBCs [26].
2.10. Endogenous Reac i e Oxygen Species (ROS) P oduc ion Assay
Bac e ial endogenous ROS p oduc ion was measu ed by using DCFDA Cellula Reac i e Oxygen
Species De ec ion Ki (Abcam Ab113851) acco ding o he gi en p o ocol and ins uc ions o bac e ial
cells [
29
,
30
]. To he cell suspension o VRSA, 10
µ
M o 2
0
,7
0
–dichlo o luo escein diace a e (DCFDA)
was added and kep a 37
◦
C o 30 min. in he da k condi ion ollowed by a wash using 1
×
washing
bu e . Then, VRSA cells we e ea ed wi h 75
µ
g/mL o HSER, HSER–CQDs, and CQDs o 3 h.
The luo escence in ensi y was measu ed by Tecan in ini e m200 p o (wa eleng h o exci a ion a 485 nm
and emission a 535 nm. The ROS was de e mined by compa ing wi h he con ol, which was ea ed
wi h H2O2showing posi i e ROS p oduc ion [31].
2.11. Mic oscopic Analysis o HSER-CQDs In e ac ion agains Euka yo ic Cells
The MDA-MB-468 (mamma y gland adenoca cinoma cells), Du-145 (p os a e adenoca cinoma cells),
PNT1A (p os a e epi helial cells), and HBL-100 (mamma y gland epi helial cells) human cell line we e
cul u ed and used. B ie ly, he suspension o 5000 cells in 300
µ
L medium supplemen ed wi h g ow h ac o s
was added o each well o mic o i e pla es, ollowed by incuba ion o 24 h a 37
◦
C wi h 5% CO
2
o ensu e
cell g ow h. A e 24 h ea men wi h HSER–CQDs, he cells we e obse ed unde an in e ed Olympus
IX 71S8F-3 luo escence mic oscope
(Olympus Co po a ion, Tokyo, Japan)
equipped wi h Olympus UIS2
se ies objec i e LUCPlanFLN 40
×(N.A. 0.6, WD 2.7–4 mm, F.N. 22),
a me cu y a c lamp X-ci e 12 (120 W;
Lumen Dynamics, Mississauga, ON, Canada), and a Came a Olympus DP73 o ob ain he b igh ield
mic oscopic image using
S eam Basic 1.7 So wa e.
The numbe o cells obse ed pe sample was obse ed
om 10 andomized mic oscopic g id ields.
3. Resul s and Discussion
The syn hesis and cha ac e iza ion o HSER–CQDs, along wi h i s an ibac e ial e icacy agains
VRSA and E. coli, was s udied and he MIC was de e mined. Fu he he oxici y es showed
i has no oxici y agains euka yo ic cell lines (p os a e and mamma y gland epi helial cell lines
(HBL-100, and PNT1A). The mechanism o ac ion was based on cell wall damage and leakage o
cellula con en . Some in e ac ion o he HSER–CQDs wi h gDNA was obse ed, and assay showed
negligible ROS gene a ion. VRSA and E. coli was used as model o ganism o es he an ibac e ial e ec
o he HSER–CQDs due o i s pa hogenici y [26].
3.1. Pep ide S uc u e
The la ges p o ein con o ma ion clus e was eached a e ~550 ns and ep esen ed
a nea ly con inuous du a ion o 21.85% o en i e simula ion (437 o 2000 ames) (Figu e 1A).
The ep esen a i e ame (Figu e 1B) o he op clus e was 81,251 (o o al 100,000). The ideo
Nanoma e ials 2020,10, 325 7 o 19
o he las 300 nanoseconds (ns) o simula ion, whe e he pep ide has s able con o ma ion, is shown
in ESI (Elec onic Supplemen a y In o ma ion). The a oms a e chlo ide ions.
Nanoma e ials 2020, 10, x FOR PEER REVIEW 7 o 21
300 nanoseconds (ns) o simula ion, whe e he pep ide has s able con o ma ion, is shown in ESI
(Elec onic Supplemen a y In o ma ion). The a oms a e chlo ide ions.
Figu e 1. Molecula dynamics simula ion o pep ide. (A) Clus e analysis o Molecula dynamics(
MD) ajec o ies. Snapsho s we e aken e e y 50 ames and he inal numbe o ames was 2000. The
op clus e was p edominan in he second hal o he simula ion. (B) The pep ide s uc u e a ame
#81,251 is ep esen a i e o he op clus e . The backbone ibbon is shown in g een while he molecula
su ace is shown in s anda d he e oa om colo . The e a e 10 in a-model hyd ogen bonds in his ame
dona ed by he ollowing a oms: A g4 (HE, HH21), Gln10 (HE21, HE22), Gln11 (HE21), A g15 (H,
HH11), A g17 (HE, HH21), and Asp18 (H). Only h ee o hese in ol ed he backbone. (C) Time
e olu ion g aph o seconda y s uc u e change. A e he i s 550 ns o he simula ion, he pep ide
displayed a s able seconda y s uc u e as ollows: 1–6 (coil), 7 (β-b idge), 8–11 (bend), 12–14 ( u n), 15
(coil), 16 (bend), 17 (β-b idge), 18–22 (coil). (D) Roo mean squa e de ia ions (RMSD) analysis o
backbone and all a oms. The s uc u e de ia ed om he o iginal α-helix in he i s ame by ange
o 5–11 Å. The RMSD o he backbone o he op clus e was below 4 Å, while o all a oms was below
6 Å.
In bo h he a e age s uc u e o la ges clus e and he ep esen a i e ame, hyd ogen bonds
we e obse ed a he in he side-chains han he backbone. Namely, Glu6 and Asp18 side-chains
p o ided accep o oxygens o he amides o a ginines and glu amines (A g4, A g15, and A g17 in
addi ion o Gln10 and Gln11). This obse a ion is impo an o in e p e a ion o FTIR ib a ional
spec a. Addi ionally, indica ing ha possible change in p o ona ion s a es (due o pH change) will
be de imen al o s able olding.
The ime e olu ion g aph o he seconda y s uc u e (Figu e 1C) shows a combina ion o alpha
helix ( esidues 5–10) bends and u ns in he i s hal o he simula ion. In he second hal o he
simula ion, a s able con o ma ion was o med in he middle o pep ide. I was ea u ed by u ns
( esidues 12–14) su ounded by bends and inally a be a b idge connec ing esidues 7 and 17. The
es o he pep ide endings we e domina ed by andom coil (Figu e 1C).
RMSD analysis con i med hese obse a ions (Figu e 1D). O e all, RMSD we e highe by ~1 Å
in all a oms compa ed o backbone-only a oms. Wi h e e ence o he i s ame (α-helix), he
Figu e 1.
Molecula dynamics simula ion o pep ide. (
A
) Clus e analysis o Molecula dynamics( MD)
ajec o ies. Snapsho s we e aken e e y 50 ames and he inal numbe o ames was 2000. The op
clus e was p edominan in he second hal o he simula ion. (
B
) The pep ide s uc u e a ame #81,251
is ep esen a i e o he op clus e . The backbone ibbon is shown in g een while he molecula su ace
is shown in s anda d he e oa om colo . The e a e 10 in a-model hyd ogen bonds in his ame dona ed
by he ollowing a oms: A g4 (HE, HH21), Gln10 (HE21, HE22), Gln11 (HE21), A g15 (H, HH11),
A g17 (HE, HH21),
and Asp18 (H). Only h ee o hese in ol ed he backbone. (
C
) Time e olu ion
g aph o seconda y s uc u e change. A e he i s 550 ns o he simula ion, he pep ide displayed
a s able seconda y s uc u e as ollows: 1–6 (coil), 7 (
β
-b idge), 8–11 (bend), 12–14 ( u n), 15 (coil),
16 (bend), 17 (β-b idge),
18–22 (coil). (
D
) Roo mean squa e de ia ions (RMSD) analysis o backbone
and all a oms. The s uc u e de ia ed om he o iginal
α
-helix in he i s ame by ange o 5–11 Å.
The RMSD o he backbone o he op clus e was below 4 Å, while o all a oms was below 6 Å.
In bo h he a e age s uc u e o la ges clus e and he ep esen a i e ame, hyd ogen bonds
we e obse ed a he in he side-chains han he backbone. Namely, Glu6 and Asp18 side-chains
p o ided accep o oxygens o he amides o a ginines and glu amines (A g4, A g15, and A g17 in
addi ion o Gln10 and Gln11). This obse a ion is impo an o in e p e a ion o FTIR ib a ional
spec a. Addi ionally, indica ing ha possible change in p o ona ion s a es (due o pH change) will be
de imen al o s able olding.
The ime e olu ion g aph o he seconda y s uc u e (Figu e 1C) shows a combina ion o alpha helix
( esidues 5–10) bends and u ns in he i s hal o he simula ion. In he second hal o he simula ion,
a s able con o ma ion was o med in he middle o pep ide. I was ea u ed by u ns ( esidues 12–14)
su ounded by bends and inally a be a b idge connec ing esidues 7 and 17. The es o he pep ide
endings we e domina ed by andom coil (Figu e 1C).
RMSD analysis con i med hese obse a ions (Figu e 1D). O e all, RMSD we e highe by ~1 Å in
all a oms compa ed o backbone-only a oms. Wi h e e ence o he i s ame (
α
-helix), he de ia ions
in he backbone and all a oms we e in he ange o 4–11 Å du ing all simula ion and 7–11 Å in
he second hal . Wi h e e ence o he ep esen a i e ame o he op clus e , RMSD d opped
om 4–12 Å
in he i s hal o 1–6 Å in he second hal o he simula ion o bo h he backbone
and all a oms.
Nanoma e ials 2020,10, 325 8 o 19
3.2. Syn hesis and Cha ac e iza ion o he HSER-CQD Conjuga e
The HSER pep ide and CQDs in 1:1 a io helps in he o ma ion o he HSER–CQDs conjuga e,
which was dialyzed and obse ed unde UV– ansillumina o and showed a bluish luo escence.
The spec opho ome ic analysis was done and he abso bance was de ec ed in he spec al ange om
230 o 1000 nm and he maxima abso p ion peak o HSER and he HSER-CQDs conjuga e was ob ained
a 280 nm (Figu e 2A). Ou expe imen al esul s clea ly indica e he absence o CQDs abso p ion
peak in isible spec al ange. Howe e , he lowe abso bance peak o HSER de ec ed a 280 nm
belongs o ansi ion o di used pi elec ons o he a oma ic ing o y osine o yp ophan [
32
].
On he con a y, he highe abso bance peak o HSER–CQDs was sligh ly shi ed and de ec ed
a 270 nm. Such a peak p obably belongs o he π–π* ansi ion o a oma ic –C=C– and –C–C– bonds
in he sp2 hyb idized domain o CQDs co e [
33
], which indica es ha he in e ac ion be ween HSER
and CQDs has occu ed. The luo escence p ope ies o HSER and CQDs can be obse ed by wo
luo escence peaks a
370 and 445 nm
om he espec i e spec a, as shown in Figu e 2B. The CQDs
emission peak was ound a 445 nm, which is asc ibed o su ace o molecule cen e o CQDs [
34
].
Such luo escence beha io o CQDs is common and usually is a ibu ed o he di e si y o pa icle
size as well as he su ace s a e o CQDs [
35
]. The lowe emission peak o HSER was de ec ed a 370 nm,
while he highe emission peak o he HSER–CQDs conjuga e was shi ed and shows he p esence o
bo h peaks
a 350 and 425 nm,
con i ming he in e ac ion be ween HSER and CQDs. A peak de ec ed
a 350 nm usually comes om he p esence o ca boxyl (–COOH) o amine (–NH2) g oups on CQDs
su ace, which a e a ibu ed o n–
π
* ansi ion o –C=O, C–N o –C–OH bonds in he sp3 hyb idized
domains [
33
]. This p obably indica es he possible in e ac ion be ween CQDs su ace wi h ca boxyl
o amine g oup om HSER. Xiaohui Gao and co-wo ke s epo ed ha shi s in he emission peak
con ibu e o he s ong in e ac ion be ween wa e molecules and exci ed dipole momen s in CQDs in
solu ion [
36
]. Shi ing o peaks con i m he s uc u al change in HSER due o in e ac ion wi h CQDs [
37
].
The dialyzed HSER CQDs we e u he cha ac e ized using HPLC coupled wi h ESI–qTOF–MS o
ob ain he indi idual peaks o HSER–CQD componen s, bu , due o he small size o CQDs, hey we e
no spo ed in HPLC; howe e , sha p peaks o he p esence o HSER we e ob ained, as shown in
he Figu e 2C.
The FTIR analysis (Figu e 3A) o he syn hesized CQDs showed wo majo bands in he amide a ea,
namely a 1550 and 1385 cm
−1
, which a e cha ac e is ic o seconda y amines and ca boxyla es,
espec i ely [
38
]. The b oad ange band nea 3000s cm
−1
(Figu e 3B) indica es o ma ion
o hyd ogen-bonded hyd oxy g oups (–OH) as compa ed wi h equi alen CA ib a ions [
38
].
The in ensi ies o hese h ee bands we e isibly dec eased ollowing he coa ing by HSER pep ide.
In pep ides and p o eins, he amide I band (in he 1600s cm
−1
) is o en used as an indica o o seconda y
s uc u e. This is based on he con ibu ions o C=O s e ching and C-N s e ching, which a e in luenced
by he s eng hs o hyd ogen bonds in ol ing hem [
39
]. Acco dingly, he
α
-helix s uc u e is co ela ed
wi h equency ange 1660–1648 cm
−1
, whe eas he
β
-shee s uc u e is co ela ed wi h equency
ange 1640–1625 cm
−1
. Fo una ely, due o a ailable da a om MD simula ions, i is clea ha such
in e p e a ion o s uc u e can be biased in his si ua ion. P edic ed HSER s uc u e appea ed o
be s abilized by amide-based elec os a ic in e ac ions o side-chains
(Hyd ogen bonds).
In a mo e
p ecise desc ip ion, he ib a ions o he backbone do no in ol e many hyd ogen bonds and hus
hey can be assigned o he diso de ed seconda y s uc u e wi h equency ange 1657–1642 cm
−1
[
40
].
The 1625 cm
−1
in HSER–CQDs is an indica o o sho ange backbone agg ega ion, while he dec ease
in 1650 cm
−1
co ela es wi h loss o andom backbone and in e up ed side-chain in e ac ions
in HSER–CQDs. The con ibu ion o amide bands is domina ed by he backbone pep ide bond,
ne e heless, se e al side-chain ib a ions all in he amide I and II ange [
41
]. Thei ex ension
coe icien (M
−1
cm
−1
) con ibu ions in he amide I a e in he ollowing ange: A g (
ε
=300–490),
Gln (ε=360–380),
and Lys (
ε
=60–130). As o he amide II egion (in he 1500s cm
−1
) hey a e in
he ollowing ange: Gln (
ε
=220–240), Asp (
ε
=290–380), Glu (
ε
=450–470) and
Lys (ε=60–130).
Fu he mo e, he Cys hiol (–SH) s e ching peak a 2551 cm
−1
[
41
] was absen in bo h HSER
Nanoma e ials 2020,10, 325 9 o 19
and HSER–CQDs spec a, sugges ing ha sul ide b idges we e o med in bo h cases. O e all, FTIR
ib a ional spec a con i med he coa ing o CQDs wi h HSER pep ide, mos ly ia s ong non-co alen
agg ega ion.
This was
cha ac e ized by amide-based sho - ange hyd ogen bonds (1625 cm
−1
) be ween
pep ide backbone and seconda y amines, ca boxyla es, and hyd oxyl g oups o he CQDs su ace.
Nanoma e ials 2020, 10, x FOR PEER REVIEW 9 o 21
= 360–380), and Lys (ε = 60–130). As o he amide II egion (in he 1500s cm
−1
) hey a e in he ollowing
ange: Gln (ε = 220–240), Asp (ε = 290–380), Glu (ε = 450–470) and Lys (ε = 60–130). Fu he mo e, he
Cys hiol (–SH) s e ching peak a 2551 cm
−1
[41] was absen in bo h HSER and HSER–CQDs spec a,
sugges ing ha sul ide b idges we e o med in bo h cases. O e all, FTIR ib a ional spec a
con i med he coa ing o CQDs wi h HSER pep ide, mos ly ia s ong non-co alen agg ega ion. This
was cha ac e ized by amide-based sho - ange hyd ogen bonds (1625 cm
−1
) be ween pep ide
backbone and seconda y amines, ca boxyla es, and hyd oxyl g oups o he CQDs su ace.
Figu e 2. (A) The luo escence spec a we e ob ained wi h he exci a ion o 320 nm and emission a
ange o 360 o 850 nm; and he bo le wi h black cap con ains Ca bon Quan um Do s(CQDs) and he
b own-capped bo le con ains he HSER-CQDs conjuga e showing bluish luo escence. (B) The
Abso bance spec a ob ained a a ange o 230 o 1000 nm. (C) Samples we e sepa a ed on column
Zo bax eclipse AAA C18 (3.5 µm pa icles; 150 × 4.6 mm) using he KNAUER PLATINblue V6900A
HPLC sys em, which consis ed o wo P 1 pumps and an au osample AS 1 (Knaue , Be lin, Ge many).
Mobile phase A consis ed o wa e wi h +0.1% o mic acid. Mobile phase B consis ed o ace oni ile
wi h +0.1% o mic acid. G adien mode: 0 min 3% B– > 30 min 97% B– > 40 min 97% B– > 42 min 3%
B– > 50 min 3% B– > STOP. Flow a e was 0.5 mL/min. Injec ed sample olume was 20 µL. P io o
injec ion he samples we e dilu ed wi h mobile phase A o ge a inal concen a ion 10 µg/mL. HPLC
was coupled wi h ESI-QqTOF mass spec ome e B uke Maxis Impac (B uke Dal onik GmbH,
B emen, Ge many). The ollowing pa ame e s o mass spec ome e we e used: End-pla e o se
po en ial, 500 V; capilla y po en ial, 4500 V; nebulize gas (N
2
) p essu e, 4 ba ; d ying gas (N
2
) low
a e, 6 L/min
−1
; d ying empe a u e, 300 °C. Mass ange was se om 50 o 3000 m/z. Posi i e ion mode
was used. P io o HPLC-MS analysis a mass spec ome e was calib a ed using ESI-TOF uning mix.
Figu e 2.
(
A
) The luo escence spec a we e ob ained wi h he exci a ion o 320 nm and emission a
ange o 360 o 850 nm; and he bo le wi h black cap con ains Ca bon Quan um Do s(CQDs) and he
b own-capped bo le con ains he HSER-CQDs conjuga e showing bluish luo escence.
(B) The Abso bance
spec a ob ained a a ange o 230 o 1000 nm. (
C
) Samples we e sepa a ed on column Zo bax eclipse AAA
C18(3.5
µ
mpa icles;150
×
4.6mm)using heKNAUERPLATINblueV6900AHPLCsys em,whichconsis ed
o wo P 1 pumps and an au osample AS 1 (Knaue , Be lin, Ge many). Mobile phase A consis ed o
wa e wi h +0.1% o mic acid. Mobile phase B consis ed o ace oni ile wi h +0.1% o mic acid. G adien
mode:
0 min 3% B– >30 min 97% B– >40 min 97% B– >42 min 3% B– >50 min 3% B– >STOP.
Flow a e
was 0.5 mL/min. Injec ed sample olume was 20
µ
L. P io o injec ion he samples we e dilu ed wi h mobile
phase A o ge a inal concen a ion 10
µ
g/mL. HPLC was coupled wi h ESI-QqTOF mass spec ome e
B uke Maxis Impac (B uke Dal onik GmbH, B emen, Ge many). The ollowing pa ame e s o mass
spec ome e we e used: End-pla e o se po en ial, 500 V; capilla y po en ial, 4500 V; nebulize gas (N
2
)
p essu e, 4 ba ; d ying gas (N
2
) low a e, 6 L/min
−1
; d ying empe a u e, 300
◦
C. Mass ange was se om
50 o 3000 m/z. Posi i e ion mode was used. P io o HPLC-MS analysis a mass spec ome e was calib a ed
using ESI-TOF uning mix.
Howe e , he pa icle size dis ibu ion showing a e age pa icle size and he ze a po en ial o
he p epa ed HSER–CQDs we e analyzed using DLS a e pu i ica ion, using dialysis in D-Tube
maxi dialyze ubes agains Mili-Q (Figu e 3C,D). The ea e , he o ma ion o nanopa icles was also
con i med by ze a size and po en ial measu ing. Ze a size esul s ob ained indica es ha he size o
CQDs is 4
±
2 nm, while he size o HSER-CQDs was ound o be 23
±
3 nm (Figu e 3D). Fu he mo e,
he alue o he ze a po en ial showed ha he lowes ze a po en ial was ound in case o CQDs a
−
3 mV,
and he highes ze a po en ial show HSER wi h 33 mV. Finally, he HSER-CQDs conjuga e e eal
he change o ze a po en ial a e in e ac ion o be 23 mV, showing he endencies o agg ega e which can
be connec ed wi h pep ide agg ega ion on he su ace o nanopa icles. Thus, a e he cha ac e iza ion
o HSER–CQDs was comple ed, i was used o u he s udy he an ibac e ial ac i i y agains pa hogenic
bac e ial s ains.
Nanoma e ials 2020,10, 325 16 o 19
showed he p esence o a high amoun o dead bac e ial cells. The mechanism o ac ion is based
on change in s uc u e o HSER a e in e ac ing wi h he CQDs, which was suppo ed by FTIR
esul s showing ha he cell wall dis up ion occu ed along wi h some in e ac ion in p esence o
gDNA, which s op i s ampli ica ion. Finally, he HSER–CQDs we e ound o be compa ible wi h
RBCs and non oxic agains no mal human epi helial cells, wi h he help o MTT and hemoly ic
assay and u he con i med by mic oscopic analysis. Thus, HSER–CQDs can be used as a subs i u e
o an ibio ics.
Supplemen a y Ma e ials:
The ollowing a e a ailable online a h p://www.mdpi.com/2079-4991/10/2/325/s1,
Figu e S1: G ow h cu e and iabili y pe cen age in p esence o HSER, Figu e S2: G ow h cu e and iabili y
pe cen age in p esence o CQDs, Figu e S3: ROS, Figu e S4: Op ical image o VRSA and E. coli, Figu e S5:
The cy o oxici y es .
Au ho Con ibu ions:
All he au ho s esea ched da a, w o e he manusc ip , and e iewed and edi ed he a icle
subs an ially. A.M. (Aninda Mazumda ) pe o med mos o he expe imen s including designing pep ide, syn hesis
o CQDs, mic obiological es s, and w o e he mos pa o he manusc ip . Y.H. helped in he MD simula ion
and de elopmen o he mechanism o ac ion. V.M. helped in he syn hesis o he pep ide and he cha ac e iza ion
o he conjuga e. H.M., R.G. and S.B. helped wi h di e en expe imen s. A.M. (Ami a a Moulick) supe ised
he whole expe imen . All au ho s ha e ead and ag eed o he published e sion o he manusc ip .
Acknowledgmen s:
This wo k was inancially suppo ed by CEITEC 2020 (LQ1601) and by EFRR p ojec
“Mul idisciplina y esea ch o inc ease applica ion po en ial o nanoma e ials in ag icul u al p ac ice”
(No. CZ.02.1.01/0.0/0.0/16_025/0007314).
Con lic s o In e es : The au ho s decla e no con lic s o in e es .
Re e ences
1.
F ie i, M.; Kuma , K.; Bou in, A. An ibio ic esis ance. J. In ec . Public Heal h
2017
,10, 369–378. [C ossRe ]
[PubMed]
2.
McNeece, G.; Naugh on, V.; Woodwa d, M.J.; Dooley, J.S.G.; Naugh on, P.J. A ay based de ec ion o an ibio ic
esis ance genes in G am nega i e bac e ia isola ed om e ail poul y mea in he UK and I eland. In . J.
Food Mic obiol. 2014,179, 24–32. [C ossRe ] [PubMed]
3.
Da ies, J.; Da ies, D. O igins and e olu ion o an ibio ic esis ance. Mic obiol. Mol. Biol. Re . MMBR
2010
,
74, 417–433. [C ossRe ] [PubMed]
4.
Juknius, T.; Tamule iˇcius, T.; G ažule iˇci
¯
u
˙
e, I.; Klimien
˙
e, I.; Ma use iˇcius, A.P.; Tamule iˇcius, S. In-si u
measu emen so bac e ia esis ance oan imic obialagen semployingleakymodesub-wa eleng hdi ac ion
g a ing. Sens. Ac ua o s B Chem. 2014,204, 799–806. [C ossRe ]
5.
Tacconelli, E.; Ca a a, E.; Sa oldi, A.; Ha ba h, S.; Mendelson, M.; Monne , D.L.; Pulcini, C.; Kahlme e , G.;
Kluy mans, J.; Ca meli, Y.; e al. Disco e y, esea ch, and de elopmen o new an ibio ics: The WHO p io i y
lis o an ibio ic- esis an bac e ia and ube culosis. Lance In ec . Dis. 2018,18, 318–327. [C ossRe ]
6.
Alexande , E.L.; Ga de e, S.; Ba , H.Y.; Wells, M.T.; Tomasz, A.; Rhee, K.Y. In e media e-Type Vancomycin
Resis ance (VISA) in Gene ically-Dis inc S aphylococcus au eus Isola es Is Linked o Speci ic, Re e sible
Me abolic Al e a ions. PLoS ONE 2014,9, e97137. [C ossRe ]
7.
Doi, Y.; Pa e son, D.L. Ca bapenemase-p oducing En e obac e iaceae. Semin. Respi . C i . Ca e Med.
2015
,
36, 74–84.
8.
Wo ld Heal h O ganiza ion. Guidelines o he P e en ion and Con ol o Ca bapenem-Resis an En e obac e iaceae,
Acine obac e Baumannii and Pseudomonas Ae uginosa in Heal h Ca e Facili ies; Wo ld Heal h O ganiza ion:
Gene a, Swi ze land, 2017.
9.
Phe, K.; Lee, Y.; McDaneld, P.M.; P asad, N.; Yin, T.; Figue oa, D.A.; Musick, W.L.; Co eau, J.M.; Hu, M.;
Tam, V.H.
In i o
assessmen and mul icen e coho s udy o compa a i e neph o oxici y a es associa ed
wi h colis ime ha e e sus polymyxin B he apy. An imic ob. Agen s Chemo he .
2014
,58, 2740–2746.
[C ossRe ]
10.
Amladi, A.U.; Abi ami, B.; De i, S.M.; Suda sanam, T.D.; Kandasamy, S.; Kek e, N.; Vee a agha an, B.;
Sahni, R.D. Suscep ibili y p o ile, esis ance mechanisms & e icacy a ios o os omycin, ni o u an oin
& colis in o ca bapenem- esis an En e obac e iaceae causing u ina y ac in ec ions. Indian J. Med Res.
2019,149, 185–191.
Nanoma e ials 2020,10, 325 17 o 19
11.
Rinc
ó
n, S.; Panesso, D.; D
í
az, L.; Ca ajal, L.P.; Reyes, J.; Muni a, J.M.; A ias, C.A. Resis encia a an ibi
ó
icos
de
ú
l ima l
í
nea en cocos G am posi i os: La e a pos e io a la ancomicina. Biomed. Re . Ins . Nac. Salud
2014,34 (Suppl. 1), 191–208. [C ossRe ]
12.
Zhu, W.L.; Lan, H.; Pa k, I.-S.; Kim, J.I.; Jin, H.Z.; Hahm, K.-S.; Shin, S.Y. Design and mechanism o ac ion o
a no el bac e ia-selec i e an imic obial pep ide om he cell-pene a ing pep ide Pep-1. Biochem. Biophys.
Res. Commun. 2006,349, 769–774. [C ossRe ] [PubMed]
13.
G oh, T.; H abe a, J.; Khalil, M.A.; Dok o o a, H.; Eckschlage , T.; S ibo o a, M. The syne gis ic e ec s o
DNA-damaging d ugs cispla in and e oposide wi h a his one deace ylase inhibi o alp oa e in high- isk
neu oblas oma cells. In . J. Oncol. 2015,47, 343–352. [C ossRe ] [PubMed]
14.
Wang, S.; Wang, Q.; Zeng, X.; Ye, Q.; Huang, S.; Yu, H.; Yang, T.; Qiao, S. Use o he An imic obial
Pep ide Sublancin wi h Combined An ibac e ial and Immunomodula o y Ac i i ies To P o ec agains
Me hicillin-Resis an S aphylococcus au eus In ec ion in Mice. J. Ag ic. Food Chem.
2017
,65, 8595–8605.
[C ossRe ] [PubMed]
15.
Wang, S.; Zeng, X.; Yang, Q.; Qiao, S. An imic obial Pep ides as Po en ial Al e na i es o An ibio ics in Food
Animal Indus y. In . J. Mol. Sci. 2016,17, 603. [C ossRe ] [PubMed]
16.
B une i, J.; Falciani, C.; Roscia, G.; Pollini, S.; Bindi, S.; Scali, S.; A ie a, U.C.; G
ó
mez-Vallejo, V.; Que cini, L.;
Ibba, E.; e al.
In i o
and
in i o
e icacy, oxici y, bio-dis ibu ion and esis ance selec ion o a no el
an ibac e ial d ug candida e. Sci. Rep. 2016,6, 26077. [C ossRe ] [PubMed]
17.
Jelinko a, P.; Mazumda , A.; Su , V.P.; Kocio a, S.; Dolezeliko a, K.; Jimenez, A.M.J.; Koudelko a, Z.;
Mish a, P.K.; Sme ko a, K.; Hege , Z.; e al. Nanopa icle-d ug conjuga es ea ing bac e ial in ec ions.
J. Con ol. Release 2019,307, 166–185. [C ossRe ]
18.
Mo adlou, O.; Rabiei, Z.; Dela a i, N.J.J.o.P.; Chemis y, P.A. An ibac e ial e ec s o ca bon quan um
do s@ hema i e nanos uc u es deposi ed on i anium agains G am-posi i e and G am-nega i e bac e ia.
J. Pho ochem. Pho obiol. A Chem. 2019,379, 144–149. [C ossRe ]
19.
Ko
á
ˇco
á
, M.; Špi alsk
á
, E.; Ma ko ic, Z.; Špi
á
lsk
ý
, Z. Ca bon Quan um Do s As An ibac e ial
Pho osensi ize s and Thei Polyme Nanocomposi e Applica ions. Pa . Pa . Sys . Cha ac .
2020
,
37, 1900348. [C ossRe ]
20.
Dong, X.; Liang, W.; Meziani, M.J.; Sun, Y.-P.; Yang, L.J.T. Ca bon Do s as Po en An imic obial Agen s.
The anos ics 2020,10, 671. [C ossRe ]
21.
Lin, F.; Bao, Y.W.; Wu, F.G. Ca bon do s o sensing and killing mic oo ganisms. C J. Ca bon Res.
2019
,5, 33.
[C ossRe ]
22.
Zabel, B.A.; Kwi niewski, M.; Banas, M.; Zabieglo, K.; Mu zyn, K.; Cichy, J. Cheme in egula ion and ole in
hos de ense. Am. J. Clin. Exp. Immunol. 2014,3, 1–19. [PubMed]
23.
Milosa lje ic, V.; Nguyen, H.V.; Michalek, P.; Moulick, A.; Kopel, P.; Kizek, R.; Adam, V. Syn hesis o ca bon
quan um do s o DNA labeling and i s elec ochemical, luo escen and elec opho e ic cha ac e iza ion.
Chem. Pap. 2015,69, 192–201. [C ossRe ]
24.
Wang, F.; Pang, S.; Wang, L.; Li, Q.; K ei e , M.; Liu, C.-y. One-S eSyn hesis o Highly Luminescen Ca bon
Do s in Noncoo dina ing Sol en s. Chem. Ma e . 2010,22, 4528–4530. [C ossRe ]
25.
Moulick, A.; Hege , Z.; Milosa lje ic, V.; Rich e a, L.; Ba oso-Flo es, J.; Me los Rod igo, M.A.; Buch elo a, H.;
Podgajny, R.; Hynek, D.; Kopel, P.; e al. Real-Time Visualiza ion o Cell Memb ane Damage Using
Gadolinium–Schi Base Complex-Doped Quan um Do s. ACS Appl. Ma e . In e aces
2018
,10, 35859–35868.
[C ossRe ] [PubMed]
26.
Jelinko a, P.; Splichal, Z.; Jimenez, A.M.J.; Haddad, Y.; Mazumda , A.; Su , V.P.; Milosa lje ic, V.; Kopel, P.;
Buch elo a, H.; Gu an, R.; e al. No el ancomycin-pep ide conjuga e as po en an ibac e ial agen agains
ancomycin- esis an S aphylococcus au eus. In ec . D ug Resis .
2018
,11, 1807–1817. [C ossRe ] [PubMed]
27.
Jelinko a, P.; Vesely, R.; Cihalo a, K.; Hege o a, D.; Ananbeh, H.A.A.A.; Rich e a, L.; Sme ko a, K.;
B nicky, M.; Kynicky, J.; Moulick, A.; e al. E ec o a senic (III and V) on oxida i e s ess pa ame e s in
esis an and suscep ible S aphylococcus au eus. En i on. Res. 2018,166, 394–401. [C ossRe ] [PubMed]
28.
Hege , Z.; Me los Rod igo, M.A.; Michalek, P.; Polanska, H.; Masa ik, M.; Vi , V.; Ple o a, M.; Pacik, D.;
Eckschlage , T.; S ibo o a, M.; e al. Sa cosine Up-Regula es Exp ession o Genes In ol ed in Cell Cycle
P og ession o Me as a ic Models o P os a e Cance . PLoS ONE 2016,11, e0165830. [C ossRe ]
Nanoma e ials 2020,10, 325 18 o 19
29.
Agbo , T.A.; Demma, Z.; M sny, R.J.; Cas illo, A.; Boll, E.J.; McCo mick, B.A.J.C.m. The oxido– educ ase
enzyme glu a hione pe oxidase 4 (GPX4) go e ns S almonella T yphimu ium–induced neu ophil
ansepi helial mig a ion. Cell. Mic obiol. 2014,16, 1339–1353. [C ossRe ]
30.
Li, Y.; L , M.; Su, C.; Long, S.; Zhang, W.; Conway, K.L.; Li, W.; Xa ie , R.J.; Shi, H.N.J.F.i.i. p40phox-De icien
Mice Exhibi Impai ed Bac e ial Clea ance and Enhanced P o-in lamma o y Responses du ing Salmonella
en e ica se o a Typhimu ium In ec ion. F on . Immunol. 2017,8, 1270. [C ossRe ]
31.
Ta a es, A.F.N.; Teixei a, M.; Rom
ã
o, C.C.; Seixas, J.D.; Nob e, L.S.; Sa ai a, L.M. Reac i e Oxygen Species
Media e Bac e icidal Killing Elici ed by Ca bon Monoxide- eleasing Molecules. J. Biol. Chem.
2011
,
286, 26708–26717. [C ossRe ]
32.
An osiewicz, M.J.; Shuga , D. UV–Vis spec oscopy o y osine side-g oups in s udies o p o ein s uc u e.
Pa 2: Selec ed applica ions. Biophys. Re . 2016,8, 163–177. [C ossRe ] [PubMed]
33.
Emam, A.N.; Lou y, S.A.; Mos a a, A.A.; Awad, H.; Mohamed, M.B. Cy o- oxici y, biocompa ibili y
and cellula esponse o ca bon do s–plasmonic based nano-hyb ids o bioimaging. RSC Ad .
2017
,
7, 23502–23514. [C ossRe ]
34.
Xu, M.; He, G.; Li, Z.; He, F.; Gao, F.; Su, Y.; Zhang, L.; Yang, Z.; Zhang, Y. A g een he e ogeneous syn hesis o
N-doped ca bon do s and hei pho oluminescence applica ions in solid and aqueous s a es. Nanoscale
2014
,
6, 10307–10315. [C ossRe ] [PubMed]
35.
Wang, Z.; Lu, Y.; Yuan, H.; Ren, Z.; Xu, C.; Chen, J. Mic oplasma-assis ed apid syn hesis o luminescen
ni ogen-doped ca bon do s and hei applica ion in pH sensing and u anium de ec ion. Nanoscale
2015
,
7, 20743–20748. [C ossRe ] [PubMed]
36.
Gao, X.; Lu, Y.; Zhang, R.; He, S.; Ju, J.; Liu, M.; Li, L.; Chen, W. One-po syn hesis o ca bon nanodo s o
luo escence u n-on de ec ion o Ag+based on he Ag+-induced enhancemen o luo escence. J. Ma e .
Chem. C 2015,3, 2302–2309. [C ossRe ]
37.
Pan, K.; Chen, H.; Baek, S.J.; Zhong, Q. Sel -assembled cu cumin-soluble soybean polysaccha ide
nanopa icles, physicochemical p ope ies and
in i o
an i-p oli e a ion ac i i y agains cance cells.
Food Chem. 2018,246, 82–89. [C ossRe ]
38.
Coa es, J. In e p e a ion o in a ed spec a, a p ac ical app oach. Encycl. Anal. Chem. Appl. Theo y Ins um.
2006
.
[C ossRe ]
39.
Jackson, M.; Man sch, H.H. The use and misuse o FTIR spec oscopy in he de e mina ion o p o ein
s uc u e. C i . Re . Biochem. Mol. Biol. 1995,30, 95–120. [C ossRe ]
40.
Ba h, A. In a ed spec oscopy o p o eins. Biochim. Biophys. Ac a (BBA)-Bioene g.
2007
,1767, 1073–1101.
[C ossRe ]
41.
Ba h, A. The in a ed abso p ion o amino acid side chains. P og. Biophys. Mol. Biol.
2000
,74, 141–173.
[C ossRe ]
42.
S ie el, P.; Schmid -Em ich, S.; Maniu a-Webe , K.; Ren, Q. C i ical aspec s o using bac e ial cell iabili y
assays wi h he luo opho es SYTO9 and p opidium iodide. BMC Mic obiol.
2015
,15, 36. [C ossRe ]
[PubMed]
43.
Mille i, F. Cell-pene a ing pep ides: Classes, o igin, and cu en landscape. D ug Disco . Today
2012
,
17, 850–860. [C ossRe ] [PubMed]
44.
Becha a, C.; Sagan, S. Cell–pene a ing pep ides: 20 yea s la e , whe e do we s and? FEBS Le .
2013
,
587, 1693–1702. [C ossRe ] [PubMed]
45.
Copolo ici, D.M.; Langel, K.; E is e, E.; Langel, U. Cell-pene a ing pep ides: Design, syn hesis,
and applica ions. ACS Nano 2014,8, 1972–1994. [C ossRe ]
46.
Zhang, Q.; Gao, H.; He, Q. Taming cell pene a ing pep ides: Ne e oo old o each old dogs new icks.
Mol. Pha m. 2015,12, 3105–3118. [C ossRe ]
47.
Soa es, J.W.; Ki by, R.; Dohe y, L.A.; Meehan, A.; A cidiacono, S. Immobiliza ion and o ien a ion–dependen
ac i i y o a na u ally occu ing an imic obial pep ide. J. Pep . Sci. 2015,21, 669–679. [C ossRe ]
48.
Do osz, J.; Go man, Y.; Kolushe a, S.; O zen, D.; Ben-Tal, N.; Nielsen, N.C.; Jelinek, R. Memb ane in e ac ions
o no icidin, a no el an imic obial pep ide, phospha idylglyce ol p omo es bilaye inse ion. J. Phys. Chem. B
2010,114, 11053–11060. [C ossRe ]
49.
Balak ishnan, S.V.; Vad, B.S.; O zen, D.E. No icidin’s memb ane pe meabilizing ac i i y is d i en by
memb ane pa i ioning bu no by helici y: A biophysical s udy o he impac o lipid cha ge and choles e ol.
Biochim. Biophys. Ac a (BBA) P o eins P o eom. 2013,1834, 996–1002. [C ossRe ]
Nanoma e ials 2020,10, 325 19 o 19
50.
Kim, S.R.; Pa k, M.J.; Lee, M.K.; Sung, S.H.; Pa k, E.J.; Kim, J.; Kim, S.Y.; Oh, T.H.; Ma kelonis, G.J.; Kim, Y.C.
Fla onoids o Inula b i annica p o ec cul u ed co ical cells om nec o ic cell dea h induced by glu ama e.
F ee Radic. Biol. Med. 2002,32, 596–604. [C ossRe ]
51.
Shoemake , M.; Cohen, I.; Campbell, M. Reduc ion o MTT by aqueous he bal ex ac s in he absence o cells.
J. E hnopha macol. 2004,93, 381–384. [C ossRe ]
©
2020 by he au ho s. Licensee MDPI, Basel, Swi ze land. This a icle is an open access
a icle dis ibu ed unde he e ms and condi ions o he C ea i e Commons A ibu ion
(CC BY) license (h p://c ea i ecommons.o g/licenses/by/4.0/).