scieee Science in your language
[en] (orig)

The Mechanism of Centriole Inactivation in Starfish Oocytes

Abstract

The centrosome is the major organizing center in a cell, composed by two centrioles, one mother and one daughter, and surrounded by a pericentriolar material, which nucleates microtubules. Centriole duplication and segregation is tightly coupled to cell cycle, which guarantees that centriole number is maintained over generations. During the somatic cell cycle, a pair of centrioles duplicates, after which each daughter cell receives a pair, forming a closed cycle. However, during fertilization, if both cells were to contribute with their pair of centrioles, gamete fusion would result in the double of the normal centriole number.(...)

Read accessible full text

The Mechanism of Centriole Inactivation in Starfish Oocytes

Author: Pinto, Joana Borrego
Year: 2015
Source: https://run.unl.pt/bitstream/10362/17416/1/phD%20thesis%20JP.pdf
Joana Bo ego Pin o
Disse a ion p esen ed o ob ain he Ph.D deg ee in Cell Biology
Ins i u o de Tecnologia Química e Biológica | Uni e sidade No a de Lisboa
Oei as, May, 2015
The Mechanism o Cen iole
Inac i a ion in S a ish Oocy es
PhD de ense
Joana Bo ego Pin o
S a ing da e: 1s Sep embe 2011
De ense da e: 18 h May 2015
Supe iso s:
D . Mónica Be encou -Dias, Ins i u o Gulbenkian de Ciência, Po ugal
D . Pé e Léná , Eu opean Molecula Biology Labo a o y, Ge many
Examine s:
D . Edga Gomes, Ins i u o de Medicina Molecula , Po ugal
D . F ancesca Pe i, Eu opean Molecula Biology Labo a o y, Ge many
D . Isabelle Ve nos, Cen e de Regulació Genòmica, Spain
D . Jan Ellenbe g, Eu opean Molecula Biology Labo a o y, Ge many
D . Ma ie-Hélene Ve lhac, Collège de F ance, F ance
3
ACKNOWLEDGMENTS
“Remembe o look up a he s a s and no down a you ee . T y o make sense o
wha you see and wonde abou wha makes he uni e se exis . Be cu ious. And howe e
di icul li e may seem, he e is always some hing you can do and succeed a . I ma e s
ha you don’ jus gi e up.”
– S ephen Hawking
Fi s o all I would like o hank Pé e Léná o accep ing me as his i s PhD
s uden , and also o le ing me wo k on cen ioles. I had a g ea un! I also ha e
o hank him o all his suppo and o no complaining ( oo much) abou all my
singing and “loudness”. I would also like o hank Mónica Be encou -Dias o he
cen iole “bichinho” she ansmi s o e e ybody (i is e y con agious!), and o all
he help p o ided in his p ojec as co-supe iso and TAC membe . I would also
like o hank my o he TAC membe s, Jan Ellenbe g and F ancesca Pe i, o all
he help ul inpu in he p ojec and o all hei a ailabili y.
I would also like o hank o all he people ha con ibu ed o his wo k, one
way o ano he , i was g ea o wo k wi h you all: Julia König and Thomas Mülle -
Reiche o he EM wo k, specially o all he hund ed se ial sec ions you had o
do, Ma hia Win e -Ka eman and Yannick Schwab o he mo e se ial sec ions
and o all he happiness ha you ind in you wo k, Ped o Machado po se o
cen iole “buddy” mais p óximo, all lab membe s om Mónica Be encou -Dias
o le ing me pa icipa e in hei jou nal club and o all he eedback,
especialmen e à Inês Ben o po pa ilha o mundo de eliminação de cen ioles
comigo, e pelas expe iências ão “ ixes” que izemos em Woods Hole. K eso! Fo
aking such good ca e o he s a ish!
I would also like o hank all he o me and cu en Léná lab membe s o all
he g ea scien i ic con e sa ions and non-scien i ic momen s ha we sha ed!
You’ e c ea ed a g ea en i onmen o wo k! Especially o all he “ his-pea ”s and
unny (“S-W-A-T eam, “’cause I am happy”, “ ha ’s magen a”, “I had my i s

4
expe ience...”, “I wanna s eal you ca /hea ”, “...you know, in he s ee s o
Pa is”, “a e we happy?”) momen s! Special hanks o Philippe o being a “Rose”
wei do, Na alia o being he c azy mama, Johanna o all he ma elous cakes,
Manuela o all he c azy Po uguese alk, Masha o being Masha, E min o
b eaking he cen i uges, Szilá d o being a Hunga ian man apped in an I ish
body, Lau a o showing he boy iend a ound, Sa a o being c azy, Im e o he
c aziness o being a physicis ! A special hanks o Masashi Mo i, my lab b o he
2, and Kalman Somogyi, my lab papa, who bo h helped me so much! I was a
pleasu e o come o wo k e e yday!
I would like o hank he EMBL communi y, especially ou 4 h loo ... ha
ocked! Specially Aas ha, Kasia, Thibau , Deepikaa Deepikaa, Iannaaaa, O i,
Ma in, Alessand a (no -Ginge Ale), Paoli a, Gus a o, Oana, Aleksand i a, Ana
Ri a maluca, Se ge, Geo ge C yp ic, Vaso, Ka in, Simone, Nils Cooling Sys em,
Ma ia mama, Mendi, Do i o and Nicole (oh my, I hope I didn’ o ge anyone!) o
all he g ea momen s: o all he cows, and “se eia à is a no po oooo”, o all
he ba becues, o all he game nigh s, o all he lamingos, o all he mo ie
nigh s, o all he smoo hies and wa m b e zels and humus and cheese and
cakes, o all he chocola es, o all he Mosca el, o all he men os, o all he
g umpy ca s, o all he ducks, o all he Muse conce s, o all he c azyyyy s u ,
o all he dinne s, o all he smiles! I was g ea o mee you all and spend so
many cool momen s wi h you! And always emembe : “Um u so osna quando
um galho caiu sob e sua cabeça, mas ele es a a sob o peso de uma á o e”. I
also would like o hank all he P edocs, specially he yea o 2011, o all he
g ea un, o he g ea communi y spi i and he g ea place o do science!
Un pe i salu a ous mes amis de Pa is, no ammen les kiiikiiiiissss qui son
oujou s lá – c’es oujou s beau la campagne e les singes e les pe i s pijamas –
( ous me manquez éllemen !), au Gomes lab qui m’a ellemen bien accep é
comme la pe i e é udian e de mas eu ! J’ai app is beaucoup a ec ous! Au pe i
B uno pou sa anquili é, ao meu i mão de labo a ó io núme o 1 Daniel Osó io e
ao Edga Gomes po me e lançado na minha p imei a in es igação “à sé ia” e
po con inua semp e disponí el pa a me a u a . E aussi a ous les au es (les
cousins e les Liwe an s) qui ne m’oublien pas e a ous mes amis E asmus!
Benno, Lana, Sammy, Ana Banana, Y onne, JP hanks o s ill being a ound!
5
Um ob igada mui o especial a odos os amigos que icam, mesmo que a
dis ância se ala gue! And eia Panada, Ana So ia, Ca ina Men, Sa a, Ma iana,
Melissa, Ma ga ida, B uno A onso, Daniel, Neuza, Ana Zhu, Diana po
con inua em aí, acon eça ou que acon ece ! Po que ocês são lindos e
con inuam bem pe inho!
Um mui o ob igada a oda a minha amília que não esquece de mim, embo a
a “pima” apanhe o a ião an as ezes e só ol e espo adicamen e. Ob igada
especialmen e ao Ruizinho que se p eocupa mesmo quando inge bem, e à
mãezinha que an o lhe cus a que a ilhinha es eja ão longe: um mui o ob igada
po odo o eu apoio e ca inho incondicional. Vou, mas ago- os comigo. Finally,
Kon adino: wha can I say? Thanks o all he help (wo k and li e ela ed). Thank
you o being he e, some imes mo e han 500 miles away, and o be he “man
who walks 500 mo e”.
Thank you. Me ci. Ob igada. You o su e make my li e mo e colo ul.
6
7
SUMMARY
“We a e d owning in in o ma ion, while s a ing o wisdom. The wo ld hence o h will
be un by syn hesize s, people able o pu oge he he igh in o ma ion a he igh
ime (...).”
– Edwa d O. Wilson
The cen osome is he majo o ganizing cen e in a cell, composed by wo
cen ioles, one mo he and one daugh e , and su ounded by a pe icen iola
ma e ial, which nuclea es mic o ubules. Cen iole duplica ion and seg ega ion is
igh ly coupled o cell cycle, which gua an ees ha cen iole numbe is main ained
o e gene a ions. Du ing he soma ic cell cycle, a pai o cen ioles duplica es,
a e which each daugh e cell ecei es a pai , o ming a closed cycle. Howe e ,
du ing e iliza ion, i bo h cells we e o con ibu e wi h hei pai o cen ioles,
game e usion would esul in he double o he no mal cen iole numbe .
The e o e, cen iole numbe needs o be educed du ing meiosis o p e en a
su plus in cen iole numbe ha would lead o o ma ion o a mul ipola spindle in
he zygo e. Indeed, wi hou excep ion, cen ioles a e ac i ely elimina ed in
oocy es o all animal species, and only he spe m con ibu es wi h ac i e
cen ioles o he zygo e. The uni e sali y o cen iole elimina ion in emale meiosis
demons a es he essen ial na u e o he p ocess in animals. None heless, i s
mechanisms emain poo ly unde s ood.
The iming o cen iole elimina ion a ies be ween species; i may occu ea ly
in p ophase I o meiosis o jus be o e e iliza ion. In s a ish oocy es (Pa i ia
minia a), cen ioles a e p esen in ully g own oocy es, and a e elimina ed du ing
he wo consecu i e meio ic di isions. I de eloped GFP ma ke s o speci ically
label and ollow cen ioles du ing s a ish meiosis by li e imaging in o de o
isualize when he elimina ion occu s. I obse ed ha a meiosis onse , wo pai s
o cen ioles a e p esen . One pai ou o hese is ex uded in o he i s pola
body a he end o meiosis I (MI), whe eas one pai emains in he oocy e. No
14

15
TABLE OF CONTENTS
“Às ezes ouço passa o en o; e só de ou i o en o passa , ale a pena e nascido”
(Some imes I hea he wind blowing; and jus by lis ening o i , i is wo h o be
bo n)
– Fe nando Pessoa
ACKNOWLEDGMENTS .................................................................................. 3
SUMMARY ....................................................................................................... 7
SUMÁRIO ....................................................................................................... 11
ABBREVIATIONS .......................................................................................... 23
1. INTRODUCTION ..................................................................................... 25
1.1. CENTROSOME ........................................................................................ 25
1.1.1. His o ical ou look: he disco e y o he cen osome ...................... 25
1.2. CENTROSOME FUNCTION ........................................................................ 26
1.2.1. The ancien unc ion o he cen osome/basal body migh ha e
been o ancho lagella and cilia .................................................................. 26
1.2.2. O he cen osome unc ions in me azoan ...................................... 28
i. Cen osome unc ion in spindle assembly ...................................... 28
ii. O he cen osomal unc ions .......................................................... 29
1.3. CENTROSOME STRUCTURE ..................................................................... 30
1.3.1. Cen iole – a well conse ed s uc u e ac oss euka yo es ............ 31
1.3.2. PCM - cons i u ion and o ma ion .................................................. 33
1.3.3. P o ein composi ion e lec s phylogene ic ela ionships be ween
euka yo es .................................................................................................... 34
1.4. CONTROL OF CENTRIOLE NUMBER DURING CELL DIVISION ........................ 36
1.4.1. Cell di ision and DNA duplica ion ................................................. 36
1.4.2. Cell di ision and cen iole duplica ion ........................................... 37
i. Cen iole duplica ion is semi-conse a i e and occu s once pe cell
cycle.. ....................................................................................................... 37
16
ii. Cen iole duplica ion: he onse and ca wheel o ma ion ............... 38
iii. Cen iole duplica ion: he cen iole g ow h ..................................... 40
i . Cen iole and DNA seg ega ion du ing mi osis .............................. 42
. Excep ions o he ule: cen iole numbe is no always conse ed . 43
1.5. CENTRIOLE AGE: THE DIFFERENCE BETWEEN MOTHER AND DAUGHTER
CENTRIOLE ......................................................................................................... 45
1.5.1. Mo he and daugh e cen iole ....................................................... 45
1.5.2. Cen iole ma u a ion – he p ocess ................................................ 46
1.5.3. The ole o mo he appendages in he ancho ing o he plasma
memb ane ..................................................................................................... 48
i. Ciliogenesis ..................................................................................... 48
ii. Mo he cen iole mo emen du ing T-cell ac i a ion ....................... 49
1.5.4. Di e en ial cen osome inhe i ance and asymme ic di ision ........ 50
1.6. CENTRIOLE ELIMINATION IN GAMETOGENESIS ........................................... 53
1.6.1. Meiosis o e iew ............................................................................ 54
1.6.2. Cen osome educ ion du ing spe ma ogenesis ............................ 55
i. Spe m cells con ain one pai o cen ioles wi h di e en deg ees o
degene a ion ............................................................................................. 56
ii. Spe m cells con ain one single cen iole wi h no degene a ion and a
p oximal cen iole-like ................................................................................ 57
iii. Spe m cells do no con ain cen ioles: comple e degene a ion ..... 57
1.6.3. Cen iole elimina ion du ing oogenesis .......................................... 58
i. Cen ioles a e elimina ed be o e p ophase I: spindle assembly is
acen iola ................................................................................................. 60
ii. One single pai o cen ioles is p esen a he beginning o meiosis:
he spe m cen iole in e enes .................................................................. 62
iii. Cen ioles a e elimina ed a he end o meiosis: spindle assembly is
cen iola ................................................................................................... 63
1.6.4. Scaling p oblems in oogenesis ...................................................... 63
i. Spindle posi ioning a he cell co ex ............................................... 63
ii. Spindle assembly ........................................................................... 66
1.7. CENTRIOLE ELIMINATION IN STARFISH OOCYTES ....................................... 68
1.7.1. O e iew o s a ish meiosis .......................................................... 68
17
1.7.2. S a ish oocy e as a model o s udy cen iole elimina ion using
molecula ma ke s and li e cell imaging ...................................................... 69
i. Cen iole elimina ion in o he model o ganisms .............................. 69
ii. Cen iole elimina ion in s a ish oocy es - wha is known so a ..... 70
iii. Cen iole elimina ion in s a ish oocy es – he s a ing hypo hesis 71
2. AIMS ........................................................................................................... 73
3. MATERIAL AND METHODS ..................................................................... 75
3.1. IDENTIFICATION OF HOMOLOGS OF CENTRIOLAR COMPONENTS IN STARFISH
......................................................................................................................... 75
3.2. FLUORESCENT MARKERS FOR LIVE IMAGING ............................................ 76
3.3. BIOLOGICAL MATERIAL ............................................................................ 77
3.3.1. Spe m and oocy e collec ion ......................................................... 77
3.3.2. Fe iliza ion .................................................................................... 78
3.4. OOCYTE INJECTION ................................................................................ 78
3.5. DRUG TREATMENT ................................................................................. 80
3.6. CONFOCAL MICROSCOPY AND GENERAL IMAGE PROCESSING ................... 80
3.7. IMAGE ANALYSIS AND PROCESSING ......................................................... 81
3.7.1. Valida ion o mo he and gene al cen iole ma ke s ...................... 82
i. Cen iole de ec ion .......................................................................... 82
ii. Quan i ica ion o o e lap be ween mo he and gene al cen iole
ma ke s ..................................................................................................... 82
3.7.2. Quan i ica ion o cen ioles ex uded in o pola bodies .................. 84
i. Vesicle au o luo escence sub ac ion om he Od 2-mEGFP
channel ..................................................................................................... 84
ii. Mo he cen iole ex usion – quan i ica ion .................................... 86
3.7.3. 3D acking o cen ioles ................................................................ 86
i. Cell ou line segmen a ion ............................................................... 86
ii. Cen iole acking o e ime and in 3D ........................................... 87
iii. Minimum dis ance be ween cen iole and plasma memb ane ...... 87
i . Plo ing minimum dis ances cen iole-cell ou line o e ime .......... 88
Calcula ion o cen iole anspo eloci y ......................................... 88
3.7.4. Cen i uga ion expe imen s ........................................................... 89
i. Cen iole mo emen quan i ica ion ................................................. 89
18
ii. Angle quan i ica ion ........................................................................ 90
3.7.5. MG-132 a es and quan i ica ion ................................................... 90
i. MG-132 a es in me aphase I ........................................................ 90
Cyclin B-mEGFP in ensi y quan i ica ion .......................................... 91
ii. MG-132 a es in me aphase II ....................................................... 91
3.7.6. Elec on mic oscopy ....................................................................... 92
i. High-p essu e eezing and se ial sec ioning o he en i e oocy e ... 92
Sample ixa ion ................................................................................. 92
Sample p epa a ion ........................................................................... 92
Sample isualiza ion: scanning o cen ioles and omog aphy ........ 93
ii. Chemical ixa ion and sec ioning a ound he PBI a ea ................... 93
Sample ixa ion ................................................................................. 93
Sample p epa a ion ........................................................................... 93
X- ay ................................................................................................. 94
Sample isualiza ion and omog aphy .............................................. 95
3.7.7. Mo pholinos agains mo he cen iole mRNA ................................. 95
i. Expe imen al de ails and image acquisi ion .................................... 96
ii. Quan i ica ion ................................................................................. 96
Acknowlegmen s: .............................................................................. 97
4. RESULTS .................................................................................................... 99
4.1. ESTABLISHMENT OF CENTRIOLE COMPOSITION AND LIVE CELL CENTRIOLAR
MARKERS IN STARFISH ........................................................................................ 99
4.1.1. Iden i ica ion o homologs o cen iola p o eins ............................. 99
4.1.2. Es ablishmen o cen iola ma ke s ............................................. 102
4.1.3. Li e cell cen iola ma ke s a e unc ional .................................... 104
4.2. STARFISH MEIOTIC SPINDLES ARE CENTRIOLAR ...................................... 107
4.2.1. Es ablishing li e cell imaging condi ions ...................................... 107
4.2.2. Li e imaging wi h gene al cen iole ma ke s ................................ 110
4.3. MOTHER CENTRIOLES ARE EXTRUDED INTO THE POLAR BODIES .............. 113
4.3.1. Each cen osome consis s o a mo he and a daugh e cen iole 113
4.3.2. The mo he cen iole is speci ically ex uded in o he second pola
body ............................................................................................................ 115
19
4.4. EXTRUSION OF THE MOTHER CENTRIOLES IS ESSENTIAL FOR CENTRIOLE
INACTIVATION .................................................................................................. 118
4.4.1. The single daugh e cen iole emaining in he egg does no
con ibu e o he zygo ic spindle ................................................................. 118
4.4.2. Mo he cen ioles a i icially e ained in he egg, emain ac i e and
con ibu e o he zygo ic spindle ................................................................. 120
4.5. THE MOTHER CENTRIOLE IS SPECIFICALLY TRANSPORTED TO THE PLASMA
MEMBRANE ...................................................................................................... 124
4.5.1. T acking o he mo he cen iole e eals a wo-s ep p ocess ...... 124
4.5.2. Cha ac e iza ion o he mo he cen iole speci ic anspo
mechanism ................................................................................................. 127
i. Is he mo he cen iole speci ic anspo d i en by mic o ubules? 128
ii. Is he mo he cen iole anspo d i en by ac in? ........................ 129
iii. Is he mo he cen iole anspo dependen on he pola body I
cy okinesis? ............................................................................................ 131
Mo he cen iole anspo is independen o pola body cy okinesis
............................................................................................................ 133
i . Mo he cen iole anspo equi es p oximi y o he nucleus ...... 135
4.6. THE MOTHER CENTRIOLE ANCHORS TO THE PLASMA MEMBRANE ............ 138
4.6.1. Ac in and mic o ubules a e no in ol ed in cen iole ancho ing .. 138
i. Es ablishing he condi ions o a es oocy es in MII ...................... 138
ii. Mo he cen iole ancho ing is independen o mic o ubules ........ 141
iii. Mo he cen iole ancho ing is independen o dynamic ac in ...... 143
4.6.2. A e he appendages connec ing he mo he cen iole o he plasma
memb ane? ................................................................................................ 145
i. Visualiza ion o cen iole ancho ing by elec on mic oscopy ........ 145
ii. Pe u bing mo he appendages: an app oach o unde s and
cen iole ancho ing ................................................................................. 149
Acknowledgemen s: ....................................................................... 152
5. DISCUSSION ........................................................................................... 153
5.1. CENTROSOMES – AN EVERGREEN TOPIC FOR CELL BIOLOGY .................. 153
5.2. CENTRIOLE ELIMINATION AS A MECHANISM TO CONTROL CENTRIOLE NUMBER
....................................................................................................................... 154

20
5.3. THE MECHANISM OF CENTRIOLE ELIMINATION IN STARFISH OOCYTES ....... 155
5.3.1. S a ing hypo hesis ....................................................................... 155
5.3.2. Molecula cha ac e iza ion o cen iola p o eins in s a ish ......... 156
5.3.3. Li e-imaging wi h cen iole molecula ma ke s ............................ 157
5.3.4. A mechanism o cen iole elimina ion in s a ish oocy es ............ 158
i. The mo he cen iole is speci ically anspo ed o he cell co ex . 159
Mo he cen iole anspo is possibly dependen o a cy oplasmic
g adien es ablished upon nuclea en elope b eakdown ..................... 161
ii. The mo he cen iole is ancho ed o he cell co ex ...................... 162
iii. Fu u e di ec ions: he mo he cen iole is di ec ly ancho ed o he
plasma memb ane h ough mo he appendages .................................... 164
5.3.5. Hypo hesis: why only he mo he cen iole can mo e and ancho ?
.................................................................................................................... 165
i. Fu u e di ec ions: how o e idence he pa allels o mo he cen iole
anspo be ween s a ish oocy es and cilia ed cells? ............................ 167
ii. Fu u e di ec ions: how o e idence he pa allels o mo he cen iole
ancho ing be ween s a ish oocy es, T-cells and cilia ed cells? .............. 168
5.3.6. Hypo hesis: how is he daugh e cen iole inac i a ed a he end o
meiosis? ...................................................................................................... 168
i. How does he daugh e cen iole lose i s mic o ubule nuclea ing
ac i i y? ................................................................................................... 170
ii. A e he e ologous daugh e cen ioles equally inac i a ed a he end
o meiosis? .............................................................................................. 171
5.3.7. A hypo he ical model o he molecula mechanism o cen iole
elimina ion in s a ish oocy es ..................................................................... 173
5.3.8. A gene al hypo hesis: how o elimina e cen ioles du ing emale
meiosis in animals ...................................................................................... 174
5.4. HYPOTHESIS: IMPORTANCE OF THE CENTROSOME DURING MEIOSIS ......... 176
5.4.1. Does an acen iola s. cen iola spindle co ela e wi h an in e nal
s. ex e nal oocy e ma u a ion? .................................................................. 176
5.5. HYPOTHESIS: A PREFERENTIAL INHERITANCE OF CENTROSOMES – LESSONS
FOR STEM CELLS .............................................................................................. 178
6. APPENDIX ................................................................................................ 181
21
6.1. HOMOLOGS FOR CENTRIOLAR PROTEINS IN DIFFERENT ORGANISMS ....... 181
6.2. SUMMARY TABLE FOR CATEGORIES ....................................................... 182
6.3. PROTEIN ALIGNMENT ............................................................................ 182
6.3.1. Cen in-2 ...................................................................................... 182
6.3.2. Poc1 ............................................................................................ 183
6.3.3. Od 2 ............................................................................................. 184
6.3.4. Chibby ......................................................................................... 185
6.4. CHIBBY LOCALIZATION IN MII ................................................................ 186
REFERENCES ............................................................................................. 187
22
23
ABBREVIATIONS
“Ne e memo ize some hing ha you can look up.”
– Albe Eins ein
1-MA: 1-me hyladenine
Cy oD: cy ochalasin D
EM: elec on mic oscopy
La B: La unculin B
MI: meiosis I
MII: meiosis II
mGSC: male ge m s em cell
MTOC: mic o ubule o ganizing cen e
NEBD: nuclea en elope b eakdown
PB/PBs: pola body/pola bodies
PBI: i s pola body
PBII: second pola body
PCM: pe icen iola ma e ial
γ-TuRC: γ- ubulin ing complex
30
ac i a ion ha e been desc ibed o mul iple sys ems (Debec e al., 2010; Doxsey,
2001; Piel e al., 2001). Mo eo e , cen osomes ha e a conse ed ole ( om
mammals o yeas ) in spindle posi ioning: hey nuclea e as al mic o ubules,
which a e essen ial o co ec ly posi ion he mi o ic spindle (see ig. 1.3) (Doxsey,
2001).
Impo an ly, du ing in e phase, he cen osome is he majo MTOC (see ig.
1.3). I is ac i ely posi ioned a he cen e o he cell, and c ea es a mic o ubule
cy oskele on ha de ines he “cell’s coo dina e sys em” o cell pola i y and
esicle a icking. Mo eo e , his ac i e posi ioning de ines he localiza ion o
o he o ganelles, as he nucleus and he Golgi, o which he cen osome is
a ached (Bo nens, 2012).
1.3. Cen osome s uc u e
As men ioned p e iously, a cen osome is composed o wo o hogonally
a anged cen ioles, su ounded by a mic o ubule-nuclea ing ma ix, he PCM ( ig.
1.4).
Nex , I will p o ide a de ailed desc ip ion o each o hese componen s. In his
sec ion, I will ocus on he cen iole s uc u e and b ie ly discuss he o ma ion o
he PCM. A desc ip ion o duplica ion and cen iole assembly will be p o ided in
la e sec ions. I will also men ion how cen iole s uc u e and molecula
Figu e 1.4: A cen osome is o med by wo cen ioles (one mo he and one daugh e cen iole),
su ounded by PCM. Only he mo he cen iole has wo cha ac e is ic se s o appendages
(dis al and subdis al).

31
composi ion a e so well conse ed among o ganisms, and how his can p o ide
insigh s in o he e olu ion o his o ganelle.
1.3.1. Cen iole – a well conse ed s uc u e
ac oss euka yo es
In he ea ly 1950s, wi h he ad en o elec on mic oscopy (EM), he i s
cen iole ul as uc u es exposed he hidden complexi y o he cen iole. In one o
hese pionee ing s udies, Ha en and Be hna d showed beau i ul ans e sal and
longi udinal sec ions o cen ioles in di e en cells, e ealing he well-conse ed
9- old symme y o he cen ioles and he pa allel “ ubules” ha compose his
hollow cylinde (Ha en and Be nha d, 1956). Today i is well es ablished ha a
cen osome has wo cen ioles, o hogonally a anged. The canonical cen iole
has 9- iple s o mic o ubules, which de e mine i s symme y, a diame e o 250
nm and a leng h ha spans om 150 o 500 nm, depending on he cell ype ( ig.
1.5) ((Winey and O’Toole, 2014). Un ela ed species such as mammals,
pa amecia, e ahymena and clamydomona ha e mic o ubule iple s (Ca alho-
San os e al., 2010). Howe e , he e a e excep ions o his ule: D. melanogas e
and C. elegans ea u e mic o ubule double s and single s, espec i ely ( ig. 1.5).
Cu iously, D. melanogas e spe m cells ha e iple s (Azimzadeh and Ma shall,
2010; Winey and O’Toole, 2014).
Figu e 1.5: Each cen iole ha composes a cen osome is o med by 9- iple s o mic o ubules
a anged in a cylind ical shape. Mo he and daugh e cen ioles a e ep esen ed – mo he
cen iole has wo se s o appendages. Each mic o ubule iple is o med by A-, B-, C- ubules.
The canonical cen iole has 9 iple s o mic o ubules (as in he human cen iole), bu excep ions
exis : D. melanogas e has 9 double s, and C. elegans 9 single mic o ubules. Scale ba : 100
nm. Pic u es adap ed om (B i o, e al. 2012) – schema ic, and (Winey and O’Toole, 2014) –
EM pic u es.
32
One cen osome has wo di e en cen ioles: one mo he and one daugh e
( ig. 1.4 and 1.5). The mo he cen iole has wo cha ac e is ic se s o
appendages, dis al and subdis al, which deco a e one o i s ends ( ig. 1.4 and
1.5). The dis al appendages a e in ol ed in ciliogenesis (see sec ion 1.5) and
a e he e o e conse ed ac oss euka yo es. In con as , he subdis al
appendages a e a new s uc u e ha only appea ed in e eb a es. These
appendages a e in ol ed in mic o ubule ancho ing du ing in e phase and hey
con ol basal body o ien a ion du ing ciliogenesis. Simila s uc u es, he basal
ee , seem o ake hei unc ion in o he me azoans (Azimzadeh, 2014).
S udies using di e en me hodologies (immunogold labeling, supe - esolu ion
mic oscopy, immuno luo escence s udies) mapped he localiza ion o cen iola
p o eins wi hin he cen iole (B i o e al., 2012). These s udies e y clea ly show
ha mo he and daugh e cen ioles a e di e en in e ms o p o ein composi ion
( ig. 1.6). Mo eo e , p o ein localiza ion is conse ed among species, wi h
mul iple homologs localizing consis en ly in mul iple species. Fo simplici y, I will
use he names o he human p o eins o he es o my hesis, bu he equi alen
homologs can be ound in se e al di e en s udies as (B i o e al., 2012) (see
Appendix sec ion 6.1).
Figu e 1.6: Ul as uc u al localiza ion o human cen iola ma ke s in a ully ma u e
cen osome. "(a) Elec on mic og aph o a longi udinal sec ion o a cen osome isola ed om
human lymphoblas oma cells (KE37 cell line). (b) Schema ic ep esen a ion o he pic u e
shown in (a). Se e al p o eins a e mo he speci ic and compose he mo he appendages
(Cep164, Cep170, e- ubulin, EB1, Ki 24, Ninein and Od 2). Con e sely, Sas6 (in e eb a e
cells) and Cen obin only localize o he daugh e cen iole. Figu e and legend adap ed om
(B i o e al., 2012).
33
1.3.2. PCM - cons i u ion and o ma ion
As men ioned abo e, a cen osome has wo cen ioles, which a e su ounded
by PCM. Bo e i was he i s o obse e he PCM, and also he i s o co ec ly
cha ac e ize i s main unc ion. Indeed, he PCM wo ks as he “cen oplasm”, om
whe e he mic o ubules a e nuclea ed ( e iewed by Schee , 2014). Gould and
Bo isy expe imen ally showed o he i s ime how isola ed PCM can nuclea e
mic o ubules in i o (Gould and Bo isy, 1977).
Ini ially, PCM was me ely desc ibed as an amo phous elec on-dense cloud
a ound he cen ioles ha would expand in size du ing mi osis. Nowadays, he
PCM componen s s a o be be e known and desc ibed, and ad ances in
supe - esolu ion mic oscopy e ealed he cu ious PCM o ganiza ion (Fu and
Glo e , 2012; Lawo e al., 2012; Mennella e al., 2012; Sonnen e al., 2012).
Du ing in e phase, he PCM is o ganized in well-de ined concen ic laye s o
p o eins (as CEP192, CDK5RAP2, γ - ubulin) a ound he cen ioles, which
cons i u es he PCM ma ix ( ig. 1.7). In his case, γ- ubulin, wi h a mic o ubule
Figu e 1.7: PCM o ganizes a ound he cen ioles. The PCM is o ganized in wo majo laye s:
PCM ibe s and PCM ma ix (he e ep esen ed sepa a ely o help isualiza ion). PCM ibe s
comp ise he elonga ed coiled-coil p o eins pe icen in/pe icen in-like p o ein (PLP) and
Cep152/Asl. PCM ma ix con ains: Cep192, CDK5RAP2,
γ - ubulin. Pic u e modi ied om
(Mennella e al., 2014).
34
nuclea ing unc ion, localizes in he ou e laye s. Pe icen in and CEP152
cons i u e he PCM ibe s and do no ollow his concen ic o ganiza ion, bu a
mo e ibe -like o ganiza ion ( ig. 1.7) (Lawo e al., 2012; Mennella e al., 2012,
2014). Pe icen in appea s o be a he op o he cascade ha leads o PCM
assembly, ec ui ing CDK5RAP2 and γ- ubulin (Mennella e al., 2014).
Upon en y in o mi osis, mo e PCM componen s a e ec ui ed, expanding he
PCM “cloud”. Cell cycle kinases, such as PLK1 and Au o a-A, ha e a ole in PCM
expansion. PLK1 phospho yla es PCM componen s, such as Pe icen in, leading
o he accumula ion o mo e PCM componen s. Au o a-A ac s mo e downs eam
adding mic o ubule-associa ed p o eins o he s uc u e. As phospho yla ion leads
o a PCM ex ension du ing mi osis, dephospho yla ion o i s componen s, in
e e se, causes PCM dissolu ion a he end o mi osis (Mennella e al., 2014;
Wood u e al., 2014). Hence, he PCM assembly/disassembly is linked o he
cell cycle, ac ing as he majo ac o o coo dina e mic o ubule assembly.
1.3.3. P o ein composi ion e lec s phylogene ic
ela ionships be ween euka yo es
As men ion be o e (see sec ion 1.2.), i is likely ha he cen osome i s
eme ged in e olu ion as a basal body, he cilia pla o m, whe eas i s MTOC
unc ion is likely o be a unc ion acqui ed subsequen ly. Rema kably, cen iole
composi ion suppo s his idea, wi h a cha ac e is ic se o ances al p o eins,
appea ing in all species ha o m cilia a any poin o hei li e ( ig. 1.8). This co e
o p o eins is conse ed a leas in ou majo euka yo ic g oups: plan ae
(including species as Clamydomonas einha d ii and Physcomi ella pa ens, a
ype o moss), exca a a (T ypanossoma b ucei, Naegle ia g ube i),
ch omal eola a (Pa amecium e au elia, Te ahymena e mophila) and holozoa
(including D osophila melanogas e , Caeno habdi is elegans and e eb a es)
( ig. 1.8). A single species om he Fungi g oup, B. denb oba idis also con ains
his se o ances al p o eins – ig. 1.8 (Ca alho-San os e al., 2011; Hodges e
al., 2010).
35
Among hese ances al se , se e al p o eins (such as SAS6, SAS4, CEP135
and CEP164) a e in ol ed in he cen iola 9- old symme y, mic o ubule
assembly and appendage o ma ion, which sugges s ha hese p o eins eme ged
Figu e 1.8: Dis ibu ion o cen iola and cen osomal p o eins among euka yo es. P o ein
homologs we e iden i ied o 45 euka yo es (29 cilia ed species (whi e) and 16 non-cilia ed
species (g ey)). (+) Indica es p esence o homologs. “Co e” p o eins a e conse ed ances al
cen iola p o eins. “Cen osomal” p o eins a e associa ed wi h cen osomal unc ions. “Pole”
p o eins migh ha e ul illed a unc ion in he ances al spindle pole. “Con ols” a e p o eins ha
a e associa ed wi h gene al mic o ubule dynamics. “Ances al” p o eins a e p esen among
ex an euka yo es. “Holozoan” p o eins ha e a es ic ed p esence in holozoa (Me azoa and M.
b e icollis). The as e isk indica es sequence d i o co e and cen osomal p o eins in C.
elegans; di e gen homologs known in he li e a u e bu no iden i ied by hei app oach a e
highligh ed wi h a pink bo de . Pic u e and legend adap ed om (Hodges e al., 2010).

36
ea ly in he euka yo es and es ablished he cen iola s uc u e (Ca alho-San os
e al., 2011; Hodges e al., 2010).
In holozoa, in which cen ioles addi ionally se e as MTOCs, one can
addi ionally ind speci ic p o eins associa ed wi h PCM assembly and mic o ubule
nuclea ion, he holozoa se ( ig. 1.8). This se includes p o eins associa ed wi h
PCM assembly and mic o ubule nuclea ion, as CEP192/Spd-2 (Azimzadeh,
2014; Ca alho-San os e al., 2010; Hodges e al., 2010). The e o e he
appea ance o his g oup o p o eins likely con ibu ed o he “dual li e” o he
cen osome. In e es ingly, PLK4, he mas e ini ia o o cen iole duplica ion,
appea s also o be es ic ed o he holozoa g oup, while o he PLK amily
membe s, such as PLK1, a e iden i ied in many o he g oups o he ee o li e.
This sugges s ha PLK4 possibly had i s o igin in he duplica ion o a PLK1-like
ances o , which became specialized in cen iole duplica ion in he holozoa g oup
(Ca alho-San os e al., 2010).
In summa y, cen osomes/basal bodies a e highly conse ed s uc u es wi h a
conse ed p o ein composi ion. This p o ein composi ion is consis en wi h he
phylogene ic ela ionships es ablished among o ganisms, which likely indica es
ha a cen iola s uc u e was al eady p esen in hei common ances o . The
s udy o molecula composi ion also allows in e ing i s ances al and newly
acqui ed unc ions du ing he e olu iona y pa hway.
1.4. Con ol o cen iole numbe du ing cell
di ision
1.4.1. Cell di ision and DNA duplica ion
Cell di ision is he basis o cell con inui y: cells duplica e and ansmi hei
gene ic in o ma ion o he nex gene a ion. In unicellula o ganisms, cell di ision
is ep oduc ion; in mul icellula o ganisms, cell di ision p oduces complexi y, in
which each cell is specialized o a speci ic ask.
37
The e a e wo ypes o cell di isions: o mul iply hei numbe , cells ollow he
mi o ic p ocess; o o m game es, and o educe hei ch omosome con en , cells
ollow he meio ic p ocess (see sec ion 1.6.1).
Bo h p ocesses a e p eceded by an in e phase ha p epa es he cell o
di ision, and comp ises h ee dis inc i e phases: G1, S and G2. Du ing G1, he
cell g ows in size, syn hesizes mul iple RNAs and p o eins ha a e necessa y o
he ollowing cell di ision. DNA duplica ion occu s du ing S-phase. DNA
duplica ion is semiconse a i e, i.e. he pa en al DNA s ands a e used as a
empla e o he syn hesis o he new DNA s and. DNA has o be licensed a he
end o he p e ious di ision cycle, by p e- eplica i e complexes, which localize a
he egions o eplica ion o igin, and allows he s and o be duplica ed. These
complexes a e displaced when duplica ion s a s, which u ns he DNA o an
unlicensed s a e un il he nex cell cycle (Nishi ani and Lyge ou, 2002). This
assu es ha DNA is only duplica ed once pe cell cycle, and gua an ees
main enance o genomic con en in he long e m (Lodish, 2008). A las , he inal
p epa a ions o cell di ision a e made du ing G2-phase. A e his, a cell en e s
ei he mi o ic o meio ic di ision.
1.4.2. Cell di ision and cen iole duplica ion
i. Cen iole+duplica ion+is+semi7conse a i e+and+occu s+once+
pe +cell+cycle+
Al hough Bo e i al eady desc ibed he cen iole as an o ganelle able o
duplica e, his duplica ion was i s desc ibed mo phologically using EM
(Kochanski and Bo isy, 1990; Robbins e al., 1968; Vo obje and YuS, 1982).
B ie ly, he pai o cen ioles en e s a new cell di ision (G1) in a disengaged
posi ion, i.e. cen ioles a e s ill connec ed, bu no longe in he o hogonal
posi ion. Du ing S-phase, each p e-exis ing cen iole duplica es, by “g owing” a
new cen iole, called he “p o-cen iole”, in an o hogonal posi ion, e-es ablishing
he cha ac e is ic o ien a ion. P o-cen ioles hen elonga e du ing G2 un il
p ome aphase.
The cen iole duplica ion esembles DNA duplica ion in ou ways: i) i occu s
du ing S-phase, ii) cen iole duplica ion is semiconse a i e – he p e-exis ing
38
cen ioles a e no des oyed, bu a e ins ead used as a pla o m o he eme ging
cen iole (Kochanski and Bo isy, 1990). Then, iii) only licensed cen ioles can
duplica e. Cen ioles a e licensed du ing mi osis by PLK1 modi ica ion (Wang e
al., 2011) and by disengagemen h ough sepa ase and also p omo ed by
PLK1(Tsou and S ea ns, 2006; Tsou e al., 2009). Finally, i ) a single si e o
o igin ensu es ha cen ioles can duplica e only once pe cell cycle (concep
adap ed om Fı a -Ka ala and S ea ns, 2014). I is no ye unde s ood how a
single si e o o igin o cen iole duplica ion is assigned. Howe e , i is known ha
he le els o PLK4, he main egula o o cen iole duplica ion, a e igh ly
egula ed du ing he cell cycle, which is essen ial o a oid cen iole o e -
duplica ion (Fı a -Ka ala and S ea ns, 2014). O he p o eins, as SAS-6 and STIL,
also s imula e cen iole o e -duplica ion and a e he e o e also igh ly egula ed
(Azimzadeh and Ma shall, 2010; Fı a -Ka ala and S ea ns, 2014).
All his hen assu es ha , simila o DNA, cen ioles a e duplica ed only once
pe cell cycle, main aining cen iole numbe o e gene a ions. Mo eo e , a he
beginning o a new cell di ision only he p e-exis ing cen ioles, he mo he
cen ioles, a e licensed and he e o e only hese wo can duplica e. The new
cen ioles, p o-cen ioles o daugh e cen ioles, a e blocked o duplica ion,
because hey a e no ye licensed.
In he nex sec ion, I will p o ide mo e de ails abou he mechanism o
cen iole duplica ion, including he o ma ion o he ca wheel ( he base ha
con e s he cen iole i s 9- old symme y), and how mic o ubules a e hen
posi ioned a ound his ca wheel, and cen ioles a e elonga ed.
ii. Cen iole+duplica ion:+ he+onse +and+ca wheel+ o ma ion++
A he beginning o a new cell cycle, a pai o disengaged cen ioles s a s i s
duplica ion du ing la e G1/S-phase. In e es ingly, a co e o only i e p o eins,
iden i ied in C. elegans, is essen ial o cen iole duplica ion: ZYG-1, SPD-2, SAS-
4, SAS-5 and SAS-6 (i.e. homologs o he co esponding human p o eins: PLK4,
CEP192, CPAP/CENJ, STIL, hSAS-6). While his co e o i e p o eins is su icien
o cen iole duplica ion in C. elegans, in D. melanogas e and human o he
ac o s a e also essen ial – o example As e less in he case o D. melanogas e ,
39
and CEP152 and CEP135 in he case o human (Azimzadeh and Ma shall, 2010;
Hi ono, 2014; Nigg and Ra , 2009; S nad and Gönczy, 2008).
Cen iole duplica ion s a s wi h he ec ui men o PLK4 o he o igin si e, by
CEP152 and CEP192, which hen ec ui s SAS-6 (Fı a -Ka ala and S ea ns,
2014). Le man MM. and colleagues desc ibed, ha a leas in C. elegans, he
ec ui men o SAS-6 would occu by di ec in e ac ion wi h he C. elegans PLK4
(ZYG-1) ( ig. 1.9) (Le man e al., 2013).
The i s mo phological ma k o a nascen daugh e cen iole is he p esence o
a ca wheel, o med by a cen al hub om which nine spokes adia e ( ig. 1.9,
1.10 and 1.11). The ca wheel is e olu iona ily conse ed among euka yo es and
Figu e 1.9: Model o he cen iole duplica ion cycle o a human cen iole. B ie ly, (a) cen iole
assembly is igge ed by Plk4, Cep152 and Cep135. (b) Ca wheel assembly by SAS6. (c)
Cen iole elonga ion s a s, mic o ubules assemble a ound he ca wheel d) Daugh e cen iole
elonga ion is comple ed. Cen osome sepa a ion, which allows he assembly o a bipola
spindle in mi osis, akes place in la e G2-phase. (e) Du ing mi osis, cen ioles disengage and
lose hei o hogonal con igu a ion, a p ocess media ed by Plk1 and sepa ase. ( ) The daugh e
cen iole is now a mo he , upon ull ma u a ion. Cen iole duplica ion and cell cycle s ages a e
indica ed a he op and bo om o he image, espec i ely. Key molecules a e shown. P o eins
ep esen ed in black indica e empo al and spa ial localiza ion du ing cen iole assembly;
p o eins ep esen ed in ed indica e momen o hei displacemen om he daugh e cen iole;
p o eins ep esen ed in g een o o ange indica e inc easing o dec easing le els a he daugh e
cen iole, espec i ely. Pic u e and legend adap ed om (B i o e al., 2012).
46
(Pain and e al., 1992; Vo obje and YuS, 1982).
Two se s o mo he appendages, dis al and sub-dis al ( ig. 1.14 inse 1 and 2,
espec i ely), can be obse ed a he dis al side o a mo he cen iole, ollowing
he conse ed cen iole 9- old symme y. Howe e , dis al and subdis al
appendages ca y ou di e en unc ions. The dis al appendages a e essen ial
du ing ciliogenesis and hey media e he cen iole ancho ing o he plasma
memb ane. The sub-dis al appendages ancho mic o ubules du ing in e phase
and a e impo an o cell pola i y. The di e en unc ionali y e lec s he ype o
p o eins ha accumula e in each se o appendages. Sub-dis al appendages
accumula e mic o ubule-associa ed p o eins as Ninein, CEP170 and ε- ubulin,
while dis al appendages accumula e p o eins such as CEP164 and Od 2 (see
p o ein localiza ion in ig. 1.6, sec ion 1.3.1) (Fu e al., 2015; Jana e al., 2014;
Ta eishi e al., 2013; Winey and O’Toole, 2014). Od 2 is one o he ew p o eins
known o localize o bo h se o appendages and o be necessa y o ancho ing o
he plasma memb ane du ing ciliogenesis (Ishikawa e al., 2005).
1.5.2. Cen iole ma u a ion – he p ocess
A he s a o a new cell cycle (G1), he daugh e cen iole is now licensed
o duplica e, and e en ually become a mo he cen iole. One could say ha he
cen iole pai is now o med by a “g andmo he ”, which was al eady a mo he in a
p e ious cycle, and a “new” mo he , which is now licensed o duplica e o he
i s ime ( ig. 1.15). Thus, he now licensed cen iole goes h ough ma u a ion,
which in ol es he acquisi ion o PCM and mo he appendages (B i o e al., 2012;
Kong e al., 2014; Winey and O’Toole, 2014).
By he end o he ollowing mi osis, he wo mo he s (g andmo he and new
mo he ) ha e appendages, and each one o hem also has a daugh e ha
o med in S-phase. In o he wo ds, h ee gene a ions o cen ioles a e p esen in
he same cell, in a egula soma ic cell di ision cycle ( ig. 1.15). No e how he
o ma ion and elonga ion o a new cen iole equi e only one cell cycle, whe eas
i s ma u a ion in o a new mo he only occu s du ing he ollowing cell cycle.

47
The exac ime o appendage assembly is likely o be dependen on he cell
ype (Kong e al., 2014). S ill, PLK1 ac i i y appea s o be equi ed h oughou S
and G2 o he cen iole’s second cell cycle, and is essen ial o appendage
o ma ion in he new mo he (Kong e al., 2014).
Fi s , appendage p o eins s a o accumula e a he dis al pa o he
cen ioles, and hen e en ually become appendage s uc u es (Kong e al., 2014;
Lange and Gull, 1995). Se e al s udies show ha p o ein accumula ion a he
mo he appendages occu s in a hie a chical way (Ibi e al., 2011; Tanos e al.,
2013; Ta eishi e al., 2013). Od 2 accumula ion in he new mo he s a s a G2/M
ansi ion (Kong e al., 2014; Lange and Gull, 1995) and in ac , Od 2 appea s o
be one o he mos ups eam componen s in he appendage assembly cascade.
Consis en ly, i s deple ion comple ely elimina es he o ma ion o ei he dis al o
subdis al mo he appendages (Ishikawa e al., 2005). How Od 2 is ec ui ed o
he new mo he cen iole is unknown, bu he p o ein 4.1R is likely in ol ed, as
upon deple ion, Od 2 localiza ion o he cen iole is pe u bed (K auss e al.,
2008). Od 2 is hen equi ed o he p ope ec ui men o se e al o he
appendage p o eins as Ninein and CEP164 (Ibi e al., 2011; Ta eishi e al., 2013).
Figu e 1.15: The e a e h ee gene a ions o cen ioles in a di iding cell. A G1, a disengaged
cen iole pai has a ecen ly licensed “new” mo he cen iole and a “g andmo he ” cen iole.
Du ing S-phase, his pai duplica es, and a new daugh e cen iole o ms in an o hogonal
posi ion. The cen osome o med by he “new” mo he and a daugh e cen iole is called he
“younge ” cen osome, whe eas he “olde ” cen osome, con ains he g andmo he and a
daugh e cen ioles.
48
As a consequence o he molecula changes ou lined abo e, he cen ioles
need a leas 1.5 cycles o become a unc ional mo he . A daugh e cen iole,
which jus duplica ed, canno become a mo he (Hoye -Fende , 2010; Kong e al.,
2014; Vo obje and YuS, 1982), possibly because i needs o disengage i s
(Kong e al., 2014; Wang e al., 2011).
1.5.3. The ole o mo he appendages in he
ancho ing o he plasma memb ane
The dis al mo he appendages media e he di ec ancho ing o he plasma
memb ane du ing ciliogenesis. Howe e , ecen ly ano he example o a di ec
ancho ing o he plasma memb ane media ed by appendages was desc ibed
du ing T-cell ac i a ion. I will desc ibe he wo p ocesses in he ollowing sec ions.
i. Ciliogenesis++
The mo he cen iole is equi ed o cilia/ lagella o ma ion: i binds o he
plasma memb ane di ec ly h ough he mo he dis al appendages, and once
ancho ed, he mo he cen iole becomes a basal body, i.e. he pla o m om
which cilia o lagella a e o med. Cilia and lagella ollow he same 9-symme y
as he mo he cen iole base, bu ins ead ha e mic o ubule double s. Mo ile
cilia/ lagella ha e no mally a mic o ubule double in he cen e , which is no
no mally p esen when cilia a e non-mo ile (Rei e e al., 2012).
In o de o become a cilia/ lagella base, he mo he cen iole i s has o
mig a e o he plasma memb ane, whe e i hen ancho s. De ails o his p ocess
a e no en i ely clea , bu esicula a icking appea s o be in ol ed. Indeed, one
o he cu en models o ciliogenesis assumes ha esicles dock o he dis al
appendages o mo he cen iole, while his is s ill loca ed in he cy oplasm ( ig.
1.16) (So okin, 1962, 1968; Sung and Le oux, 2013). The mo he dis al
appendage p o eins Od 2 and CEP164 a e esponsible o he in e ac ion wi h
Rab11 and Rab8 esicles, espec i ely (Hehnly e al., 2012; Schmid e al.,
2012). Mo e ecen ly, Chibby was ound o be in ol ed in media ing he
in e ac ion be ween CEP164 and he Rab8 esicles (Bu ke e al., 2014).
Subsequen ly, he esicles s a o use wi h each o he , o ming a la ge esicle,
49
called he cilia y esicle, a he dis al end o he mo he cen iole. Then, he
mo he cen iole is anspo ed o he plasma memb ane along he esicle
anspo pa hway, whe e i ancho s upon cilia y esicle usion wi h he plasma
memb ane ( ig. 1.16) (Rei e e al., 2012; Sung and Le oux, 2013).
How he mo he cen iole is anspo ed o he plasma memb ane is an
unsol ed ques ion, bu elemen s o he cy oskele on a e likely in ol ed. The
p ocess is bes desc ibed in mul icilia ed cells. Fo example, in mul icilia ed
o iduc s, de ec s in he cen iole ancho ing a e obse ed upon depolyme iza ion
o ac in, while mic o ubule depolyme iza ion has no e ec (Bois ieux-Ul ich e al.,
1989, 1990; Dawe e al., 2007). I has been shown ha he apical su ace o
mul icilia ed Xenopus emb yonic cells a e en iched wi h a dense meshwo k o
ac in, which con ibu es o basal body spacing and docking, and coo dina ion o
cilia bea ing (An oniades e al., 2014; We ne e al., 2011). Cy oplasmic
mic o ubules also con ibu e o his p ocess, by o ming a ne wo k ha pola izes
locally he basal bodies (We ne e al., 2011).
ii. Mo he +cen iole+mo emen +du ing+T7cell+ac i a ion+
Cy oly ic immune cells such as cy o oxic T-lymphocy es kill in ec ed cells by
eleasing ly ic enzymes, which hen induce apop osis. Upon con ac wi h he
Figu e 1.16: Model o ciliogenesis. (1) Mo he cen iole associa es wi h Rab11 esicles, which
bind o he dis al appendages. (2) and (3) Rab8 esicles associa ed wi h he p e ious esicles,
o ming he cilia ly esicle. The mo he cen iole is anspo ed o he plasma memb ane,
hi chhiking he sec e o y pa hway. A p o-axoneme migh s a o ex end while s ill inside he cell.
(4) Vesicles use wi h he plasma memb ane, and mo he cen iole emains ancho ed di ec ly
ia i s mo he appendages. Cilium ully ex ends. Figu e and legend modi ied om (Sung and
Le oux, 2013)
50
a ge cell, an immunological synapse o ms, and he T-cell unde goes
pola iza ion and e-o ganiza ion o i s mic o ubule cy oskele on ( ig. 1.17). This
e-o ganiza ion is accomplished by cen osome mig a ion o he cen e o he
immunological synapse. Cy oly ic g anules hen mo e in a mic o ubule-minus-
end di ec ed mo ion owa ds he con ac si e, and a e deli e ed o he a ge cell
( ig.1.17) (S inchcombe e al., 2006, 2011). Mic o ubules and ac in likely play a
ole in cen osome mo emen o he plasma memb ane, media ed by dynein and
o min espec i ely (S inchcombe and G i i hs, 2014).
Cen osome mo emen and associa ion wi h he plasma memb ane a e e y
simila o cilia o ma ion. Indeed, ecen ly S inchcombe and colleagues iden i ied
ha in his case mo he cen iole connec s o he plasma memb ane h ough he
mo he appendages (pe sonal communica ion).
1.5.4. Di e en ial cen osome inhe i ance and
asymme ic di ision
As men ioned (see sec ion 1.5.2), h ee gene a ions o cen ioles co-exis in a
soma ic cell. Du ing me aphase, a one pole he e is he olde cen osome
(which con ains he “g andmo he ” cen iole and i s daugh e ), and a he o he
pole he younge cen osome (which con ains he “new” mo he and i s daugh e )
Figu e 1.17: Cen osome pola iza ion in T-cells, a e in e ac ion wi h a ge . Cen osome is
shown in ed, T-cell in blue, and a ge cell in ligh b own. (i) When a T-cell mee s i s a ge , he
T-cell’s cen osome mo es owa ds he con ac si e. The mic o ubule ne wo k (black lines),
including mic o ubule-associa ed o ganelles, such as sec e o y esicles (yellow) and cy oly ic
sec e o y g anules (o ange) a e eo ganized. (ii) Tigh cen osome localiza ion a he plasma
memb ane aligns mic o ubules, which c ea es a low o cy oly ic sec e o y g anules owa ds he
con ac si e. Signalling pa hways a e ac i a ed a he con ac si e ( ed a ow). Figu e and legend
adap ed om (S inchcombe and G i i hs, 2014).
51
( ig. 1.15). The e o e, a he end o cell di ision, each daugh e cell inhe i s one
o hese cen osomes. Due o his asymme y in cen osome age, a cell di ision is
in ac always asymme ic.
In he s anda d de ini ion o an asymme ic di ision wo daugh e cells a e
p oduced ha di e ega ding hei cell a e and/o size. The p ime example o
his is he s em cell di ision: s em cells unde go asymme ic di isions and
p oduce a daugh e cell ha will di e en ia e, while he o he daugh e cell
main ains i s s em cells s a us and plu ipo ency.
Is he e a link be ween cen osome age and cell a e? Cen osomes a e
impo an o spindle o ien a ion and he e o e o es ablishing he symme y o
asymme y o cell di ision. Indeed, mul iple s udies show ha cen osome age
de e mines he di ision axis o s em cells, which consequen ly es ablishes which
cen osome each cell inhe i s. The i s epo o his was in he male ge m s em
cell (mGSC) line o D. melanogas e . Hub cells a e impo an in main aining he
mGSCs plu ipo en en i onmen ( ig. 1.18) (Yamashi a e al., 2007). The mGSC
di ides, main aining he plu ipo en cell close o he hub cells, while he o he
daugh e cell p oceeds in o spe ma ogenesis. In e es ingly, he olde cen osome,
due o i s highe mic o ubule nuclea ing ac i i y, is cons ained o he adhe ens
junc ion be ween he hub cell and he mGSC du ing in e phase. Consequen ly,
du ing spindle assembly, he younge cen osome mo es dis ally, de ining he
u u e axis o cell di ision. As a esul , he plu ipo en s em daugh e inhe i s he
olde cen osome, while he di e en ia ing daugh e inhe i s he younge
cen osome ( ig. 1.18) (Pelle ie and Yamashi a, 2012; Yamashi a e al., 2007).
Howe e , no always he p ogeni o cell keeps he olde cen osome. In he
same o ganism, in di iding neu oblas s he plu ipo en cell keeps he younge
cen osome, while he di e en ia ing daugh e cell, which will gi e ise o he
ganglion mo he cell, ecei es he olde cen osome ( ig. 1.18). This asymme y is
es ablished ea lie , du ing in e phase, when he neu oblas has a single pai o
cen ioles localized apically. The mo he cen iole apidly loses i s PCM and i s
apical localiza ion, while he daugh e cen iole main ains i s mic o ubule
nuclea ing ac i i y and emains connec ed apically, s abilized by he mic o ubule
as e ( ig. 1.18) (Condui and Ra , 2010; Rebollo e al., 2007; Rusan and Pei e ,
2007). In e es ingly, Cen obin, a daugh e cen iole ma ke , is essen ial o

52
p ese ing PCM a he daugh e cen iole, conse ing i s MTOC po en ial du ing
in e phase (Condui and Ra , 2010; Januschke e al., 2013).
In he abo e cases, he connec ion o ei he he olde o he younge
cen osome, espec i ely in D osophila mGSCs o neu oblas s, o he s em cell
niche du ing in e phase, de e mines he cell di ision axis, di ec ing he s em cell
in o an asymme ic di ision p og am. Howe e , om hese examples, i is no
clea whe he he e is a unc ional link be ween he ype o cen osome ha is
Figu e 1.18: Di e en ial inhe i ance o cen osomes du ing s em cell di ision o D.
melanogas e . (A) Male ge minal s em cells (mGSC) (yellow) a e associa ed wi h hub cells
(blue). The olde cen osome has a highe mic o ubule nuclea ing ac i i y and emains con ined
o he adhe ens junc ion be ween hese wo cells. As a consequence, he olde cen osome is
p e e en ially inhe i ed by he p ogeni o s em cell, whe eas he goniablas (pink) ecei es he
younge cen osome. (B) Du ing in e phase, he daugh e cen iole e ains PCM and
mic o ubule nuclea ing ac i i y. The e o e i emains a he apical co ex. In con as , he mo he
cen iole loses PCM and mic o ubule nuclea ing ac i i y. When he cell en e s di ision, he
p ogeni o cell ( iole ) inhe i s he younge cen osome, whe eas he ganglion mo he cell
inhe i s he olde cen osome (g ey).
53
inhe i ed and cell a e. In he mouse neu al co ex, he apical p ogeni o cells
(also known as adial glia p ogeni o cells) upon asymme ic di ision inhe i he
olde cen osome (Wang e al., 2009). The olde cen osome e ains memb ane
componen s, eminiscen o he cilia, which help he p ogeni o cell o as e
e o m he cilia han he daugh e cell wi h he younge cen osome. The eby,
Pa idean and colleagues showed o he i s ime he unc ional impo ance o
inhe i ing one speci ic cen osome: he wo daugh e cells sense and espond
di e en ly o he en i onmen , which likely con ines hei cell a e in o a p ogeni o
ype cell o in o he neu onal di e en ia ion pa hway (Ande son and S ea ns,
2009; Pa idaen e al., 2013).
1.6. Cen iole elimina ion in game ogenesis
As explained in he abo e sec ions, cen iole duplica ion and seg ega ion
main ains cen iole numbe in soma ic cells in a highly con olled manne and
wi h high ideli y. Howe e , de ia ions exis om he canonical cen iole cycle. A
p ominen example is game ogenesis, whe e his p ocess is essen ial o sexual
ep oduc ion o all animal species.
Du ing meiosis, oocy es and spe ma ozoa al e hei cen osome ac i i y and
composi ion in a complemen a y manne . Spe ma ozoa lose hei PCM
componen s, bu keep he cen iola s uc u e because o hei essen ial ole in
cilia o ma ion, and consequen ly, spe m mo emen . In con as , by he end o
meiosis, all emale game es lose he cen iole s uc u e. The e o e a e
e iliza ion, he i s emb yonic cen ioles a e a sole pa e nal con ibu ion. Ye ,
oocy es accumula e a as ese oi o p o eins necessa y o he u u e
emb yonic de elopmen , and cen osomal p o eins a e no an excep ion.
In iguingly, upon e iliza ion, spe m educed cen ioles use his ma e nal
cen osomal p o ein pool o ully eco e i s unc ionali y (Fab i ius e al., 2011;
Manandha e al., 2005) .
Again, Bo e i al eady p o ided us mul iple hin s abou cen iole elimina ion in
he beginning o he 19 h cen u y. He was he i s o desc ibe he lack o
cen ioles in sea u chins eggs and p o ide e idence ha he emb yonic cen iole
o igina es om he spe m. Bo e i also obse ed how cen osome numbe is
54
impo an du ing emb yogenesis: an ex a numbe o cen osomes ha esul s
om polyspe my ( e iliza ion by mo e han one spe m) c ea es mul ipola
spindles leading o aneuploidy, wi h consequen de ec s in emb yonic
de elopmen (Made spache , 2008; Mo i z and Saue , 1996; Schee , 2014).
Following Bo e i’s pionee ing wo k, mul iple s udies a emp ed o cha ac e ize
he cen iole cycle du ing oocy e and spe m meiosis, e e ed o as oogenesis
and spe ma ogenesis, espec i ely. In he nex sec ion I will p o ide a sho
summa y o cen iole educ ion in spe ma ozoa, and will ocus in mo e de ail on
he mechanism o cen iole elimina ion in he oocy e. Bu i s , I will jus gi e a
b ie in oduc ion o he majo s eps o meiosis.
1.6.1. Meiosis o e iew
Meiosis was disco e ed by Edoua d Van Beneden in 1883-84, using he ho se
oundwo m Asca is megalocephala (Hamoi , 1992). Meiosis in ol es he same
s eps as mi osis, bu in his case he ch omosomes s ill duplica e a single ime in
S-phase (4N), bu unde go wo successi e di isions – Meiosis I (MI) and
Meiosis II (MII). Hence, ou daugh e cells o igina e, each one o hem wi h a
haploid se o ch omosomes (N). Bo h emale and male game ocy es unde go
meiosis, and male meiosis gene a es daugh e cells o equi alen size (spe m
cells o spe ma ozoa) - ig. 1.19; emale meiosis is ex emely asymme ic,
o igina ing he oocy e and pola bodies (PBs) – ig. 1.20 (Lodish, 2008).
B ie ly, he s eps o meiosis a e: MI s a s wi h P ophase I, no mally he
longes phase o meiosis, which comp ises di e en s eps (only named o u u e
e e ence): ch omosomes ge condensed a lep o ene ( om he g eek lep onema,
“ hin eads”); hen, a zygo ene (g eek zygonema, “pai ed h eads”), each
ch omosome inds i s “pai ”, he o he homologous ch omosome. A he
pachy ene s age (pachynema, " hick h eads"), c ossing o e occu s be ween he
pai o homologous ch omosomes. As a consequence, non-sis e ch oma ids
exchange gene ic ma e ial, c ea ing small new ea angemen s in he DNA
composi ion; a diplo ene (diplonema, “ wo h eads”), all c ossing o e s a e
es ablished. Mos oocy es a e a es ed a his s age, un il e iliza ion o ho monal
s imula ion esume he p ocess. Finally, p ophase I is comple ed wi h diakinesis
55
(“mo ing h ough”), whe e ch omosomes acqui e hei maximum condensa ion,
and NEBD occu s (Lesch and Page, 2012).
In me aphase I, he pai ed homologous ch omosomes a e aligned a he
equa o ial pla e. In anaphase I, he pai s o homologous ch omosomes sepa a e,
and each se o ch omosomes mig a es o i s espec i e pole o he daugh e cell.
A elophase I, he wo daugh e cells a e indi idualized, each one o hem s ill
diploid, since each ch omosome s ill has wo ch oma ids. A second di ision s a s
(MII), bu no S-phase occu s and hus no duplica ion o DNA akes place. MII is
simila o a mi o ic di ision in e ms o ch omosome con igu a ion and ollows he
same s eps as MI. Thus, by elophase II, each cell ecei es a single se o
ch oma ids and consequen ly ou haploid cells a e o med ( ig. 1.19 and 1.20).
1.6.2. Cen osome educ ion du ing
spe ma ogenesis
A he las s ages o spe ma ogenesis, he p ima y spe ma ocy e (4N)
unde goes meiosis, gi ing ise o ou equi alen haploid spe ma ids (N) ( ig.
1.19). These cells unde go a majo di e en ia ion, educing all cell componen s o
only hose s ic ly indispensable o e iliza ion. DNA becomes highly condensed
educing nucleus size, he Golgi appa a us becomes he ac osomal cap and
con ains enzymes impo an o e iliza ion, cen ioles o ganize he lagella
complex, and mi ochond ia accumula e a he neck o he spe ma ozoa and
p o ide ene gy o he lagella mo emen ( ig. 1.19) (Lodish, 2008).
As men ioned, cen ioles, which a e essen ial o spe ma ozoa mo emen , a e
no elimina ed in spe m cells, ye some deg ee o degene a ion is obse ed. This
p ocess, e med cen osome educ ion, in ol es loss o PCM p o eins and
mic o ubule nuclea ing ac i i y, wi h some deg ee o cen iole s uc u e
deg ada ion. In some ex eme cases, he e is he comple e elimina ion o he
cen iole and espec i e mic o ubule iple s. The ex en o cen iole deg ada ion
is a iable be ween species; oden s a e he only known species ha comple ely
elimina e hei spe m cen ioles (Manandha e al., 2005). Mo eo e , di e ences
also exis in he numbe o cen ioles p esen in he spe m cells o di e en
species. Nex , I will p o ide an o e iew o he numbe and degene a ion s a e o
62
Cen iole elimina ion in his o ganism is delayed upon deple ion o he
ge mline helicase CGH-1, which associa es wi h ce ain ma e nal mRNAs. As a
consequence, cen iole elimina ion is de ec i e and oocy es s ill con aining
cen ioles a e e ilized, c ea ing mul ipola spindles in he emb yos (Mikeladze-
D ali e al., 2012). Al hough a po en ial e ec o o mechanism was no iden i ied,
CGH-1 is he i s p o ein known o be in ol ed in cen iole elimina ion.
Taken oge he , al hough he species desc ibed abo e a e no closely ela ed,
hei cen ioles a e elimina ed by he diplo ene s age, du ing p ophase I ( ig.
1.21). Whe he he unde lying mechanisms a e conse ed is no known.
ii. One+single+pai +o +cen ioles+is+p esen +a + he+beginning+o +
meiosis:+ he+spe m+cen iole+in e enes++
The pulmona y snail Lymnea s agnalis has an al e na i e cen iole cycle
du ing meiosis – a single pai o cen ioles is p esen a he beginning o MI.
Consequen ly, he MI spindle o ganizes wi h a single cen iole in each pole, wi h
one o he cen ioles being ex uded in o he PBI. The emaining cen iole o ms
he MII spindle pole acing he ou side o he cell, whe eas he spe m basal body
is posi ioned a he o he spindle pole (K iou chko a e al., 1994b). Al hough he
o ma ion o he MII spindle equi es he spe m basal body’s in e en ion, he
oocy e cen iole pai is success ully ex uded in o he PBs and he e o e
elimina ed om he egg cy oplasm.
Figu e 1.23: Schema ic ep esen a ion o a C. elegans gonad. The gonad can be subdi ided
in o ou egions: (1) p oli e a ing ge m cells; (2) ge m cells in pachy ene s age; (3) ge m cells
a e pachy ene; (4) ge m cells in diplo ene s age: cen ioles a e no longe isible a his s age.
No e diakinesis oocy es a e ma ked –1, –2, –3 p io o he spe ma heca. Shea h cell nuclei a e
depic ed in blue. Figu e and legend adap ed om (Mikeladze-D ali e al., 2012).

63
iii. Cen ioles+a e+elimina ed+a + he+end+o +meiosis:+spindle+
assembly+is+cen iola +
No all oocy es o ganize an acen iola spindle du ing meiosis. In ac ,
ul as uc u e s udies show ha wo pai s o cen ioles a e p esen a he
beginning o meiosis in oocy es o echinode ms (such as sea u chin H.
pulche imus, s a ish P. pec ini e a and a nu ensis and sea-cucumbe H.
moebi) and bi al es (such as mussel M. edulis). Al hough only EM s udies we e
pe o med in hose species, i is desc ibed ha du ing MI spindle o ma ion, a pai
o cen ioles localizes a each pole o he MI spindle. The PBI is ex uded wi h
one pai o cen ioles. In e es ingly, du ing MII, single cen ioles a e obse ed a
he MII spindle poles. A second PB (PBII) is ex uded wi h one o he cen ioles,
and a single cen iole emains in he ma u e egg (Ka o e al., 1990; Longo and
Ande son, 1969; Miyazaki e al., 2005; Nakashima and Ka o, 2001). The
emaining cen iole is hen elimina ed, and he spe m p o ides he emb yo wi h
he i s pai o cen ioles (Saiki and Hamaguchi, 1998). How he emaining single
cen iole o he oocy e is elimina ed emains an unsol ed p oblem. In a nex
sec ion, mo e in o ma ion abou he di e en cen iola beha io s obse ed in
s a ish oocy es will be de ailed.
The di e ences in iming o cen iole elimina ion ha e di ec consequences o
he ype o spindle assembly ha is adop ed: when cen ioles a e elimina ed
be o e NEBD, he spindle is acen iola ; when cen ioles a e main ained un il he
end o meiosis, cen ioles o ganize he spindle. Al hough he ype o spindle
assembly, cen iola o acen iola , has been iden i ied o hese species, we a e
a om unde s anding wha dic a es he iming o cen iole elimina ion.
1.6.4. Scaling p oblems in oogenesis
i. Spindle+posi ioning+a + he+cell+co ex+
Oocy es a e among he bigges animal cells, which unde go highly asymme ic
di isions in o de o educe hei DNA con en o a haploid se o ch omosomes.
Oocy e asymme ic di ision is unc ionally impo an because i p ese es
64
nu ien s and p o eins, essen ial o ea ly emb yonic de elopmen . Mo eo e , only
he ma u e egg is e ilizable: he PB canno bind spe m due o i s lack o
mic o illi, equi ed o spe m en y (B une and Ve lhac, 2011).
Oocy es’ meio ic spindles a e small and localize asymme ically in close
p oximi y o he oocy e plasma memb ane, which ensu es he ex eme
asymme y o he di ision, so ha jus a small ac ion o cy oplasm is los du ing
cell di ision (Chaigne e al., 2012; McNally, 2013). Al hough asymme ic spindle
posi ioning occu s in all emale oocy es, i can happen a di e en s ages o
meiosis. In many species, he en i e nucleus mo es o he animal pole be o e
NEBD (e.g. s a ish, sea cucumbe , C. elegans, D. melanogas e ), whe eas in
mouse oocy es, he nucleus emains in he cen e , and mig a ion occu s only
a e spindle assembly (Fab i ius e al., 2011; Miyazaki e al., 2005).
Cen ioles, which a e e ained un il he end o meiosis in s a ish and sea
cucumbe oocy es, localize close o he plasma memb ane a he animal pole in
he imma u e oocy e. The nucleus is hen posi ioned o he animal pole in a
mic o ubule-dependen mechanism. In s a ish oocy es, his nuclea localiza ion
o he animal pole happens long be o e he esump ion o meiosis (Miyazaki e
al., 2000). In con as , in sea cucumbe , he long mic o ubules nuclea ed by he
cen osome mo e he nucleus owa ds he animal pole, sho ly a e meiosis
esump ion (Miyazaki e al., 2005). Some s udies sugges ha cen ioles, be o e
elimina ion, a e likely o posi ion he oocy e nucleus in D. melanogas e . Indeed,
i has been shown ha he (mul iple) cen ioles g ow mic o ubules, which push
he nucleus om a cen al posi ion un il i eaches a la e al one (Zhao e al.,
2012).
In C. elegans, he nucleus is also localized o he co ex be o e NEBD, in a
mic o ubule and Kinesin-1 dependen manne (Fab i ius e al., 2011).
In mouse oocy es, he mechanism o spindle localiza ion o he plasma
memb ane is well cha ac e ized. P io o meio ic esump ion, he nucleus
localizes o he cen e o he oocy e and only a e NEBD and spindle o ma ion,
he MI spindle is anspo ed owa ds he plasma memb ane (Ve lhac e al.,
2000). In mouse oocy es, ac in d i es spindle anspo ( ig. 1.24 B). Indeed, he
oocy e is illed up wi h an ac in ne wo k wi h esicles a he ne wo k’s b anching
poin s, which ac as he o ganizing cen e s o his ne wo k. On he esicle
su ace, ac in nuclea o s (Spi e-1 and -2 and Fo min-2) and he mo o p o ein
65
Myosin-Vb accumula e. Ac in is polyme ized om hese esicles, and Myosin-Vb
gene a es pulling o ces mo ing hese esicles owa ds each o he . This
al oge he c ea es a highly dynamic ac in ne wo k ha se es as a subs a e o
spindle anspo (Almonacid e al., 2014; Azou y e al., 2008; Holubco á e al.,
2013; Schuh, 2011). Upon spindle o ma ion, an ac in cage o ms su ounding he
MI spindle, and Myosin-II localizes a spindle poles ( ig. 1.24 B). The spindle is
hen anspo ed o he closes co ex on he dynamic cy oplasmic ac in ne wo k,
d i en by Myosin-II (Schuh and Ellenbe g, 2008). Fo min-2 egula ion is likely
associa ed wi h he symme y-b eaking e en : be o e he esump ion o meiosis,
high le els o Fo min-2 keep he nucleus a he cen e o he oocy e; upon
esump ion o meiosis, a sudden d op in he le els o Fo min-2 changes he ac in
ne wo k o ganiza ion, and consequen ly allows o -cen e ing o he spindle
(Azou y e al., 2008; Ve lhac e al., 2000).
As men ioned ea lie , all oocy es posi ion hei spindle in close p oximi y o he
plasma memb ane be o e cell di ision. Mo eo e , he MI and MII spindle a e
Figu e 1.24: Schema ic ep esen a ion o spindle posi ioning in a mouse oocy e (B) and
espec i e compa ison wi h soma ic cell (A). (A) Soma ic cell in me aphase o mi osis. Spindle is
posi ioned by as al mic o ubules. Co ical F-ac in ancho s as al mic o ubules o he co ex and
inc eases cell igidi y. (B) Mouse oocy e in me aphase I. A cy oplasmic and highly dynamic ac in
meshwo k d i es spindle posi ioning o he cell co ex. Cy oplasmic meshwo k is nuclea ed om
esicles localizing a i s b anching poin s. By localizing a he spindle poles, myosin II likely
d i es his mo emen , by pulling on cy oplasmic F-ac in (cu ed black a ows). Figu e and
legend adap ed om (Almonacid e al., 2014).
66
o ien a ed pe pendicula ly o he plasma memb ane, a ea u e ha is conse ed
in all oocy es. Fo example, in he wo m C. elegans, he MI spindle lies i s
pa allel o he co ex, and hen o a es by dynein ac ion, becoming pe pendicula
o he co ex. Al hough his o a ion is less desc ibed in o he species, spindles
always ha e a pe pendicula o ien a ion be o e PB ex usion. This pe pendicula
o ien a ion and he close p oximi y o he plasma memb ane appea o be
essen ial o co ec PB ex usion (Fab i ius e al., 2011).
ii. Spindle+assembly++
In a mi o ic cell, cen osomes o ganize he poles o he spindle, nuclea ing
mic o ubule a ays ha cap u e he ch omosomes ( ig. 1.24 A). In he p esence o
cen osomes, his cen iola spindle assembly pa hway domina es. None heless,
ch omosomes can also nuclea e mic o ubules, con ibu ing o spindle o ma ion
(Walczak and Heald, 2008). In he absence o cen osomes, ch omosomes can
p omo e he sel -assembly o an acen iola spindle. This was shown o he i s
ime in Xenopus egg ex ac s: wi hou cen ioles, bipola mi o ic spindles a e s ill
assembled on spe m ch oma in o e en a ound DNA coa ed beads (Heald e al.,
1996). In a simpli ied way, ch omosomal mic o ubule nuclea ion depends on a
Ran-GTP g adien , which is es ablished a ound he ch omosomes. Ran-GTP
hen ac i a es se e al mic o ubule associa ed p o eins, including TPX2, which
ec ui s he Augmin complex ha consequen ly ec ui s γTuRC, allowing
mic o ubule nuclea ion om he ch omosomes (Goshima e al., 2008; G uss e
al., 2001; Pe y e al., 2013). O he p o eins a e also in ol ed in he o ma ion o
he bipola spindle: he kinesin Eg5 aligns he nascen mic o ubules, he mo o
XKlp1 pushes he mic o ubule away om he ch omosomes, whe eas dynein
ocuses he mic o ubule ends and con ibu es o spindle pole o ma ion (Ka sen i
and Ve nos, 2001; Walczak and Heald, 2008).
Acen iola spindle assembly mechanisms in li e oocy es a e no as well
cha ac e ized as in he egg ex ac . Howe e , in oocy es, acen iola spindle
assembly also occu s om non-cen iola MTOCs, and no only om he
ch oma in (Dumon and Desai, 2012). Some cla i ica ion o hese p ocesses
a ose om he iden i ica ion o hese non-cen iola MTOCs, pa icula ly in D.
melanogas e , ogs and mouse oocy es.
67
In og oocy es, a disk-shaped MTOC ( e e ed o as a ansien mic o ubule
a ay) assembles a he base o he nucleus, sho ly a e NEBD, and hen
mig a es owa ds he animal pole. This MTOC is likely o collec he
ch omosomes and unc ion as a p ecu so o he MI spindle, being subsequen ly
emodeled in o a bipola spindle (Ga d, 1992).
In D. melanogas e , non-cen iola MTOCs appea de no o sho ly be o e
NEBD, o ganizing sca e ed mic o ubules as e s, which hen o ganize in o a
bipola spindle. The kinesin Ncd localizes o he ini ial mic o ubules as e s, and
has a cen al ole du ing MI spindle assembly, by e-shaping hese mic o ubule
as e s in o a bipola spindle (Meg aw and Kau man, 2000; Sköld e al., 2005).
Again, mo e da a is a ailable in mouse oocy es: se e al s udies show he
p esence o mul iple pe icen in and γ- ubulin-con aining MTOCs, which o m de
no o sho ly be o e NEBD ( ig. 1.25) (Cala co, 2000; Ca aba sos e al., 2000;
Schuh and Ellenbe g, 2007). These MTOCs a e ini ially sca e ed h oughou he
oocy e, and con e ge owa ds each o he and o he nuclea egion a e NEBD,
o ming a “sphe e” o mic o ubules a ound he ch omosomes ( ig. 1.25 – I o III).
This sphe e o mic o ubules is p og essi ely shaped in o a MI bipola spindle by
Kinesin-5 and o he molecula mo o s ( ig. 1.25 – IV o VI) (Schuh and Ellenbe g,
2007).
Figu e 1.25: Model o acen iola spindle assembly in mouse oocy es. I-III Acen iola MTOCs
localize i s dispe sed in he oocy e’s cy oplasm. Upon NEBD, a “sphe e” o mic o ubules
o ganize a ound he ch omosomes. IV-V: Acen iola MTOCs s a o clus e and a bipola
spindle is o ganized (VI), media ed by Kinesin-5. VI: Spindle u he elonga es. O he molecula
mo o s a e likely o be in ol ed. Figu e and legend adap ed om (Schuh and Ellenbe g, 2007).

68
As men ioned be o e, mic o ubule nuclea ion in og ex ac s depends
comple ely on he ch oma in gene a ed Ran-GTP g adien s. Howe e , in he
o ma ion o he MI spindle in mouse oocy es, Ran-GTP-dependen nuclea ion is
no essen ial, ye con ibu es by accele a ing he spindle assembly p ocess
(Dumon e al., 2007; Schuh and Ellenbe g, 2007). In e es ingly, he Ran-pa hway
is essen ial o MII spindle assembly, possibly by con ibu ing speeding up he
p ocess, which occu s much as e han he MI spindle assembly (Dumon e al.,
2007).
In summa y, one can conside ha acen iola assembly mechanisms a e
simila be ween egg ex ac s and meio ic oocy es: mo o p o eins a e impo an
o bipola i y, while ch omosomes and associa ed Ran-GTP a e a sou ce o
mic o ubule nuclea ion, ye no he only ac o in meio ic oocy es. E en in cells
o ming acen iola spindles, MTOCs a e p esen . This sugges s ha ei he non-
cen iola MTOCs o cen osomes ypically accele a e he ch oma in-media ed
spindle assembly pa hway du ing emale meiosis.
1.7. Cen iole elimina ion in s a ish oocy es
1.7.1. O e iew o s a ish meiosis
S a ish oocy es a e la ge cells, wi h a diame e o 170 µm and when ully
g own and a es ed in P ophase I, con ain a nucleus wi h 80 µm diame e ( ig.
1.26 A). The la ge nucleus localizes close o he animal pole, de ining a clea
axial asymme y in he oocy e. Two pai s o cen osomes localize be ween he
nucleus and he oocy e plasma memb ane and ac ually hold he nucleus a he
animal pole by long in e phase mic o ubules ( ig. 1.26 A) (Miyazaki e al., 2000).
Sho ly a e meiosis esump ion, NEBD occu s. Ac in has a majo ole in he
ea ly e en s o meiosis: an ac in shell, an A p2/3-dependen s uc u e composed
o highly compac ed b anched ac in, ansien ly accumula es a nuclea en elope
and p omo es as agmen a ion o he nuclea en elope ( ig. 1.26 B) (Mo i e al.,
2014). Sho ly a e , an ac in meshwo k o ms in he nuclea egion, which
collec s he sca e ed ch omosomes ac oss he nucleus ( ig. 1.26 C). This ac in
69
meshwo k is highly dynamic and con ac s di ec ionally owa ds he animal pole.
Once he ac in ne wo k deli e s he ch omosomes close o he animal pole, hey
a e collec ed by he cen osomal mic o ubule as e s, which hen o ganize he MI
spindle (Léná e al., 2005; Mo i e al., 2011). The cen osomes o ganize he
spindle (see sec ion 1.6.3 iii) and he oocy e unde goes wo consecu i e meio ic
di isions wi h he ex usion o wo PBs.
1.7.2. S a ish oocy e as a model o s udy
cen iole elimina ion using molecula
ma ke s and li e cell imaging
i. Cen iole+elimina ion+in+o he +model+o ganisms+
Cen iole elimina ion is a p ocess cha ac e ized by a as swi ch om a s a e
including cen ioles in he cy oplasm, o ano he wi hou cen ioles. Indeed, no
“collapsing” s uc u e has e e been obse ed. Mo eo e , i is likely a e y as
p ocess (Mikeladze-D ali e al., 2012), which complica es i s obse a ion du ing
he long p ophase I, cha ac e is ic o all canonical model o ganisms ( ogs, D.
melanogas e , C. elegans, mouse).
Figu e 1.26: NEBD and ch omosome cong ession du ing s a ish meiosis. (A) Oocy e is
a es ed in P ophase I. (B) A e ho mone addi ion, he ac in shell ansien ly accumula es a he
nuclea en elope and p omo es as NEBD. (C) Ac in meshwo k o ms inside he nuclea
egion, ac in- ich egions o ganize a ound he ch omosomes p e iously localized close o he
nuclea en elope. (C) Ac in meshwo k con ac s unidi ec ionally and ch omosomes a e
anspo ed owa ds he plasma memb ane.
70
Consis en ly, so a no molecula mechanism has been de ined o cen iole
elimina ion du ing emale meiosis. Fo mos model sys ems only he iming o
cen iole elimina ion is known, de ec ed by he loss o cen iola p o eins and
subsequen disappea ance o he cen iola s uc u e. Wi h he excep ion o he
helicase CGH-1 in wo ms, no o he p o ein was desc ibed o be in ol ed in
cen iole elimina ion, and s ill i s ole emains unclea .
ii. Cen iole+elimina ion+in+s a ish+oocy es+7+wha +is+known+so+
a ++
S a ish became a model sys em o meiosis esea ch a e he isola ion and
iden i ica ion o 1-me hyladenine (1-MA) (Kana ani e al., 1969), he ho mone
esponsible o inducing esump ion o meiosis, allowing expe imen ally con olled
s udy o meio ic ma u a ion. S a ish oocy es a e a obus sys em ha allows
mul iple and a iable manipula ions wi hou a ec ing he iabili y o he oocy es.
Cen iole elimina ion was i s in es iga ed in his sys em mo e han wo decades
ago, because he anspa ency o he oocy e allowed he isualiza ion o he
p ocess by phase-con as mic oscopy.
Cen iole elimina ion was ini ially add essed om he poin o
pa henogenesis. Un e ilized oocy es a ely unde go pa henogenic
de elopmen . Howe e , Washi ani-Nemo o and colleagues showed ha
pa henogenesis can be easily igge ed in s a ish oocy es i PB ex usion is
supp essed (Washi ani-Nemo o e al., 1994). A he ime, a majo hypo hesis was
ha he p esence o an ac i e cen osome (he e me ely de ined by a la ge as e
isible by ansmi ed ligh mic oscopy) is key o pa henogenesis. A ew yea s
la e , Saiki and Hamaguchi obse ed ha only he cen ioles ex uded in o he
PBs e ained a “ eplica i e”, i.e. an as e o ming capaci y. They p oposed o i s
ime ha s a ish cen ioles ha e an “in insic cha ac e is ic”, which makes hem
he e ogeneous in hei eplica ion capabili y: he cen iole, which emains in he
ma u e egg is “non- eplica i e”, and as a consequence decays and is elimina ed.
In con as , spe m de i ed cen ioles, as well as cen ioles de i ed om e-
in oduced PBs, a e “ eplica i e”, because hey main ain hei mic o ubule
nuclea ing ac i i y (Saiki and Hamaguchi, 1998).
71
Addi ionally, EM da a indica ed ha a he beginning o meiosis, each
cen osome con ains a pai o cen ioles (Ka o e al., 1990). The e o e, ou o
hese ou cen ioles h ee would be ex uded in o he wo PBs, and he single
cen iole emaining in he ma u e egg would need o be a non- eplica i e cen iole
( ig. 1.27) (Tamu a and Nemo o, 2001). La e , Ue ake and colleagues u he
showed ha upon PB supp ession, wo eplica i e cen ioles emain in he egg,
which canno be elimina ed. In ac , hey can s ill duplica e ei he in
pa henogene ic ac i a ed eggs o in e ilized eggs (Ue ake e al., 2002; Zhang e
al., 2004). By u he ansplan a ion expe imen s, i has been shown ha hese
eplica i e cen ioles a e al eady “ esis an ” o elimina ion be o e meiosis
esump ion (Shi a o e al., 2006).
In conclusion, upon s a ish oocy e meiosis, ea lie s udies es ablished ha
wo ypes o cen ioles exis in he oocy e: eplica i e and non- eplica i e. The
eplica i e cen ioles a e ex uded in o he PBs, whe eas a non- eplica i e
cen iole emains in he ma u e egg, whe e i can be e icien ly elimina ed in
con as o he eplica i e cen ioles o ced o emain in he egg.
iii. Cen iole+elimina ion+in+s a ish+oocy es+–+ he+s a ing+
hypo hesis+
In he abo e ci ed li e a u e, a la ge a ie y o manipula ions we e pe o med,
anging om PB ansplan a ion and PB supp ession using ei he a i icially
Figu e 1.27: Schema ic ep esen a ion o he cen iole cycle in a s a ish oocy e. (A) Two pai s
o cen ioles o ganize he i s MI spindle. (B) One pai is ex uded in o he PBI. (C) A pai
emains and single cen iole localize a he MII spindle. (D) One cen iole is ex uded in o he
PBII. Two eplica i e cen ioles a e ex uded in o he wo PBs. The emaining cen iole is non-
eplica i e. No e ha his cycle was ne e con i med wi h molecula ma ke s o cen ioles.
78
ma u a ion. O a ies we e hen ans e ed o a Pe i dish con aining esh il e ed
seawa e , supplemen ed wi h ace ylcholine (100 µM), o allow o a y con ac ion
and oocy e elease. Oocy es we e hen ans e ed wi h a Pas eu pipe e o a
Pe i dish con aining esh il e ed seawa e , and kep a 14°C o up o wo days.
Spe m was ob ained by punc u ing a small hole on he do sal side o he a m
o a male s a ish. Tes is we e hen collec ed wi h o ceps in o an Eppendo ube
and kep “d y” a 4°C.
3.3.2. Fe iliza ion
S a ish e iliza ion is ex e nal, i.e. i occu s na u ally in he sea, ou side o he
pa en ’s body; hus, emb yos a e easily ob ained by mixing spe m wi h ma u e
eggs. None heless, o a oid polyspe my, spe m had i s o be dilu ed in esh
il e ed seawa e (app oxima ely 1:8000), which ac i a es he spe m cells a he
same ime. Fe iliza ion and emb yo de elopmen can be ollowed in he same
chambe s used o mic oinjec ion up o one day, by which ime emb yos each
he ea ly gas ula s age. The ea e , he emb yos become cilia ed and swim away
om he injec ion chambe s.
3.4. Oocy e injec ion
Imma u e oocy es we e moun ed in o mic oinjec ion chambe s as desc ibed in
de ail a h p://m e asaki.us/panda/injec ion/. B ie ly, he oocy es we e moun ed
be ween wo glass co e slips (one 22 x 22 mm squa e and a small cu co e slip)
held oge he by double s ick ape, e e ed o as co e slip chambe ( ig. 3.1 A).
Figu e 3.1: (A) Co e slip chambe – whe e he oocy es a e moun ed. (B) Co e slip chambe is
hen moun ed in he mic oinjec ion chambe – whe e he oocy es a e injec ed and imaged. See
side- iew o co e slip chambe in ig. 3.2.

79
These co e slip chambe s we e hen moun ed in a U-shaped chambe and illed
up wi h seawa e , o ming a mic oinjec ion chambe ( ig. 3.1 B). This chambe
keeps he oocy es in place du ing injec ion, o e nigh incuba ion and subsequen
imaging. Mo eo e , o igge oocy e ma u a ion, he seawa e jus has o be
exchanged by a 10 μM 1-me hyladenine (1-MA) seawa e solu ion.
Mic oinjec ion was pe o med wi h a CellT am Oil manual injec o using
me cu y-con aining needles, as p e iously desc ibed a
h p://m e asaki.us/panda/injec ion/. All needles we e pulled om D ummond
glass capilla ies using a Na ishige PN-3 Glass Mic oelec ode Ho izon al Needle
Pipe e Pulle .
P io o injec ion, mRNAs and p o eins we e loaded in o loading capilla ies
(D ummond) oge he wi h non- eac i e silicon oil dime hylpolysiloxane
( iscosi y: 20 c s, Sigma), as desc ibed in h p://m e asaki.us/panda/injec ion/.
Fo each oocy e o be injec ed, he needle was on -loaded om he loading
capilla y, wi h oil, mRNA o p o ein, and oil. This non- eac i e oil p e en s mRNA
mixing wi h he seawa e and allows he iden i ica ion o injec ed oocy es. The
me cu y localizes a he back ( ig. 3.2), balances he p essu e on he needle and
helps con olling he mo emen o he injec ed liquid. Only he oocy es wi h he
nucleus acing he op o he chambe ( ig. 3.2) we e injec ed. Du ing imaging,
his side o he chambe aces he objec i e and he e o e imaging condi ions a e
be e , as he ligh has o a el less o he ocus, minimizing sca e ing ( ig. 3.2).
Fluo escen ly labeled p o eins we e injec ed sho ly be o e ma u a ion and li e
cell imaging, whe eas mRNAs encoding luo escen ma ke s we e injec ed he
day be o e o allow p o eins o be exp essed o e nigh .
Figu e 3.2: Mic oinjec ion: needle con ains oil – mRNA/p o ein – oil – me cu y. Only he oil and
mRNA/p o ein is injec ed in he oocy e. Oocy e has a nucleus acing up and i is moun ed in he
mic oinjec ion chambe (side- iew).
80
3.5. D ug ea men
All he s ock solu ions we e dissol ed in DMSO. Be o e addi ion, he s ock
solu ions we e dilu ed in seawa e and hen applied o he oocy es. In o de o be
able o add d ugs a speci ic ime poin s du ing meiosis, while con inuously
imaging, I used a modi ica ion o he abo e desc ibed mic oinjec ion chambe
( ig. 3.1). Fo his, he co e slip chambe was ans e ed o a small µ-Dish (Ibidi)
wi h a window cu in o he plas ic bo om o he dish. These dishes a e open a
he op, which allows di ec applica ion o d ug solu ions, and a e single-use, hus
a oiding c oss-con amina ion.
I used he ollowing d ugs: cy ochalasin D (cy oD) (Sigma, s ock: 10mM,
dilu ion: 10µM), la unculin B (la B) (EMD Biosciences, s ock: 1mM, dilu ion:
250nM), axol (s ock: 11µM, dilu ion: 11nM), Nocodazole (EMD Biosciences,
s ock: 10 mM, 3.3 µM dilu ion) and MG-132 (Calbiochem, s ock: 50 mM, dilu ion:
250µM). La B and cy oD a e bo h ac in-depolyme izing d ugs, ye hey ac in a
di e en way: la B seques e s ac in monome s, whe eas cy oD caps F-ac in
mic o ilamen s. Bo h nocodazole and axol ac on mic o ubules, bu ha e
opposi e e ec s: nocodazole depolyme izes mic o ubules and axol s abilizes
hem. MG-132 is a p o easome inhibi o . Each d ug has a di e en ime o ac ion:
he e ec o la B, nocodazole and axol is isible in less han 2-5 min a e d ug
addi ion. Cy oD and MG-132 ake 30 and 45 min, espec i ely, o ac , equi ing a
longe p eincuba ion o oocy es.
3.6. Con ocal mic oscopy and gene al
image p ocessing
All ligh mic oscopy was pe o med on a SP5II con ocal mic oscope (Leica)
equipped wi h a as Z- ocusing de ice (Supe Z Gal o s age) and using 40x HCX
PL APO 1.10 NA (Leica) wa e imme sion lens.
S a ish oocy es we e imaged in 3D and o e ime a oom empe a u e
(20°C). Scan speed was se o 700 o 1000 Hz, using a bidi ec ional scan and a
line a e age o 3 o 4. Whe eas he XY scaling and ime esolu ion a e a iable
81
and p o ided o each igu e, I used a Z-s ep o 1.5 µm o all he expe imen s,
and excep ionally a s ep o 2 µm o imaging o en i e emb yos and oocy es.
Each s ack was aken wi h 20-25 Z-s eps, depending on he o ien a ion o he
oocy e. Time esolu ion depended on he numbe o s acks and he ype o
expe imen ; bu an a e age s ack ook 30-40 seconds o be acqui ed. A ound 2-5
oocy es we e imaged pe chambe .
Du ing he as 3D li e imaging acquisi ion, o ack he mo he cen iole
anspo , he imaging speed was imp o ed in o de o ge a good desc ip ion o
such a as p ocess. In his case, one single oocy e was imaged pe chambe ,
and he numbe o Z-s eps educed o 10-15. In his case, he imaging was
pe o med wi h an app oxima e ime esolu ion o 20 seconds.
3.7. Image analysis and p ocessing
Fo all da a isualiza ion, I used Fiji (h p:// iji.sc/Fiji) and Ima is
(h p://www.bi plane.com/ima is). Fiji is an open sou ce image analysis package,
which was used o basic image p ocessing and isualiza ion, while Ima is was
used o 3D isualiza ion and 3D acking.
To educe sho noise, a Gaussian blu il e (sigma alue = 0.8) o Gaussian
Blu 3D (X, Y and Z sigma alue = 0.8) was applied o all images. O he image
p ocessing s eps speci ic o each expe imen a e desc ibed in he app op ia e
sec ion below.
All p ocessed igu es we e assembled in Adobe Illus a o . Some panels
co espond ei he o single Z-slices o o maximum in ensi y p ojec ions, o a e
da ase s ende ed in 3D by Ima is, which is always no ed in he legend. In Ima is,
I c ea ed a 3D su ace model o he oocy e ou line using he cy oplasmic
backg ound in ensi ies. No e ha hese models do no ep esen he eal plasma
memb ane and a e jus an app oxima e ep esen a ion o he cell con ou .
Time-lapse panels we e gene a ed in Fiji by p ojec ing o e ime a ec angula
ROI, using he “Make mon age” unc ion in Fiji.
82
3.7.1. Valida ion o mo he and gene al cen iole
ma ke s
I de eloped an au oma ic me hod o alida e ou ma ke s and con i m
cen osome composi ion in s a ish. In hese expe imen s, oocy es we e double
injec ed wi h Poc1-mChe y as a gene al cen iole ma ke and Od 2-mEGFP, as
a mo he cen iole speci ic ma ke . Oocy es we e ma u ed and e ilized, as
desc ibed abo e. A e 24h, a Z-s ack was acqui ed om a single laye o cells o
an ea ly gas ula epi helium (see schema ic ep esen a ion Resul s sec ion
4.1.2 ig. 4.4 B).
i. Cen iole+de ec ion++
Cen iole de ec ion was pe o med using he Ima is unc ion “spo de ec ion”,
in which spo s a e au oma ically de ec ed based on hei diame e (he e 0.3 µm),
and in ensi y h eshold. This unc ion also sa es he XYZ posi ion o each spo .
O he de ec ion p og ams we e es ed as he “Mosaic” plugin (Sbalza ini and
Koumou sakos, 2005) o Fiji. Spo s we e also de ec ed based on hei diame e
and in ensi y (selec ed adius: 2 pixels, pe cen ile (i.e. which pe cen age o b igh
pixels a e conside ed): 0.2%. Di e en measu emen s such as spo a ea and
in ensi y ( o each channel), and espec i e XYZ coo dina es we e eco e ed.
Ima is was he me hod chosen o cen iole de ec ion (see below o he
compa ison be ween he wo me hods – ig. 3.4).
ii. Quan i ica ion+o +o e lap+be ween+mo he +and+gene al+
cen iole+ma ke s+
We implemen ed a sc ip in R (R De elopmen Co e Team, 2009) o
au oma ically quan i y he numbe o Od 2-mEGFP-labeled cen ioles (“mo he ”)
pe pai o Poc1-mChe y-labeled cen ioles (“gene al”).
Fi s , spo posi ions we e independen ly loaded o each channel. To con ol
agains any shi s in he images, and o ha e an ini ial es ima e o he spo
colocaliza ion, we plo ed all spo s in 3D using he “sca e plo 3d” package
(Ligges and Maechle ) o R.
83
Ma ches be ween gene al-gene al spo s and gene al-mo he spo s, i.e.
colocalizing spo s, we e calcula ed using he Euclidean pai wise dis ance
be ween all pai s o gene al and mo he spo s, and hen sol ing he linea sum
assignmen p oblem (Papadimi iou and S eigli z, 1982) using he “clue” package
(Ho nik, 2005) – ig. 3.3. Mo he spo s we e only assigned o he closes gene al
spo s i hei dis ance was less han a ixed h eshold based on he cell diame e .
I is impo an o de ine a pai o gene al spo s as a single uni (i.e. wo
cen ioles o ming a cen osome), o be ma ched wi h a single mo he spo . I no ,
one gene al spo o he pai would be ma ched wi h he mo he spo , bu he o he
would be ca ego ized as an “unma ched” spo . Hence, we i s desc ibed he
espec i e pai s o gene al spo s by inding he minimum dis ances be ween he
pai wise dis ances. Wi h his in o ma ion, we calcula ed he minimum dis ance
be ween he mo he spo s and he gene al spo s (pai ed o no ). Thus, he
minimum dis ance di ec ly ela es wi h colocaliza ion o he spo s.
All ma ches we e o ganized in co esponding ca ego ies o ma ched o
unma ched pai s, by coun ing he numbe o mo he (m) spo s (one, wo o none)
colocalizing wi h he numbe o gene al (g) spo s (one, wo – ou biological pai s
–, o none): g0m1, g1m0, g1m1, g2m0, g2m1 and g2m2. We es ed which
Figu e 3.3: Cha o an example case o one emb yo, showing colocalizing mo he ma ke s (m)
and gene al (g) ma ke s – in g een; non-pai ed mo he ma ke s a e ep esen ed in ed; non-
pai ed gene al ma ke s a e shown in blue.

84
me hod o cen iole de ec ion was mo e sensi i e ( ig. 3.4). As Ima is was mo e
sensi i e in he iden i ica ion o “g2m1” ca ego ies, “cen osome-like”
con igu a ion, i was he me hod selec ed o u he cen iole de ec ion.
The biological ele ance o hese ca ego ies is discussed in Resul s. All
emb yos and hei espec i e cen osomes we e ca ego ized, and he o al
equency o each ca ego y was calcula ed.
Finally, we conside ed only he g2 ca ego y as biologically ele an and all
o he s esul s we e no conside ed o he inal quan i ica ion (see in Resul s).
3.7.2. Quan i ica ion o cen ioles ex uded in o
pola bodies
To de e mine he speci ic mo he cen iole ex usion du ing meiosis in s a ish
oocy es, I double injec ed oocy es wi h Od 2-mEGFP (o Chibby-mEGFP), and
he spindle ma ke s Poc1-mChe y o Cy3-Tubulin.
i. Vesicle+au o luo escence+sub ac ion+ om+ he+Od 27mEGFP+
channel+
Da a we e acqui ed as a Z-s ack and in ou di e en channels: C1-C4. C1
con ains he signal co esponding o Od 2-mEGFP ma ched o mEGFP emission
p o ile, whe eas C2 con ains a ed-shi ed de ec ion window o eco d he au o-
luo escence o cy oplasmic esicles, aking ad an age o he ac ha
au o luo escence has a much b oade emission spec um han mEGFP ( ig. 3.5).
Figu e 3.4: Compa ison be ween Mosaic and Ima is o an example case o one emb yo. No e
ha bo h de ec simila o al numbe o pai s. Howe e , Ima is is mo e sensi i e de ec ing he
ca ego y g2m1 s. g1m1 (see blue squa es). The e o e, i was he selec ed me hod o cen iole
de ec ion. Ca ego ies a e indica ed (g) ep esen s gene al, (m) indica es mo he , wi h he
espec i e numbe o spo s ound. A schema ic ep esen a ion o he ca ego ies is shown: g een
co esponds o mo he , ed co esponds o gene al.
85
In a second scan (using he sequen ial scan unc ion o he Leica con ocal
so wa e) C3 con ains he signal co esponding o he spindle ma ke (Poc1-
mChe y o Cy3-Tubulin), and C4 eco ds he ansmi ed ligh image.
Reco ding he au o luo escence in a sepa a e channel allowed me o sub ac
i om he mEGFP channel ha con ains bo h he speci ic signal o Od 2-mEGFP
and au o luo escence o he cy oplasmic esicles ( ig. 3.5). This imp o ed he
images signi ican ly, because i isola es he Od 2-mEGFP signal. No e ha he
cy oplasmic esicles a e much la ge han cen ioles and less b igh ; hus e en
wi hou backg ound sub ac ion, cen ioles could s ill be unambiguously iden i ied.
I de eloped a mac o in Fiji o au oma e his au o luo escence sub ac ion.
Fi s , all ou channels we e sepa a ed o indi idual channels, and C1 and C2
il e ed by a “Gaussian blu ” (sigma = 0.8). Then, a esicle was selec ed using a
ma ching ci cula ROI. The ROI a he same posi ion was au oma ically selec ed
in C2. The mean in ensi y alues we e ob ained o his ROI o each channel,
and he a io be ween he wo calcula ed. C2 window was hen mul iplied by his
a io o no malize he luo escence le els be ween C1 and C2, ollowed by
Figu e 3.5: Vesicle au o luo escence sub ac ion om he Od 2-mEGFP channel – schema ic
ep esen a ion. (A) Shows he di e en channels: C1 con ains Od 2-mEGFP au o- luo escence,
C2 con ains only he au o- luo escence, C1-C2 shows only he Od 2-mEGFP signal.
A owheads indica e Od 2-mEGFP signal. (B) Shows a ep esen a ion o he de ec ion ange o
he wo channels.
86
sub ac ion o C2 in ensi y le els om C1. This sub ac ion was applied o all Z-
s eps o he mul idimensional s ack.
All panels shown in igu es a e a e sub ac ion o esicle au o- luo escence.
ii. Mo he +cen iole+ex usion+–+quan i ica ion+
Od 2-mEGFP labeling was su icien o unambiguously iden i y single mo he
cen ioles, and i was addi ionally con i med by co-localizing wi h he Poc1-
mChe y ma ke o he spindle pole labeled by Cy3- ubulin.
Fo quan i ying mo he cen iole localiza ion a he me aphase II spindle, I
coun ed he numbe o imes an Od 2-mEGFP labeled cen iole was obse ed a
he MII spindle’s ou e pole s. inne pole. Fo quan i ying mo he cen iole
localiza ion a he second pola body (PBII) s age, I coun ed he numbe o imes
Od 2-mEGFP cen iole was ex uded in o PBII s. he numbe o imes ha i
emained inside he cy oplasm.
No e ha PBI always con ains an Od 2-mEGFP- and a non-labeled cen iole.
The same quan i ica ion was applied o oocy es injec ed wi h Chibby-mEGFP.
3.7.3. 3D acking o cen ioles
To ollow cen iole anspo , I de eloped a me hod o i) au oma ically segmen
ou he cell ou line based on he cy oplasmic backg ound luo escence, ii) de ec
cen iole posi ions o e ime and in 3D, iii) calcula e he minimum dis ance o
cen ioles o he plasma memb ane o e ime and in 3D, and inally i ) plo
minimum dis ances o e ime. Ou 3D quan i ica ion in ends o limi e o s
associa ed wi h di e en 3D oocy e and spindle o ien a ions, which could a ec
measu emen s pe o med in 2D.
This me hod was o iginally de eloped o Poc1-mEGFP signal, bu wo ks
equally o EB3-mEGFP wi h a ew changes ha will be discussed in he
app op ia e sec ion.
i. Cell+ou line+segmen a ion+
I de eloped a Fiji mac o o au oma ically segmen he cell ou line and u n i
in o a se o 3D su ace coo dina es. An ini ial il e ing s ep was pe o med using
87
he in-buil plugin “Aniso opic Di usion 2D” il e (numbe o i e a ions: 40, edge
h eshold heigh : 2), which e icien ly il e s ou single pixel noise while p ese ing
sha p edges. Nex , addi ional Z slices we e added by in e pola ion esul ing in
iso opic XYZ esolu ion. This in e pola ion “simula es” a plasma memb ane
close o a eal plasma memb ane. This was ollowed by ano he il e ing s ep
(“3D Gaussian blu ”, XYZ sigma=0.8), ollowed by an au oma ic h esholding
(using Fiji’s “Mean” algo i hm) ha c ea es a mask, i.e. a bina y 3D image o he
cell ou line (whi e: ou side o cell, black: inside o he cell). The mask was il e ed
by he “Analyze pa icles” unc ion, based on size (size (pixel2)=5000 o in ini y).
Finally, cell ou lines coo dina es we e sa ed using he Fiji unc ion (“Sa e XY
coo dina es...”), looping h ough Z and ime o ob ain all coo dina es in a 4D
s ack.
ii. Cen iole+ acking+o e + ime+and+in+3D++
The il e ed Z s ack ob ained in Fiji (a e “3D Gaussian blu ”) was loaded in o
Ima is o pe o m cen iole acking, using he au oma ic “spo de ec ion” unc ion
plus he in eg a ed acking. Again, cen ioles we e de ec ed based on in ensi y
and size. Spo s a e hen acked using he “Au o eg essi e Mo ion” algo i hm.
Se e al pa ame e s can be se , such as he maximum dis ance (µm) expec ed
and he maximum gap size allowed be ween ime poin s du ing he acking.
T acks we e u he selec ed based on hei du a ion.
Spo de ec ion was manually con olled and spo s manually edi ed when
au oma ic spo de ec ion ailed. The spo s XYZ coo dina es we e expo ed o an
Excel ile.
iii. Minimum+dis ance+be ween+cen iole+and+plasma+memb ane+
Using he 3D plasma memb ane coo dina es and he 3D cen iole coo dina es
(bo h o e ime), he inal s ep is o measu e he dis ance be ween each cen iole
and he closes poin in he plasma memb ane (i.e. he minimum dis ance). Fo
his, a sc ip was w i en in Ma lab (h p://www.ma hwo ks.com/p oduc s/ma lab/).
All cell ou line XYZ coo dina es we e loaded in o a single able, as well as all
cen iole coo dina es. The minimum dis ance (in µm) be ween he wo was
calcula ed by sea ching o he minimum Euclidian dis ance among any possible
94
K4Fe(CN)6 (Me ck) in 0.1 M cacodyla e bu e . Seconda y pos - ixa ion was hen
pe o med wi h 1% OsO4 in 0.1M cacodyla e bu e . The samples we e s ained
wi h aqueous UA and g adually dehyd a ed in inc easing concen a ion o e hanol
in wa e ( om 25% up o 100%). The sample was in il a ed wi h inc easing
concen a ion o Epon in e hanol ( om 25% o 100%). Oocy es we e hen
moun ed in esin molds and le o polyme ize o h ee o ou days a 60oC. The
esin blocks we e inally immed using a imming diamond kni e (Dia ome) o
c ea e a e e ence su ace o u u e measu emen s.
X7 ay+
Be o e EM image acquisi ion, we pe o med Mic oscopic X- ay compu ed
omog aphy (mic oCT) scanning in a Phoenix Nano om m (GE Sensing &
Inspec ion Technologies GmbH, Ge many) ope a ing unde Phoenix da os|x 2
and xs con ol so wa e (GE Sensing & Inspec ion Technologies GmbH,
Ge many). Resin-embedded samples we e immed o a smalle olume (<1
mm3) and moun ed as close as possible o he X- ay sou ce, o ob ain a highe
esolu ion upon imaging. The mic oCT olume was econs uc ed using Phoenix
da os|x econs uc ion so wa e (GE Sensing & Inspec ion Technologies GmbH,
Ge many), and he olume was hen p ocessed using he VGS udio MAX
so wa e (Volume G aphics).
The mic oCT da ase s we e hen loaded in Ami a (FEI company,
h p://www. ei.com/so wa e/ami a-3d- o -li e-sciences/), and semi-au oma ically
segmen ed using he “Labels” module. Then, 3D su ace models we e gene a ed,
which exposed he esin block, he oocy e and mo e impo an ly he p o uding
PBI ( ig. 3.10). The dis ance be ween he PBI and he esin block was hen
measu ed in Ami a, in o de o de e mine how much ma e ial can be immed
om he esin block un il eaching he PBI. The e o e, his X- ay isualiza ion
allowed us o c ea e a “dis ance map” o he PBI and sec ion only he egion
a ound he PBI, ins ead o sec ioning h oughou he en i e oocy e as pe o med
be o e. Sec ions o 200nm we e cu and collec ed on o g ids o u he EM
analysis.

95
Sample+ isualiza ion+and+ omog aphy+
Highe magni ica ion images o he oocy es we e acqui ed using he Bio win
elec on mic oscope (120kV T ansmission Elec on Mic oscope, FEI company).
Tomog ams o he selec ed 200nm sec ions we e hen ob ained wi h F30 (300 kV
TEM, FEI company). The omog ams we e hen assembled and aligned in
3DMOD.
3.7.7. Mo pholinos agains mo he cen iole
mRNA
Mo pholinos a e small oligome s ha bind a ge mRNA and block ansla ion,
consequen ly educing p o ein le els (Wada e al., 2012). Mo pholinos we e
designed as an an isense sequence o he 5’ end o Od 2, Chibby, and CEP164.
As con ol, sense mo pholinos we e injec ed ( able 1).
Each mo pholino sequence has a leng h o 20-30bp and includes he s a
codon o he a ge sequence. Each mo pholino (syn he ized by Gene Tools) was
dissol ed in wa e o a inal concen a ion o 1mM.
Figu e 3.10: Mic oCT da ase s when loaded in Ami a. Oocy es a e shown in o ange, embedded
in he esin block (yellow). Le panels (A) and (B) show highe magni ica ions o p o uding PBI.
Highe magni ica ions inse s o he PBI a e equally shown. Ma hia Win e -Ka eman gene a ed
hese 3D models.
96
Table 1: Lis o mo pholinos es ed. An isense sequences a e p o ided, excep o he con ol
(sense sequence p o ided).
Mo pholino (an isense)
Sequence 5’ – 3’
Od 2
TGGTCATCCTCTACGAGATTTTCCA
CEP164
AGCTGATCTCCCATCATCTTGATAT
Chibby
TGTTACTCGGGAGAAGTGGCATCTT
Con ol sense
GTTGGTCAATTCAAGATGCCACTTC
i. Expe imen al+de ails+and+image+acquisi ion+
We pe o med mo pholino deple ion in oocy es and emb yos. Mo pholinos o
ou a ge genes we e injec ed in o oocy es, which we e incuba ed o a o al o
h ee days a 14°C. The day be o e imaging, oocy es we e injec ed wi h EB3-
mChe y mRNA and e-incuba ed a he same empe a u e. These expe imen al
condi ions we e e ec i e o CEP164 and Od 2, and o Chibby mo pholino
injec ion in emb yos and oocy es, espec i ely. O he mo pholino concen a ions
and incuba ion pe iods we e es ed o CEP164 and Od 2 in oocy es.
The oocy es we e li e imaged du ing he p ocess o meiosis. Spindle
mo phology and beha io we e eco ded using EB3-mEGFP ma ke .
Emb yos we e obse ed a ea ly gas ula s age, 24h a e e iliza ion, using
he mic oscope Zeiss Cellobse e .
ii. Quan i ica ion++
Oocy es we e analyzed and accessed acco ding o he ollowing pheno ypes
(o lack o ): i) spindle ancho ing de ec s and ii) PB ex usion de ec s. Emb yos
we e accessed acco ding o i) cell di ision de ec s, and ii) pe u ba ion in cilia
o ma ion.
97
Acknowledgmen s:+
K esimi (K eso) C nokic (Animal House, EMBL) o aking ca e o he s a ish
(and all he o he animals om he ma ine acili y).
Kalman Somogyi (Léná lab) p epa ed he s a ish cDNA collec ion (see
sec ion 3.1). Kalman also cloned Chibby-mEGFP (see sec ion 3.2) and es ed
i s localiza ion. Mo eo e , he pe o med all mo pholino expe imen s (see sec ion
3.7.7.).
Kasia Ta nawksa (Nédelec’s g oup, EMBL) p o ided he labeled ubulin used
in his wo k (see sec ion 3.2).
Kon ad Rudolph (Ma ioni’s g oup, a EMBL/EBI) w o e all he R sc ip s: i) in
he alida ion o mo he and gene al cen iola ma ke s (see sec ion 3.7.1 ii),
and o ii) gene a ing he mean cu es o he MG-132 cyclinB-exp essing
oocy es (see sec ion 3.7.5 i). Pé e Léná helped wi h he Fiji mac o o isola e
he Od 2-mEGFP signal and he eloci y measu emen s (see sec ion 3.7.2 I and
3.7.3 i ). Philippe Bun (Léná ’s g oup) helped wi h he Fiji mac o o cell
memb ane segmen a ion (see sec ion 3.7.3 i). Se ge Dimi ie (Nédelec’s g oup)
gene a ed he sc ip in Ma lab o calcula e he dis ances be ween he cen iole
and he plasma memb ane (see sec ion 3.7.3 iii).
Toge he wi h Julia König (Mülle -Reiche ’s g oup, a D esden Uni e si y o
Technology) we immobilized s a ish oocy es by high-p essu e eezing, which
she hen p ocessed and ho oughly se ial sec ioned (see sec ion 3.7.6 i). De im
Acehan ( o me membe o he Elec on Mic oscopy Co e Facili y, EMBL) helped
me acqui ing he omog ams o hese samples (see sec ion 3.7.6 i). Ped o
Machado (Elec on Mic oscopy Co e Facili y, EMBL) helped me wi h he 3D
models gene a ed om he omog ams (see sec ion 3.7.6 i). Toge he wi h
Ma hia Win e -Ka eman (Schwab’s g oup a EMBL) we ixed he oocy es by
chemical ixa ion. Ma hia pe o med all u he p ocessing, X- ay sc eening,
sec ioning and omog aphy o hese samples (see sec ion 3.7.6.ii).
I would like o hank all o all he g ea help you p o ided.
A las , I would like o hank all he ac ual Léná labo a o y membe s, o all
he sha ed equipmen and eagen s, and a special hanks o Masashi Mo i, a
o me labo a o y membe , who augh me a lo abou s a ish oocy es.
98
99
4. RESULTS
“The mos exci ing ph ase o hea in science, he one ha he alds he mos disco e ies,
is no ‘Eu eka!’ (I ound i !) bu ‘Tha ’s unny…’”
― Isaac Asimo
4.1. Es ablishmen o cen iole composi ion
and li e cell cen iola ma ke s in
s a ish
4.1.1. Iden i ica ion o homologs o cen iola
p o eins
P e ious s udies ha e analyzed he ul as uc u e o cen ioles in s a ish, bu
he molecula composi ion was no known. The s a ish cen iole ul as uc u e
ollows he conse ed s uc u e o me azoan cen ioles wi h nine iple s o
mic o ubules cons i u ing he cen iole’s cylinde (Ka o e al., 1990). This
conse ed s uc u e sugges s ha he cen iole’s p o ein composi ion migh also
be conse ed. To his end, an ex ensi e phylogene ic compa ison o cen iole
s uc u e and molecula composi ion is al eady a ailable o a la ge panel o
species (Ca alho-San os e al., 2010; Hodges e al., 2010). Howe e , hese
s udies did no include in o ma ion on he molecula composi ion o s a ish
cen ioles because no genomic o ansc ip omic da a was a ailable.
Recen ly, he Léná labo a o y in collabo a ion wi h he labo a o y o P o .
Takeo Kishimo o (Tokyo Ins i u e o Technology, Tokyo, Japan) ini ia ed a s a ish
ansc ip ome sequencing p ojec o he wo s a ish species P. pec ini e a and
P. minia a. Using hese da ase s, I iden i ied s a ish homologs o cen iola
p o eins. The iden i ica ion o he s a ish homologs is ob iously essen ial o
u he molecula analyses o cen osomal p ocesses.

100
In my sea ch I included cen iola p o eins ha ha e been analyzed in he wo
mos comp ehensi e compa a i e s udies (Ca alho-San os e al., 2010, 2011;
Hodges e al., 2010), as well as he unc ionally bes desc ibed cen iola p o eins
in he li e a u e. Addi ionally, since ou cen al hypo hesis is based on a speci ic
beha io o mo he cen ioles, I ha e speci ically ocused on p o eins ha localize
o he mo he cen iole-speci ic appendages.
S ikingly, I was able o success ully iden i y homologs o all 25 cen iola
p o eins es ed ( ig. 4.1). Fi s , I iden i ied he homologue o he key componen o
he mic o ubule nuclea ing γTuRC complex, γ- ubulin and he key egula o o
mic o ubule g ow h, he plus ip-localizing EB1 p o ein, bo h o which a e widely
conse ed among euka yo es (Raynaud-Messina and Me des, 2007; Ti naue
and Bie e , 2000). I was able o addi ionally iden i y all o he ubulin- amily
membe s in s a ish: he componen s o he mic o ubule subuni s, he e odime
o ming α- and β- ubulin, and also δ- and ε- ubulin p oposed o be in ol ed in
he s abiliza ion o he cen iola mic o ubule iple (Winey and O’Toole, 2014).
I also iden i ied all he main p o eins equi ed o cen iole duplica ion and
cen iole elonga ion: PLK4, CEP192, CPAP, SAS-6 and STIL. The same applies
Figu e 4.1: Iden i ica ion o s a ish homologs o cen iola ma ke s. The homologs ha we e
success ully iden i ied a e indica ed by (+). Highly di e gen p o eins bu s ill conside ed
unc ional homologs a e iden i ied by a blue squa e. Gene al and mo he o daugh e speci ic
ma ke s a e indica ed in he schema ic ep esen a ion a he bo om o he igu e. Al e na i e
names o o he species a e p o ided.
101
o he ca wheel s abilize CEP135 and he p o ein CP110, which limi s cen iole
g ow h. The componen s o he pe icen iola ma e ial (PCM) could also be
iden i ied (CEP192, CEP152 and Pe icen in), as well as PLK1, he mi o ic
kinase, impo an o PCM ec ui men a mi osis ( e e ed o as cen osome
ma u a ion). Addi ionally, Poc1 and Cen in-2 a e highly conse ed p o eins
among euka yo es (Fou age e al., 2010; Kelle e al., 2009; Salisbu y, 2007),
and I ound bo h o be p esen in s a ish. Poc1 has impo an unc ions in
cen iole in eg i y (Venoux e al., 2012) and basal body s abili y (Pea son e al.,
2009). Many s udies sugges ha Cen in-2 has a ole in cen iole duplica ion,
ye i s unc ion is no comple ely unde s ood (Salisbu y, 2007). The binding
pa ne o Cen in-2, hPoc5, in ol ed in cen iole elonga ion, was also iden i ied.
Fu he mo e, I also looked o p o ein homologs speci ic o he mo he and
daugh e cen iole. As men ioned be o e, he mo he cen iole has wo se s o
mo he appendages. These include he subdis al appendage p o eins Ninein and
CEP170, and he dis al appendage componen s CEP164. Chibby, which
in e ac s wi h CEP164 and localizes o he dis al appendages (Bu ke e al.,
2014), was also ound in s a ish. Addi ionally, he ubiqui ous appendage
componen Od 2 was iden i ied. Cen obin is a speci ic daugh e cen iole
ma ke and also p esen in s a ish oocy es (see In oduc ion o mo e
in o ma ion abou hese p o eins).
Taken oge he , I was able o unambiguously iden i y s a ish homologs o all
es ed s uc u al and PCM componen s in he s a ish ansc ip ome.
Compa isons e eal ha , consis en wi h i s phylogene ic posi ion, s a ish
cen ioles ha e a “s anda d” deu e os ome a chi ec u e, and he e o e simila o
human (H. sapiens) and sea u chin (S. pu pu a us). In con as , s a ish
cen iole composi ion is qui e dis inc om p o os ome cen ioles o he ui ly
(D. melanogas e ) o he oundwo m (C. elegans) ( ig. 4.1). No ably, al hough
many o he key cen iola p o eins and hei unc ions ha e been i s iden i ied in
C. elegans, i has highly di e gen cen iola composi ion, meaning ha i s
p o eins ha e educed homology wi h o he cen iola p o eins and as a esul ail
o be de ec ed in compa a i e s udies (see blue squa es in he ig. 4.1). This
highly di e gen se o cen iole p o eins in consis en wi h he highly di e gen
cen iole ul as uc u e also p esen in his o ganism (Hodges e al., 2010).
102
4.1.2. Es ablishmen o cen iola ma ke s
Nex I will de ail he luo escen p o ein cen iola ma ke s ha we e cloned ou
o he se o homologs iden i ied abo e. Fo each, alignmen de ails and p o ein
domain a chi ec u e will be p o ided. Two ypes o ma ke s we e gene a ed:
“gene al” molecula ma ke ha labels bo h cen ioles o he pai (used as a
cen iole e e ence), and also speci ic mo he cen iole ma ke s ha speci ically
iden i y mo he cen ioles.
Cen in-2 and Poc1 we e es ed as gene al cen iola ma ke s, as bo h ha e
been b oadly used in o he species (Fou age e al., 2010; Kelle e al., 2009; Piel
e al., 2000; Whi e e al., 2000). Sequence alignmen s o hese p o eins show a
high simila i y be ween he p o ein sequences ound in s a ish and he o he
o ganisms analyzed (see Appendix sec ion 6.3.1 and 6.3.2, espec i ely).
Mo eo e , all he cha ac e is ic domains, desc ibed o hese p o eins in o he
species, can be de ec ed. S a ish Cen in-2 con ains ou Ca2+-binding EF-hands
domains (see ig. 4.2) and also con ains a i s C- e minal end he domain
KKTSLY, which is cha ac e is ic o cen iole-associa ed cen ins (see ig. 4.2,
o ange domain) (Salisbu y, 2007; Schiebel and Bo nens, 1995). S a ish Poc1
con ains se en WD40 epea s and he C- e minal coiled-coil which includes he
conse ed “Poc1” domain (see ig. 4.2, o ange domain) (Fou age e al., 2010;
Kelle e al., 2009) (see ig. 6.3 and 6.4 in Appendix o p o ein alignmen s).
To gene a e a mo he cen iole speci ic ma ke I ca e ully analyzed he
li e a u e and selec ed a sho lis o po en ial ma ke s o be ini ially cloned and
es ed: Od 2, Chibby, EB1 and ε-Tubulin. This lis was based on i) alida ion as
mo he ma ke in p e ious s udies, ii) sequence leng h compa ible wi h
ampli ica ion o he ull cDNA sequence. This echnical cons ain excluded well-
desc ibed mo he cen iole ma ke s such as CEP164, CEP170 and Ninein (Chen
e al., 2003; G ase e al., 2007; Gua guaglini e al., 2005; Lau e al., 2012; Ou e
al., 2002; Wang e al., 2009), which a e e y la ge p o eins (mo e han 1500
amino acids) and hus ampli ica ion om cDNA is echnically mo e di icul . Od 2
is pe haps he bes desc ibed mo he cen iole ma ke on his lis , wi h mul iple
pape s epo ing i s ole as a mo he appendage componen (Chang e al., 2013;
Ishikawa e al., 2005; Kunimo o e al., 2012; Lange and Gull, 1995; Nakagawa e
al., 2001; Schweize and Hoye -Fende , 2009; Soung e al., 2006; Ta eishi e al.,
103
2013). Fewe s udies epo on EB1 and ε-Tubulin as mo he cen iole ma ke s
(Chang e al., 2002; Louie e al., 2004). Chibby was only ecen ly cha ac e ized
as a mo he cen iole ma ke (Bu ke e al., 2014; S ee e e al., 2012) and
he e o e jus ecen ly included in his s udy. All o hese ma ke s we e cloned
and es ed by exp ession o injec ed mRNA in s a ish oocy es. Ou o hese,
Od 2 and Chibby showed speci ic luo escen labeling o he mo he cen ioles.
Since a speci ic signal could no be de ec ed, EB1 and ε-Tubulin we e no u he
cha ac e ized.
Od 2 was i s epo ed in mammalian cells (B ohmann e al., 1997; Lange and
Gull, 1995) and al hough phylogene ic analyses o his p o ein we e ne e
ca e ully pe o med, homologs o a ious species a e anno a ed. Howe e , hese
desc ibed Od 2 homologs a e limi ed o e eb a es ( og, zeb a ish, a , mouse
and monkey) and o he hemi-cho da e aco n wo m (Saccoglossus). Od 2
homologs we e no p e iously epo ed in o he phylogene ic g oups. Indeed, my
analysis iden i ied Od 2 he i s ime in echinode ms, namely in s a ish and he
Figu e 4.2: Cons uc design o cloned p o eins. All mEGP we e placed a he C- e minus o he
p o ein. Fo each p o ein, he espec i e numbe o amino acids and cha ac e is ic domains a e
indica ed. (A) S a ish Cen in-2: EF-h indica es EF-hands domains. In o ange, a speci ic
domain iden i ied in cen ins associa ed wi h cen ioles. (B) S a ish Poc1: WD1–7 indica es he
se en WD40 domains. The Poc1 domain (o ange) can also be iden i ied a he C- e minal end
o he p o ein. CC indica es coiled-coil domains p esen in Poc1, Od 2 and Chibby.
110
iming, esul ing in ully ma u ed eggs ha can be e ilized and de elop in o
iable emb yos. PB ex usion is p eceded by a con ac ion wa e, which causes a
subs an ial mo emen o he oocy e. My imaging condi ions also accoun o his,
which gua an ees ha a all imes he en i e spindle is imaged.
Impo an ly, he li e da a ecapi ula e all s eps o spindle assembly p e iously
desc ibed du ing s a ish meiosis. In addi ion, i e eals all he delica e de ails
and p ocesses ha ha e emained uncha ac e ized p e iously. Acco dingly, my
li e cell da a shows o he i s ime how he MI spindle assembles pa allel o he
plasma memb ane and hen o a es o assume a pe pendicula posi ion o he
co ex be o e PB ex usion. This clea ly di e s om he immedia e pe pendicula
o ien a ion o he MII spindle assembly, which I could also show o he i s ime.
Addi ionally, using EB3-mEGFP3 as a ma ke , his assay will allow quan i ica ion
o mic o ubule dynamics du ing spindle assembly in u u e s udies.
4.2.2. Li e imaging wi h gene al cen iole ma ke s
Al hough p o iding a good o e iew o mic o ubule dynamics and spindle
assembly and disassembly du ing meiosis, EB3-3mEGFP3 imaging does no
allow o di ec ly in es iga e he p esence o cen ioles. EB3 oci a e indica i e o
he p esence o cen ioles, bu could also ep esen acen iola mic o ubule
o ganizing cen e s (MTOCs) ha a e seen in mouse oocy es, o example.
The e o e, I used he abo e es ablished imaging condi ions and he cen iole
ma ke s I desc ibed in 4.1, o ollow he a e o indi idual cen ioles h oughou
he meio ic di isions. Fi s , I co-injec ed bo h gene al cen iole ma ke s Poc1-
mChe y and Cen in2-mEGFP and con i med ha bo h ma ke s a e able o
e icien ly label he ou indi idual cen ioles in s a ish oocy es ( ig. 4.8).
While Cen in2-mEGFP labeling is es ic ed o he cen ioles, Poc1
addi ionally labels mic o ubules ( ig.4.8 and 4.9). This u ned ou o be an
ad an age, because his co-labeling o mic o ubules acili a es he iden i ica ion o
cen ioles in he oocy e. Addi ionally, Cen in-2 o en o med addi ional
luo escen agg ega es, also desc ibed in o he species ha we e di icul o
unambiguously dis inguish om he cen ioles ( ig.4.8). The e o e, luo escen ly
agged Poc1 was hen he p e e ed cen iole ma ke used in u he expe imen s.

111
Using hese ma ke s, I could de e mine cen iole numbe a any gi en meio ic
phase, which has no ye been shown in any p e ious s udies o s a ish oocy es.
Thus, I could obse e in a li e oocy e ha he poles o he MI spindle a e
o ganized in a simila manne o soma ic cells wi h one pai o cen ioles a each
spindle pole ( ig. 4.8 and 4.9, A and B). Upon PBI ex usion, he pai o cen ioles
p oximal o he co ex is ex uded wi h hal o he ch omosomes ( ig. 4.8 and 4.9,
E), whe eas he o he pai emains in he oocy e ( ig. 4.8 and 4.9, C and D). A
he end o MI, as no cen iole duplica ion occu s be ween MI and MII, his pai
spli s and he single cen ioles o m he poles o he MII spindle ( ig. 4.8 and 4.9,
F and G). This con igu a ion is e y di e en om he MI spindle and mi o ic
spindles. A PBII ex usion, one cen iole is ex uded in o he PBII ( ig. 4.9, K),
and a single cen iole emains in he cy oplasm o he ma u e egg ( ig. 4.9 J).
Taken oge he , I could es ablish li e cell imaging condi ions o ollow
cen ioles in s a ish meiosis o e 2 hou s in 3D a 30 second ime esolu ion
wi hou pe u bing he p ocess. Fu he mo e, using luo escen cen iola p o ein
ma ke s, I could ollow meiosis in li e oocy es a a esolu ion ha allowed me o
unequi ocally iden i y a all imes all single cen ioles p esen a ha speci ic
Figu e 4.8: Two pai s o cen ioles localize a he MI spindle, whe eas single cen ioles localize
a he poles o he MII spindle. Dashed whi e line shows he ou line o he oocy e. Inse s show a
highe magni ica ion o cen ioles. Pannels show a Z-p ojec ion o he acqui ed s acks. Scale
ba : 10 µm.
112
s age. Consis en wi h p e ious elec on EM s udies, hese obse a ions show
ha in s a ish oocy es he MI spindle is o ganized by a pai o cen ioles a each
pole, while he MII spindle has an unusual con igu a ion wi h one single cen iole
a each pole. Consequen ly, in meiosis 3 ou o 4 cen ioles a e ex uded in o he
PBs, and only a single cen iole emains in he ma u e egg.
Figu e 4.9: Poc1-mEGFP labels cen ioles and he mic o ubules o he spindle. A owheads
poin a cen ioles. Inse s (A-M) show magni ied cen ioles o each ime poin . Mo ie s a s 1h
a e 1-MA ho mone addi ion. Z-s acks eco ded e e y 30 seconds. Pannels show a Z-
p ojec ion o he acqui ed s acks. Scale ba : 10 µm. A schema ic ep esen a ion o he
cen ioles o ganizing he meio ic spindles is shown.
113
4.3. Mo he cen ioles a e ex uded in o he
pola bodies
4.3.1. Each cen osome consis s o a mo he and
a daugh e cen iole
The abo e desc ibed ools and assays allowed me o he i s ime o label
s a ish cen ioles wi h luo escen ma ke s and ollow hem li e. Indeed, I could
isualize single cen ioles and show ha s a ish oocy es ha e wo cen osomes,
each o which is composed o a pai o cen ioles a meio ic onse . I is well
es ablished in he li e a u e ha he cen osome is composed o one mo he and
one daugh e cen iole. Howe e , un il now no de ini i e da a on cen iole
ma u a ion s a e was a ailable in s a ish oocy es.
To es i he no mal con igu a ion o he cen osome is obse ed in s a ish
oocy es, I co-exp essed one gene al (Poc1-mChe y o Cy3-Tubulin) and one
mo he cen iole speci ic (Od 2-mEGFP) ma ke in oocy es. I could isualize ha
du ing me aphase I, a single Od 2-mEGFP-labelled mo he cen iole localizes a
each MI spindle pole, as expec ed (Fig. 4.10). Consequen ly, one Od 2-mEGFP
labeled cen iole is ex uded in o PBI along wi h one non-Od 2-mEGFP labeled
cen iole (Fig. 4.10). The pai ha emains in he oocy e hen sepa a es, and he
single cen ioles o ganize he MII spindle. This is consis en wi h he da a I
ob ained using only a gene al ma ke (as desc ibed in he p e ious sec ion).
Howe e , using he speci ic Od 2-mEGFP-mo he -labelling I obse e clea ly ha
he wo spindle poles a MII a e di e en in ega d o cen iole age, one
con aining mo he cen iole and he o he he daugh e (Fig. 4.10).
I has o be no ed ha he mo he ma ke s used he e canno dis inguish
be ween he “olde ” mo he cen iole, i.e. he “g andmo he ”, and he “new”
mo he , and I will he e o e conside ha bo h poles o he MI spindle a e
equi alen . I is impo an o men ion ha he in ensi y o Od 2-mEGFP labeling is
some imes a iable be ween he wo mo he cen ioles, wi h one mo e in ensely
labeled han he o he . Howe e , his di e ence is likely o esul om op ical
114
e ec s, i.e. cen ioles deepe in he cy oplasm appea dimme due o ligh
sca e ing.
4.3.2.
Figu e 4.10: Each s a ish cen osome has one mo he cen iole. Mo ie s a s 1h15 a e 1-MA
ho mone addi ion. Z-s acks eco ded e e y 38 seconds. Pannels show a Z-p ojec ion o he
acqui ed s acks. Scale ba : 5 µm. Dashed whi e line indica es he ou line o he oocy e.
115
4.3.2. The mo he cen iole is speci ically
ex uded in o he second pola body
In iguingly, I obse ed in all cases ha he single Od 2-mEGFP-labeled
mo he cen iole localizes a he MII spindle pole acing he plasma memb ane,
he ou e pole, whe eas he daugh e cen iole localizes a he pole owa ds he
cell in e io , he inne pole (n=17/17) ( ig. 4.11 B). The 3D da a can be di icul o
isualize and in e p e in 2D, he e o e 3D isualiza ion (using he so wa e
Ima is) was used o con i m all o ien a ions (( ig. 4.11 A and B)
As a consequence o i s localiza ion o he ou e spindle pole, he mo he
cen iole is ex uded in o he PBII ( ig. 4.10). To es whe he his is a speci ic
mechanism o mo he cen iole, I exp essed he mo he ma ke Od 2-mEGFP
oge he ei he wi h a gene al ma ke Poc1-mChe y o Cy3- ubulin, and coun ed
how o en he mo he cen iole is ex uded in o he PBII, in a la ge numbe o
oocy es ( ig. 4.12).
Figu e 4.11: The mo he cen iole always localizes o he ou e pole o he MII spindle. (A) Z-
p ojec ion, gene a ed in Fiji. Scale ba : 10 µm. (B) 3D isualiza ion o he same image, using
Ima is. No e how he mo he cen iole clea ly localizes o he ou e pole in (B). The oocy e’s
con ou is shown in g ey. Scale ba : 5 µm.

116
Figu e 4.12. Mo he cen iole is always ex uded in o he PBs. (A) and (B) show an example o a
double injec ion wi h he mo he cen iole ma ke Od 2-mEGFP and ei he Poc1-mChe y o Cy3-
Tubulin. (*) Indica es he emaining daugh e cen iole. (C) shows an example o a double injec ion
wi h he mo he cen iole ma ke Chibby-mEGFP and EB3-mChe y3. All pannels show a Z-p ojec ion
o he acqui ed s acks. Scale ba : 10 µm. (D) shows he numbe o cases obse ed o con igu a ion
(depic ed below) o ex usion o mo he cen iole ma ke .
117
S ikingly, in all oocy es imaged (n=42), I ound he Od 2-mEGFP labeled
mo he cen iole in he PBII, whe eas he Od 2-mEGFP nega i e daugh e
cen iole always emained in he ma u e egg ( ig. 4.12 A, B and D). Hence, hese
obse a ions clea ly show ha in MII, he mo he cen iole is speci ically ex uded
in o he PBII.
To con i m his pa e n wi h ano he mo he cen iole ma ke , I es ed Chibby-
mEGFP, ecen ly desc ibed as a p o ein localizing o he dis al mo he
appendages (Bu ke e al., 2014). Localiza ion o Chibby-mEGFP ollows exac ly
he same pa e n as Od 2-mEGFP: one single cen iole labeled pe cen iole pai
a MI, an asymme ic localiza ion o he ou e MII spindle pole (see Appendix
sec ion 6.4), and he esul ing ex usion o he Chibby-mEGFP-labeled mo he
cen iole in o PBII (n=12/12) ( ig. 4.12 C and D).
Taken oge he , I alida ed bo h Chibby- and Od 2-mEGFP as mo he
cen iole ma ke s, by which I was able o cha ac e ize cen osome composi ion
and ma u a ion s a e o cen ioles in s a ish oocy es. Mos impo an ly, by
ollowing cen ioles in li e oocy es h oughou he meio ic di isions, I could show
ha a MII, he spindle always o ien s wi h he mo he cen iole acing he co ex,
and consequen ly he mo he cen iole is ex uded in o he PBII ( ig. 4.10, 4.11
and 4.12, see schema ic ep esen a ion in ig. 4.13).
Figu e 4.13. Mo he cen ioles a e always ex uded in o he PBs. One pai o cen ioles (each
wi h one mo he and one daugh e ) o ganizes he MI spindle. Du ing MII, he mo he cen iole
localizes o he ou e spindle pole and is consequen ly ex uded in o he PBII. A single daugh e
cen iole emains in he ma u e egg.
118
The e o e, a clea asymme y is es ablished be ween he ex uded and
e ained cen ioles: he wo mo he cen ioles a e ex uded in o he PBs, whe eas
he single daugh e cen iole emains in he ma u e egg ( ig. 4.13). The ac ha I
ha e obse ed his pa e n in all oocy es imaged wi hou excep ion (n>60)
indica es ha his is a igh ly con olled p ocess.
4.4. Ex usion o he mo he cen ioles is
essen ial o cen iole inac i a ion
4.4.1. The single daugh e cen iole emaining in
he egg does no con ibu e o he zygo ic
spindle
I is a pa e n gene al o me azoa ha he zygo ic spindle is o ganized by he
cen ioles p o ided by he spe m, while he emale cen ioles a e inac i a ed
be o e he o ma ion o he zygo ic spindle. Speci ically, s a ish oocy es can be
e ilized al eady du ing meiosis, sho ly be o e he PBI ex usion. In his case, as
p e iously shown (Ki ajima and Hamaguchi, 2005), he spe m cen osomes s ay
“do man ” in he e ilized oocy e up o he comple ion o emale meiosis. A e
comple ion o meiosis, he daugh e cen iole is elimina ed sho ly a e he end o
meiosis, and he p onucleus o ms. The spe m cen osome as e apidly g ows
and cap u es he emale p onucleus, by pulling male and emale p onuclei
owa ds each o he . The p onuclei hen use and he i s zygo ic spindle is
o ganized by he cen ioles p o ided by he spe m (Zhang e al., 2004).
Why do he cen ioles no con ibu e o he zygo ic spindle, and a wha poin
a e hey elimina ed? As desc ibed abo e, imma u e oocy es ea u e wo pai s o
duplica ed cen ioles o which wo mo he cen ioles and one daugh e cen iole
a e ex uded in o he wo PBs in he cou se o meio ic di isions, lea ing a single
daugh e cen iole in he ma u e egg. In EB3-mEGP3 injec ed oocy es, I could
con i m ha he same sequence o e en s occu s in oocy es, which ha e been
119
e ilized du ing meiosis. Indeed, he p esence o spe m cen ioles does no a ec
he a e o he oocy e’s cen ioles – cen iole ex usion s ill occu s ( ig. 4.14).
Impo an ly, by imaging e ilized oocy es li e a he end o meiosis, I could
obse e how spe m as e ex ension is synch onous wi h he disassembly and he
disappea ance o he emaining daugh e cen iole as e ( ig. 4.14, =15.6 min).
Thus, he daugh e cen iole does no pa icipa e in he o ma ion o he zygo ic
spindle, and no sign o his cen iole is de ec ed la e , as emb yonic de elopmen
p og esses ( ig. 4.14).
In he li e a u e i is assumed ha he daugh e cen iole is elimina ed a he
end o oocy e meiosis, and my obse a ions also poin owa ds his di ec ion.
Sho ly a e comple ion o meiosis he daugh e cen iole loses i s mic o ubule
nuclea ion ac i i y as de ec ed by EB3-mEGFP3.
Figu e 4.14: The single daugh e emaining in he ma u e egg does no pa icipa e in he
emb yonic spindle. Fe iliza ion occu ed a e PBI ex usion. Mo ie s a s 1h30 a e 1-MA
ho mone addi ion. Z-s acks eco ded e e y 79 seconds. Pannels show a Z-p ojec ion o he
acqui ed s acks. Scale ba : 10 µm. See schema ic ep esen a ion below.
126
mo he cen iole. Addi ionally, I con i med his by ollowing he mo he cen iole
anspo in double EB3-mChe y3 and Od 2-mEGFP-labeled oocy es ( ig. 4.19).
These da a di ec ly con i ms ha only he mo he cen iole has he abili y o be
anspo ed o he cell memb ane, and no mo ion o he daugh e cen iole
owa ds he co ex was e e obse ed.
Figu e 4.18: (A) Mo he cen iole anspo occu s sho ly a e PBI ex usion. 3D isualiza ion
using Ima is. Oocy e’s con ou is shown in g ey. Z-s acks eco ded e e y 12 seconds. Mo ie
s a s a e PBI ex usion. Scale ba : 5 µm. MC co esponds o mo he cen iole (B) Mo he
cen iole is i s anspo ed owa ds he plasma memb ane, whe e i hen ancho s. Cha shows
dis ance measu emen s o he cen iole o he plasma memb ane eco ded in 3D and o e ime.

127
Toge he , I conclude ha a speci ic mechanism anspo s he mo he cen iole
o he plasma memb ane sho ly a e PBI ex usion. The ea e , he mo he
cen iole emains s ably associa ed wi h he plasma memb ane un il he end o
MII. A he same ime he daugh e cen iole was ne e obse ed o mo e
owa ds he plasma memb ane bu a he mo e in o he cell in e io h ough he
elonga ion o he spindle ( ig. 4.18 and 4.19).
4.5.2. Cha ac e iza ion o he mo he cen iole
speci ic anspo mechanism
The speci ic and di ec ional anspo o he mo he cen iole owa ds he cell
co ex s ongly sugges s ha his p ocess is media ed by he cy oskele on.
The e o e, o add ess he mechanisms o he speci ic anspo o he mo he
cen iole o he cell co ex, I used a ious inhibi o s o he ac in and mic o ubule
cy oskele on. Howe e , hese ea men s u ned ou o be qui e challenging,
because cen iole anspo is a e y quick p ocess ha occu s sho ly a e he
end o MI, which in u n equi es mic o ubules ( elophase) as well as ac in
(cy okinesis) o be comple ed. I es ablished p o ocols o add cy oskele al
inhibi o s and he eby a ec cen iole anspo as speci ically as possible. Ye ,
due o he echnical di icul ies de ailed abo e, hese expe imen s a e no ye ully
conclusi e.
Figu e 4.19: Time-lapse shows mo he cen iole being anspo ed and ancho ing o he plasma
memb ane. Mo ie s a s a e PBI ex usion. Z-s acks eco ded e e y 30 seconds. Pannels
show a Z-p ojec ion o he acqui ed s acks. Dashed line shows he cell coun ou . Scale ba : 10
µm.
128
i. Is+ he+mo he +cen iole+speci ic+ anspo +d i en+by+
mic o ubules?+
To es how mic o ubules con ibu e o cen iole anspo , I ea ed oocy es
wi h he mic o ubule-depolyme izing d ug, nocodazole, sho ly a e PBI ex usion
in Poc1-mEGFP exp essing oocy es ( ig.4.20).
Figu e 4.20: (A) Mic o ubule depolyme iza ion b ings bo h cen ioles close o he plasma
memb ane. 3D isualiza ion using Ima is. Oocy e’s con ou is shown in g ey. Mo ie s a s a e
PBI ex usion. Z-s acks eco ded e e y 20 seconds. Scale ba : 5 µm. MT co esponds o
mic o ubules, PM o plasma memb ane and ncdz o nocodazole. (B) Cha shows dis ance
measu emen s o he cen iole o he plasma memb ane eco ded in 3D and o e ime. No e
how one o he cen ioles he (p esumed) mo he cen iole emains ancho ed o he plasma
memb ane, whe eas he o he ends up being los om he Z-s ack. Blue ec angle shows when
he inhibi o y d ug s a s o be ac i e.
129
Recall ha Poc1-mEGFP labels all cen ioles and spindle mic o ubules, bu
since nocodazole only depolyme izes dynamic mic o ubules, cen iola
mic o ubules a e p ac ically una ec ed, as hey a e highly s able s uc u es.
Nocodazole e ec is isible 2-4 minu es a e addi ion: mic o ubules o he MI
spindle quickly depolyme ize esul ing in a apid inwa d collapse o he spindle.
Unexpec edly, his collapse mo es bo h cen ioles nea he plasma memb ane
( ig. 4.20).
Thus, I was no able o conclude on he di ec in ol emen o mic o ubules in
he anspo o he mo he cen iole o he plasma memb ane: imed addi ion o
nocodazole causes he spindle o collapse owa ds he cell co ex deli e ing bo h
cen ioles o he cell co ex. This howe e indica es ha indeed he spindle is
ancho ed o he co ex, which jus i ies why he spindle collapses owa ds he
plasma memb ane.
Addi ionally, hese esul s clea ly show ha by b inging any cen iole close o
he plasma memb ane is no su icien o s able ancho ing: only he p esumed
mo he cen iole is able o ancho , while he p esumed daugh e cen iole di uses
away ( ig. 4.20).
ii. Is+ he+mo he +cen iole+ anspo +d i en+by+ac in?++
To es he in ol emen o ac in in he mo he cen iole anspo , I ea ed
EB3-mEGFP3-exp essing oocy es wi h la B, sho ly a e PBI ex usion, i.e. jus
be o e he beginning o he mo he cen iole speci ic anspo o he plasma
memb ane.
No e ha al hough EB3-mEGFP labels equally mo he and daugh e
cen ioles, bu hey can be dis inguished based on he mic o ubule nuclea ing a
he end o meiosis: as shown abo e (see Resul s sec ion 4.4.2 ig. 4.16) he
daugh e cen iole is inac i a ed a he end o meiosis, losing i s mic o ubule
nuclea ing ac i i y. In con as , he mo he cen iole emains ac i e and is able o
nuclea e mic o ubules in he ma u e egg. The e o e, by ollowing Poc1-mEGFP o
EB3-mEGFP3 label up o he end o meiosis, I can ack back mo he and
daugh e cen ioles.
130
I obse ed ha upon la B addi ion, he mo he cen iole (M2) is anspo ed
no mally owa ds he cell memb ane ( ig. 4.21), whe e i p ope ly ancho s
(n=6/6). Subsequen ly, as meiosis p og esses, La B- ea ed oocy es canno
ex ude PBII, because he PBII ex usion is ac in dependen . The e o e, he MII
Figu e 4.21: (A) Dynamic ac in is no in ol ed in he mo he cen iole anspo . 3D isualiza ion
using Ima is. Oocy e’s con ou is shown in g ey. Mo ie s a s a e PBI ex usion. Z-s acks
eco ded e e y 22 seconds. Scale ba : 5 µm. (B) Cha shows dis ance measu emen s o he
cen ioles o he plasma memb ane. T anspo phase indica ed by he dashed lines in he
g aph. Blue ec angle shows when he inhibi o y d ug s a s o be ac i e. M2 and D2: mo he
and daugh e cen iole, espec i ely, om he MII spindle.
131
spindle disassembles, and he abno mally e ained mo he cen iole (M2)
p ese es i s mic o ubule nuclea ing ac i i y in he ma u e egg’s cy oplasm (no e
how he daugh e (D2) loses mic o ubule nuclea ing ac i i y, whe eas he mo he
is s ill ac i e – ig. 4.21).
These da a oge he sugges ha dynamic ac in is no equi ed o mo he
cen iole anspo o he cell memb ane. Howe e , simila o nocodazole, La B
seques e s ac in monome s, and he e o e apidly a ec s dynamic o newly
o ming ac in s uc u es, howe e s able ilamen s a e much mo e slowly a ec ed.
Thus, my p o ocol o ea ing oocy es wi h La B o only a ew minu es be o e
cen iole anspo can exclude he possibili y ha he p ocess is d i en by
dynamic ac in s uc u es, bu canno exclude he possibili y o in ol emen o
s able ilamen s.
iii. Is+ he+mo he +cen iole+ anspo +dependen +on+ he+pola +
body+I+cy okinesis?+
In he p e ious sec ion, I only conside ed oocy es in which PBI o ma ion was
comple ed jus be o e la B addi ion, and in hese oocy es mo he cen iole
anspo was no mal. Howe e , i la B was added jus a li le oo ea ly, oocy es
ailed o comple e PBI cy okinesis, and he PBI collapses back in o he oocy e
( ig. 4.22).
When I analyzed hese oocy es o unde s and i anspo s ill occu ed, I ound
ha , in e es ingly, he MII spindle does no o ganize in a pe pendicula
o ien a ion. Ins ead, i o ms pa allel o he cell memb ane (no e ha M2 and D2
a e a almos he same dis ance om he memb ane – ig. 4.22). S ikingly, he
mo he cen iole is no longe anspo ed o he plasma memb ane and he en i e
MII spindle jus sinks in o he cy oplasm – ig. 4.22. I obse ed his same
pheno ype in 8 ou o 9 oocy es in which PBI cy okinesis ailed: no mo he
cen iole anspo occu s and he MII spindle o ms pa allel o he memb ane.
These da a sugges ha mo he cen iole anspo may happen only i PBI
o ma ion is comple ed. Piel and colleagues showed ha mo he cen iole mo es
owa ds he abscission si e du ing cell di ision in mammalian cells. They
hypo hesized ha his mo emen occu s because he mo he cen iole emains
connec ed wi h he mic o ubules om he midbody (Piel e al., 2001). Indeed, a

132
simila mechanism could occu in s a ish oocy es: he midbody o ma ion du ing
PBI cy okinesis would cause he mo he cen iole o mo e owa ds he abscission
Figu e 4.22: (A) PBI o ma ion migh be impo an o mo he cen iole anspo . 3D
isualiza ion using Ima is. Oocy e’s con ou is shown in g ey. Mo ie s a s a e PBI ex usion.
Z-s acks eco ded e e y 22 seconds. Scale ba : 5 µm. (B) Cha shows dis ance measu emen s
o he cen ioles o he plasma memb ane. Blue ec angle shows when he inhibi o y d ug s a s
o ac . M1 and D1 a e espec i ely he mo he and daugh e cen ioles om PBI. M2 and D2 a e
espec i ely he mo he and daugh e cen ioles om he MII spindle. Bo h mo he cen ioles
(M1 and M2) p ese e MT nuclea ing ac i i y a he end o meiosis.
133
si e. The e o e, mo he cen iole would only occu i PBI ex usion and midbody
o ms. This mo emen owa ds he memb ane would hen allow he mo he
cen iole o be a a eachable dis ance o he plasma memb ane o allow
ancho ing.
Mo he +cen iole+ anspo +is+independen +o +pola +body+cy okinesis+
R. Ma suu a and K. Chiba p e iously showed ha upon gen le cen i uga ion
o oocy es, cen ioles main ain a co ical a achmen a he animal pole o he
oocy e, whe eas he nucleus, which is less dense han he cy oplasm, mo es
away om he co ex (Ma suu a and Chiba, 2004) (see Ma e ial and Me hods
sec ion 3.7.4 ig. 3.7). Cen i uged oocy es s ill unde go meiosis: NEBD occu s
no mally, ye PB ex usion does no ake place (Ba aka e al., 1994; Ma suu a
and Chiba, 2004). As in hese cen i uged oocy es no PB is o med, his
cons i u es a pe ec sys em o add ess whe he PB cy okinesis o he midbody is
equi ed o mo he cen iole anspo o occu , as hypo hesized abo e. Would
he mo he cen iole s ill mo e o he plasma memb ane in his manipula ed
sys em?
Because I needed o co e a la ge dep h and a la ge a ea du ing li e
imaging, I used EB3-mEGFP3 in hese expe imen s. As be o e, I dis inguished
mo he and daugh e cen ioles in e ospec by acking back whe he hey a e
ac i e o no a he end o meiosis.
In e es ingly, a e ma u a ion o hese cen i uged oocy es, mo he cen ioles
a e s ill anspo ed o he plasma memb ane (n=9/9) ( ig. 4.23 A and B – no e
how bo h mo he cen ioles (M1 and M2) localize o he plasma memb ane).
Mo eo e , mo he cen ioles localizing wice as deep in he cy oplasm, when
compa ed o cen ioles in non-cen i uged oocy es a he beginning o he
anspo , a e s ill able o mo e o he cell memb ane (compa e he dis ances
be ween ig. 4.18 and ig. 4.23). Howe e , mo he cen iole anspo is slowe
(0.4 µm/min) han in non-cen i uged oocy es. One idea would be ha spindle
elonga ion (in non-cen i uged oocy es) could accele a e he anspo owa ds
he plasma memb ane. Once mo he cen ioles each he plasma memb ane,
hey also emain ancho ed. In con as , daugh e cen ioles (D1 and D2) clea ly
134
lack he po en ial o mo e o he plasma memb ane, and hey jus mo e andomly
in he cy oplasm ( ig. 4.23).
Taken oge he , hese da a indica e ha mo he cen iole anspo does no
depend on PBI cy okinesis si e, as mo he cen ioles (M1 and M2) clea ly mo e
o he memb ane in cen i uged oocy es. This mo emen is also no dis ance
dependen , as mo he cen ioles localizing deepe in he cy oplasm, can s ill
mo e o he plasma memb ane. On he o he hand, his is clea ly a speci ic
Figu e 4.23: (A) Mo he cen iole anspo occu s in a cen i uged oocy e – hey do no mo e as
a consequence o midbody o ma ion. “PM” s ands o plasma memb ane. 3D isualiza ion
using Ima is. Oocy e’s con ou is shown in yellow. Mo ie s a s a e NEBD. Inse s show
magni ica ions o he cen ioles’ localiza ion. (*) Shows nuclea localiza ion a e cen i uga ion.
Z-s acks eco ded e e y 50 seconds. Scale ba : 50 µm. (B) Cha shows dis ance
measu emen s o he cen ioles o he plasma memb ane. M1 and M2 a e mo he cen ioles. D1
and D2 a e daugh e cen ioles. In his case, classi ica ion as M1 o M2 is a bi a y (in con as
o ig. 4.22). The same applies o D1 and D2.
135
p ope y o he mo he cen ioles, as no daugh e cen iole (D1 and D2) was e e
anspo ed o he plasma memb ane.
To econcile hese esul s wi h he obse a ions desc ibed in he p e ious
sec ion ( ig. 4.22), i is clea ha he cy okine ic si e is no a equi emen o he
speci ic anspo o he mo he cen iole o he plasma memb ane. Howe e , a
ailed cy okinesis likely in oduces an addi ional mic o ubule as e om he PBI
ha migh p e en ancho ing o occu . The 3D acks indeed sugges his ( ig.
4.22 B): when PBI collapses, he daugh e cen iole D1 (i.e. he daugh e
cen iole om he PBI) has a descending ajec o y, which is e y simila o he
also descending ajec o ies o he cen ioles M2 and D2 (mo he and daugh e
ha o m he MII spindle). This sugges s ha he descending mic o ubule as e s
o he collapsing PBI likely i) in e up he o ma ion o he MII spindle in a
pe pendicula o ien a ion, which he e o e becomes pa allel o he plasma
memb ane, and ii) push he MII spindle down, spa ially in e e ing wi h mo he
cen iole anspo o he plasma memb ane, and consequen ancho ing.
i . Mo he +cen iole+ anspo + equi es+p oximi y+ o+ he+nucleus+
I obse ed ha mo he cen ioles do no always mo e o he plasma
memb ane in cen i uged oocy es ( ig. 4.24) (n=12). In hese si ua ions, bo h
mo he (M1 and M2) and daugh e (D1 and D2) cen ioles would emain in he
cy oplasm and no di ec ed mo emen was obse ed. This was a he in iguing:
why would he mo he cen iole no mo e in some cases?
Sys ema ic analysis o mul iple oocy es e ealed ha mo he cen iole
mo emen was ela ed wi h he cen iole dis ance o he nucleus. Dependen on
he ini ial posi ions o he oocy es in he co e slip chambe , cen i uga ion c ea es
a pool o oocy es wi h a iable dis ances be ween he new nuclea posi ion and
he cen ioles (see Ma e ial and Me hods sec ion 3.7.4 Fig. 3.7 and 3.8). I
cha ac e ized his dis ance be ween cen ioles and nucleus by measu ing he
angle be ween he wo; an angle o 180° be ween he wo means ha nucleus
and cen osome a e a opposi e poles o he oocy e (see Ma e ial and Me hods).
142
di ec ion. In e es ingly, his con i ms my abo e obse a ions (sec ion 4.5.2.i):
e en when he daugh e cen iole localizes close o he plasma memb ane (upon
mic o ubule depolyme iza ion) i canno ancho .
Figu e 4.29: A) Mo he cen iole does no depend on mic o ubules o ancho o he plasma
memb ane. No e how as al mic o ubules g ow om he inne pole, whe eas in he ou e pole,
mo he posi ioning is no a ec ed. 3D isualiza ion using Ima is. Oocy e’s con ou is shown in
g ey. Mo ie s a s a e d ug addi ion. Z-s acks eco ded e e y 40 and 44 seconds, o
nocodazole and axol, espec i ely. Scale ba : 5 µm. MC and DC co espond o mo he cen iole
and daugh e cen iole, espec i ely. MT co esponds o mic o ubules (B) Cha shows dis ance
measu emen s o he cen ioles o he plasma memb ane. Blue ec angle shows when he
inhibi o y d ug s a s o be ac i e.

143
I also es ed he e ec o axol ea men and consequen mic o ubule
s abiliza ion: axol ea men induces spindle g ow h o he double o i s no mal
leng h. S ill he mo he cen iole does no de ach om he memb ane and i s
posi ion emains s able o e ime (n=12/13) ( ig. 4.29 A, second panel, and B). A
he same ime, he daugh e cen iole ge s “pushed” deepe in he cy oplasm as
spindle ex ends, and as al mic o ubules expand om he inne spindle pole.
Howe e , no g ow h o mic o ubules was obse ed om he ou e pole.
iii. Mo he +cen iole+ancho ing+is+independen +o +dynamic+ac in+
To also es whe he ac in is in ol ed in he ancho ing o he mo he cen iole, I
pe o med simila expe imen s by ea ing a es ed MII oocy es wi h ac in
depolyme izing d ugs.
T ea men ei he wi h Cy ochalasin D (cy oD) o la B had no e ec on he
mo he cen iole ancho ing (n=8/12, o bo h cases) ( ig. 4.30), and o bo h cases
he MII spindle emains a ached o he plasma memb ane. In e es ingly, he MII
spindle p og essi ely shows a slan ed o ien a ion o he plasma memb ane plane
(app oxima ely 45°), bu s ill emains ancho ed ( ig. 4.30 A and B, o la B and
cy oD ea men ). Cu iously, he mo he cen iole mo es in he plane o he
plasma memb ane, bu ne e away om i . This sugges s ha ac in, al hough no
in ol ed in he mo he cen iole ancho ing, migh s abilize he mo he cen iole
posi ion a he plasma memb ane.
Taken oge he , I conclude ha mic o ubules and ac in a e no in ol ed in
ancho ing he mo he cen iole o he plasma memb ane. Mo eo e , axol
ea men clea ly shows how he wo cen ioles a he wo MII poles a e di e en :
as al mic o ubules g ow beyond he inne pole, whe eas he same does no
occu in he ou e pole.
144
Figu e 4.30: A) Mo he cen iole does no depend on dynamic ac in o ancho o he plasma
memb ane. 3D isualiza ion using Ima is. Oocy e’s con ou is shown in g ey. Mo ie s a s a e
d ug addi ion. Z-s acks eco ded e e y 40 and 37 seconds, o cy oD and la B, espec i ely.
Scale ba : 5 µm. MC and DC co espond o mo he cen iole and daugh e cen iole,
espec i ely. (B) Cha shows dis ance measu emen s o he cen ioles o he plasma
memb ane. Blue ec angle shows when he inhibi o y d ug s a s o be ac i e.
145
4.6.2. A e he appendages connec ing he mo he
cen iole o he plasma memb ane?
As shown in he p e ious sec ions, ac in and mic o ubules do no play a ole in
ancho ing he mo he cen iole o he plasma memb ane du ing MII. Indeed, such
close connec ion be ween cen iole and he plasma memb ane has p e iously no
been documen ed in cell di ision. Howe e , cases exis in which he cen iole
appea s in close p oximi y o he plasma memb ane: du ing cilia and
immunological synapse o ma ion (Rei e e al., 2012; S inchcombe and G i i hs,
2014; Sung and Le oux, 2013, pe sonal comunica ion). In bo h cases, he mo he
cen iole ancho s o he plasma memb ane h ough i s appendages p o iding he
ounda ion o g owing cilia, and he basis o e-o ganize he mic o ubule
cy oskele on o he deli e y o he cy o oxic g anules o he immunological
synapse egion, espec i ely.
Because o he simila i y o hese p ocesses o ou s udied case, I wan ed o
es whe he he same mechanism o di ec ancho ing h ough appendages o he
plasma memb ane also unc ions o he mo he cen iole in s a ish oocy es.
i. Visualiza ion+o +cen iole+ancho ing+by+elec on+mic oscopy+
Mo he cen iole appendages a e bes isualized by EM. Mo he appendages
can be obse ed as small ays adia ing om he mo he cen iole and ollowing
i s 9- old symme y (see In oduc ion sec ion 1.5). The e o e, we pe o med EM
o assess whe he a di ec linkage be ween mo he cen iole and plasma
memb ane exis s. S a ish oocy es we e immobilized by high-p essu e eezing o
by chemical ixa ion (see igu e legend and Ma e ial and Me hods 3.7.6 i and ii)
p e e en ially a me aphase II, when a single mo he cen iole localizes o he
ou e spindle pole. This way we ob ained se e al elec on omog aphy da ase s,
which show he cen iole s uc u e and he ela ion be ween cen iole and
memb ane a a much highe esolu ion han p e iously epo ed using hin
sec ion EM (Ka o e al., 1990).
We could isualize ha consis en wi h ou con ocal da a, cen ioles localize in
e y close p oximi y o he memb ane du ing MII as well as du ing MI ( ig. 4.31 B
and C, pu ple). In he econs uc ed omog ams, he conse ed 9- old symme y
146
and iple o ganiza ion can be nicely ecognized ( ig. 4.31 A), con i ming p e ious
epo s in s a ish oocy es (Ka o e al., 1990). The omog ams also allowed
measu emen o cen iole leng h o ≈320nm (n=4), and a diame e o ≈170nm
(n=4), which a e also consis en wi h p e ious s udies (Ka o e al., 1990).
The bes da ase s ha we e ob ained co espond o wo oocy es bo h in ea ly
MII s age, in which wo cen ioles can nicely be iden i ied inside he PBI ( ig. 4.31
C and 4.32 A, cen ioles in simila o ien a ions a e amed wi h he same colo s -
o ange and blue). These da ase s can be used o ex apola e how he cen iole
migh be ancho ed while wi hin he oocy e. Meanwhile, we a e pe o ming mo e
ixa ions o ob ain cen ioles ancho ed a he MII spindle.
Figu e 4.31: S a ish cen ioles ul as uc u e: s a ish cen ioles localize in close p oximi y o he
plasma memb ane in MI and MII. (A) S a ish cen ioles ha e 9 iple s o mic o ubules. (B) One
pai o cen ioles om he MI ou e spindle pole localizes in close p oximi y o he plasma
memb ane. No e how he wo cen ioles localize in an o hogonal o ien a ion o each o he (see
schema ic ep esen a ion). Single sec ions om wo di e en omog ams, ob ained om wo
consecu i e se ial sec ions. (A) and (B) ob ained by high-p essu e eezing. (C) S a ish in
me aphase II. This sample was ob ained by chemical ixa ion. In pu ple, shows he p esumed
mo he cen iole close o he plasma memb ane. In o ange and blue, wo o hogonally o ien ed
cen ioles ob ained om wo consecu i e se ial sec ions o he PBI. No e how he pe pendicula
cen iole (o ange) is closely localized o he plasma memb ane. Black dashed lines indica e he
oocy e ou line. Scale ba : 100 nm.
147
Figu e 4.32: Ul as uc u e o wo cen ioles con ained in he same PBI. These samples we e
ob ained by high-p essu e eezing. (A) The pe pendicula cen iole inside he PBI is closely
localized o he plasma memb ane. (B) Same da ase as in (A), o ange, bu omog am was
o a ed in a di e en o ien a ion (see schema ic ep esen a ion, le ). O ange a ows indica e
poin s o connec ion be ween he cen iole and he plasma memb ane. Black dashed lines
indica e he oocy e ou line. Single sec ions om omog ams a e shown. Scale ba : 100 nm. (C)
3D model o (A): each cen iole is shown in he same co esponding colo s o ange and blue.
Le panel shows he 3D model o e laid wi h he EM. Middle and le panels show wo di e en
o a ions o he 3D model.

148
In hese da a se s, one can iden i y one cen iole pe pendicula and o he
pa allel o he memb ane ( ig. 4.31 C and 4.32 A, o ange and blue, espec i ely).
This pe pendicula o ien a ion is ypical o a mo he cen iole connec ed o he
plasma memb ane, ac ing as a basal body. The e o e his pe pendicula cen iole
migh co espond o he mo he cen iole. Indeed, his cen iole clea ly localizes in
close p oximi y o he plasma memb ane ( ig. 4.31 C and 4.32 A, o ange).
Mo eo e , elec on-dense connec ions a e ound be ween his cen iole and he
plasma memb ane, which may co espond o mo he appendages ( ig. 4.32 B –
a ows – his da a se co esponds o a 3D o a ion o he omog am shown in ig.
4.32 A, o ange). Mul iple esicles a e ound in close p oximi y o he p esumed
mo he cen iole ( ig. 4.32 A and C, o ange).
In e es ingly, in bo h da a se s, he cen iole in a pa allel o ien a ion localizes
u he away om he plasma memb ane, and does no show any ype o
connec ion wi h he plasma memb ane ( ig. 4.31 C and 4.32 A). This is u he
e idenced by he 3D models ( ig. 4.32 C, blue).
Clea ly, mo e samples will be equi ed o elucida e he ul as uc u e o
cen iole ancho ing o he cell memb ane du ing MII. As s a ish oocy es a e e y
la ge cells, sec ioning h ough an en i e oocy e p o ed o be a e y challenging
and ime-consuming p ocess. The e o e, I ini ia ed a collabo a ion wi h Ma hia
Win e -Ka eman, who ecen ly in oduced an inno a i e me hod o single cell o
such la ge p opo ions: a e chemical ixa ion, an X- ay omog aphy is pe o med
be o e se ial sec ioning (see Ma e ial and Me hods sec ion 3.7.6.ii). This allows
he iden i ica ion o PB posi ioning and subsequen a ge ed sec ioning o only he
egion o in e es . Using his new echnique, wi hin a sho ime span, we
ob ained ou i s da ase ( ig. 4.31 C), and hope o acqui e mo e da a in he nea
u u e. This da a will es ablish he ul as uc u e o mo he cen iole ancho ed o
he plasma memb ane a MII.
In conclusion, he EM da a e eals he close p oximi y o cen ioles and he
plasma memb ane. I could isualize elec on-dense connec ions be ween one o
he cen ioles and he cell memb ane in he PBI, sugges ing ha a di ec
in e ac ion ia mo he appendages is possible. Ou new s a egy ha in ol es
a ge ed sec ioning using X- ay omog aphy p omises o apidly inc ease he
149
sample numbe and allow us o i mly es ablish he ul as uc u e linking he
cen ioles o he plasma memb ane in s a ish oocy es.
ii. Pe u bing+mo he +appendages:+an+app oach+ o+unde s and+
cen iole+ancho ing++
To complemen he EM da a, we pe o med a unc ional assay by mo pholino
knockdown o pe u b appendage o ma ion. In ciliogenesis, mo he cen iole
ancho s o he plasma memb ane h ough i s dis al mo he appendages
(composed o Od 2 and CEP164), he e o e we a ge ed he wo dis al mo he
appendage p o eins which I p e iously iden i ied in he s a ish ansc ip ome:
Od 2 and CEP164.
Od 2 is one o he main ups eam ac o s in he hie a chic p ocess o mo he
appendage assembly (Ibi e al., 2011; Ta eishi e al., 2013), and se e al p o eins
(Ninein, CEP164 and Chibby) depend on Od 2 o localize a he mo he cen iole
(Ishikawa e al., 2005). In ac , deple ion o Od 2 causes a comple e inhibi ion o
mo he appendage o ma ion, which di ec ly a ec s cilia o ma ion (Ta eishi e al.,
2013). Simila ly, deple ion o CEP164 in cul u ed cells impai s he o ma ion o
cilia (G ase e al., 2007).
Fi s , in o de o es mo pholino e icacy, we moni o ed he e ec o
mo pholinos in emb yos. The g owing emb yo equi es ac i e cen iola p o ein
ansla ion as cell di ision p og esses and mo e cen ioles a e equi ed.
The e o e, i mo pholino pe u ba ion is e ec i e, p oblems in cell di ision and
cilia o ma ion a e expec ed. Indeed we obse e a pheno ype in emb yos ea ed
wi h mo pholinos agains Od 2 o CEP164 ( ig. 4.33) (n=10/10 o each
mo pholino). These emb yos ha e highly asymme ic cell di isions, p oblems in
de elopmen and a educ ion in he numbe o cilia, when compa ed o con ol
emb yos. This indica es ha he mo pholinos wo k in emb yos and e ec i ely
block mRNA ansla ion wi h consequences a pheno ypic le el.
We hen es ed he e ec o mo pholino injec ion in oocy es; de ec s in spindle
ancho ing we e moni o ed by EB3-mEGFP co-exp ession. Howe e , bo h
mo pholinos (Od 2 and CEP164) did no show a pheno ype in oocy es. The
spindle s ill ancho s no mally o he plasma memb ane and PBs o m no mally
(da a no shown). Possible explana ions o he lack o pheno ype could be: i)
150
oocy es ha e a high amoun o s o ed mRNA, which complica es an e ec i e
mRNA inhibi ion, ii) mo pholino e iciency s ongly co ela es wi h he u no e o
he p o ein, i.e. he balance be ween p o ein p oduc ion and deg ada ion, which is
he ha des ac o o p edic o candida e p o eins. P o eins wi h a high u no e ,
as cyclin B (Wada e al., 2012), Dys e lin (Oulhen e al., 2014) and Mos
(Tachibana e al., 2000), we e shown o be e ec i ely deple ed upon mo pholino
injec ion in s a ish oocy es. Howe e , hese p o eins ha e a high u no e , which
likely explains why mo pholino ea men is so e ec i e. Cen ioles on he o he
hand a e highly s able o ganelles, o med by p o eins wi h a low u no e (Nigg,
2006). The e o e, e en i he en i e mRNA pool is inhibi ed upon mo pholino
injec ion, he mo he appendages p o eins migh s ill emain, and be s able o
se e al days o e en mon hs he ime o which oocy es a e no mally s o ed in
he mo he ’s body. This migh explain he lack o a pheno ype in he oocy e:
mo he appendage p o eins would s ill be p esen and cen iole would s ill ancho .
In con as , du ing emb yonic de elopmen , mRNA has o be cons an ly
ansla ed in o de o p oduce mo e cen iola p o eins o he newly o ming
cen ioles. This would explain he s ong mo pholino pheno ype in he emb yos.
Figu e 4.33: Od 2 mo pholino a ec s he no mal emb yonic de elopmen . (A) Shows no mal
emb yos upon injec ion o a con ol sense mo pholino. See ig. 4.4 B o schema ic
ep esen a ion. (B) Show mu an emb yos a e Od 2 mo pholino injec ion. Cep164 mo pholino
show simila e ec s. Fou examples a e shown o each case. Scale ba : 10 µm.
151
We ha e ecen ly s a ed o es mo pholino injec ion agains Chibby. Chibby
was ecen ly desc ibed o in e ac wi h CEP164, binding o he dis al
appendages. Chibby deple ion was shown o impai cilia o ma ion and he e o e
we included i in ou s udy (Bu ke e al., 2014; Enjol as e al., 2012).
Upon mo pholino injec ion, a pheno ype is obse ed in he oocy e: in se e al
ins ances he spindle ails o ancho , which di ec ly leads o ailu e o PB
ex usion ( ig. 4.34 A). Indeed, when compa ing o oocy es con ol (sense), a wo-
Figu e 4.34: Chibby mo pholino causes de ec s in spindle ancho ing, and consequen ly PB
ex usion. (A) Mo ie s a s 1h a e 1-MA ho mone addi ion. Z-s acks eco ded e e y 1 min ( i s
panel) and 1min9sec (second panel). Pannels show a Z-p ojec ion o he acqui ed s acks. Scale
ba : 10 µm. Dashed whi e line indica es he ou line o he oocy e. (B) Quan i ica ion o oocy es
injec ed wi h Chibby-an isense (n=45) mo pholino o con ol (n=24)