CHARACTERIZATION OF THE MAJOR AUTOLYSIN IN
STAPHYLOCOCCUS AUREUS
JOANA FILIPA GOMES DA SILVA
DISSERTATION PRESENTED TO OBTAIN A MASTER DEGREE IN
MEDICAL MICROBIOLOGY
OCTOBER 2015
CHARACTERIZATION OF THE MAJOR AUTOLYSIN IN
STAPHYLOCOCCUS AUREUS
JOANA FILIPA GOMES DA SILVA
DISSERTATION PRESENTED TO OBTAIN A MASTER DEGREE IN
MEDICAL MICROBIOLOGY
Supe iso : D . Ri a Sob al, UCIBIO-FCT/UNL
Co-supe iso : P o . Ana Madalena Ludo ice, DCV-FCT/UNL;
ITQB/UNL
OCTOBER 2015
ii
iii
Bibliog aphic elemen s esul ing om his disse a ion
Sil a, J., I. G ilo, A. M. Ludo ice, H. de Lencas e, R. G. Sob al. Cha ac e iza ion o
he majo pep idoglycan hyd olase o S aphylococcus au eus. Mic oBio ec’15 –
Po uguese Cong ess o Mic obiology and Bio echnology 2015. P230, pg. 354.
Decembe 10-12, 2015.
iii
i
Ag adecimen os
À Dou o a Ri a Sob al, exp esso o meu p o undo ag adecimen o pela o ien ação, pela
disponibilidade pa a o deba e de ideias e apoio que mui o ele a am os meus
conhecimen os cien í icos e, sem dú ida, mui o es imula am o meu desejo de que e
sabe mais e a on ade cons an e de que e aze melho .
Ag adeço, ambém, à P o esso a Ana Madalena Ludo ice, pela co-o ien ação nes e
p oje o. Mui o ob igada pelo p o issionalismo e pela o al disponibilidade que semp e
e elou pa a comigo.
Aos meus colegas de labo a ó io, Bá ba a, Raquel, Rica do e Vanessa, um mui o
ob igado pela ossa amizade, companhei ismo e ajuda, a o es mui o impo an es na
ealização des a ese e que me pe mi i am que cada dia osse enca ado com um so iso e
pa icula mo i ação.
À Inês G ilo, com quem i e o p i ilégio de colabo a , ag adeço oda a disponibilidade
e paciência que e e pa a comigo nas semanas que es i e no ITQB/UNL.
Aos colegas do UCIBIO, que o ag adece a disponibilidade pa a pa ilha de ideias, pelo
auxílio e pelos momen os que elemb o com um so iso nos lábios, em pa icula à
Cyn hia Ba oco, ao João Caço, ao João B i o, ao Tiago Dias e à Nicole.
Ao José Dias, um ag adecimen o especial pelo apoio e ca inho diá ios, pelas pala as
doces e pela ansmissão de con iança e de o ça, em odos os momen os.
Ag adeço, ambém aos meus amigos que semp e me apoia am.
À minha amília, em especial aos meus pais, um eno me ob igada po ac edi a em
semp e em mim, pelo es o ço e dedicação que semp e i e am pa a que eu pudesse
e mina es a e apa e po odos os ensinamen os de ida. À minha ia Dulce e às minhas
p imas-manas Inês e Viole a pelo apoio e pela o ma como me acolhe am e in eg a am
em Lisboa.
Po im, mas não po úl imo, que ia ag adece a Deus pela opo unidade e pela manei a
como guiou es a ese, que ac edi o e sido uma bênção.
i
Abs ac
Fo bac e ial cells o enla ge and di ide, pep idoglycan mus be clea ed by speci ic
hyd olases so ha new subuni s can be inco po a ed in o he ma u e cell wall. The mos
impo an mu ein hyd olase o he oppo unis ic human pa hogen S aphylococcus
au eus is ATL, a 137.5 kDa bi unc ional p o ein wi h wo domains: AM and GL ha
a e ex acellula ly p ocessed and bind o he s aphylococcal su ace a p ecise loca ions
o he equa o ial su ace ings. Based on obse a ions ha showed ha a l mu an s,
cons uc ed in di e en S. au eus gene ic backg ounds, a e no all impai ed in bio ilm
o ma ion, and ha he GL-DNA in e ac ion impac s bio ilm o ma ion in a s ain
speci ic way, we hypo hesized ha he physiological oles o ATL may be s ain-
speci ic. Di e en app oaches we e used o cha ac e ize ATL in di e en S. au eus
s ains: (i) he a l gene was sequenced o iden i y amino acid di e ences in he p o ein
ha could change i s ac i i y o unde go di e en p o eoly ic clea age; (ii) he size o
he di e en ATL p ocessed o ms and he cell compa men whe e hey accumula e
was assessed; (iii) he exp ession o ATL was analyzed o e ime by wes e n blo ing;
(i ) he impac o DNA on GL ly ic ac i i y was de e mined o hea -inac i a ed cells,
cell wall and pep idoglycan, h ough ly ic assays wi h he GL pu i ied p o ein.
The esul s ob ained allowed o iden i y dis inc pa e ns o ATL p o ein exp ession and
o p o eoly ic clea age ha may be he basis o he p ima y pheno ypic di e ences.
Keywo ds: Au olysin; S aphylococcus au eus; ly ic ac i i y; ATL; Glucosaminidase;
p o ein exp ession.
xiii
Ni-NTA
Nickel Ni ile-T iace ic Acid
Nm
Nanome e
NMR
Nuclea Magne ic Resonance
OD
Op ical Densi y
O/N
O e nigh
PBP
Penicillin-Binding-P o ein
PBS
Phospha e Bu e ed Saline
PCR
Polyme ase Chain Reac ion
pI
Isoelec ic Poin
PP
P opep ide
K
Kel in
KH2PO4
Monopo assium Phospha e
kDa
Kilodal on
Rpm
Re olu ions pe minu e
RT
Room Tempe a u e
SCCmec
S aphylococcal casse e ch omosome mec
SDS
Sodium Dodecyl Sul a e
SDS-PAGE
SDS-Polyac ilamide Gel Elec opho esis
SNP
Single-nucleo ide Polymo phism
TA
Teichoic Acids
TCA
T ichlo oace ic Acid
TSA
T yp ic Soy B o h Aga
TSB
T yp ic Soy B o h
UV
Ul a iole
V
Vol
WTA
Wall Teichoic Acids
1
Chap e I - In oduc ion
1. S aphylococcus au eus
S aphylococcus au eus a e G am-posi i e cocci wi h low DNA G+C con en ha
usually occu as g ape-like clus e s, and o m a ai ly la ge yellow colony on ich
medium and a e o en hemoly ic on blood aga . S aphylococci a e acul a i e anae obes
ha g ow by ae obic espi a ion o by e men a ion ha yields p incipally lac ic acid.
These bac e ia a e ca alase-posi i e (con e s hyd ogen pe oxide o wa e ) and oxidase-
nega i e, and can g ow a a empe a u e ange o 15 o 45 deg ees and a NaCl
concen a ions as high as 15 pe cen . They a e coagulase posi i e, a ma ke ha allows
he dis inc ion be ween S. au eus and o he S aphylococcus (Kloos, 1997).
1.1. Pa hogenici y
S. au eus a e equen ly ound as a commensal in he espi a o y ac o humans
(Kluy mans e al, 1997) bu can also ac as an oppo unis ic human pa hogen. They a e
he majo cause o nosocomial in ec ions wo ldwide (P alle e al, 1988).
In coloniza ion, he ela ionship wi h he hos is benign and asymp oma ic, bu b eak
o he cu aneous ba ie allows he bac e ia o in e nalize and cause diseases such as
skin and so issue in ec ions (nonin asi e in ec ions). As a pa hogen, i is conside ed
e sa ile bac e ia, as i can cause a wide spec um o in ec ions om impe igo and
olliculi is o li e- h ea ening in asi e in ec ions, such as bac e emia, pneumonia o
endoca di is. In addi ion, in ake o oxins om ood p oduc s colonized by S. au eus,
can cause acu e gas oen e i is (Bouche e al, 2010; Lee, 2003; P ojan & No ick,
1997).
1.2. Vi ulence
S. au eus exp esses many po en ial i ulence ac o s including oxins, immune-
modula o y ac o s, and exoenzymes (Wa kins e al, 2012).
Mos o hese i ulence ac o s a e cell-su ace-associa ed, helping o a oid
phagocy osis and consequen ly allowing he e asion o hos de enses. They usually a e
in ol ed in one o he ollowing p ocesses: i) adhe ence o S. au eus o su aces, such
as adhesins, coagulase, ib inogen-binding p o eins, clumping ac o , and bio ilm
2
polysaccha ides; ii) escaping o he hos immune sys em, such as en e o oxins, p o ein
A and leukocidins; and iii) damage o he hos including hemolysins, phospholipase C
and α- oxin. Toxins, p o eases and supe an igens, p e en he de elopmen o a s ong
an ibody esponse by p omo ing he bac e ial a ack o he hos , p e en ing he
de elopmen o an an ibody esponse, comp omising he immune memo y (Fos e ,
2005; P ojan e al, 1997).
S. au eus is also insensi i e o lysozyme (pep idoglycan hyd olase), a bac e icidal
p o ein p oduced by he inna e immune sys em ha is p esen in mos human body
luids such as sali a, swea and ea s, and which p oduc ion is inc eased du ing
in ec ion (Be a e al, 2005; Le y , 2000; Schindle e al, 1997).
The ac ha S. au eus has he abili y o easily acqui e gene ic in o ma ion also
con ibu es o i ulence, mainly h ough he acquisi ion o mobile gene ic islands ha
ca y i ulence de e minan s.
1.2.1. Mul i-d ug esis ance
S. au eus, he pa adigm among he bac e ia o his na u al phenomenon, has always
been a challenge o an i-mic obial chemo he apy (Chambe s, 2001).
Ini ially, s aphylococci in ec ions we e ea ed wi h penicillin, a β-lac am an ibio ic
disco e ed in 1928 imp o ing he p ognosis o pa ien s wi h s aphylococcal in ec ions,
dec easing he ex emely high mo ali y a e. β-lac ams inhibi he las s ep o he cell
wall pep idoglycan biosyn hesis, inac i a ing he penicillin binding p o eins (PBPs) due
o he simila i y o hei subs a e – pep idoglycan e minal D-ala-D-ala. The acquisi ion
o a plasmid encoding o a β-lac amase p o ein (penicillinase) led o penicillin
esis ance (Ab aham and Chain, 1940); his β-lac amase hyd olyzes he β-lac am ing
and consequen ly inac i a es he an ibio ic (Ghuysen, 1991). In o de o o e come he
acqui ed esis ance o his na u al an ibio ic, semi-syn he ic compounds (de i a i es o
penicillin), modi ied o esis o β-lac amase ac ion, we e de eloped o comba S. au eus
penicillin esis an in ec ions: me hicillin and i s de i a i es oxacillin, na cillin, among
o he s (Pla a e al, 2009; Moelle ing, 2012).
Me hicillin was in oduced clinically in 1959, howe e only wo yea s la e , he i s
s ains o me hicillin esis an S. au eus (MRSA) we e iden i ied, ca ying he
3
exogeneous mecA gene (Je ons, 1961). The MRSA pheno ype is a mul i ac o ial
p ocess ha occu s by he acquisi ion o a s aphylococcal ch omosome casse e
(SCCmec) and he exp ession o se e al housekeeping auxilia y genes. Besides β-
lac ams an ibio ics (penicillins, cephalospo in and ca bapenems), MRSA s ains also
de eloped esis ance o i ually all o he classes o an ibio ics ha we e in oduced in o
clinical p ac ice, such as mac olides, chlo amphenicol and e acycline, ha a ge
p o ein syn hesis o luo oquinolones and i ampicin, ha a ge nucleic acid syn hesis
(Bambeke e al, 2003).
The majo esis ance elemen o SCCmec is he mecA gene. This gene codes o an
ex a PBP, PBP2a (Reynolds & B own, 1985). PBP2a has a e y low a ini y o β-
lac ams, allowing cell wall biosyn hesis o p oceed in he p esence o he an ibio ic
(Ha man and Tomasz, 1984). The mecA gene is no na i e o S. au eus bu was
acqui ed om ano he species, mos p obably S. sciu i (Cou o e al 1996; Rolo e al
2013), by an unknown mechanism. (Beck e al, 1986) Al hough mecA is he main
gene ic de e minan o me hicillin esis ance, ecen ly, a highly di e gen mecA gene,
mecC, was iden i ied wi h ela i ely low p e alence a es (Sho e e al, 2011).
The me hicillin- esis an pheno ype also depends on he exp ession o mo e han 32
housekeeping genes - auxilia y ac o s, equen ly associa ed wi h he cell wall
pep idoglycan biosyn hesis and deg ada ion (Roeme e al, 2013; Be ge -Bächi e al,
1992; de Lencas e e al, 1999).
1.2.2. MRSA epidemiology
The e a e se e al p edominan clonal lineages o S. au eus; each clonal lineage is
de ined as a esul o i s speci ic gene ic backg ound and o he geog aphic si e o i s
i s iden i ica ion (Johnson e al, 2005). S udies based on he gene ic analysis o MRSA
isola es om di e en coun ies e ealed ha mos cases o Hospi al-acqui ed MRSA
(HA-MRSA) in ec ions a e caused by a small g oup o epidemic MRSA (EMRSA)
clones, which a e highly dissemina ed wo ldwide (Tomasz & de Lencas e, 1997;
Oli ei a e al, 2002). Each MRSA clonal lineage ecei ed a designa ion and some o he
mos success ul and well dissemina ed a e he Ibe ian, B azilian, Huga ian, New
Yo k/Japan, Pedia ic and epidemic clones: EMRSA-16, EMRSA-15 and Be lin.
4
In con as o MRSA in ec ions a hospi al se ings, in which in ec ed pa ien s ha e
p edisposing isk ac o s such as an immunocomp omised immune sys em, speci ic
MRSA clones eme ged in he communi y, in he mid and la e 1990’s, in heal hy
indi iduals wi hou hospi aliza ion his o y – he communi y acqui ed MRSA (CA-
MRSA) (DeLeo e al, 2010; Da id & Daum, 2010). CA-MRSA s ains a e usually mo e
i ulen and mo e ansmissible, howe e less esis an o an ibio ics in compa ison wi h
HA-MRSA. Mo eo e , CA-MRSA s ains ca y he smalle SCCmec elemen s o ypes
IV and V which we e associa ed wi h lowe i ness cos s, hus p omo ing inc eased
oxin p oduc ion and he eby inc eased i ulence (Chambe s & DeLeo 2009; DeLeo e
al. 2010; O o 2012).
Se e al CA-MRSA backg ounds eme ged and sp ead di e en ly in sepa a e
geog aphical a eas, howe e , nowadays CA-MRSA a e no es ic ed o a speci ic
geog aphic egion. USA400 clone is p esen in Asia, Eu ope and he USA, USA300 in
he USA and Eu ope, he Sou hwes Paci ic clone in Aus alia, Eu ope and Sou h
Ame ica, he ST59-V clone in Asia and he USA, he Eu opean clone in Eu ope, Asia
and he Middle Eas , and ST398 clone, i s associa ed wi h coloniza ion in pigs in
F ance, is cu en ly dissemina ed wo ldwide, no only in animals bu also in humans
(Media illa e al, 2012; Monecke e al, 2011; Uhlemann e al, 2012).
The expanding communi y ese oi o CA-MRSA has led o he ine i able
in il a ion o CA-MRSA in o hospi als. This phenomenon has become a majo public
heal h h ea and i is pos ula ed ha CA-MRSA will become he dominan MRSA
s ain in hospi als, wi h compe i i e exclusion o he adi ional HA-MRSA s ain
(Seybold e al, 2006).
2. Cell Wall
One o he c ucial bac e ial s uc u es is he cell en elope and i s in eg i y has o be
gua an eed.
The G am-posi i e cell en elope consis s o wo unc ional laye s: a cy oplasmic
memb ane, su ounded by a hick cell wall. The cell wall is a complex and a highly
o ganized s uc u e ha allows bac e ia o in e ac wi h he en i onmen bu also
p o ec s hem agains hos ile insul s. The G am-posi i e cell wall is composed by
5
di e se s uc u es, being he pep idoglycan hei majo componen (up o 50%) and he
eichoic acids (TAs) he key mul i- unc ional componen s o he cell wall. Many G am-
posi i e bac e ia, such as S. au eus, con ain wo ypes o TAs; wall eichoic acids
(WTA), which a e co alen ly linked o he pep idoglycan laye and lipo eichoic acids
(LTA), which a e embedded in he memb ane ia a lipid ancho (Reichmann &
G undling, 2011; Xia e al 2010). Besides pep idoglycan and eichoic acids, he cell
wall ha bo s a a ie y o di e en polysaccha ides, polyme s and p o eins, like he
PBPs.
2.1. Pep idoglycan Biosyn hesis
Pep idoglycan, also called mu ein, is a polyme ha consis s o long glycan chains
o al e na ed disaccha ide uni s (N-ace yl-glucosamine and N-ace yl-mu amic acid) ha
a e c oss-linked ia lexible pep ide b idges o o m a s ong bu elas ic s uc u e ha
p o ec s om lysis due o he high in e nal osmo ic p essu e (Ehle & Hol je, 1996;
Hol je, 1998; Nanninga, 1998; Schlei e & Kandle , 1972) (Figu e 1).
Figu e 1 - Chemical s uc u e o S. au eus pep idoglycan: disaccha ide uni s c oss-linked h ough
an in e -pep ide b idge consis ing o i e glycines o connec he ε-amino g oup o L-Lys in he hi d
posi ion o one s em (b idge-link, highligh ed) o he D-Ala in he ou h posi ion o he connec ed s em
(c oss-link) wi h he concomi an clea age o he e minal D-Ala. (Zhou & Cegelski, 2012)
Pep idoglycan and i s biosyn he ic pa hway is he a ge o se e al an ibio ic classes
including β-lac ams and glycopep ides (Pla a e al. 2009).
6
In S. au eus, pep idoglycan syn hesis begins in he cy oplasm whe e he p ecu so
UDP-Mu NAc-pen apep ide is assembled. I consis s o a uni o N-ace yl-mu amic acid
(Mu NAc) ha is a ached o a pen ape ide chain L-alanine-D-glu ama e-L-lysine-D-
alanyl-D-alanine (Vollme e al, 2008). Then, UDP-Mu NAc-pen apep ide is ans e ed
o a memb ane-bound lipid ca ie by he ac ion o M aY, o ming lipid I. UDP-GlcNAc
is added o lipid I by he ac ion o Mu G, leading o he o ma ion o lipid II ( an
Heijenoo , 2007), ha is anspo ed h ough he memb ane by he ac ion o F sW
lippase and is polyme ized h ough ansglycosyla ion ( o ex end he glycan chains)
and anspep ida ion (c osslinking be ween s em pep ides o di e en glycan s ands). In
S. au eus mos o he pen apep ide chains o adjacen mac omolecules a e linked by
pen aglycine in e b idges be ween he penul ima e D-alanine o one pep ide chain and
he ee amino g oup o he lysine o he o he chain. This is achie ed h ough he
anspep ida ion ac i i y o he so-called penicillin-binding p o eins (PBP’s), which also
ca alyze he ansglycosyla ion eac ion. (Go in e al, 1998) The pep idyl ans e ases
(FemX, FemA and FemB) a e esponsible o he addi ion o he i e glycine esidues o
he b idge, in a eac ion ca alyzed a he memb ane le el. (Figu e 2)
Addi ional modi ica ions o he pep idoglycan s uc u e occu in many bac e ial
species including modi ica ions o he glycan chains, modi ica ions o he s em pep ide,
such as he amida ion o he glu ama e esidue by he p o eins Mu T and Ga D, and
inco po a ion o cell wall polyme s (Figuei edo e al, 2012).
The hickness o he mu ein laye , in S. au eus, a ies be ween 20 o 400 nm
(50% o he cell wall). I is a dynamic mac o-molecule ha su e s pe manen
biosyn hesis, ma u a ion, ecycling, assembly and disassembly in o de o main ain he
cell shape, and allow o cellula g ow h and di ision. (Figu e 2)
7
Figu e 2 – Schema ic ep esen a ion o coo dina ed cell wall biosyn hesis and cell di ision in S.
au eus (adap ed om Roeme e al, 2013).
2.2. Hyd olases
Syn hesized pep idoglycan uni s a e inco po a ed in o he in ac cell wall laye a e
clea age by pep idoglycan hyd olases. A p ope balance be ween pep idoglycan
syn hesis and deg ada ion du ing bac e ial g ow h is essen ial. In gene al, pep idoglycan
hyd olases a e hough o play an impo an ole in cell wall u no e , cell di ision, and
cell sepa a ion, and in he lysis o bac e ia induced by he β-lac am an ibio ics (Biswas
e al, 2006).
S. au eus p oduces se e al pep idoglycan hyd olases, such as N-
ace ylglucosaminidases, N-ace ylmu amidases, N-ace ylmu amyl-L-alanine amidases,
ly ic ansglycosylases and endopep idases. Only he genes a l, sleI and ly M and hei
p oduc s ha e been cha ac e ized (Figu e 3).
8
Figu e 3 – Mu ein hyd olases a ge s wi hin S. au eus pep idoglycan. The a ows indica e he
clea age si es (adap ed om Szweda e al, 2012).
SleI is a 32kDa p o ein wi h N-ace ylmu amyl-L-alanine ac i i y and is in ol ed in
cell sepa a ion a e di ision in S. au eus (Heilmann e al, 2005). Ly M is a 32 kDa
p o ein wi h glycylglycine endopep idase ac i i y, being able o hyd olyse he glycyl-
glycine bonds o S. au eus c oss b idges. Ramadu ai (1997 and 1999) epo ed ha
Ly M plays a ole in cell g ow h as i is dis ibu ed on he cell su ace uni o mly. O he
pep idoglycan hyd olases wi h N-ace ylmu amyl-L-alanine amidases ac i i y we e
desc ibed in S. au eus, including Ly A (23 kDa), Ly H (33kDa) and Ly N (46kDa).
2.3. ATL – The majo au olysin o S aphylococcus au eus
The mos p ominen mu ein hyd olase o S. au eus is ATL, a 137.5 kDa
bi unc ional p o ein (Oshida, 1995). ATL p o ein consis s o a signal pep ide, a p o-
pep ide, a ca aly ic domain wi h N-ace ylmu amyl-L-alanine amidase ac i i y (AM),
h ee epea s (R1-R3), and a C- e minal ca aly ic domain wi h N-ace ylglucosaminidase
ac i i y (GL). A e sec e ion, he p ecu so p o ein is p ocessed ex acellula ly o yield
he ma u e amidase (AM) and glucosaminidase (GL) p o eins. (Figu e 4)
9
Figu e 4 – Domain a angemen o he bi unc ional ATL p ecu so p o ein. A ows (ligh ning)
indica e he pos - ansla ional clea age si es. SP- signalpep ide; PP- p opep ide; ca - ca aly ic domains;
R1 R2 R3- epea domains.
The amidase (63.3 kDa) clea es he amide bond be ween he N-ace yl mu amic
acid in he glycan backbone and L-alanine in he s em pep ide, con ains an enzyma ic
domain and wo epea domains in ol ed in localiza ion and subs a e ecogni ion (R1
and R2, ha can each be u he di ided in o an a- ype and a b- ype subuni ) (Biswas,
2006; Ma ino e al, 2002). The amidase epea s R1R2 a e esponsible o a aching he
enzyme o he cell wall and do no con ibu e o ly ic ac i i y (Oshida, 1995; Biswas,
2006). The s uc u e o AM om S aphylococcus epide midis is al eady de e mined
(Figu e 5). This domain, wi hou epea s, adop s a globula , mixed α/β old, wi h six
s anded, cen al β-shee su ounded by se en α-helices (Zoll e al, 2010). In he cen e
o he ecessed a ea is a zinc ion. R2ab esembles a hal -open β-ba el o med by a
semi-ci cula , ou s anded β-shee , and he wo subuni s a e a anged in a simila
o ien a ion.
Figu e 5 – (A) S uc u e o he ca aly ic domain o AmiE amidase (wi hou epea s R1,2) o S.
epide midis A lE. Helices and s ands a e shown in g een and pink espec i ely. (B) S uc u e o he A l
epea s R2ab. R2a and R2b ha e a simila β-s uc u e ha is connec ed wi h a lexible linke wi h R1a.
(Gö z e al, 2013)
B
16
2. DNA Me hods
Ch omosomal DNA om s ains was ex ac ed using Wiza d Genomic DNA
Pu i ica ion ki (P omega, USA) as sugges ed by he manu ac u e , wi h some
modi ica ions, namely, an ini ial cell lysis s ep, pe o med in T is pH8 supplemen ed
wi h 10 mg/ml o lysos aphin (AMBI PRODUCTS LLC, USA) and 30 µg/ml o RNase
(SIGMA, USA).
2.1. PCR and sequencing
Rou ine PCR (polyme ase chain eac ion) amplifica ion was pe o med wi h
NZYTaq DNA polyme ase (Nzy ech, Po ugal). The p ime s used a e lis ed in Table 2.
PCR p oduc s we e pu ified wi h DNA Clean & Concen a o TM-5 (Zymo Resea ch,
USA).
Table 2 – P ime s used o PCR ampli ica ion.
P ime
Sequence
n
PAM w BamHI
CCAGGATCCGCTTCAGCACAACCAAGATCAG
31
pGL XhoI
CCACTCGAGTTTATATTGTGGGATGTCG
28
P eAM w
ATGAATGCCCAATGTCATGC
20
AM
AGTAGTTACTTTAGGTGTCGC
21
PcompATL w SalI
CGAGTCGACGATTTGTCACGTCACC
25
PAMR2 SalI
CCAGTCGACTTAGGTAGTTGTAGATTGCG
29
PR1R2R3GL w NcoI
GCTCCATGGCTCCTACTACACCATCAAAACC
31
PAM SalI
CCAGTCGACTTATTTTACAGCTGTTTTTGG
30
PR2R3GL w NcoI
GCACCATGGCTCCTACACCAACACCTAAGCC
31
pGLSH3 SalI
CCTGTCGACTTAATGCTTAACATCATTAAAGTTAG
C
36
PGL w BamHI
CGTGGATCCGCTTATACTGTTACTAAACC
29
PGL SalI
CCAGTCGACTTATTTATATTGTGGGATGTCG
31
PGLSH3 w
GATGTTAAGCATGCAATGGATACG
24
PosGL
ACGTTGCGAATTGATTGAAGC
21
PCR p oduc s we e sequenced a STAB VIDA (Po ugal), and he sequence
aces we e analyzed using he so wa e DNAs a Lase gene SeqMan P o (Ve sion:
7.1.0).
17
3. F ac iona ion o cul u e con en s
Cul u e samples we e aken o e ime co esponding o he ollowing OD620nm:
0.1, 0.2, 0.4, 0.6, 1, 2, 3, 4, 6 and a la e s a iona y phase (≈24h). Cells we e ha es ed
by cen i uga ion (10 000g, o 10 minu es a 4ºC) and he supe na an and he pelle
we e sepa a ely s o ed a -20ºC and la e p ocessed as ollows.
Supe na an
The supe na an p o ein p ecipi a ion was pe o med using 1/10 olume o
TCA, du ing 17h, a -20ºC. The p o ein ac ion was collec ed by cen i uga ion a
13 000 pm 4ºC, 10 minu es (SIGMA 3-16K, 12155 o o , Sa o ius, Ge many). The
p o ein pelle was insed wi h ice-cold ace one and cen i uged a 13 000 pm 4ºC o
10 minu es. The supe na an was disca ded and he d ied pelle essuspended in
500µl PBS 1x.
Pelle
In o de o ob ain he same cell numbe , di e en olumes o cul u e we e
used, as showed in Table 3. The pelle was washed in 1ml o ice-cold 50mM T is-
HCl (pH7.5)-150mM NaCl and cen i uged a 10 000 pm, 4ºC o 10 minu es. Then,
he memb ane-associa ed p o eins we e ex ac ed by essupending he pelle in 100µl
o 4% SDS and incuba ing a oom empe a u e (RT) o 30 minu es wi h s i ing.
The SDS suspensions we e cen i uged a 13 000 pm (Bio uge Pico He aeus), o 15
minu es a RT. The supe na an s we e s o ed in aliquo s a -20ºC.
Table 3 – Cul u e olumes aken a di e en OD’s620nm.
OD620nm
Volume (mL)
0.1
50
0.2
25
0.4
12.5
0.6
8.3
1
5
2
2.5
3
1.7
4
1.25
6
0.83
18
3.1. P o ein analysis by SDS-PAGE and Wes e n Blo
To e i y he in eg i y o he p o ein ex ac s, p o ein samples we e analyzed
unde dena u ing condi ions using SDS-polyac ylamide gel elec opho esis (PAGE),
wi h he mini-PROTEAN sys em (BIO-RAD, USA). Be o e elec opho esis, he
samples we e mixed in a a io o 1:2 wi h 19:1 (Laemmli: β-me cap oe hanol) solu ion,
incuba ed a 95ºC o 5 min and hen 10 min on ice. Elec opho esis was pe o med in
unning bu e (24 mM T is-base, 191 mM Glycine, 3.46 mM SDS) a 30 mA o 1-1.5
h. Samples we e analyzed in 10% SDS-PAGE along wi h molecula weigh ma ke
(Colo Bu s Elec opho esis Ma ke , Sigma o P ecision Plus P o einTM All Blue
S anda ds, BIO-RAD).
P o eins we e ans e ed o a ni ocellulose memb ane (Ame sham Hybond
ECL Ni ocellulose, 0.45 µm om GE Heal hca e, UK) using he Mini T ans-blo
elec opho e ic ans e cell (BIO-RAD) and ans e solu ion (25 mM T is-base, 192
mM Glycine, 10% E hanol). Blo ing was pe o med a 4ºC o 90 min a 100 V wi h
agi a ion. A e blo ing, he memb ane was incuba ed o e nigh in blocking solu ion
(PBS-Tween and 5% w/ low- a milk), washed wi h PBS-Tween and p obed wi h he
p ima y an ibody an i-GL o an i-AM (G ilo e al, unpublished), in a a io o 1:1500 o
2 h and 1:1000 o 5h, espec i ely. The memb ane was hen washed, imme sed in esh
blocking bu e and incuba ed wi h seconda y an ibody (an i- abbi IgG) (Pe kin Elme ,
USA) in a a io o 1:20000 o 30min. A e a inal washing s ep, he memb ane was
incuba ed wi h chemiluminescence de ec ion solu ion o 1 min (Wes e n Ligh ning
Plus-ECL, Pe kinElme , USA) and exposed o au o adiog aphic ilm (Ame sham
Hype ilmTM ECL GE Heal hca e) o app op ia e pe iods o ime. The ilm was
p ocessed manually by imme sion in de eloping and ixing eagen s.
4. GL-media ed Lysis Assays
Th ee di e en subs a es we e used o analyze he ly ic ac i i y o GL: (i) hea -
inac i a ed cells, (ii) cell wall, and (iii) pep idoglycan. Samples we e p epa ed as
desc ibed in he nex sec ions (4.1 – 4.3). Hea -inac i a ed cells we e dilu ed o an
OD600≈ 0.4 in T is pH7.5. Cell wall and pu i ied pep idoglycan we e p epa ed T is
pH7.5 o an ini ial concen a ion o 4mg/mL. Low-molecula weigh salmon spe m
DNA (Sigma) (0.5 and 0.05 mg/mL) and pu i ied p o ein ATL-C (GL domain wi hou
19
he epea egion, G ilo e al, 2014) (5ng/µl) we e added o he wells, as needed.
Mu anolysin (5µg/mL) and lysos aphin (5µg/mL) we e used as posi i e con ols o
ly ic ac i i y.
Lysis assays we e pe o med in s e ile non ea ed 96-well mic opla es
(B andpla es®, B and, Po ugal) a 37ºC wi h shaking o 10h, aking eadings (600nm)
wi h 10 minu es in e al in a mic opla e eade Sp ec a Max190 (Molecula de ices,
USA).
4.1. Pu i ica ion o hea -inac i a ed cells
S. au eus s ains we e g own a 37°C wi h s i ing o an OD o ≈0,3 and cells we e
ha es by cen i uga ion a 10 000 pms a 4ºC o 10 minu es (So all RC-5C 19 Plus,
SLA-150 o o , Kend o Labo a o y P oduc s New own, USA). The pelle s we e
essuspended in cold wa e and cells we e boiled in SDS ( o a inal 4% SDS
concen a ion) o 30 minu es. The cul u es we e kep a RT O/N. The SDS was
emo ed by washing he cells wi h ho wa e un il no SDS is de ec ed in he
essuspended pelle h ough he Hayashi me hod. The pelle cells we e kep in H2O wi h
0,05% NaN3.
4.2. Cell wall ex ac ion
To ex ac he cell walls, he p ocedu e o sec ion 4.1. was pe o med and
subsequen ly he cells we e b oken by glass beads (Glass beads, acid-washed, 425-600
μm, Sigma) using he Fas p ep appa a us (Fas p ep FP120, Bio 101 Sa an , F ance), 3
imes, 40 seconds a speed 6. The samples we e cooled on ice be ween uns. Glass
beads we e emo ed by il a ion using a accum il e (po osi y 3). The il a e was
cen i uge in co ex ubes o 5 minu es a 2 000 pm, RT, o emo e unb oken cells and
la ge cellula deb is. The supe na an was cen i uged o 15minu es a 15 000 pm, RT.
Pelle s we e essuspended in 100mM T is (pH 7.5).
To pu i y he cell walls, he samples we e incuba ed wi h MgSO4 (20 mM),
DNAse and RNAse (10 and 50 µg/ml, espec i ely) a 37ºC o 2h. A e wa ds, CaCl2
(10 mM) and ypsin (100µg/ml) we e added and he samples we e incuba ion
p oceeded O/N wi h agi a ion. To inac i a e he enzymes, SDS was added o a inal
concen a ion o 1% and he samples boiled o 15minu es.
20
SDS was emo ed by 2 washes wi h H2O, cen i uging a 15 000 pm o 15
minu es. The pelle was incuba ed in 8M LiCl2, o 30 minu es a 37ºC and cen i uged
o 15 minu es a 15 000 pm a RT. The pelle was incuba ed in 0.1M EDTA (pH 7.0),
o 30 minu es a 37ºC and again cen i uged. A e 4 washings wi h H2O he pelle was
lyophilized O/N in Speed ac (Sa an TM Speed acTM Concen a o , USA).
4.3. Pu i ica ion o Pep idoglycan
Pep idoglycan pu i ica ion was pe o med ollowing he p ocedu es o sec ions
4.1. and 4.2.. The lyophilized pelle (sec ion 4.2) was ea ed wi h 48% hyd o luo ic
acid, o 48h a 4ºC wi h agi a ion. A e incuba ion, H2O was added and a pelle was
ob ained by cen i uga ion (45min a 20 000 pm, 4ºC). This s ep was epea ed. The
pelle was essuspended in 10mM T is (pH 7.0), ollowed by cen i uga ion. Th ee H2O
washing s eps we e pe o med. The pelle was lyophilized O/N in Speed ac.
5. P o ein exp ession and pu i ica ion
ATL-C p o ein (GL domain wi hou he epea egion) (G ilo e al, 2014) was
exp essed using wo di e en p ocedu es, acco ding o he inal objec i e: i) p o ein o
he lysis assays, and ii) p o ein o he NMR assays.
5.1. Exp ession o ATL-C p o ein in complex medium o diges ion
assays
ATL-C p o ein was exp essed in E. coli BL21(DE3)+PET28a-ATL-C. Cells
ans o med wi h he app op ia e ecombinan plasmid we e g own in LA medium
supplemen ed wi h Kanamycin (30 μg/ml o Km) a 37ºC.
A colony was inocula ed in 500mL o au o-induc ion medium (LB medium
supplemen ed wi h 2mM MgSO4, 10mL 50x5052 (0.5% glyce ol, 0.05% glucose and
0.2% lac ose), 25mL 20xNPS (see annex 3) and Kanamycin 30µg/ml), g own a
37ºC o 17h and cells we e ha es ed (12000 pm o 10 min) (So all RC-5C 19
Plus) and essuspended in 20mL lysis bu e (50mM Na2HPO4; 300mM NaCl;
10mM Imidazole; pH8) and 10 UmL-1 benzonase (No agen, Ge many) (4µL).
A e cell dis up ion pe o med wi h a F ench P ess (FA-032 (40k) s anda d
cell a 12000 psi om The mo Elec on Co po a ion), and emo al o cellula deb is
21
and memb anes by cen i uga ion (12000 pm o 1 h), he lysa e was subsequen ly
pu i ied as desc ibed in he nex sec ion.
5.1.1. Manual p o ein pu i ica ion using Ni-NTA ma ix
The column was cha ged wi h Ni-NTA aga ose (Qiagen, USA) and equilib a ed
wi h 20mL o wa e and 20mL o lysis bu e . The lysa e was loaded on o he column
and an aliquo was collec ed ( low- h ough). 20mL o wash bu e (50mM Na2HPO4;
300mM NaCl; 30mM Imidazole; pH8) was used o he washing s eps and 2mL o
Elu ion Bu e (50mM Na2HPO4; 300mM NaCl; 250mM Imidazole; pH8) o collec ing
5 elu ions. Finally, he column was washed wi h wa e and 30% e hanol and s o ed a
4ºC. Aliquo s we e collec ed a each s ep.
To e i y he p o ein pu i y le el, he p o ein samples we e analyzed unde
dena u ing condi ions using SDS-polyac ylamide gel elec opho esis (PAGE), as
desc ibed be o e, in sec ion 3.1.
5.2. Exp ession o ATL-C p o ein in Minimal Medium o NMR analysis
ATL-C p o ein was exp essed in E. coli BL21(DE3)+PET28a-ATL-C. To es
he exp ession condi ions, he assays we e pe o med in small-scale, using 200 ml o
bac e ial cul u e, while, o ob ain high quan i ies o p o ein, exp ession was pe o med
in la ge-scale, using 500mL o 1L o bac e ial cul u e. The me hod o cell dis up ion
adop ed was mechanical dis up ion wi h F ench P ess as be o e.
Small-scale:
A colony was inocula ed in 10mL o non-induc ion minimal medium (50mM
Na2HPO4, 50mM KH2PO4, 5mM Na2SO4, 50mM NH4Cl, 2mM MgSO4, 0.2x ace
me als (see annex 3), 0.5% glucose) and g own a 37ºC o 7h. Subsequen ly, 2% o he
olume was inocula ed in 25 mL o esh non-induc ion minimal medium and he
cul u e was g own a 37ºC o 17h. Then, 2% o he cul u e was ans e ed o 200mL o
induc ion minimal medium (50mM Na2HPO4, 50mM KH2PO4, 5mM NaSO4, 50mM
NH4Cl, 2mM MgSO4, 0.2x ace me als, 200µL 50x5052). A e 24 h o incuba ion a
37ºC, cells we e ha es ed (12000 pm o 10 min) (So all RC-5C 19 Plus) and
essuspended in 20mL lysis bu e and 10 UmL-1 benzonase (adap ed om S udie ,
2005).
22
A e cell dis up ion pe o med using a F ench P ess and emo al o cellula
deb is and memb anes by cen i uga ion, he lysa e was subsequen ly pu i ied as
desc ibed in 5.1.1 sec ion and analyzed by SDS-PAGE as desc ibed in sec ion 5.1.2..
La ge-scale:
The p ocedu e was he same as o small-scale, wi h he co esponding olumes
scalled-up o 1L o bac e ial cul u e.
5.2.1. Exp ession o ATL-C p o ein in Minimal Medium o 15N NMR
analysis
The p o ein exp ession p ocedu e was pe o med as op imized o minimal medium
(sec ion 5.2), wi h he excep ion ha ins ead o 50mM NH4Cl, labeled 15NH4Cl (Sigma)
was added o he same concen a ion, wi h he co esponding olumes scalled-up o
500mL o bac e ial cul u e.
5.3. Desal ing and p o ein concen a ion
Desal ing and bu e exchange we e pe o med using PD-10 desal ing columns (GE
Heal hca e) o 100mM T is (pH7.5). PD-10 Desal ing Columns con ain Sephadex G-25
Medium, which allows sepa a ion o high molecula weigh subs ances om low
molecula weigh subs ances; small molecules like sal and o he impu i ies a e
e icien ly sepa a ed om he high molecula weigh subs ances o in e es .
The samples we e concen a ed using Amicon® Ul a-4 (10 k) Cen i ugal Fil e
Uni s (Me ck Millipo e, USA). This de ice p o ides e icien concen a ion and
desal ing o mac omolecules by ul a il a ion using Millipo e’s Ul acel® YM
egene a ed cellulose aniso opic memb anes. Cen i ugal o ce d i es sol en s and low
molecula weigh solu es h ough he memb ane while he mac omolecules emain
inside he sample ese oi .
5.4. P o ein quan i ica ion
The o al amoun o p o ein p esen in each ac ion collec ed was es ima ed by
UV abso p ion a 280 nm (NanoD op ND-1000, Fishe Scien i ic, Spain), using
ex inc ion coe icien and p o ein molecula weigh calcula ed wi h he online ools
23
P o Pa am and Compu e pI/MW (ExPASy, Bioin o ma ics Resou ce Po al) speci ic o
he a ge p o ein (ATL-C: ε= 64860 cm-1/M; MW = 39639.6641 Da).
P o ein concen a ion om he ex ac s (sec ion 3) was measu ed wi h BCA assay
(Pie ce) in a mic opla e eade .
6. NMR analysis
NMR expe imen s we e pe o med a 298 K in a A ance II+ 600-MHz spec ome e
(B uke , Ge many) equipped wi h 5-mm TCI c yop obe. P o on chemical shi s we e
e e enced agains ex e nal DSS while ni ogen chemical shi s we e e e enced
indi ec ly o DSS using he absolu e equency a io. Da a was p ocessed using he
Topspin 3.1 package (B uke ).
A 1 mM solu ion o 15N-labeled ATL-C in 25mM T is-DCl bu e (10% 2H2O,
pH=7.5) 75mM NaCl, was i a ed.
24
25
Chap e III – Resul s
P elimina y esul s (see annex1) sugges ha he physiological oles o ATL
au olysin and in pa icula , i s associa ion wi h DNA (G ilo e al, 2014) is dependen on
he gene ic backg ound o S. au eus. Thus, wi h he pu pose o cha ac e ize he S.
au eus ATL p o ein, ega ding s ain speci ici y, di e en app oaches we e designed
and di e en gene ic backg ounds we e used, namely s ains COL (HA-MRSA, a chaic
clone), WIS (CA-MRSA, Taiwan clone), HDE288 (HA-MRSA, pedia ic clone),
UAMS-1 (MSSA, , JE2 (CA-MRSA, USA300), NCTC8325 (MSSA, labo a o y s ain)
and MW2 (CA-MRSA, USA400).
1. De e mina ion o a l gene SNPs
In o de o compa e he nucleo ide sequence o a l gene o he di e en s ains, he
a l gene was ully sequenced o s ains o which he genome sequence was s ill
unde e mined, namely WIS, HDE288 and JE2.
The sequence leng h o a l gene, including he p omo e egion, is app oxima ely
4000 bps; ampli ica ion o his egion was pe o med in 6 sepa a e DNA agmen s
( agmen s A o F), as shown on Table 4 and Figu e 7.
Table 4 – a l gene agmen s ampli ied and p ime s used o PCR ampli ica ion.
DNA agmen
P ime s
Leng h (bps)
A
PcompATL wSalI + PAMR2 SalI
1431
B
PR1R2R3GL wNcoI + PAM SalI
1053
C
PR2R3GL wNcoI + pGLSH3 SalI
1392
D
PGL wBamHI + PGL SalI
1446
E
P eAM w + AM
941
F
PGLSH3 w + PosGL
915
32
4221
AG
778
TA
4416
GA
1022
TI
4424
GA
1025
AT
1051
GD
2659
ACCATCAAC
-
255
KPS
WIS
1109
AG
-
-
-
-
-
1197
GA
-
-
-
-
-
HDE288
1802
AC
-
-
-
152
NH
1868
AG
174
TA
-
-
1868-1992
176-184
-
1946
GA
199
TA
2942
CT
-
-
-
531
PS
3042
AT
-
-
-
563
QL
3147
CT
-
-
-
599
TI
3802
AG
-
-
-
874
KR
4133
GT
-
-
-
928
AS
4416
CT
-
-
-
1022
TI
4424
GA
-
-
-
1025
AT
4503
GA
-
-
-
1051
GD
1071
G
-
-
-
JE2
2619
CG
-
-
-
252
TS
2686
TA
-
-
-
256
KT
2743
AT
-
-
-
597
TA
2942
CT
-
-
-
615
SA
2998
TC
-
-
-
742
FY
3042
AT
-
-
-
752
VI
3147
CT
-
-
-
773
AV
4156
TC
-
-
-
776
AD
4424
GA
-
-
-
1025
AT
4503
GA
-
-
-
1051
GD
33
3. ATL p o ein exp ession along g ow h
In o de o analyze he ATL p o ein exp ession o e ime and o de e mine i he
exp ession pa e n and he p o eoly ic p o ile a ies om s ain o s ain, he ela i e
amoun o AM and GL was assessed by Wes e n blo ing, o s ains COL, NCTC 8328,
WIS, HDE288, JE2, UAMS-1 and MW2. Wes e n blo ing (o p o ein immunoblo ) is
an analy ical echnique ha can be used o de ec speci ic p o eins in a complex ex ac ,
using speci ic an ibodies. We used he p e iously a ailable an i-GL and an i-AM aised
an ibodies aised agains p o eins GL-C (GL wi hou epea s domain) and ATL-H (AM
wi hou epea s domain) espec i ely (G ilo e al, unpublished). The amoun o ATL
p o ein was assessed in he cell supe na an ac ion (spen medium) (Figu e 11, panel
A) and also in he cell wall ac ion (Figu e 11, panel B).
Cul u e samples we e aken a disc e e ime poin s along he g ow h cu e (Figu e
10).
Figu e 10 – G ow h cu e o s ains COL, WIS, HDE288, UAMS-1, JE2, NCTC8325 and MW2 in
complex medium a 37ºC.
0
1
2
3
4
5
6
7
0 2 4 6 8 10
OD620nm
Time (h)
JE2
UAMs-1
WIS
HDE 288
COL
NCTC 8325
MW2
34
3.1.Exp ession analysis using an i-GL an ibody
The p o ein ex ac s we e sepa a ed by SDS-PAGE and ans e ed o a ni ocellulose
memb ane ha was hen hyb idized wi h he an i-GL an ibody. By analyzing he
appa en molecula weigh o he bands ob ained, he an i-GL an ibody was obse ed o
hyb idize wi h he ull ATL p o ein (137.5 kDa), he ATL wi hou he PP (121 kDa) and
also wi h mo e han one p ocessed o m o he GL domain, he ull o m R3GL (53.6
kDa), and GL (40.5 kDa).
35
Figu e 11 – GL exp ession along ime. Wes e n blo ing was pe o med o p o ein ex ac s om s ains
WIS, HDE288, JE2, UAMS-1, COL, NCTC8325 and MW2, using an i-GL speci ic an ibody. (A) Cell
supe na an ; (B) Cell wall ac ion. A- OD 0.2, B- OD 0.4, C- OD 0.6, D- OD 1, E- OD 2, F- OD 3, G-
OD 4, H- OD 6, I- OD 11.
Di e ences no only in he amoun o ATL p o ein p oduced along ime, bu also in
he numbe and molecula weigh o he p o ein bands ob ained, we e obse ed be ween
he 7 s ains analyzed.
O e all, o mos s ains, ATL p o ein ( he unp ocessed o m o he AM-R1R2R3-
GL o m) seemed o accumula e i s ly in he supe na an (a OD~0.2-0.4) and only la e
was he p ocessed GL domain a ge ed o he cell wall (s a ing a OD~0.4).
WIS, HDE 288, JE2, UAMS-1, NCTC 8325 and MW2 showed a simila ATL
exp ession pa e n in he supe na an , wi h a g adual inc ease along ime, while COL
showed a cons an ATL exp ession pa e n. The ATL unp ocessed o m and he AM-
36
R1R2R3-GL o m we e no obse ed in he cell wall ac ion o he pe iod o g ow h
analyzed.
Rega ding GL domain, se e al p ocessed o ms accumula ed oge he wi h he ATL
ull p o ein in he supe na an o mos s ains excep COL. Fo s ains HDE288 and JE2,
GL domain began o accumula e in he supe na an du ing exponen ial phase (OD-0.1)
and la e (OD-4) o s ains WIS, UAMS-1 and NCTC8325. Fo s ain MW2, GL
domain was only de ec ed du ing la e s a iona y phase (OD-11). A he cell wall le el,
GL domain was p esen in one single o m (co esponding o one band) o s ains
HDE288 and MW2 o as se e al p ocessed bands (co esponding o mul iple bands) o
s ains WIS, JE2, UAMS-1, COL and NCTC8325. These dis inc GL bands may
co espond o di e en clea age e en s o GL p o ein.
Rega ding he amoun o GL domain p esen in he cell wall ac ion, i was
in e es ing o obse e h ee di e en pa e ns: o s ains WIS, HDE288, JE2 and
UAMS-1, GL domain showed an accumula ion peak a exponen ial phase (OD-1)
ollowed by a apid dec ease a OD-2 and inally a s eady inc ease; o s ains COL and
NCTC8325, GL domain only s a ed o accumula e a la e exponen ial phase (OD~3-4),
while o s ain MW2, i cons an ly accumula ed along ime.
3.2. Exp ession analysis using an i-AM an ibody
The same p o ein ex ac s we e sepa a ed in SDS-PAGE and ans e ed o a new
ni ocellulose memb ane ha was hyb idized wi h an i-AM an ibody. By analyzing he
appa en molecula weigh o he bands ob ained, we obse ed ha he an i-AM
an ibody was no able o ecognize he unp ocessed o m o ATL (137.5 KDa), only he
AM domain (63.3 kDa). The Wes e n blo ing esul s a e shown in Figu e 12, panel A
(supe na an ac ion) and panel B (cell wall ac ion).
37
38
Figu e 12 – AM exp ession along ime. Wes e n blo ing was pe o med o p o ein ex ac s om
s ains WIS, HDE288, JE2, UAMS-1, COL, NCTC8325 and MW2, using an i-AM speci ic an ibody. (A)
Cell supe na an ; (B) Cell wall ac ion. A- OD 0.2, B- OD 0.4, C- OD 0.6, D- OD 1, E- OD 2, F- OD 3,
G- OD 4, H- OD 6, I- OD 11.
Di e ences in he exp ession pa e n o AM domain along ime and amongs s ains
was e en mo e s iking han o GL domain.
While WIS, COL and UAMS-1 showed low and poo ly consis en amoun s o AM in
he supe na an , NCTC8325 and MW2 only showed AM p esence a la e s a iona y
phase (OD 6 o 11). HDE288 did no p esen AM in he supe na an un il la e
exponen ial phase (OD 1), and JE2 did no p esen AM in he supe na an in he
s a iona y phase.
Rega ding he amoun o AM domain p esen in he cell wall ac ion, i was
in e es ing o obse e, as o GL domain, h ee di e en pa e ns: o s ains WIS,
HDE288 and UAMS-1, AM domain showed an accumula ion peak a exponen ial phase
(OD-1) ollowed by a apid dec ease a OD-2 and inally a s eady inc ease; o s ains
COL, NCTC8325 and MW2, AM domain did no accumula e a he cell wall ac ion;
o s ain JE2, i cons an ly accumula ed along ime.
4. The associa ion be ween DNA and GL ly ic ac i i y
The in e ac ion be ween DNA and GL seems o ha e an impo an ole in he bio ilm
o ma ion. In o de o unde s and i he GL-DNA associa ion also has impo ance in
ly ic ac i i y, ly ic assays we e pe o med using hea -inac i a ed cells, cell wall ac ion
and pu i ied pep idoglycan as subs a e o GL in he p esence o added DNA. To
de e mine i he cell wall o he pep idoglycan composi ion o he s ain would in luence
GL ac i i y, hese we e es ed o all he s ains unde s udy.
39
ATL-C ecombinan His- agged p o ein (GL domain wi hou he epea egion) was
exp essed o he diges ion assays, and hen pu i ied using a Ni-NTA column. The Ni-
NTA (nickel ni ile- iace ic acid) column co-pu i ica ion is based in he high a ini y
be ween polyhis idine agged p o eins and he nickel ions p esen in he ma ix o he
Ni-NTA columns. P o eins bound o he esin a e elu ed by compe i ion wi h imidazole.
The p o ein pu i y le el was e i ied by SDS-PAGE as shown a igu e 13.
Figu e 13 - Pu i ica ion o ATL-C ecombinan His- agged p o ein. Lane 1: o al ex ac ion lysa e;
Lane 2: low- h ough; Lane 3 and 4: washes; Lane 5-9: elu ions 1-5; Lane 10: p o ein ma ke (Low
Molecula Weigh P o ein Ma ke ). G een a ows: ATL-C (GL wi hou R3).
In o de o de ine he bes ly ic ac i i y condi ions, di e en bu e s we e es ed
(Sodium Phospha e Bu e pH 7.4; Sodium Phospha e Bu e pH 5.5; T is-HCl pH 8;
T is-HCl pH 7.4; T is-HCl pH 5.5) and di e en GL p o ein concen a ions (5ng/µl;
10ng/µl; 20ng/µl). The eac ion condi ions ha e ie ed highe GL pep idoglycan ly ic
ac i i y le els we e bu e T is pH 7.5 and a p o ein concen a ion o 5ng/µl. The
sample was incuba ed a 37ºC wi h agi a ion and he OD600 was moni o ized o 2h wi h
5 minu e in e als eads.
As posi i e con ols, mu anolysin (a mu aly ic enzyme ha clea es he N-
ace ylmu amyl-β-N-ace ylglucosamine linkage o he bac e ial cell wall polyme
pep idoglycan-polysaccha ide) and lysos aphin (enzyme ha clea es he c osslinking
pen aglycin b idges o S. au eus pep idoglycan) we e used; bo h enzymes we e able o
40
deg ade he hea -inac i a ed cells, he cell wall ac ion and he pu i ied pep idoglycan
samples. To de e mine i he salmon spe m DNA added o he samples would in luence
he measu emen s, con ols we e pe o med only wi h subs a e and added DNA; no
signi ican di e ences we e obse ed when compa ed o he samples wi hou DNA.
Di e ences we e obse ed in he ly ic ac i i y o GL when using subs a es om
di e en s ains: pu i ied pep idoglycan, cell wall and hea -inac i a ed cells (Figu e 14).
The ollowing g aphics a e p esen ed wi h ep esen a i e alues o ime, he g aphics
wi h all ime poin s a e p esen ed in annex 2.
The ly ic ac i i y o GL was highe o he pep idoglycan o s ains WIS, HDE288,
UAMS-1 and MW2. In WIS and MW2 GL-DNA wi h 0.05 and 0.5 mg/mL,
espec i ely, has a highe diges ion o pep idoglycan.
Rega ding he cell wall, i is obse ed mo e ly ic ac i i y o GL in he s ains
HDE288 and MW2. The e seems o be no signi ican di e ence in GL ac i i y when
associa ed wi h DNA.
In he inac i a ed cells he e is a g adual dec ease in OD600 when GL is added,
howe e no di e ences a e obse ed in he p esence o DNA.
GL showed no ly ic ac i i y o he hea -inac i a ed cells o all se en s ains.
Fu he mo e, GL also did no show ly ic ac i i y o he cell ac ion o he pu i ied
pep idoglycan o s ain COL. The ly ic ac i i y o GL was highe o he cell wall
ac ion o s ains MW2 and HDE288; acco dingly, o hei pep idoglycan ac ion as
well. Fo all o he s ains (WIS, UAMS-1, JE2 and NCTC8325), GL only showed ly ic
ac i i y in he pep idoglycan ac ion.
Rega ding he e ec o DNA addi ion o he lysis eac ion, con a y e ec s we e
obse ed o he ly ic ac i i y o GL agains WIS and MW2 pep idoglycan: he 0.05
mg/ml concen a ion was ound o ac i a e GL ly ic ac i i y on WIS pep idoglycan and
inhibi he same ac i i y on MW2 pep idoglycan. In con as , he highe DNA
concen a ion, 0.5 mg/mL, was esponsible o inhibi ing GL ac i i y on WIS
pep idoglycan and ac i a es i on MW2 pep idoglycan.
41
0
0,2
0,4
0,6
0,8
1
1,2
1,4
OD (600 nm)
(A) COL
5 min. 25 min. 50 min. 75 min. 100 min. 120 min.
0
0,2
0,4
0,6
0,8
1
1,2
1,4
OD (600 nm)
(B) WIS
48
49
Chap e IV – Discussion and Conclusions
The main objec i e o his p ojec was o cha ac e ize he ATL p o ein ega ding
s ain speci ici y. Fo his pu pose, ou asks we e p oposed: (i) s udy he di e en
p ocessed o ms and he cell compa men whe e he clea age occu s, in di e en S.
au eus backg ounds; (ii) analyze he exp ession o ATL along ime in he di e en
s ains; (iii) analyze he impac o DNA on GL ly ic ac i i y on he pep idoglycan o
se e al S. au eus lineages; (i ) cha ac e ize GL-DNA in e ac ion by NMR.
S aphylococcus au eus is a e y clonal mic oo ganism ha is able o dissemina e
wo ldwide. Among he se e al clonal lineages o S. au eus, in his s udy we included
s ains ep esen ing MSSA, CA-MRSA and HA-MRSA clonal lineages ha showed
di e en ATL-dependen bio ilm o ma ion pa e ns.
COL is a hospi al acqui ed MRSA wi h a sccmec ype I, membe o he
“a chaic” clone o MRSA and pe haps he mos s udied MRSA s ain. COL was
isola ed om a pa ien in Colindale, Uni ed Kingdom in 1960 (Je ons, 1961). This
s ain is a membe o he mos success ul o all MRSA lineages, which nowadays no
only includes hospi al bu also communi y-associa ed s ains. NCTC 8325 and UAMS-1
a e bo h MSSA; NCTC 8325 was isola ed om a co neal ulce , and he o iginal genome
map o S. au eus was based on his s ain (No ick, 1991), UAMS-1 was isola ed om
an os eomyeli is pa ien . MW2, a communi y acqui ed MRSA wi h sccmec ype IV, was
isola ed in 1998 in he USA and caused a al sep icemia and sep ic a h i is (Baba,
2002). I belongs o he USA400 clone, one o he mos common lineages in he Uni ed
S a es. WIS is a CA-MRSA wi h sccmec ype V, isola ed in Taiwan. HDE288 is a HA-
MRSA wi h sccmec ype VI, a pedia ic clone isola ed in Nica agua. JE2 is a CA-
MRSA ha belongs o USA300 clone, isola ed om skin and so issue in ec ions in
USA.
1. a l gene SNPs a ec he p o ein sequence
Single nucleo ide polymo phisms, equen ly called SNPs, a e he mos common
ype o gene ic a ia ion. SNPs wi hin a coding sequence do no necessa ily change he
amino acid sequence o he p o ein.
50
The SNPs obse ed in he a l egion o he s ains in his s udy p o ided in e es ing
in o ma ion. No al e a ions we e obse ed in he p omo o egion, indica ing ha any
exp ession di e ences be ween he s ains do no esul om mu a ions in his egion.
Some SNPs esul ed in amino acid esidue subs i u ions and only one was loca ed in he
icini y o he ac i e si e o GL domain, E1128 (V1126I) in MW2 s ain. The sequence
o ATL p o ein o UAMS-1 showed mo e di e ences, mainly in he p opep ide egion,
when compa ed wi h he o he s ains, sugges ing an al e ed p o eoly ic clea age
pa e n. The ATL sequence o HDE288 and JE2 also showed se e al amino acid
subs i u ions, mo e dispe sed along he ATL p o ein domains (PP, AM, R epea s and
GL). The only ATL sequence ha was iden ical o COL was he one o WIS s ain.
2. Di e ences in he exp ession o ATL p o ein along g ow h
ATL is 137.5 kDa mu ein hyd olase, wi h wo ca aly ic domains: AM (63.3 kDa),
ha con ains an enzyma ic domain and wo epea domains (R1 and R2), and GL (53.6
kDa), con aining an enzyma ic domain and a single epea domain (R3).
To analyze he ATL p o ein exp ession o e ime and de e mine i he exp ession
pa e n a ies om s ain o s ain, he ela i e amoun o ATL was assessed by Wes e n
blo ing, using speci ic an ibodies agains AM and GL domains. The an i-GL an ibody
was ound o ecognize he ATL comple e p o ein while also ecognizing GL domain.
A he beginning o exponen ial phase, ATL p o ein was p esen only in he supe na an ,
sugges ing ha he p o ein accumula ed in he cell ex e io and only a e a p o ein
eshold limi i was hen a ge ed o he cell wall, al eady in a clea ed o m. The
comple e o m o ATL (137 kDa) was no p esen in he cell wall ac ion.
The p esence o GL was mo e e iden in he pelle , sugges ing ha a e clea age,
GL domain is a ge ed o he cell wall. These esul s suppo he ecen ly desc ibed
unc ion o his hyd olase in bio ilm de elopmen : GL may p o ide an a achmen
poin be ween he cell su ace and he bio ilm ma ix.
Rega ding AM domain, COL and NCTC8325 s ains seem no o a ge AM domain o
he cell wall. Howe e , p esence o AM a he cell wall was obse ed in he o he
s ains, in acco dance wi h he li e a u e desc ip ion o R1R2 epea s being esponsible
51
o a ge ing AM domain o he pelle (Biswas, 2006; Ma ino e al, 2002). These
obse a ions demons a e how di e en s ains can ha e di e en le els o AM
associa ed o he cell wall and aise wo hypo heses: AM is no loca ed a he cell wall in
some s ains, o AM is only a ge ed o he cell wall a a la e g ow h phase. Two
possible mechanisms a e desc ibed o he speci ic localiza ion o ATL a he sep al
si es o he cell su ace. One is ha ATL p o ein is syn hesized, ansloca ed a he cell
di ision si e, and localized wi h an ancho ing componen . The o he is ha ATL is
sec e ed in o he cul u e medium and eabso bed o an ancho ing componen ia ligand-
ecep o in e ac ion (Schlag e al, 2010; Yamada e al, 1995). Di e ences in he
s uc u e o he epea domains o AM and GL migh e lec he di e ences o he
ecogni ion si es on s aphylococcal cell walls. Ou esul s con i m ha a ge ing o AM
and GL occu s h ough independen mechanisms: GL was p esen in he cell wall o all
s ains, in con as o AM. Fu he mo e, he ac ha no AM was obse ed in he cell
wall o some s ains s eng hens he second hypo hesis ha he ATL domains a e
sec e ed and subsequen ly eabso bed.
Di e en ATL, GL and AM exp ession pa e ns along he g ow h cu e we e
obse ed o he di e en s ains and also dis inc p o eoly ic pa e ns, illus a ed by he
occu ence o bands o di e en sizes. Howe e , no di ec ela ion wi h he amino acid
subs i u ions iden i ied p e iously was possible o es ablish. Fo example, he ATL
sequence o WIS and COL s ains a e iden ical, howe e , hei ATL, GL and AM
exp ession p o iles we e comple ely dis inc .
3. The impac o DNA on GL ly ic ac i i y
ATL is he mos p edominan pep idoglycan hyd olase in s aphylococci. Al hough
se e al s udies ha e ocused on he unc ion o ATL, he indi idual con ibu ions o he
AM and GL domains a e no known. Recen s udies e eal he impo ance o he
in e ac ion be ween DNA and GL in bio ilm o ma ion. This ac aises he ques ion i
he in e ac ion be ween DNA and GL may also be impo an o he majo unc ion o
ATL, he pep idoglycan ly ic ac i i y.
52
The esul s ob ained showed no signi ican di e ences in he ly ic ac i i y o GL
when DNA is added, excep o s ains WIS and MW2. The e ec o bo h DNA
concen a ions on he ly ic ac i i y o GL o he pep idoglycan o hese wo s ains, was
con adic o y: i had apposi e inhibi o y and ac i a ing e ec s. Di e ences in he
pep idoglycan composi ion o hese s ains may explain he di e en ly ic ac i i y o GL
p o ein and he pep idoglycan o hese s ains should be analyzed in u u e expe imen s.
Fu he mo e, all he assays we e pe o med wi h GL p o ein om COL s ain. I is
in e es ing o obse e no ly ic e ec agains COL inac i a ed cells, cell wall o e en
pep idoglycan, sugges ing ha GL may ac as a weapon agains o he S. au eus s ains,
al hough no ha ing ly ic ac i i y agains i s own su ace polyme s.
Rega ding he hea -inac i a ed cells, no e ec o GL ly ic ac i i y was obse ed;
as GL is expec ed o lyse he pep idoglycan mesh a disc e e loca ions, his beha io
was expec ed. Also, o he cell su ace associa ed ac o s/enzymes may also bind o
DNA, in his way compe ing wi h GL. Conce ning he esul s o he cell wall ac ion,
he p esence o WTAs, which p e en s S. au eus om au olysis (Schlag e al, 2010),
can be, also, he explana ion o he non-signi ican ly ic ac i i y. I is belie ed ha
a ge ing o amidase R1R2 epea domains is a he based on an a oidance s a egy by
WTA, which p e en s binding o ATL. As WTAs a e abundan in he old cell wall bu
no a he c oss-wall egion, ATL can bind o he sep al egion.
I would be in e es ing o analyze he ly ic ac i i y o AM-R1R2 in hese s ains, in
he p esence o added DNA, since he DNA-binding ac i i y o he AM domain appea s
o be es ic ed o he epea s (G ilo e al, 2014).
4. NMR
Nuclea magne ic esonance (NMR) spec oscopy is a me hodology ha e eals he
a omic s uc u e o mac omolecules in solu ion in highly concen a ed samples (app ox.
1 mM) (Bha i and Roy, 2012). The echnique is based on he ac ha ce ain a omic
nuclei a e in insically magne ic. Only a limi ed numbe o iso opes display his
p ope y, called spin (½), such as 1H, 15N, 13C. A spinning p o ein in α s a e can be
aised o an exci ed s a e (β s a e) applying a pulse elec omagne ic adia ion (a adio-
53
equency). The spin will change om α o β and esonance will be ob ained. A
esonance spec um o a molecule can be ob ained a ying he magne ic ield a a
cons an equency o elec omagne ic adia ion o keeping he magne ic ield cons an
a ying elec omagne ic adia ion. Wi h his echnique, one, wo and ee-dimension
spec a (1H-spec um, 1H-15N-spec um and 1H15N-13C-spec um) can be ob ained in
o de o de e mine he p o ein s uc u e (Mon elione e al., 2000). To bea he low
na u al abundance o 15N and 13C o ob aining wo and ee-dimension spec a,
inco po a ion o such iso opes mus be o ced by exp essing he p o ein in minimal
media supplemen ed wi h he iso opes.
In his s udy, ATL-C, GL domain wi hou epea s, was exp essed in 15N labeled
minimal medium and hen analyzed by NMR. The 15N-HSQC spec um ob ained
e ealed ha he p o ein is olded since a high signal dispe sion is obse ed. These
esul s p o ided impo an con ibu ions o he cha ac e iza ion o GL by NMR. The
s uc u e o GL domain has no been elucida ed ye , in con as wi h AM domain. I is
necessa y in he u u e o op imize he condi ions o he exp ession o GL o ob ain a
13C spec um essen ial o he s udy o he in e ac ion be ween GL and DNA.
5. Conclusion
This s udy allowed o iden i y dis inc pa e ns o ATL p o ein exp ession and
p o eoly ic clea age ha may be he basis o he p ima y pheno ypic di e ences
associa ed o ATL p o ein. GL and AM exp ession a ies om s ain o s ain, and GL
and AM we e shown o be he a ge ed o he cell wall h ough di e en mechanisms.
Ou esul s suppo he hypo hesis o ATL being sec e ed in o he cul u e medium and
hen e a ge ed o he cell wall. The e ec o DNA-GL binding in ly ic ac i i y o GL
was ound o be, as al eady obse ed o bio ilm o ma ion, s ain dependen . The
s uc u al cha ac e iza ion o GL-DNA associa ion may cla i y he mechanisms behind
hese obse a ions.
The hyd olysis o pep idoglycan by hyd olases esul s in a s ong bac e icidal e ec
which makes his g oup o enzymes an al e na i e an ibac e ial weapon, o example a
54
possible accina ion scheme wi h ATL-AM has been s udied and his accine was
shown o induce Th1 and Th2 immune esponse (Nai e al, 2015).
Due o he impo ance al eady demons a ed o he ATL in S aphylococcus au eus
and he possibili y o being a po en ial weapon agains his mic oo ganism, i is
impo an o s udy and cha ac e ize his p o ein.
55
Re e ences
Ab aham, E. P., and E. Chain. 1940. An Enzyme om Bac e ia able o Des oy
Penicillin. Na u e, 146:837.
Amako, K., and A. Umeda. 1977. Scanning elec on mic os-copy o S aphylococcus.
Jou nal o Ul as uc u e Resea ch, 58:34–40.
A che , N. K., M. J. Mazai is, J. W. Cos e on, J. G. Leid, M. E. Powe s, and M. E.
Shi li . 2011. S aphylococcus au eus bio ilms: P ope ies, egula ion and oles in
human disease. Vi ulence, 2:445–459.
Baba, T., and O. Schneewind. 1998. Ta ge ing o mu aly ic enzymes o he cell
di ision si e o G am-posi i e bac e ia: epea domains di ec au olysin o he equa o ial
su ace ing o S aphylococcus au eus. The EMBO Jou nal, 17:4639–4646.
Bha i, S.K., and R. Roy. 2012. Quan i a i e H NMR spec oscopy. T ends in
Analy ical Chemis y, 35:5–26.
Beck, W. D., B. Be ge -Bächi, and F. H. Kayse . 1986. Addi ional DNA in
me hicillin- esis an S aphylococcus au eus and molecula cloning o mec-speci ic
DNA. Jou nal o Bac e iology, 165:373–378.
Be a, A., S. He be , A. Jakob, W. Vollme , and F. Gö z. 2005. Why a e pa hogenic
s aphylococci so lysozyme esis an ? The pep idoglycan O-ace yl ans e ase Oa A is he
majo de e minan o lysozyme esis ance o S aphylococcus au eus. Molecula
Mic obiology, 55:778–787.
Be ge -Bächi B., A. S assle, J. E. Gus a son, and F. H. Kayse . 1992. Mapping and
cha ac e iza ion o mul iple ch omosomal ac o s in ol ed in me hicillin esis ance in
S aphylococcus au eus. An imic obial Agen s and Chemo he apy, 36:1367-1373.
Be gey, D. H., Robe Ea le Buchanan, and N. E. Gibbons. 1974. Be gey's manual
o de e mina i e bac e iology. 8 h ed Williams & Wilkins. Bal imo e.
56
Biswas, R., L. Voggu, U. K. Simon, P. Hen schel, G. Thumm, and F. Gö z. 2006.
Ac i i y o he majo s aphylococcal au olysin A l. FEMS Mic obiology Le e s,
259:260-268.
Boles, B. R., M. Thoendel, A. J. Ro h, and A.R. Ho swill. 2010. Iden i ica ion o
genes in ol ed in polysaccha ide-independen S aphylococcus au eus bio ilm
o ma ion. PLoS One, 5:e10146.
Bose, J. L., M. K. Lehman, P. D. Fey, and W.K. Bayles. 2012. Con ibu ion o he
S aphylococcus au eus A l AM and GL mu ein hyd olase ac i i ies in cell di ision,
au olysis and bio ilm o ma ion. Plos One, 7:e42244.
Bouche , H., L. G. Mille , and R.R. Razonable. 2010. Se ious in ec ions caused by
me hicillin- esis an S aphylococcus au eus. Clinical In ec ious Diseases, 51:183–197.
Chambe s, H. F. 2001. The changing epidemiology o S aphylococcus au eus?
Eme ging In ec ious Diseases Jou nal, 7:178–182.
Chambe s H. F., and F. R. DeLeo. 2009. Wa es o esis ance: S aphylococcus au eus
in he an ibio ic e a. Na u e Re iews Mic obiology, 7:629-641.
Cou o, I., H. de Lencas e, E. Se e ina, W. Kloos, J. A. Webs e , R. J. Hubne , I. S.
Sanches, and A. Tomasz. 1996. Ubiqui ous p esence o a mecA homologue in na u al
isola es o S aphylococcus sciu i. Mic obial D ug Resis ance, 2:377-391.
Das, T., P. K. Sha ma, H. J. Bussche , H. C. an de Mei, and B. P. K om. 2010.
Role o ex acellula DNA in ini ial bac e ial adhesion and su ace agg ega ion. Applied
En i onmen al Mic obiology, 76:3405-3408.
Da id, M. Z., and R. S Daum. 2010. Communi y-associa ed me hicillin- esis an
S aphylococcus au eus: epidemiology and clinical consequences o an eme ging
epidemic. Clinical Mic obiology Re iews, 23:616-687.
de Lencas e, H., S. W. Wu, M. G. Pinho, A. M. Ludo ice, S. Filipe, S. Ga de e, R.
Sob al, S. Gill, M. Chung and, A. Tomasz. 1999. An ibio ic esis ance as a s ess
esponse: comple e sequencing o a la ge numbe o ch omosomal loci in
57
S aphylococcus au eus s ain COL ha impac on he exp ession o esis ance o
me hicillin. Mic obial D ug Resis ance, 5:163-175.
DeLeo F. R., M. O o, B. N. K eiswi h, and H. F. Chambe s. 2010. Communi y-
associa ed me hicillin- esis an S aphylococcus au eus. The Lance , 375:1557-1568.
Edwa ds A. M., R. C. Massey, and S. R. Cla ke. 2012. Molecula mechanisms o
S aphylococcus au eus nasopha yngeal coloniza ion. Molecula O al Mic obiology,
27:1-10.
Ehle , K., and J. V. Hol je. 1996. Role o p ecu so ansloca ion in coo dina ion o
mu ein and phospholipid syn hesis in E.coli. Jou nal o Bac e iology, 178:6766-6771.
Figuei edo T.A., R. G. Sob al, A. M. Ludo ice, J. M. Almeida, N. K. Bui, W.
Vollme , H. de Lencas e, and A. Tomasz. 2012. Iden i ica ion o gene ic
de e minan s and enzymes in ol ed wi h he amida ion o glu amic acid esidues in he
pep idoglycan o S aphylococcus au eus. PLoS Pa hogens 8:e1002508.
Fos e , T. J. 2005. Immune e asion by s aphylococci. Na u e Re iews Mic obiology,
3:948–958.
Ghuysen, J. M. 1991. Se ine β-Lac amases and Penicillin-Binding P o eins. Annual
Re iew o Mic obiology, 45:37-67.
Giesb ech , P., J. Wecke, and B. Reinicke. 1976. On hemo phogenesis o he cell
wall o s aphylococci. In e na ion Re iew o Cy ology, 44:225–318.
Go in, C., and J. M. Ghuysen. 1998. Mul imodula penicillin-binding p o eins: an
enigma ic amily o o hologs and pa alogs. Mic obiology and Molecula Biology
Re iews, 62:1079-1093.
Gö z, F., C. Heilmann, T. S ehle. 2014. Func ional and s uc u al analysis o he majo
amidase (A l) in S aphylococcus. In e na ional Jou nal o Medical Mic obiology,
304:156-163.
64
Wa kins R. R., M. Z. Da id, and R.A. Sala a. 2012. Cu en concep s on he
i ulence mechanisms o me hicillin- esis an S aphylococcus au eus. Jou nal o
Medical Mic obiology, 61:1179-1193.
Xia, G., T. Kohle , and A. Peschel. 2010a. The wall eichoic acid and lipo eichoic acid
polyme s o S aphylococcus au eus. In e na ional Jou nal o Medical Mic obiology,
300:148–154.
Yamada, S., M. Sugai, H. Koma suzawa, S. Nakashima, T. Oshida, A. Ma sumo o,
and H. Suginaka. 1996. An au olysin ing associa ed wi h cell sepa a ion o
S aphylococcus au eus. Jou nal o Bac e iology, 178:1565–1571.
Zhou, X., and L. Cegelski. 2012. Nu ien -dependen S uc u al Changes in S. au eus
Pep idoglycan Re ealed by Solid-S a e NMR Spec oscopy. Biochemis y, 51:8143–
8153.
Zoll, S., B. Pä zold, M. Schlag, F. Gö z, H. Kalbache , and T. S ehle. 2010.
S uc u al Basis o Cell Wall Clea age by a S aphylococcal Au olysin. PLoS
Pa hogens, 6:e1.
65
Annex
1. Impac o he GL-DNA associa ion in bio ilm o ma ion. (G ilo e al, 2014)
I has been shown ha a l mu an s do no o m bio ilm p esumably due o he ole o
he au olysin in genomic DNA elease and also in assis ing he a achmen o cells o he
su ace du ing he i s phases o bio ilm o ma ion.
1.1. In ol emen o ATL in bio ilm o ma ion o s ain MW2
These p elimina y s udies es ed he independen and combined oles o AM and GL
domains in bio ilm o ma ion, using a S. au eus s ain, MW2, ha o m bio ilm.
In o de o unde s and bio ilm o ming capaci y o he a l mu an , an assay wi h
di e en ecombinan ATL p o eins was pe o med. (Figu e 18)
Figu e 18 – Bio ilm o ma ion o s ain MW2, i s isogenic a l mu an MW2L9, and MW2L9 wi h
added ecombinan p o eins. A l e e s o he AMR1-3GL ecombinan p o ein, N-His-GL e e s o
R3GL, and AM e e s o AMR1-2. Th ee expe imen s we e pe o med, a leas in duplica es.
P o ein AMR1-2 was able o complemen he bio ilm o ming capaci y o he
mu an , owing o he inc ease o ex acellula DNA p esen in he media due o he ly ic
ac i i y o he added ecombinan p o ein. When AMR1-2 and R3GL p o eins we e added
oge he , as well he comple e p o ein AMR1-3GL, he bio ilm o ming capaci y was
also complemen ed, al hough only o highe p o ein amoun s. Howe e , when R3GL
66
was added alone no complemen a ion o bio ilm o ma ion occu ed. In some cases, he
bio ilm o ming capaci y o he mu an wi h R3GL was lowe han he mu an alone, and
no concen a ion dependence was seen.
1.2. In ol emen o ATL in bio ilm o ma ion in di e en s ains.
To analyze he impo ance o ATL in bio ilm o ma ion s ains we e chosen due o
hei high bio ilm o ming capaci y and a l mu an s we e ob ain (by ansduc ion o he
RUSAL9 ansposi ion mu an wi h phage 80α). The esul ing isogenic a l mu an s we e
es ed by Wes e n Blo . Di e en pa e ns and amoun s o GL p o ein we e ound
be ween he di e en s ains as shown a Figu e 19.
Figu e 19 – De ec ion o GL p o ein pe o med by Wes e n Blo using an i-GL aised an ibody
agains cellula ex ac s o di e en s ains and hei espec i e isogenic a l mu an s.
When s a ic bio ilm assays we e pe o med on hese s ains and hei a l mu an s,
only MW2L9 and WISL9 showed a dec ease in bio ilm o ma ion when compa ed o
he espec i e pa en al s ains (Figu e 20).
67
Figu e 20 – Bio ilm o ma ion by s ains MW2, HDE 288, WIS and NCTC 8325 and hei
espec i e isogenic a l mu an s. Values shown a e a e age alues e e ing o he pe cen age o bio ilm
when compa ed o MW2 s ain. Two expe imen s we e pe o med, a leas in iplica es.
These esul s we e unexpec ed; he lack o a l is expec ed o esul in a dec ease in
bio ilm o ma ion in S. au eus. Howe e , his suppo s he impo ance o he gene ic
backg ound on bio ilm o ma ion, and he di e en pa e ns ound in he GL Wes e n
Blo could also jus i y he di e en impac ha he lack o ATL has in bio ilm
o ma ion, which is s ain-dependen .
Also, he s ains wi hou a l has a diminished bio ilm (MW2 and WIS) and simila
Wes e n pa e ns, wi h many smalle bands pe haps co esponding o ex ensi e
p ocessing o GL p o ein.
1.3. In ol emen o GL in bio ilm o ma ion in s ain WIS
To s udy he bio ilm o ming capaci y o s ain WIS and i s a l mu an , di e en ATL
ecombinan p o eins in di e en concen a ions we e added. The bio ilm o ming
capaci y o s ain WIS was p og essi ely es o ed, achie ing ull complemen a ion a a
p o ein concen a ion o 10 µg. The addi ion o AMR1-2 and R3GL ecombinan
p o eins oge he showed a highe bio ilm o ming capaci y when compa ed o he
addi ion o only one o hese p o eins, sugges ing ha he wo p o eins may wo k
syne gis ically in p omo ing bio ilm o ma ion. (Figu e 21)
O he a ia ions we e obse ed be ween WIS and MW2, showing ha he di e en
gene ic backg ound may be in ol ed.
68
Figu e 21 - Bio ilm o ma ion o S. au eus s ain WIS and i s isogenic a l mu an WISL9 wi h
added ecombinan p o eins. Bio ilms we e g own wi h di e en amoun s o ex acellula ly added
ecombinan GL domain (R3GL), AM domain (AMR1-2), and en i e A l ecombinan p o ein lacking he
SP and PP sequences (AMR1-3GL).
1.3.1. ATL-DNA associa ion
The addi ion o ex acellula DNA was able o comple e he pa ial complemen a ion
achie ed when added a less p o ein concen a ion (5 µg), howe e , ull es o a ion was
no achie ed un il AMR1-2 was added. This is consis en wi h a c i ical ole o
ex acellula DNA in he GL-dependen bio ilm o ma ion p ocess. (Figu e 22)
Figu e 22 - Bio ilm o ma ion o S. au eus s ain WIS and i s isogenic a l mu an WISL9 wi h
added ecombinan p o eins. Bio ilms we e g own wi h 1 µg o he di e en ecombinan p o eins and
complemen ed wi h 100 µg o low molecula weigh salmon spe m DNA o 50 µg/ml o DNase I.
Addi ion o complemen ing amoun s o any o he ecombinan p o eins oge he
wi h DNase I o he mu an esul ed in an almos comple e block o bio ilm o ma ion
69
(Figu e 23). This e ec was less dis inc when only AMR1-2 was added, suppo ing he
sugges ion ha he GL domain o ATL plays a mo e impo an ole han he AM
domain o his p o ein in he DNA-dependen o ma ion o bio ilm.
Figu e 23 - Bio ilm o ma ion o S. au eus s ain WIS and i s isogenic a l mu an WISL9 wi h
added ecombinan p o eins. Bio ilms we e g own wi h 10 µg o he di e en ecombinan p o eins,
and addi ion o DNase I a 50 µg/ml dis up ed bio ilm o ma ion. The amoun o bio ilm p oduced was
calcula ed as a pe cen age o he bio ilm p oduced by he pa en al WIS s ain.
70
2. Lysis assay
The esul s ob ained in he lysis assay o pep idoglycan a e shown in he nex
g aphics (Figu e 24), he e a e no ele an di e ences in he ly ic ac i i y o GL when
DNA is added.
0
0,5
1
1,5
2
050 100 150
OD600nm
Time (minu es)
COL GL(5ng/µl)
GL + DNA (0,05mg/mL) GL + DNA (0,5mg/mL)
A
0
1
2
050 100 150
OD600nm
Time (minu es)
WIS GL(5ng/µl)
GL + DNA (0,05mg/mL) GL+ DNA (0,5mg/mL)
B
0
0,5
1
1,5
2
050 100 150
OD600nm
Time (minu es)
HDE 288 GL(5ng/µl)
GL + DNA (0,5mg/mL) GL + DNA (0,05mg/mL)
C
0
0,5
1
1,5
2
050 100 150
OD600nm
Time (minu es)
UAMS-1 GL(5ng/µl)
GL + DNA (0,05mg/mL) GL + DNA (0,5mg/mL)
D
0
0,5
1
1,5
2
050 100 150
OD600nm
Time (minu es)
JE2 GL(5ng/µl)
GL + DNA (0,05mg/mL) GL + DNA (0,5mg/mL)
E
71
0
0,5
1
1,5
2
050 100 150
OD600nm
Time (minu es)
MW2 GL(5ng/µl)
GL + DNA (0,05mg/mL) GL + DNA (0,5mg/mL)
Figu e 24 – Ly ic ac i i y o GL p o ein in pep idoglycan and DNA-GL associa ion in di e en
s ains. (A) COL; (B) WIS; (C) HDE288; (D) UAMS-1; (E) JE2 (F) NCTC8325; (G) MW2. Pu ple:
pep idoglycan wi hou GL; Blue: pep idoglycan wi h GL 5ng/µl; Red: pep idoglycan wi h GL 5ng/µl and
DNA(0,05mg/mL); G een: pep idoglycan wi h GL 5ng/µl and DNA(0,5mg/mL).
The esul s ob ained in he lysis assay o cell wall a e shown in he nex g aphics
(Figu e 25), he e a e no ele an di e ences in he ly ic ac i i y o GL when DNA is
added.
A
0
1
2
050 100 150
OD600nm
Time (minu es)
GL(5ng/µl) GL + DNA (0,05mg/mL)
GL + DNA (0,5mg/mL) COL
B
0
1
2
050 100 150
OD600nm
Time (minu es)
WIS GL(5ng/µl)
GL + DNA (0,05mg/mL) GL + DNA (0,5mg/mL)
0
0,5
1
1,5
2
050 100 150
OD600nm
Time (minu es)
NCTC 8325 GL(5ng/µl)
GL + DNA (0,05mg/mL) GL + DNA (0,5mg/mL)
F
G
72
Figu e 25- Ly ic ac i i y o GL p o ein in cell wall and DNA-GL associa ion in di e en s ains. (A)
COL; (B) WIS; (C) HDE288; (D) UAMS-1; (E) JE2 (F) NCTC8325; (G) MW2. Pu ple: pep idoglycan
wi hou GL; Blue: pep idoglycan wi h GL 5ng/µl; Red: pep idoglycan wi h GL 5ng/µl and
DNA(0,05mg/mL); G een: pep idoglycan wi h GL 5ng/µl and DNA(0,5mg/mL).
C
0
1
2
050 100 150
OD600nm
Time (minu es)
HDE 288 GL(5ng/µl)
GL + DNA (0,05mg/mL) GL + DNA (0,5mg/mL)
D
0
1
2
050 100 150
OD600nm
Time (minu es)
GL(5ng/µl) GL + DNA (0,05mg/mL)
GL + DNA (0,5mg/mL) UAMS-1
E
0
0,5
1
1,5
2
050 100 150
OD600nm
Time(minu es)
JE2 GL(5ng/µl)
GL + DNA (0,05mg/mL) GL + DNA (0,5mg/mL)
F
0
0,5
1
1,5
2
050 100 150
OD600nm
Time (minu es)
NCTC 8325 GL(5ng/µl)
GL + DNA (0,05mg/mL) GL + DNA (0,5mg/mL)
G
0
1
2
050 100 150
OD600nm
Time (minu es)
mw2 GL(5ng/µl)
GL + DNA(0,05mg/mL) GL + DNA (0,5mg/mL)
73
The esul s ob ained in he hea inac i a ed cells ly ic assay a e shown in he nex
g aphics (Figu e 26).
0
0,5
1
1,5
2
050 100 150
OD600nm
Time (minu es)
GL(5ng/µ)l GL + DNA (0,05mg/mL)
GL + DNA (0,5mg/mL) COL
A
0
0,5
1
1,5
2
050 100 150
OD600nm
Time (minu es)
GL(5ng/µl) GL + DNA (0,05mg/mL)
GL + DNA (0,5mg/mL) WIS
B
0
0,5
1
1,5
2
050 100 150
OD600nm
Time (minu es)
GL(5ng/µl) GL+DNA (0,05mg/mL)
GL + DNA (0,5mg/mL) HDE 288
C
0
0,5
1
1,5
050 100 150
OD600nm
Time (minu es)
GL(5ng/µl) GL+ DNA (0,05mg/mL)
GL + DNA (0,5mg/mL) UAMS-1
D
0
0,5
1
1,5
2
050 100 150
OD600nm
Time (minu es)
GL(5ng/µl) GL+ DNA(0,05mg/mL)
GL + DNA (0,5mg/mL) JE2
E
0
0,5
1
1,5
2
050 100 150
OD600nm
Time (minu es)
GL(5ng/µl) GL + DNA (0,05mg/mL)
GL + DNA (0,5 mg/mL) NCTC 8325
F