scieee Science in your language
[en] (orig)

Trypanosoma brucei peptidase inhibitors.Immunolocalization, secretion and potential use as targets for therapy

Abstract

As peptidases encontram-se envolvidas em diversas funções biológicas possuindo um papel importante na patogenicidade de várias infecções parasitárias. Em mamíferos, a actividade peptidica é controlada por inibidores endógenos, como as cistatinas e as serpinas. Os genes que codificam para inibidores homólogos às cistatinas e serpinas de mamíferos, encontram-se ausentes do genoma de tripanossomatídeos. A ecotina é uma proteína de Escherichia coli, capaz de inibir uma grande variedade de peptidases serínicas da família S1A, tais como a tripsina. Existem duas proteínas do tipo da ecotina em T. brucei, ISP1 e ISP2. A ausência de peptidases sensíveis à acção dos ISPs no genoma de Trypanosoma brucei, sugere que estes tenham como alvo as peptidases serínicas do hospedeiro. Linhas celulares de T. brucei deficientes em ISP1 (Δisp1), ISP2 (Δisp2) e em ambos os ISPs (Δisp1/2) foram produzidas com sucesso e a ausência dos inibidores comprovada com o uso de anticorpos monoclonais específicos contra o ISP1 e o ISP2, que reconhecem a proteina alvo em extractos de proteína total de parasitas selvagens mas não em extractos de parasitas mutantes. O efeito da ausência dos ISPs nas células foi avaliado in vitro e in vivo, verificando-se que a delecção individual de cada ISP não produz qualquer efeito nos parasitas que revelam um crescimento normal em cultura e padrões de infectividade em murganhos idênticos aos de parasitas selvagens. Em contraste, os parasitas Δisp1/2, embora possuam um crescimento normal in vitro com ausência de alterações morfológicas grosseiras, são caracterizados por um alteração na mobilidade e pela acumulação de micro-vesiculas na região da bolsa flagelar, consistente com um defeito no processo de endocitose/exocitose. Adicionalmente, por imunofluorescência foi possível localizar os ISPs no citoplasma e na perto da bolsa flagelar. Em conjunto, estes dados sugerem uma função intracelular, independente da actividade inibitória dos ISPs e provavelmente associada ao flagelo ou à bolsa flagelar. O papel biológico dos ISPs na interação parasita-hospedeiro foi também avaliada através da infecção de murganhos com os parasitas Δisp1/2.A monitorização da infecção demonstrou que a deleção de ambos os inibidores resulta em sobrevivência prolongada dos murganhos com cargas parasitárias reduzidas, sugerindo que os ISPs possuem um papel importante na sobrevivência do parasita. Em contraste com os resultados obtidos em Leishmania que atribuem diferentes funções a ISP1 e ISP2, este estudo sugere que existe uma redundância funcional dos mesmos em T. brucei, sendo necessária a presença de ambos para que o parasita estabeleça eficientemente a infecção no hospedeiro mamifero. Foram também realizados estudos de imuno-protecção em murganhos de modo a determinar o potencial dos ISPs como alvos terapêuticos. A imunização com ISP recombinante e o tratamento com anticorpos específicos contra ISP1 e ISP2 não produzem qualquer efeito protector ou neutralizante da infecção de murganhos, sugerindo que estes inibidores não constituem bons candidatos para o desenvolvimento de uma vacina ou terapia baseada em anticorpos.

Read accessible full text

Trypanosoma brucei peptidase inhibitors.Immunolocalization, secretion and potential use as targets for therapy

Author: LAIRES, Raquel de Sá da Silva
Publisher: Instituto de Higiene e Medicina Tropical
Year: 2013
Source: https://run.unl.pt/bitstream/10362/19282/1/Thesis_RLaires.pdf
Uni e sidade No a de Lisboa
Ins i u o de Higiene e Medicina T opical
T ypanosoma b ucei pep idase inhibi o s.
Immunolocaliza ion, sec e ion and po en ial use as a ge s o
he apy
Raquel de Sá da Sil a Lai es
DISSERTAÇÃO PARA A OBTENÇÃO DO GRAU DE DOUTOR EM CIÊNCIAS BIOMÉDICAS,
ESPECIALIDADE DE BIOLOGIA CELULAR E MOLECULAR
(JULHO, 2012)
ii
Uni e sidade No a de Lisboa
Insi u o de Higiene e Medicina T opical
Thesis: T ypanosoma b ucei pep idase inhibi o s. Immunolocaliza ion, sec e ion and
po en ial use as a ge s o he apy
Au ho : Raquel de Sá da Sil a Lai es
Supe iso : Doc o Ca los No o, IHMT, UNL
Co-supe iso : P o esso Je emy C. Mo am, (Uni e si y o Glasgow)
Tu o ial Commi ee:
Doc o Ca los No o (IHMT, UNL)
Doc o Luís Tá o a Ta i a (IHMT, UNL)
P o esso Jo ge A ouguia (IHMT, UNL)
Disse a ion p esen ed o ob ain a PhD deg ee in Biomedical Sciences, speciali y
Celula and Molecula Biology and was supe ised by Doc o Ca los No o, P o esso
Je emy C. Mo am and Doc o Luís Tá o a Ta i a. Financial suppo was p o ided by
Fundação pa a a Ciência e Tecnologia (FCT) wi h a PhD ellowship g an
(SFRH/BD/32110/2006) unde POCI 2010 p og am.
iii
Uni e sidade No a de Lisboa
Insi u o de Higiene e Medicina T opical
Tí ulo da Tese: Inibido es de pep idases de T ypanosoma b ucei. Imunolocalização,
sec eção e po encial uso como al o e apêu ico
Au o : Raquel de Sá da Sil a Lai es
O ien ado : In es igado Dou o Ca los No o, IHMT, UNL
Co o ien ado : P o esso Dou o Je emy C. Mo am, (Uni e sidade de Glasgow)
Comissão Tu o ial:
In es igado Dou o Ca los No o (IHMT, UNL)
In es igado Dou o Luís Tá o a Ta i a (IHMT, UNL)
P o esso Dou o Jo ge A ouguia (IHMT, UNL)
Disse ação ap esen ada pa a cump imen o dos equisi os necessá ios à ob enção do
g au de Dou o em Ciências Biomédicas, Especialidade de Biologia Celula e
Molecula , ealizada sob a o ien ação cien í ica do In es igado Dou o Ca los No o, do
P o esso Dou o Je emy C. Mo am e do In es igado Dou o Luís Tá o a Ta i a.
Apoio inancei o da FCT com a bolsa de dou o amen o SFRH/BD/32110/2006 ao
ab igo do P og ama Ope acional Ciência e Ino ação 2010 (POCI 2010) do III Quad o
Comuni á io de Apoio (2000-2006)
i
Dedico es a ese,
Ao meu pai e à minha mãe que semp e me enco aja am a i mais longe
Ao Zé que es e e semp e ao meu lado nes a longa caminhada
Ao Hen ique, a luz dos meus olhos, po quem eu aspi o semp e mais
“Há um empo em que é p eciso abandona as
oupas usadas, que já em a o ma do nosso co po, e
esquece os nossos caminhos, que nos le am semp e
aos mesmos luga es. É o empo da a essia: e, se
não ousa mos azê-la, e emos icado, pa a semp e,
à ma gem de nós mesmos.”
Fe nando Pessoa (1888-1935)
Pa a o meu ilho Hen ique uma impo an e lição,
To my son Hen ique, a aluable lesson,
“Sejam quais o em os esul ados, com êxi o ou não,
o impo an e é que no inal cada um possa dize : ‘ iz o que
pude’”
“Whe he ou e o s a e, o no , a o ed by li e, le
us be able o say, when we come nea he g ea goal, ‘I
ha e done wha I could’”
Louis Pas eu (1822-1895)

i
Acknowledgemen s
This jou ney wouldn' be possible wi hou he suppo , scien i ic o mo al, om
se e al people o whom I am uly g a e ul.
To begin wi h, I would like o hank my supe iso , D . Ca los No o o his
cons an suppo , guidance and iendship ha made i easie o o e come all he
obs acles inhe en o such jou ney and added so much o my expe ience o e he pas 5
yea s.
I would also like o hank my co-supe iso , P o . Je emy C. Mo am o he
oppo uni y o wo k in his lab in Glasgow and whose guidance and scien i ic suppo
we e aluable asse s o my hesis.
Wo king in he “Mo am Lab” was de ini ely an amazing expe ience and I
would like o exp ess my g a i ude o all he people ha welcomed me and con ibu ed
o he success o my “Glasgow expe ience”, no only wi h scien i ic help bu also wi h
hei iendship. Pa icula ly, I would like o hank Elaine, Will, Daniela, Jim Sco ,
Na haniel, Elma ie, Es he , He be , Ta iana, Alana and also Co inna, Tansy, Sophie
and Glynn om he Hamma on g oup. I has been a pleasu e o mee you all and I will
su e be missing you.
To all he people ha wo ked wi h me in he o me UTPAM, Tiago, Bé, So ia,
Ângela, Ma ia, Ana Ma ia, Ana Domingos, Fe nando; and he ones I me mo e ecen ly
in IHMT, Cá ia, Ped o, Ana, Tiago, Isabel, Idalécia and so many o he s; hank you o
all he suppo . You we e all e y impo an o he success o my PhD.
To my dea iend Rubina, a special hanks. You a e pa ially esponsible o my
PhD. I i wasn’ o I wouldn’ ha e me all he people men ioned abo e. Thank you o
being he e o me, o you iendship and o ca ing.
Ano he special hanks o Sand a: o he companionship, o he ides home, o
he p egnancy expe ience ha we sha ed oge he and o being such an angel. You a e a
e y special iend.
ii
Finally hanks o my “Ma ia” C is ina. She was my lab colleague, my oomma e,
my iend, my suppo when I was eeling down, my “clown” when I needed a laugh e ,
my “sis e ” when we we e away. Ou imes in Glasgow will ne e be o go en and he
Welcome Cen e will ne e be he same!!!!
Gos a a de ag adece a odos os meus amigos o a da es e a labo a o ial. Não
ou menciona nomes po que são an as as pessoas que co ia o isco de me esquece de
alguém. Nes e aspec o sou uma mulhe ica, ica em boas amizades de pessoas que me
acompanham há anos e sabem a lu a que em sido es e meu pe cu so. Todos o am
de e minan es pa a o meu sucesso, cada um à sua manei a e a odos, um mui o
ob igado.
À minha i mã Claúdia e aos meus sob inhos And eia e Rod igo que me
acompanham semp e e que são pa a mim um mo i o de o gulho. Ob igado po odo o
amo e ca inho!
Aos meus pais que semp e me enco aja am a segui es e caminho; que me
apoia am em odas as decisões; que me es imula am pa a i semp e mais além; que me
educa am pa a se uma pessoa esponsá el e com alo es; que ize am de mim a pessoa
que sou hoje e que desejo se semp e!
Finalmen e, ag adeço ao meu ma ido, meu namo ado e amigo de longa da a, Zé.
Com ele eu pa ilhei a desilusão de não en a pa a o cu so que inicialmen e p e endia,
com ele b indei ao sucesso da conclusão da licencia u a, com ele so i a saudade pela
dis ância que nos sepa ou quando o dou o amen o me le ou pa a Glasgow, com ele ui
eliz no dia 21 de junho de 2008 e ainda mais eliz no dia 14 de dezemb o de 2010
quando o nosso ilho ão desejado eio a es e mundo, com ele b indo ago a ao sucesso
da conclusão do dou o amen o. A ele ag adeço a e e na paciência, o companhei ismo, o
amo e a amizade que ao longo des es 16 anos êm ei o de mim uma mulhe plena de
elicidade.
iii
Abs ac
ix
T ypanosoma b ucei pep idase inhibi o s. Immunolocaliza ion, sec e ion and
po en ial use as a ge s o he apy
Raquel de Sá da Sil a Lai es
Keywo ds: T ypanosoma b ucei, ISP1, ISP2, lagellum, lagella pocke , endocy osis,
hos -pa asi e in e ac ions, monoclonal an ibodies.
Pep idases a e in ol ed in se e al biological unc ions playing an impo an ole in he
pa hogenici y o many pa asi ic in ec ions. In mammals, one way in which he ac i i y
o hese pep idases is con olled is by in e ac ion wi h na u al inhibi o s, such as
cys a ins and se pins. In ypanosoma ids, he genes encoding o endogenous inhibi o s
homologous o mammalian cys a ins and se pins, a e absen . Eco in is an Esche ichia
coli p o ein capable o inhibi ing a wide ange o se ine pep idases om S1A amily
such as ypsin. Eco in o hologues can be ound in a es ic ed ange o bac e ial
pa hogens and also in ypanosoma id pa asi ic p o ozoa. In T ypanosoma b ucei wo
p o eins o 19.7 kDa and 17.8 kDa we e iden i ied as eco in-like inhibi o s and gi en
he gene ic name o Inhibi o s o Se ine Pep idases (ISP). The absence o pep idases
p edic ed o be sensi i e o he ac ion o ISPs in T. b ucei sugges s ha hese inhibi o s
a e a ge ing he hos ’s se ine pep idases, al hough hei exac biological ole was
unknown. T. b ucei mu an cell lines de icien in ISP1 (Δisp1), ISP2 (Δisp2) and bo h
ISPs (Δisp1/2) we e success ully gene a ed by a ge ed gene dis up ion. This was
con i med using monoclonal an ibodies gene a ed speci ically agains ISP1 and ISP2
ha ecognize he a ge p o ein in wild ype and e-exp esso cell lysa es bu no in he
espec i e mu an cell line. The e ec o ISP dele ion in he pa asi es was de e mined
bo h in cul u e and in mice in i o. The dele ion o ISP genes indi idually was shown o
ha e no e ec on he pa asi es in i o o in i o. Howe e , di e en esul s we e
ob ained o he simul aneous dele ion o ISP1 and ISP2. Al hough Δisp1/2 pa asi es
ha e no mal g ow h and mo phology in cul u e, hey exhibi a mo ili y de ec and a e
cha ac e ized by he accumula ion o small esicles ou side he lagella pocke
consis en wi h an endocy osis/exocy osis de ec . Fu he mo e, immuno luo escence
shows ha bo h ISPs a e localized in he cy osol and in small punc ua ed s uc u es nea
he lagella pocke egion. These da a sugges s ha ISPs ha e an in acellula unc ion
independen o hei inhibi o y ac i i y and p obably associa ed wi h he lagella
pocke . The biological ole o ISP1 and ISP2 in he hos -pa asi e in e ac ion was also
e alua ed by in ec ing mice wi h Δisp1/2 pa asi es. Pa asi emia moni o ing shows ha
he dele ion o bo h ISPs esul s in p olonged hos su i al wi h educed o unde ec able
pa asi e loads, sugges ing an impo an ole o hese inhibi o s in he pa asi e’s
su i al. In con as wi h ecen indings o ISPs unc ion in Leishmania, ha assigns
di e en biological oles o ISP1 and ISP2, he p esen s udy e eals some unc ional
edundancy o ISPs in T. b ucei, wi h bo h inhibi o s being equi ed o he pa asi e o
in ec he mammalian hos e icien ly. Finally, immuno-p o ec ion s udies we e made,
o assess he po en ial o ISPs as a ge s o he apy. Immuniza ion wi h ecombinan
ISPs and ea men wi h an ibodies speci ic agains ISP1 and ISP2 had no p o ec i e o
neu alizing e ec on T. b ucei in ec ed mice, e ealing ha hese inhibi o s a e poo
candida es o an an i-disease accine o o an ibody-based he apy.
x i
2.1 Bac e ial Cul u es ................................................................................................ 43
2.1.1 S ains used ................................................................................................ 43
2.1.2 Bac e ial cul u e and s o age ..................................................................... 43
2.1.3 P epa a ion o E. coli compe en cells ....................................................... 43
2.2 Molecula Biology Techniques ........................................................................... 44
2.2.1 Polyme ase Chain Reac ion (PCR) and oligonucleo ides used ................. 44
2.2.2 Aga ose gel elec opho esis ....................................................................... 45
2.2.3 Cloning o PCR p oduc s ........................................................................... 46
2.2.4 Res ic ion endonuclease diges ion ........................................................... 47
2.2.5 Liga ion o DNA agmen s ....................................................................... 47
2.2.6 T ans o ma ion o DNA agmen s in E. coli ............................................ 48
2.2.7 Selec ion o ans o man s ......................................................................... 48
2.2.8 Colony sc eening by PCR ......................................................................... 48
2.2.9 Plasmid DNA pu i ica ion ......................................................................... 49
2.2.10 DNA sequencing ....................................................................................... 49
2.2.11 DNA p epa a ion o ans ec ion .............................................................. 49
2.2.12 Si e di ec ed mu agenesis .......................................................................... 49
2.2.13 Plasmid gene a ion .................................................................................... 50
2.2.13.1 Mu an ICP cons uc ................................................................................ 50
2.2.13.2 ISP knock ou cons uc s ......................................................................... 51
2.2.13.3 ISP1 and ISP2 e-exp ession cons uc s .............................................. 51
2.2.14 Sou he n Blo ing ....................................................................................... 52
2.3 P o ein Biochemis y ........................................................................................... 53
2.3.1 Exp ession and pu i ica ion o ecombinan p o eins ................................ 53
2.3.2 De e mina ion o p o ein concen a ion ..................................................... 54
2.3.3 Polyac ylamide gel elec opho esis (SDS-PAGE) .................................... 54
2.3.4 Coomassie s aining o SDS-PAGE ........................................................... 55
2.3.5 Wes e n Blo ing ........................................................................................ 55
2.4 T. b ucei cell cul u e ............................................................................................ 56
2.4.1 Bloods eam o m T. b ucei cul u ing ....................................................... 56
2.4.2 BSF ans ec ions ....................................................................................... 57
2.4.3 Ta ge ed gene eplacemen ........................................................................ 58

x ii
2.4.4 Isola ion o T. b ucei genomic DNA ......................................................... 59
2.4.5 P epa a ion o whole cell ex ac s ............................................................. 59
2.4.6 T. b ucei animal in ec ion and pa asi emia de e mina ion ........................ 59
2.5 Monoclonal An ibodies ....................................................................................... 60
2.5.1 Gene a ion o hyb idomas ......................................................................... 60
2.5.2 Sc eening o an ibody p oducing Hyb idomas......................................... 61
2.5.3 Hyb idomas cul u e and s o age ................................................................ 62
2.5.4 De e mina ion o an ibody iso ype ............................................................ 63
2.5.5 An ibody pu i ica ion ................................................................................ 63
2.6 Indi ec Immnuno luo escence Analysis (IFA) ................................................ 64
2.7 Scanning Elec on Mic oscopy ........................................................................... 64
2.8 In i o g ow h inhibi ion assays ........................................................................ 65
2.9 In i o g ow h inhibi ion assays ......................................................................... 65
2.9.1 P o ec ion o T. b ucei in ec ed mice by ISP Immuniza ion ..................... 65
2.9.2 Neu aliza ion o T. b ucei in in ec ed mice by ISP MAb’s ...................... 66
2.10 S a is ical analysis ................................................................................................ 66
Chap e 3 – Resul s ...................................................................................................... 67
3.1 Gene a ion o Monoclonal An ibodies ............................................................... 68
3.1.1 Gene a ion o MAb’s agains ICP ............................................................. 68
3.1.2 Gene a ion o MAb’s agains ISP 1 and ISP2 ........................................... 73
3.2 Localisa ion o ISP 1 and ISP2 in T. b ucei cells .............................................. 79
3.3 Dele ion o T. b ucei ISP1 and ISP2 by a ge ed gene eplacemen ............... 81
3.3.1 Gene a ion o ISP null mu an cell lines o T. b ucei ................................ 81
3.3.2 Con i ma ion o null mu an and e-exp ession cell lines ......................... 86
3.3.2.1 PCR ................................................................................................................... 86
3.3.2.2 Sou he n Blo ing .......................................................................................... 92
3.3.2.3 Wes e n Blo ing ........................................................................................... 97
3.3.3 In i o analysis o null mu an cell lines .................................................. 98
3.3.4 In i o analysis o null mu an cell lines ................................................. 100
3.3.5 Elec on Mic oscopy................................................................................ 103
3.3.6 Exp ession o ISP1 is egula ed by ISP2 ................................................. 104
x iii
3.4 G ow h Inhibi ion by Monoclonal An ibodies ................................................ 105
3.4.1 In i o g ow h inhibi ion assay ............................................................... 105
3.4.2 In i o g ow h inhibi ion assay ................................................................ 107
3.5 Immuno-p o ec ion assay ................................................................................. 109
Chap e 4 – Discussion and Conclusions .................................................................. 112
4.1 ISP1 and ISP2 ha e an in acellula unc ion associa ed wi h he lagellum
and he lagella pocke ……………………………………………………… 114
4.2 Δisp1/2 pa asi es ha e educed i ulence in mice........................................... 121
4.3 Monoclonal an ibodies agains ISP1 and ISP2 do no con e p o ec ion
agains T. b ucei in ec ion in i o ..................................................................... 126
4.4 Conclusions and inal conside a ions .............................................................. 131
Re e ences .................................................................................................................... 134
xix
Index o Figu es
Figu e 1.1 – Human a ican ypanosomiasis (HAT) ansmission cycle ........................ 3
Figu e 1.2 – Geog aphical dis ibu ion o HAT and epidemiological s a us o he
disease in he las decade. ................................................................................................. 4
Figu e 1.3 – T ypanosoma b ucei li e cycle. ................................................................. 10
Figu e 1.4 – The basic s uc u e o T. b ucei. ................................................................ 13
Figu e 1.5 – The cell cycle o PCF T. b ucei. ................................................................ 21
Figu e 1.6 – The cell cycle o T. b ucei ypomas igo es. ............................................. 22
Figu e 1.7 – Rep esen a ion o he eco in- ypsin e ame ic complex .......................... 39
Figu e 3.1 – ICP se um i e de e mina ion by ELISA. ................................................. 68
Figu e 3.2 – ICP and T31-T32 ICP Se um i e de e mina ion by ELISA. ............... 70
Figu e 3.3 – Sc eening o an i-ICP an ibody p oducing hyb idomas by ELISA and
Wes e n Blo ing. ............................................................................................................ 71
Figu e 3.4 – Wes e n Blo ing wi h an i-ICP MAb’s. .................................................... 72
Figu e 3.5 – IS1 and ISP2 se um i e de e mina ion by ELISA. .................................. 73
Figu e 3.6 – Sc eening o an i-ISP1 an ibody p oducing hyb idomas by ELISA and
Wes e n Blo ing. ............................................................................................................ 75
Figu e 3.7 – Sc eening o an i-ISP2 an ibody p oducing hyb idomas by ELISA and
Wes e n Blo ing. ............................................................................................................ 76
Figu e 3.8 – Wes e n Blo ing analysis o pu i ied an ibodies. ..................................... 79
Figu e 3.9 – Immuno luo escence analysis o ISPs in BSF T b ucei. ........................... 80
Figu e 3.10 – Gene a ion o ISP1 null mu an s ............................................................. 83
Figu e 3.11 – Gene a ion o ISP2 null mu an s ............................................................. 84
Figu e 3.12 – Gene a ion o ISP e-exp ession cell lines. ............................................. 85
Figu e 3.13 – Con i ma ion o isp1 HYG/NEO by PCR. ............................................ 87
Figu e 3.14 – Con i ma ion o isp1 BSD/PAC by PCR. ............................................. 88
Figu e 3.15 – Con i ma ion o isp2 by PCR. ............................................................... 90
xx
Figu e 3.16 – Con i ma ion o isp1/2 by PCR. ........................................................... 91
Figu e 3.17 – Con i ma ion o ISP1 and ISP2 e-exp ession cell lines by PCR. .......... 91
Figu e 3.18 – Sou he n Blo ing analysis o isp1 HYG/NEO null mu an s. ............... 93
Figu e 3.19 – Sou he n Blo ing analysis o isp1 BSD/PAC null mu an s. ................. 94
Figu e 3.20 – Sou he n Blo ing analysis o isp2 null mu an s. .................................. 95
Figu e 3.21 – Sou he n Blo ing analysis o isp1/2 null mu an s. ............................... 96
Figu e 3.22 – Wes e n Blo ing analysis o

isp1 cell lines. ......................................... 97
Figu e 3.23 – Wes e n Blo ing analysis o

isp2 cell lines. ......................................... 98
Figu e 3.24 – In i o g ow h analysis o ISP null mu an cell lines. ............................ 99
Figu e 3.25 – Mouse su i al a es. ............................................................................. 101
Figu e 3.26 – Mouse in ec ion p o ile. ........................................................................ 102
Figu e 3.27 – Scanning Elec on Mic oscopy analysis. ............................................... 103
Figu e 3.28 – Analysis o T. b ucei ISP1 and ISP2 exp ession by Wes e n Blo ing. 104
Figu e 3.29 – In i o g ow h analysis o T. b ucei. .................................................... 106
Figu e 3.30 – An ibodies agains ISP1 and ISP2 ha e no e ec on T. b ucei in ec ion
in i o. ........................................................................................................................... 108
Figu e 3.31 – Immuniza ion o mice wi h ISP1 and ISP2 doesn’ con e p o ec ion o T.
b ucei in ec ion. ............................................................................................................ 111
xxi
Index o Tables
Table 2.1 – Oligonucleo ides used in his s udy ............................................................ 46
Table 2.2 – Plasmids gene a ed and used in his s udy .................................................. 50
Table 3.1 – Hyb idomas sc eened by ELISA. ................................................................ 74
Table 3.2 – Iso ype de e mina ion scheme. .................................................................... 77
Table 3.3 – Iso ype de e mina ion esul s. ..................................................................... 78
Table 3.4 – Cell lines gene a ed. .................................................................................... 85

Chap e 1
In oduc ion
2
1.1 Human A ican T ypanosomiasis
1.1.1 Epidemiology
A ican ypanosomiasis is a amily o pa asi ic diseases a ec ing bo h humans
and animals. I is caused by a lagella ed p o ozoan pa asi e o he genus T ypanosoma
ha li es and mul iplies ex acellula ly in he blood and issue luid o i s mammalian
hos s. The pa asi e is ansmi ed by he blood eeding se se ly (Glossina sp.) and he
geog aphical dis ibu ion o ypanosomiasis in A ica is di ec ly linked o he ec o ’s
sui able habi a , comp ising a o al o 10 million km2 o e i o y, be ween la i ude 14°
No h and 29° Sou h, om he sou he n edge o he Saha a and he no h o Kalaha i
dese s, one hi d o A ica’s landscape (B un e al., 2010, Ba e e al., 2003).
T ypanosoma b ucei is di ided in 3 subspecies, T. b ucei gambiense and T.
b ucei hodesiense causing he human o m o he disease in Wes and Eas A ica,
espec i ely and T. b ucei b ucei ha , along wi h T. congolense, T. e ansi and T. i ax,
causes he animal o m o A ican ypanosomiasis, also known as Nagana, a Zulu wo d
meaning powe less/useless. Al hough hese pa asi es cause ela i ely mild in ec ions in
wild animals, hey cause a mo e se e e o m o he disease, o en a al in domes ic
animals. The symp oms begin wi h e e , eye discha ge, oedema and anaemia and as
he illness p og esses, animals became mo e and mo e weak un il pa alysis and dea h
e en ually occu (B un e al., 2010).
Domes ic and wild animals can also be in ec ed by T. b ucei gambiense and T.
b ucei hodesiense. Animals do no de elop he disease when in ec ed wi h hese
ypanosome species bu hey ha e a majo epidemiological impo ance, ac ing as
ca ie s o ese oi s o he in ec ion (Figu e 1.1).
T. b ucei hodesiense in ec ion, which is a zoonosis, is usually ansmi ed om
animals o man, wi h li es ock and game animals (mainly an elopes) being he p ima y
ese oi . T. b ucei gambiense in ec ion, which is conside ed an an h opono ic
in ec ion, is mainly ansmi ed om man o man and he ese oi is almos exclusi ely
he human. Pigs and some wild animals can ac as second ese oi and occasionally
3
ansmission can occu di ec ly om animals o humans, which is belie ed o be one o
he causes o he long e m main enance o he disease in endemic a eas (Mal y and
Chappuis, 2011).
Figu e 1.1 – Human a ican ypanosomiasis (HAT) ansmission cycle.
T. b. gambiense ansmission is mos ly human- o-human (an h opono ic in ec ion) and ansmission om
domes ic animals o human occu s occasionally. T. b. hodesiense in ec ion in humans is ansmi ed
mainly be ween game animals (zoono ic in ec ion) and some imes be ween animals and humans. Adap ed
om (Sima o e al., 2011).
Human A ican T ypanosomiasis (HAT), also known as sleeping sickness
disease is one o he “neglec ed diseases”, a g oup o diseases ha includes
schis osomiasis, isce al leishmaniasis and Chagas disease. This g oup o diseases is
esponsible o he dea h o hund eds o housands o people in unde de eloped opical
egions. Ne e heless, cu en ea men o hese diseases is o en conside ed inadequa e
and ine ec i e and un il ecen ly he pha maceu ical indus y as shown li le in e es in
de eloping new d ugs (Kennedy, 2008).
Human A ican ypanosomiasis is a po en ial a al disease ha a ec s mainly
u al popula ions in 36 coun ies o sub-Saha an A ica (Figu e 1.2). Along he pas
cen u y, he p e alence has changed d ama ically and h ee majo epidemics ha e been
epo ed. The i s one a ec ed equa o ial A ica be ween 1896 and 1906 and killed an
es ima ed 800,000 people (B un e al., 2010, S e e ding, 2008). A second majo
epidemic occu ed be ween 1920 and 1940 and was con olled by he e o o mobile
eams ha o ganized ac i e su eillance p og ams, sc eening millions o people a isk
(Ba e , 2006).
By he 1960s he disease was almos e adica ed hanks o he highly e ec i e
su eillance p og ams (Kennedy, 2008). Howe e , he incidence o he disease e-
4
eme ged in he 1990s due o he collapse o he su eillance and con ol p og ams allied
o ci il con lic s in some o he mos endemic coun ies, such as Angola, Uganda,
Democ a ic Republic o Congo and Sudan (B un e al., 2010, S ua e al., 2008,
Kennedy, 2008, S ua e al., 2005). By ha ime, 40,000 cases we e epo ed bu an
es ima ed numbe o 300,000 cases emained undiagnosed and he e o e un ea ed
(Sima o e al., 2011)(h p://www.who.in /mediacen e/ ac shee s/ s259/en/).
In 2005, su eillance was ein o ced and he numbe o epo ed cases dec eased
signi ican ly. Howe e , hese numbe s a e known o be unce ain as a esul o unde -
epo ing, once ha A ican T ypanosomiasis a ec s mainly emo e u al popula ions
wi h li le o no access o heal h acili ies (B un e al., 2010).
Figu e 1.2 – Geog aphical dis ibu ion o HAT and epidemiological s a us o he disease in he las
decade.
Geog aphic dis ibu ion o HAT is di ec ly ela ed wi h he se se ly popula ion in he a ea. T. b.
gambiense is ansmi ed by i e ine se se lies om he palpalis g oup in Wes A ica and T. b.
hodesiense is ansmi ed by se se lies om he mo si ans g oup (Sima o e al., 2011).
11
Di iding slende pa asi es a e ound in ascending pa asi emia while non-
di iding s umpy ypomas igo es can be obse ed when he pa asi emia goes in o
emission (Fenn and Ma hews, 2007, Vicke man, 1985). As he numbe o pa asi es
inc eases, sho s umpy ypomas igo es eplace slende ones a e p oli e a ion in he
mammalian bloods eam. This di e en ia ion appea s o be induced by a molecule
sec e ed by he pa asi e, e e ed o as S umpy Induc ion Fac o , and may se e wo
pu poses. Fi s i limi s he numbe o pa asi es in he blood, inc easing hos ’s su i al
and maximizes he p obabili y o disease ansmission. Second, i ensu es he
coo dina ion o mo phological changes needed o he e icien ansmission o he
se se ly p o iding he con inua ion o he pa asi e’s li e cycle (Ma hews, 2005,
Vassella e al., 1997).
When accumula ed, he S umpy Induc ion Fac o igge s cell cycle a es in G1
phase and he mi ochond ial espi a o y chain is ac i a ed, p epa ing he cell o glucose
limi ed en i onmen and p e-adap ing he pa asi e o he d as ic changes o
en i onmen al condi ions and o e icien ansmission o he se se ly ec o (Vassella
e al., 1997, P ies and Hajduk, 1994).
1.2.1.2 De elopmen o T. b ucei in he se se ly ec o
The ypanosome ini ially es ablishes in he se se ly midgu a e a blood meal,
be o e mig a ing o he sali a y glands (Ma hews, 2005). When he ly eeds om a
mammalian hos , he in ec ed blood con ains bo h long slende and sho s umpy
pa asi es. The ans o ma ion o his pleomo phic popula ion o mammalian
bloods eam o ms o T. b ucei o p ocyclic o ms mus apidly occu o ensu e
pa asi e’s su i al in he ec o (Ziegelbaue e al., 1990).
While he eplica ing slende o ms o he pa asi e a e killed by p o eases, he
non p oli e a ing s umpy o ms ha a e p e-adap ed o li e in he ly mus apidly
unde go s uc u al and me abolic ans o ma ion o insec s age cells (p ocyclic o m) in
he gu lumen (Rodi i and Lehane, 2008, Hu and Aksoy, 2006).

12
The p ocyclic o m (PCF) o T. b ucei is ex emely di e en om i s
mammalian coun e pa : i uses p oline as ene gy sou ce ins ead o glucose, shows a
di e en mo phology and cell a chi ec u e and se e al changes in gene exp ession
(Ma hews and Gull, 1994).
A e he di e en ia ion o bloods eam o ms in o p ocyclic o ms begins, he
VSG coa is los and eplaced by a new su ace p o ein coa , a p ocyclin coa esis an o
se se ly midgu p o eases (Ma hews and Gull, 1994, Ziegelbaue e al., 1990). As
app oxima ely 99% o he pa asi es p esen in he inges ed blood a e elimina ed by he
ly, he ypanosome es ablishmen in he midgu s a s om a e y small popula ion o
ully di e en ia ed p ocyclic cells (Van Den Abbeele e al., 1999, Ziegelbaue e al.,
1990).
Tha small popula ion o PCF cells g ows igo ously and as coloniza ion
p og esses, om he pos e io o he an e io midgu , pa asi es s a o elonga e and long
ypomas igo es (mesocyclic ypomas igo es) can be ound nea he p o en iculus, in
he ec ope i ophic space in he an e io midgu . These cells in ade he p o en iculus
lumen and mig a e o he o egu and p oboscis, whe e hey unde go a complex
di e en ia ion o sho epimas igo es (Rodi i and Lehane, 2008, Van Den Abbeele e al.,
1999).
To comple e i s li e cycle, he pa asi e mus colonize he se se ly sali a y gland
in o de o gene a e me acyclic o ms, in ec i e o mammals. In he p o en iculus, he
long ypomas igo e cells eplica e hei nuclea DNA and eposi ion hei kine oplas
and basal body o igina ing long epimas igo e o m pa asi es.
These cells unde go asymme ic di ision, gene a ing sho epimas igo es,
p esumed o be he ones colonizing he se se ly sali a y gland and long epimas igo es
whose a e is unknown.
Due o i s small lagella, sho epimas igo es ha e educed mo ili y and esemble
he a ached epimas igo es in he sali a y gland. Howe e , hei ine icien lagella
make i impossible o hem o swim om he p oboscis o he sali a y gland, ough he
hypopha ynx. I is hen p oposed ha he cells eaching he sali a y gland a e he
asymme ically di iding epimas igo es, which d i e hemsel es using he lagellum o
he long daugh e cell (Rodi i and Lehane, 2008).
13
Once in he sali a y gland, hese cells comple e hei di ision and he sho
epimas igo es a e now able o a ach o he wall and con inue hei de elopmen in o
ma u e me acyclic ypomas igo e o ms, in ec i e o mammals (Rodi i and Lehane,
2008).
1.2.2 T. b ucei cell biology
Al hough T. b ucei exis s in wo di e en de elopmen al o ms, pe ec ly
adap ed o su i e in each o i s hos s, bo h BSF and PCF pa asi es exhibi a simila
mo phology cha ac e ized by a cell body wi h a e mi o m shape wi h ape ed ends and
a single lagellum eme ging om he basal body, nea he pos e io end o he cell
h ough a specialized plasma memb ane in agina ion, he lagella pocke (Figu e 1.4)
(Field and Ca ing on, 2009, Rals on e al., 2009).
Figu e 1.4 – The basic s uc u e o T. b ucei.
Schema ic ep esen a ion o T. b ucei‘s cell mo phology, showing he pa asi e’s majo o ganelles and
hei o ganiza ion wi hin he cell (G ün elde e al., 2003).
The lagellum o ypanosomes has se e al impo an unc ions, some o hem
essen ial o he pa asi e’s pa hogenici y. T ypanosomes use he lagellum o mo e,
d i ing hemsel es wi h he lagellum leading, o ming wa es om ip o base and no
om base o ip as obse ed in he majo i y o lagella ed cells (Bas in e al., 2000).
14
In addi ion o i s ole in he pa asi e’s mo ili y, he lagellum is essen ial o hos -
pa asi e in e ac ion, once i is equi ed o he a achmen o epi helial cells in he se se
ly sali a y gland (Vaughan, 2010). The lagellum is also c i ical o cellula
mo phogenesis (Kohl e al., 2003, Mo ei a-Lei e e al., 2001), o ganelle inhe i ance and
posi ioning and cell di ision (Rals on e al., 2006, Kohl e al., 2003). Finally, he
lagellum could be in ol ed in cell signaling and senso y unc ions (Vaughan, 2010).
Elec on mic oscopy analysis o he lagellum e eals he p esence o many
con en ional lagella s uc u es, such as he axoneme and some elec on dense pa icles
esembling IFT pa icles, bu also o unusual ex a-axonemal s uc u es such as he
pa a lagella od (PFR) and he lagellum a achmen zone (FAZ) and he lagella
connec o (FC), unique o ypanosomes and a ew ela ed p o ozoa (Rals on e al.,
2009, Kohl and Bas in, 2005, Land ea and Igna ushchenko, 2001).
The axoneme p esen s he ypical 9+2 mic o ubule a angemen , wi h he 9 ou e
double s su ounding a cen al pai o single mic o ubules (Rals on e al., 2009, Kohl
and Bas in, 2005). I also possesses all he con en ional componen s o o he euka yo ic
axonemes such as he inne and ou e dynein a ms, he adial spokes connec ing he
ou e double s o he cen al pai , he nexin links associa ed wi h he ou e double s and
he p ojec ions om each cen al pai mic o ubules connec ing hem o one ano he ,
e ealing a high s uc u al deg ee o conse a ion (Kohl and Bas in, 2005, Bas in e al.,
2000).
The pa a lagella od exis ence is es ic ed o kine oplas ids, euglenoids and
dino lagella es (Bas in e al., 1998). I can be de ec ed alongside he axoneme once he
lagellum exi s om he lagella pocke , unning un il he lagellum ip (Rals on e al.,
2009). This s uc u e is di ided in 3 dis inc egions, he p oximal, in e media e and
dis al domains, wi h he p oximal domain o he PFR being igh ly connec ed o
double s 4 and 7 o he axoneme (Kohl and Bas in, 2005). Al hough i s unc ion emains
unknown, PFR seems o be essen ial o lagellum and cell mo ili y in ypanosomes
and (Bas in e al., 1998). The abla ion o one o he main PFR s uc u al componen s
(PFR2) in BSF cells causes le hal pheno ypes bo h in in i o cul u es and in i o, in
mouse in ec ions (G i i hs e al., 2007), ha mani es in abe an de ec s in cy okinesis
and cell mo phology (Po man and Gull, 2010, B oadhead e al., 2006).
15
Along he leng h o he cell, he lagellum and he cell body a e held by a
ne wo k o cy oskele al and memb anous connec ions ha oge he comp ise he
lagella a achmen zone (Rals on and Hill, 2008, Gull, 1999). Al hough he FAZ is
no pa o he lagellum, i is closely associa ed o he lagellum and i s unc ions.
When he lagellum eme ges om he lagella pocke , i bends o e he cell body,
a aching o he cell body memb ane. The lagella pocke and he cell body memb ane
emain in igh con ac and he FAZ can be ecognized om he lagella pocke a ea,
ollowing he lagellum and ending a he an e io ip o he pa asi e (Kohl and Bas in,
2005, Kohl and Gull, 1998). I s componen s a e mos ly unknown, bu he ul as uc u e
o FAZ is ex ensi ely cha ac e ized. I con ains 2 dis inc s uc u es, he FAZ ilamen
on he cy oplasmic side and a unique se o 4 mic o ubules associa ed wi h he
memb anous compa men . The FAZ ilamen is connec ed o bo h he axoneme and he
PFR by a ne wo k o ilamen s p omo ing he con ac o he cell body memb ane wi h
he lagellum (Rals on e al., 2009, Rals on and Hill, 2008). The lagellum and he FAZ
oge he p o ide s uc u al and posi ional suppo o he pa asi e, ha in luence
cy okinesis and cell mo phogenesis and he dis up ion o lagellum a achmen esul s in
ailing o ini ia e cy okinesis (Rals on and Hill, 2006, Kohl e al., 2003).
Al hough i has c i ical oles in mobili y, mo phogenesis and cell di ision
h oughou he pa asi e’s li e cycle, mos s udies o lagellum s uc u e and unc ion
ha e been conduc ed in he p ocyclic o m o T. b ucei (Rals on and Hill, 2006). The
new lagellum eme ges om he lagella pocke and ex ends along he cell body
owa ds he an e io end o he pa asi e, ollowing a le -handed helical pa h. As i
elonga es, he new lagellum is always loca ed o he le o he old one, when looking a
cell om he pos e io end. In p ocyclic ypomas igo es, he dis al ip o he new
lagellum is connec ed o he side o he old one by he lagella connec o , a
ansmemb ane complex o unknown composi ion, impo an in p o iding all he i al
mo phogene ic in o ma ion o he daugh e cell’s lagellum o assemble co ec ly
(Field and Ca ing on, 2009, Da idge e al., 2006, B iggs e al., 2004).
This physical con ac held be ween he old and he new lagellum ensu es ha as
he new lagellum elonga es, i ollows he same helical pa h along he cell as he old
one, main aining i s s uc u e, pola i y and alignmen (Da idge e al., 2006, B iggs e
al., 2004).
16
Du ing he assembly o he new lagellum, he anspo o all lagella
p ecu so s o he dis al ip o he lagellum is dependen on in a lagella anspo
(IFT), a bidi ec ional anspo sys em o p o eins in he lagella ma ix. The IFT is
d i en by a wo mo o complexes, he he e o ime ic kinesin II ha mo es pa icles
owa ds he lagellum ip and a dynein complex ha mo es he pa icles back o he
base o he lagellum (Absalon e al., 2008b, B iggs e al., 2004). Func ional s udies
e eal ha IFT is equi ed o he co ec lagella biogenesis in T. b ucei and he
p esence o IFT pa icles in he old and new lagella o he same cell sugges s ha IFT
ope a es in bo h and is no only equi ed o he g ow h o he new lagellum bu also
o he main enance o he ma u e one (Absalon e al., 2008b).
The silencing o IFT genes esul s in cells wi h sho e lagella and in some
cases wi h no lagella, leading o p og essi ely sho e cells (Absalon e al., 2008b). The
absence o no mal lagellum elonga ion does no a ec he lagella pocke o ma ion,
which emains p esen in hese cells. Ne e heless, abno mally sho e pa asi es exhibi
lagella pocke wi h di e en shapes, sugges ing ha no mal lagellum elonga ion is
essen ial o he o ganiza ion, o ien a ion and unc ion o he lagella pocke (Absalon
e al., 2008a).
Once i exi s he cy oplasm, h ough he lagella pocke , he lagellum is
su ounded by i s own memb ane and is a ached o he cell body, along mos o i s
leng h. The cell memb ane, he lagella pocke and he lagella memb ane comp ise
he h ee con iguous bu mo phologically and biochemically dis inc domains o he
pa asi e’s su ace memb ane, each one wi h unique unc ions (Rals on and Hill, 2008,
Land ea and Igna ushchenko, 2001). All 3 domains a e co e ed by he densely packed
VSG coa in he bloods eam o m pa asi es o du ing he me acyclic s age in he se se
ly sali a y gland o by a p ocyclin coa in he o he p ocyclic o ms (Bas in e al.,
2000).
In he lagella pocke domain, he densi y o his p o ein coa seems o be
di e en om he emaining memb ane domains and he subpellicula mic o ubules a e
absen , wi h he excep ion o a qua e o specialized mic o ubules ha un along one
su ace o he lagella pocke , allowing he endo- and exocy osis e en s o occu a his
si e (Gull, 2003, Bas in e al., 2000). All esicula a ic passes h ough he lagella

17
pocke de ining i as a dynamic po al o hos o ec o en i onmen . This dynamic
in e ac ion p o ides esis ance o he hos ’s inna e and acqui ed immune esponses and
al hough he lagella pocke is a c i ical o ganelle o he ypanosome biology wi h
impo an oles in immune e asion, e y li le is known abou i s a chi ec u e and how
molecules ge o and om he lagella pocke (Lacomble e al., 2009, Gull, 2003).
The lagella pocke has a complex o ganiza ion and a p ecise posi ioning
ela i ely o cy oskele al elemen s and o he o ganelles. I can be di ided in o se e al
subdomains, wi h he basal body used o de ine one pole o his s uc u e. The
memb ane and luminal olume o he lagella pocke a e asymme ic due o he
associa ion wi h he Golgi complex and he p obasal body. Associa ed wi h he Golgi
appa a us is he neck egion which is loca ed dis al o he lagellum exi poin . The neck
o he lagella pocke is a specialized memb ane a ea also associa ed wi h he FAZ and
whe e a mic o ubule qua e in eg a es in o he subpellicula a ay, de ining an axis o
he en i e lagellum and i s associa ed s uc u es (Field and Ca ing on, 2009, Lacomble
e al., 2009). The lagella pocke has 2 bounda y subdomains associa ed wi h o ganized
s uc u es connec ed ac oss he memb ane and cy oskele on, he colla , de ining he
lagellum exi poin , and he colla e e, he poin whe e i en e s he lagella pocke
(Field and Ca ing on, 2009).
Wi h he lagella pocke as he only si e o endocy osis and exocy osis, he T.
b ucei cell, and hus he T. b ucei endomemb ane sys em, is highly pola ized. This high
deg ee o pola iza ion o he endomemb ane sys em is e lec ed in he localiza ion o he
sec e o y and endocy ic o ganelles, wi h he endoplasmic e iculum (ER) widely
dis ibu ed h oughou he cy oplasm and all he es compac ly o ganized in he
pos e io po ion o he cell, be ween he nucleus and he kine oplas and he single
lysosome close o he nucleus (Field and Ca ing on, 2009, Mo gan e al., 2002a).
The lagella pocke has a dis inc p o eome wi h mos o he p o ein amilies
equi ed o esicle a icking in o he euka yo ic o ganisms ep esen ed in i , like he
16 Rab and Rab- ela ed p o eins encoded in T. b ucei genome (Acke s e al., 2005,
Be iman e al., 2005).
Rab p o eins a e small GTPases in ol ed in endocy ic, exocy ic and ecycling
pa hways, wi h TbRAB7 associa ed wi h he lysosome and p e-lysosome and TbRAB4,
18
TbRAB5A, TbRAB5B and TbRAB11 as pa o he ea ly endosome and ecycling a ms
o he endocy ic pa hway (Mo gan e al., 2002b, Field e al., 1998).
Al hough ypanosomes ha e con en ional endomemb ane sys em, i has some
dis inc unusual ea u es, such as he cla h in dependence o all endocy osis (Allen e
al., 2003). These mechanisms seem o ha e an ex eme impo ance in immune e asion
and emphasize he high le el o endocy ic ac i i y in BSF ypanosomes as a po en ial
eason o he p o ec ion agains he mammalian immune sys em (Na esan e al., 2010).
T ypanosomes can be e icien ly elimina ed by mammalian an i-VSG an ibodies
and complemen ac i a ion. Ne e heless, he VSG-an ibody complex doesn’ emain
bound o he cell su ace and is apidly in e nalized, deg aded and he VSG is ecycled.
This an ibody up ake by he pa asi e appea s o be media ed by hyd odynamic low ha
d i es he an ibody bound o he highly abundan GPI-ancho ed VSG o he lagella
pocke whe e i is in e nalized (Na esan e al., 2011, Engs le e al., 2007). This p ocess
in ol es anspo s eps media ed by RAB5 and RAB11, bo h p o eins egula ed
acco ding o he de elopmen al s age (Pal e al., 2003), sugges ing ha he endocy ic
sys em is ac i a ed in he bloods eam s age (G ün elde e al., 2003, Pal e al., 2002).
Deg ada ion o immunoglobulins inside he pa asi e is ex emely selec i e,
occu ing wi h low p o eolysis o he VSG molecules and he de ails he enzymes used
in his selec i e p ocess a e unknown. The e a e me acaspases p esen in endosomal
esicles, co-loca ed wi h RAB11. Howe e hey ha e no di ec in ol emen in he an i-
VSG an ibody deg ada ion o VSG ecycling since hei knockdown and knockou
p oduce no majo e ec on hese p ocesses(Helms e al., 2006).
I is no clea i he e is any simila de ensi e ole in PCF pa asi es o i he e is
an adequa e explana ion o he ela i ely low endocy ic ac i i y in insec s age
pa asi es, al hough he e a e e idences ha pa asi es do no equi e high endocy ic
ac i i y in o de o su i e in he insec ec o (Na esan e al., 2007).
Apa om he singula i y o he lagellum complex o ganiza ion and
unc ionali y, T. b ucei has some o he dis inc ea u es. One o hese dis inguishing
ea u es is he p esence o he kine oplas , a sub-cellula s uc u e ound nea he basal
body, a he base o he lagellum. The kine oplas is a highly complex disk-shaped
s uc u e loca ed wi hin he ma ix o he single mi ochond ion o he T. b ucei cell and
19
composed by a s uc u al mass o p o eins and ca ena ed ci cula DNA molecules, he
kine oplas id DNA (kDNA) (S ua e al., 2005). The s uc u e o he kDNA is unique,
consis ing o a ne wo k o housands o ci cula DNA molecules, minici cles,
opologically in e locked wi h a ew dozen o la ge DNA molecules, maxici cles (Chen
e al., 1995, Shapi o and Englund, 1995).
The kine oplas and he basal body a e connec ed by an a achmen complex ha
c osses bo h he mi ochond ial and cell memb ane and h ough which he mi ochond ial
genome seg ega ion and he basal body eplica ion and seg ega ion e en s a e linked
(Ogbadoyi e al., 2003).
The mi ochond ion i sel is an elonga ed s uc u e ha in BSF pa asi es is de oid
o c is ae, e lec ing he absence o oxida i e phospho ila ion a his s age. Ene gy
gene a ion in BSF pa asi es is dependen on glycoly ic eac ions ha ake place wi hin
specialized o ganelles, he glycosomes (Pa sons, 2004). Glycosomes a e o ganelles
belonging o he amily o pe oxisomes, bu wi h an almos exclusi ely glycoly ic ole
in T. b ucei, wi h glycoly ic enzymes comp ising a ound 90% o p o ein con en o
hese o ganelles in he BSF pa asi e. Compa men a ion o glycolysis is unique and
essen ial o BSF pa asi e o de elop p ope ly, enabling hese o ganisms o o e come
sho pe iods o anae obiosis, al hough wi hou sus ained g ow h (Michels e al., 2006).
When in he mammalian hos , pa asi es encoun e a la ge supply o glucose
cons an ly a ailable in he bloods eam o ce eb ospinal luid. The mi ochond ion is
la gely ep essed and all ATP is gene a ed by a high a e o ae obic glycolysis inside he
glycosome (Pa sons, 2004). These pa asi es a e no adap ed o li e in he insec ec o
and quickly die i inges ed by he ly, unless hey di e en ia e in o sho s umpy
pa asi es which, al hough s ill glycolysis dependen , ha e a pa ially de- ep essed
mi ochond ial sys em (Michels e al., 2006).
In he insec hos , amino acids a e he p ima y nu ien s o pa asi es and e en
hough glycosomes emain abundan , hei enzyma ic con en changes.
Mos o he glycoly ic enzymes dec ease o e y low le els while o he
glycosomal enzyme le els inc ease and he oxida i e phospho yla ion eplaces
glycolysis as he p ima y ene gy gene a ion mechanism (Pa sons, 2004).
20
This enzyma ic con en a ia ion be ween di e en li e-cycle s ages o he
pa asi e is ex emely impo an o he apid and e icien adap a ion o he di e en
en i onmen s and glycosomes may play a signi ican ole in his me abolic adap a ion
(Michels e al., 2006, Pa sons, 2004).
T. b ucei also con ains ano he dis inc o ganelle in ol ed in he s o age o
polyphospha es, calcium and o he ca ions (Docampo e al., 2010). Acidocalcisomes a e
elec ondense acidic o ganelles p esen in a wide a ie y o p oka yo ic and euka yo ic
o ganisms, bu absen in mammalian cells (Mo eno and Docampo, 2003). The
memb ane o acidocalcisomes has nume ous pumps, exchange s and a leas one
channel and he ma ix is illed wi h enzymes in ol ed in polyphospha e me abolism.
Acidocalsisomes ha e an impo an ole no only in he s o age o phospho us and
ca ions bu also in calcium signaling, pH homeos asis and osmo egula ion in esponse o
en i onmen al s ess (Docampo e al., 2010).
This in e es ing and complex cellula o ganiza ion o T. b ucei is no cons an
and di e en mo phological o ms o he pa asi e can be obse ed depending on i s li e
cycle s age (See sec ion 1.2.1).
These mo phological o ms a e dis inguished acco ding o he posi ion o he
kine oplas and lagella pocke in ela ion o he nucleus. In ypomas igo es, he
kine oplas and lagella pocke a e loca ed on he pos e io end o he cell wi h a
cen ally loca ed nucleus and he lagellum eme ging om he an e io end o he cell.
In epimas igo es he kine oplas and lagella pocke a e an e io o he nucleus
and he lagellum eme ges app oxima ely om he middle o he pa asi e (Field and
Ca ing on, 2009).
Li e cycle p og ession is closely connec ed o he cell cycle egula ion wi h
p oli e a i e pa asi es al e na ing wi h non-p oli e a i e ones, whe e he cell cycle is
a es ed as a o m o p e-adap a ion o ansmission be ween hos s (McKean, 2003).
Al hough T. b ucei cell cycle is b oadly simila o he mammalian one, he e a e
some unique aspec s o be discussed in he ollowing chap e , such as he coo dina ed
eplica ion and seg ega ion o he pa asi e’s single copy o ganelles and he independen
eplica ion o he wo uni genome o he pa asi e.
27
As in o he papain–like pep idases, ca hepsin L and ca hepsin B–like pep idases
om kine oplas ids include a signal pep ide, a p o-pep ide essen ial o he ac i a ion o
he ca aly ic domain and a PepC1 ca aly ic domain. Addi ionally, kine oplas id
ca hepsin L–like pep idases ha e a C– e minal ex ension, which unc ion is ye o be
de e mined wi h accu acy. Al hough his C– e minal ex ension has no ca aly ic ole, i is
highly immunogenic and can be used o diagnos ic pu poses (Ca ey and S e e ding,
2009, Ca ey e al., 2000).
The ac i e si e o hese enzymes has a conse ed cys eine, his idine and
aspa agines esidue and is su ounded by highly conse ed pep ide mo i s. Like in o he
ca hepsin B–like pep idases, kine oplas id ones also ha e an inse ion o 20 aminoacids
in he ca aly ic domain, he occluding loop, ha con ibu es o he dipep idyl ca boxiyl
pep idase ac i i y o ca hepsin B (Ca ey and S e e ding, 2009).
The genome o kine oplas ids has se e al copies o ca hepsin L–like pep idases
genes. In T. b ucei, he e a e mo e han 20 copies o he gene a anged in andem a ay
and in T. c uzi he e a e mo e han 130 polymo phic genes a anged in clus e s loca ed
in di e en ch omosomes. The exp ession o ca hepsin B–like pep idases is much
simple and is no mally es ic ed o one o wo copies o he gene (Ca ey and
S e e ding, 2009, Mo am e al., 1998).
The e is a o al o 65 cys eine pep idases encoded in he genome o Leishmania
majo . Like in o he pa asi ic p o ozoa, mos s udies a e ocused on amily C1
pep idases, CPA and CPB, bo h ca hepsin L–like pep idases and CPC, a ca hepsin B–
like pep idase. Leishmania’s ca hepsin L pep idases a e s age egula ed and mainly
exp essed in amas igo es, whe e hey a e es ic ed o la ge lysosomes, also e med
megasomes (Ca ey and S e e ding, 2009).
CPB exis s as mul iple isoenzymes encoded by a andem a ay o CPB genes (19
in L. mexicana and 8 in L. majo ) in a single locus (Mo am e al., 2004, Mo am e
al., 1998). These isoenzymes a e sligh ly di e en , p esen ing dis inc ca aly ic
p ope ies and subs a e p e e ences and p obably, di e en unc ions in he hos -
pa asi e in e ac ion (Mo am e al., 1998). The gene a ion o null mu an s o CPA, CPB
and CPC in Leishmania showed ha hese enzymes ha e a signi ican ole in he hos -
pa asi e in e ac ion, ac ing as modula o s o he mammalian’s immune sys em and

28
enabling he pa asi e’s su i al and p oli e a ion inside he mac ophages (Mo am e
al., 2004, Mo am e al., 1998).
C uzipain, he main cys eine pep idase o T. c uzi, can be ound in all li e cycle
s ages, al hough i s exp ession is highe in he eplica ing o ms o he pa asi e,
pa icula ly, in epimas igo es. C uzipain localiza ion is di e en in epimas igo es, whe e
i is ound in he endosomal/lysosomal sys em, and amas igo es, whe e i is localized on
he cell su ace (Ca ey and S e e ding, 2009, Mo am e al., 2004). The enzyme
seems o be in ol ed no only in he hos ’s immune sys em e asion bu also in
me acyclogenesis (McKe ow e al., 2009). Addi ionally, c uzipain has signi ican oles
in amas igo e eplica ion, in acellula de elopmen and cellula in asion (Ca ey and
S e e ding, 2009).
T. b ucei has cys eine pep idases belonging o bo h ca hepsin L and ca hepsin B–
like pep idases. B ucipain, a ca hepsin L–like pep idase, is he majo CP o he pa asi e.
I has been iden i ied in all li e cycle s ages and i s le els o exp ession is app oxima ely
5 o 10 imes highe in sho s umpy o ms han in long slende BSF o p ocyclic o ms,
whe e i has compa a i ely li le ac i i y. I s cellula localiza ion is dependen on cell
cycle s age. In BSF he enzyme is con ined o he lysosomes while in PCF he
localiza ion o b ucipain is ye o be de e mined (Ca ey and S e e ding, 2009, Ca ey
e al., 2000). Ca hepsin B–like pep idases o T. b ucei (TbCa B) a e exp essed
essen ially in he bloods eam o ms o he pa asi e, while in T. c uzi and Leishmania
hese enzymes a e exp essed h oughou he li e cycle (Ca ey and S e e ding, 2009).
Bo h ca hepsin L and ca hepsin B–like pep idases a e essen ial o he pa asi e
success ul su i al wi hin he mammal hos . RNAi o TbCa B esul ed in engo ged
lysosome, g ow h a es and dea h o pa asi es in i o. Simila s udies in ol ing
b ucipain RNAi in i o showed no pe cep ible pheno ype. In in i o s udies, he
knockdown o TbCa B cu ed he in ec ion whe eas he RNAi agains b ucipain led o an
ex ended li e ime o in ec ed mice (Ca ey and S e e ding, 2009, Abdulla e al.,
2008).
Fu he s udies show ha b ucipain assis s he pa asi e mig a ion h ough he
blood b ain ba ie in o he b ain, sugges ing ha al hough he enzyme is no essen ial
o pa asi e iabili y, i has an impo an ole in he ne ous sys em in asion and he
29
de elopmen o he second s age o he sleeping sickness disease (Abdulla e al., 2008,
Nikolskaia e al., 2006).
G ea p og ess has been made in he es ablishmen o cys eine pep idases as d ug
a ge s in T. b ucei. Inhibi o y s udies using syn he ic inhibi o s such as
benzyloxyca bonyl-phenylalanine-alanine diazome hane (Z-Phe-Ala-CHN2) ha e been
conduc ed wi h some success, esul ing in pa asi e dea h bo h in i o and in i o in a
mu ine model (Ca ey and S e e ding, 2009, Mackey e al., 2004).
Al hough TbCa B has al eady been alida ed as d ug a ge (Malla i e al.,
2009), b ucipain is s ill a main ocus in he e o o inding an e ec i e ypanocidal
inhibi o . The enzyme is ye o be alida ed as chemo he apeu ic a ge since he
comple e silencing has no been achie ed and he impo ance o b ucipain o he
in ec ion and disease p og ession is s ill unde e mined (Ca ey and S e e ding, 2009).
1.3.1.2 Se ine Pep idases in T ypanosoma ids
Se ine pep idases belong o he mos abundan and di e se g oup o p o eoly ic
enzymes, accoun ing o mo e han one hi d o all pep idases. G ouped in 40 amilies
dis ibu ed o e 13 Clans, se ine pep idases a e widely dissemina ed in na u e and can
be ound in he mos di e se o ganisms om animals and plan s o i us and bac e ia
(Di Ce a, 2009, Page and Di Ce a, 2008). These enzymes a e no mally endopep idases
and use a ca aly ic iad o se ine, aspa a e and his idine, exhibi ing simila special
a angemen bu di e en o de in he amino acid sequence (Polgá , 2005). O he se ine
pep idases can use ei he simple dyad mechanisms o se ine and lysine o his idine in
he ac i e si e o di e en ca aly ic iads (Page and Di Ce a, 2008).
The –OH g oup o he se ine esidue ac s as a nucleophile on he ca bonyl
ca bon o he scissile pep ide bond o he subs a e while he pai o elec ons on he
his idine accep s he hyd ogen om he se ine –OH g oup, coo dina ing he a ack o
he pep ide bond. The ca boxyl g oup o he aspa a e makes he pai o elec ons much
mo e elec onega i e (Di Ce a, 2009). The combina ion o he h ee aminoacid esidues
ha comp ise he ca aly ic iad is known in ou di e en 3D p o ein olds ( ypsin,
30
sub ilisin, p olyl oligopep idase and ClpP pep idase), sugges ing di e en e olu iona y
o igins (Page and Di Ce a, 2008).
Clan PA is he la ges and bes s udied clan o se ine pep idases wi h membe s
in ol ed in many c i ical physiological p ocesses. I includes amily S1A and S1B, wo
phylogene ically di e en g oups o enzymes ha ha ha e in common he wo β-ba el
a chi ec u e and he o de His/Asp/Se o ca aly ic esidues on he polypep ide chain
(Page and Di Ce a, 2008). S1A o chymo ypsin like pep idases, a e di ided in o 6
di e en g oups in humans, acco ding o hei unc ion, in: diges i e enzymes ( ypsin
and chymo ypsin), coagula ion and immuni y enzymes, yp ases (componen s o
sec e o y g anules in mas cells), ma ip ases (memb ane bound enzymes wi h subs a e
selec i i y simila o ypsin), kallik ein (pep idases in ol ed in blood p essu e
egula ion) and g anzymes (apop osis media o s and de ense agains i al in ec ions).
This g oup o enzymes has limi ed dis ibu ion in plan , p oka yo es and a chaea. In
con as , S1B pep idases a e es ablished h oughou all o ganisms and a e in ol ed in
p o ein u no e (Di Ce a, 2009).
The abundance o S1 pep idases e lec s he selec i e ad an age o
chymo ypsin-like old o his amily. Howe e , he dissemina ion o clan PA
pep idases only ook place in euka yo ic o ganisms, while in p oka yo es, plan and
ungi, he p edominan se ine pep idases belong o can SB and SC (Page and Di Ce a,
2008).
Clan SB includes sub ilisin and is mo e abundan in plan s and bac e ia wi h
li le exp ession in he animal kingdom (Page and Di Ce a, 2008). Clan SB and clan PA
pep idases exhibi simila a chi ec u e bu di e en 3D s uc u es, sugges ing an
independen bu ye con e gen e olu ion (Polgá , 2005). Wi h pa allel β-shee
a angemen and Asp/His/Se o de o ca aly ic esidues, sub ilisin amily ( amily S8) is
a e y success ul g oup o enzymes wi h ep esen a i es wi h simple p o eoly ic ac i i y
in ungi and bac e ia and mo e in ica e ones in euka yo es (Ba e and Rawlings,
1995). Ne e heless, hei biological ole ends o be ela ed wi h nu i ion and p o ein
p ocessing (Page and Di Ce a, 2008).
Clan SC pep idases a e he second la ges g oup o se ine pep idases in humans.
The α/β hyd olase- old, cha ac e is ic o SC pep idases, p o ides a e sa ile ca aly ic
31
pla o m and hese enzymes can p esen addi ional ca aly ic ac i i y, ac ing as es e ases,
lipases, dehalogenases, halope ozidases, lyases o epoxide hyd olases (Page and Di
Ce a, 2008). Enzymes belonging o Clan SC p esen bo h, endo- o exop o eoly ic
ac i i y, a cha ac e is ic con as ing wi h o he amilies o se ine pep idases ha a e
usually cons i u ed ei he by endopep idases o exopep idases (Page and Di Ce a, 2008).
The S9 amily is he mos ep esen a i e amily o Clan SC pep idases, wi h 41
homologous iden i ied in he human genome. P olyl oligopep idase (POP) exhibi s he
o de Se /Asp/His in he polypep ide chain, cha ac e is ic o clan SC pep idases. POP is
one o he bes cha ac e ized enzymes om amily S9, and i has been sugges ed ha i
plays a pu a i e ole in neu opep ide me abolism (Page and Di Ce a, 2008).
Clan SK pep idases a e mos ly ep esen ed in bac e ia and ha e he impo an
pu pose o main aining in acellula p o ein le els. The ca aly ic uni o clan SK
enzymes is a ied, bu in ClpP pep idase, an impo an enzyme o p o ein u no e in
E. coli, he con en ional ca aly ic iad is used in a no el a angemen o esidues in he
polypep ide chain (Se /His/Asp) (Page and Di Ce a, 2008).
Despi e he ex ensi e s udies ca ied ou on se ine pep idases, in
ypanosoma ids he e a e jus a ew membe s iden i ied and well cha ac e ized and
only wo ha e been used as chemo he apeu ic a ge s, oligopep idase B, a membe o
POP amily ound in he cy osol o T. c uzi, T. b ucei, T. congolense and L.
amazonensis, and POP Tc80, iden i ied in T. c uzi (Coe ze e al., 2008, Bea iz
Ve melho e al., 2007).
POP Tc80 ac i i y is de ec able in all de elopmen al s ages o T. c uzi. The
enzyme is sec e ed by ypomas igo es and is also associa ed wi h he pa asi e’s
lagella pocke . This enzyme’s ac i i y is speci ically di ec ed o majo componen s o
he ex acellula ma ix such as ype I and IV collagen and also ib onec in. This
sugges s ha POP Tc80 may be in ol ed in he hos cell in asion by clea age o
collagen and in e ac ion wi h he in eg in ecep o s, o i may assis in he pa asi e’s
mig a ion h ough he ex acellula ma ix, p o iding i s access o any cell o he hos
o ganism (Bea iz Ve melho e al., 2007).
Oligopep idase B, o OPB is a se ine pep idase membe o amily S9 om clan
SC. Al hough i exhibi s ypsin-like subs a e speci ici y, his enzyme has some
32
p ope ies ha place i in he se ine pep idases g oup, namely he sensi i i y o
inhibi o y molecules o se ine pep idase ac i i y and he insensi i i y o inhibi o s o
cys eine pep idase ac i i y (Bea iz Ve melho e al., 2007). To da e, i s biological ole
has no been es ablished wi h accu acy, al hough i has been iden i ied as an impo an
i ulence ac o in ypanosoma ids (Coe ze e al., 2008).
In T. c uzi, oligopep idase B is a cy osolic pep idase associa ed wi h he
pa asi e’s abili y o in ade mammalian cells and he es ablishmen o in ec ion (Bea iz
Ve melho e al., 2007). Fo he in asion o occu , he pa asi e mus ec ui he hos ’s
lysosome, a p ocess dependen on he in acellula concen a ion o ee calcium
([Ca2+]i). In ec i e ypomas igo es igge he inc ease o in acellula calcium in
mammalian cells, essen ial o he pa asi e’s in asion and associa ed wi h he ac i i y o
he pa asi e’s OPB. Inhibi ion o T. c uzi OPB ac i i y using p o ease inhibi o s o
speci ic an ibodies esul s in inhibi ion o he Ca2+ signaling ac i i y. The same e ec is
obse ed in OPB null mu an ypomas igo es, esul ing in de ec i e cell in asion and
es ablishmen o in ec ion in mice (Coe ze e al., 2008, Cale e al., 1998, Bu leigh e
al., 1997).
In Leishmania is possible ha OPB media es he ac i a ion o cy osolic p o eins
ha can damage he memb ane o mac ophages h ough he o ma ion o
ansmemb ane po es (Leishpo ins) (Coe ze e al., 2008). Gene a ion o OPB null
mu an s in L. majo led o a dec ease o he me acyclic p omas igo es popula ion and o
a educ ion o he abili y o in ec mac ophages in i o.
Howe e , when used o in ec mice, OPB null mu an s showed no signi ican
e ec , sugges ing ha he enzyme i sel is no an impo an i ulence ac o in L. majo ,
con as ing wi h he obse ed in ypanosomes (Munday e al., 2011).
T. b ucei oligopep idase B is eleased by he pa asi es in o he mammalian
bloods eam and he e i s ays ac ing on he hos ’s pep ide ho mones and p omo ing he
pa hogenesis. Despi e he p esence o nume ous pep idase inhibi o s in he mammalian
bloods eam, he enzyme e ains ull ca aly ic ac i i y since i ’s no inhibi ed by he
plasma se pins. Once in he bloods eam, he enzyme ac s on clea ing egula o y
pep ides p esen in he hos ’s se um, sugges ing a possible ole o T. b ucei OPB in he

33
dis up ion o he hos ’s ho mone me abolism du ing in ec ion (Coe ze e al., 2008,
Bea iz Ve melho e al., 2007, Mo y e al., 1999).
The e a e no oligopep idase B homologous iden i ied in mammals, bu he
ypanosomal enzyme has simila speci ici y o se e al mammalian plasma se ine
pep idases, making i di icul o design highly speci ic inhibi o s (Bea iz Ve melho e
al., 2007, T oebe g e al., 1996).
1.3.2 Na u al Inhibi o s o Pep idases
Pep idases ca alyze mainly i e e sible hyd oly ic eac ions and can be
po en ially haza dous o he en i onmen . As a esul , hei ac i i y has o be s ic ly
egula ed (Bode and Hube , 2000).
This can be done in he li ing o ganism by se e al mechanisms, such as,
egula ion o gene exp ession; ac i a ion o inac i e zymogens; a ge ing o speci ic
cellula compa men s; pos - ansla ional modi ica ions; and inhibi ion by endogenous
inhibi o s (López-O ín and Bond, 2008, Rawlings e al., 2004).
The numbe o endogenous inhibi o s iden i ied o da e is ex emely low when
compa ed o he numbe o pep idases and hey all seem o be p o eins, al hough some
mic oo ganisms can p oduce small non-p o ein molecules capable o inhibi ing
p o eoly ic ac i i y o hos pep idases (López-O ín and Bond, 2008, Bode and Hube ,
2000). The dispa i y o pep idases and pep idase inhibi o s numbe s esul s om he low
speci ici y o inhibi o s and om he ac ha some pep idases ha e hei p o eoly ic
ac i i y egula ed h ough ano he mechanism and a e no inhibi ed by any endogenous
inhibi o (López-O ín and Bond, 2008).
Pep idases inhibi o s can be classi ied in o amilies acco ding o he ca aly ic
class o he a ge pep idase. The e a e 67 amilies o pep idase inhibi o s iden i ied in
MEROPs da abase. F om hese, 49 amilies a e g ouped in o 38 di e en clans
acco ding o hei e ia y s uc u e. No clan was assigned o he emaining 18 amilies,
once hei e ia y s uc u e is ye o be sol ed (Rawlings, 2010).
34
The classi ica ion o pep idase inhibi o s can also be based on he mechanism o
inhibi ion in ou di e en g oups. Canonical inhibi o s include se ine pep idase
inhibi o s (Se pins) and ac on he a ge pep idase by binding o he ac i e si e o he
enzyme in a way ha esembles he subs a e. Exosi e-inhibi o s g oup includes cys eine
pep idase inhibi o s (Cys a ins) and some h ombin inhibi o s. These inhibi o s bind o a
egion adjacen o he ac i e si e o he a ge pep idase, p e en ing he access o
subs a e o he ac i e si e, wi hou blocking he ca aly ic esidues. (López-O ín and
Bond, 2008) A hi d g oup o endogenous inhibi o s use an inhibi ion mechanism ha
combines bo h he canonical and he exosi e-binding mechanism. This g oup includes
he TIMPs (Tissue Inhibi o s o Me allop o einases), which a e na u al inhibi o s o
ma ix me allop o einases ound in mos issues and body luids. Finally a ou h g oup
o inhibi o s binds o a egion dis an ly loca ed om he ac i e si e, inhibi ing he
pep idase by p e en ing i s dime iza ion and blocking i s ac i i y. (López-O ín and
Bond, 2008)
Inhibi ion mechanisms mus be coo dina ed o ensu e ha he igh subs a es a e
p ocessed a he igh ime and place and hus p e en ing he de egula ion o p o eoly ic
ac i i y ha can be po en ially ha m ul o he cell. (López-O ín and Bond, 2008)
Unde s anding how inhibi o s and pep idases in e ac wi h each o he may be help ul o
disco e new app oaches o he design o syn he ic inhibi o s o use as he apeu ic
d ugs. (Rawlings e al., 2004)
1.3.2.1 Inhibi o s o Cys eine Pep idases
In plan s and mammals, he ac i i y o cys eine pep idases is con olled by
endogenous inhibi o s o he cys a in and hy o opin classes. (López-O ín and Bond,
2008)
Membe s o he cys a in supe amily a e low molecula , single chain p o eins
ha bind e e sibly o he cys eine pep idases, o ming igh -binding complexes (Bea iz
Ve melho e al., 2007). In lowe euka yo es, such as p o ozoan pa asi es, he e is no
e idence o he exis ence o cys a in-like inhibi o s, despi e he p esence o la ge
amoun s o cys eine pep idases. S udies ocused on iden i ying endogenous inhibi o s o
35
cys eine pep idases in pa asi ic p o ozoa led o he disco e y o inhibi o y ac i i y
agains papain in leishmania cell lysa es. Ne e heless he esponsible molecule was no
ecognized and in 2001, using T. c uzi as a model, a p o ein capable o inhibi ing
papain-like cys eine pep idases was inally iden i ied in all li e s ages o he pa asi e.
(Mon ei o e al., 2001)
The endogenous inhibi o iden i ied as chagasin is a low molecula weigh ,
he mo- esis an p o ein ha ac s as a igh -binding e e sible inhibi o wi h s ong
a ini y o c uzipain and o he papain-like cys eine pep idases. I s biochemical
p ope ies a e simila o hose o cys a ins bu i s p ima y s uc u e di e s signi ican ly
om he membe s o he cys a in supe amily o om any o he known p o ein
(Mon ei o e al., 2001, Rigden e al., 2001). In ac , chagasin adop s an unusual
immunoglobulin- ype old (Rigden e al., 2001), exhibi ing high sequence simila i y
wi h a iable ligh chains, and may be he esul o ho izon al gene ans e om a hos
animal (Lima and Mo am, 2010, Rigden e al., 2001).
Homologous o chagasin we e ound in se e al euka yo es, bac e ia and a chaea,
being he i s pep idase inhibi o s o be iden i ied in p oka yo es. The sequence is
highly conse ed and all chagasin-like inhibi o s a e ypically 110-130 aminoacids long
wi h no addi ional domains wi h a conse ed co e s uc u e consis ing o se en β-
s ands plus one o wo mo e po en ial β-s ands. (Rigden e al., 2002) By NMR
spec oscopy i was de e mined ha membe s o he chagasin amily ha e se e al
conse ed esidues loca ed a one end o he molecule dis ibu ed along h ee exposed
loops, L2, L4 and L6.
These loops con ain he NPTTG mo i esponsible o inhibi ing papain and a e
mos likely in ol ed in binding o a ge pep idases, wi h he conse ed esidues T31
and T32 in loop L2 in ol ed in he o ma ion o key hyd ogen bonds wi h he pep idase
nea he ca aly ic iad (Lima and Mo am, 2010, dos Reis e al., 2008, Salmon e al.,
2006).
The mode o in e ac ion wi h cys eine pep idases is also conse ed and exhibi s
simila i ies o he mode o in e ac ion be ween membe s o he cys a in supe amily and
hei cys eine pep idases. (Rigden e al., 2002) These indings esul ed in he
classi ica ion o he chagasin-like pep idase inhibi o s as clan IX, amily I42 in he
36
MEROPS da abase a new amily o inhibi o s o cys eine pep idases, commonly
designa ed ICP (Inhibi o s o Cys eine Pep idases). Rep esen a i es o he ICP amily
we e also iden i ied and cha ac e ized in T. b ucei, L. mexicana and L. majo , all
e ec i e inhibi o s o clan CA, amily C1 cys eine pep idases om mammals and
p o ozoa. (San os e al., 2005, Sande son e al., 2003)
T. c uzi pa asi es depend on hei majo lysosomal cys eine pep idase, c uzipain,
o in ade and p oli e a e wi hin mammalian hos cells. S udies wi h syn he ic inhibi o s
ha e sugges ed ha c uzipain ac i i y is c ucial o he pa asi e’s g ow h and
di e en ia ion, by blocking he ma u a ion o he p o-enzyme, esul ing in he
accumula ion o unp ocessed p o-c uzipain in he la e Golgi esicles in epimas igo es
(Mon ei o e al., 2001).
The co-localiza ion o c uzipain and chagasin in he Golgi complex and in
ese osomes (a la e endocy ic compa men o T. c uzi and main deposi o ac i e
c uzipain) sugges s ha he inhibi o mus combine wi h he ma u e pep idase inside
hese compa men s, once he ma u a ion o c uzipain is hough o occu inside he
Golgi. The o e exp ession o chagasin in T. c uzi epimas igo es esul s in dec eased
c uzipain ac i i y, educed di e en ia ion o me acyclic ypomas igo es and inc eased
esis ance o he pa asi e o syn he ic cys eine pep idase inhibi o s.
T ypomas igo es o e exp essing chagasin ha e also e ealed o be less in ec i e
in cul u e, sugges ing ha chagasin modula es T. c uzi di e en ia ion and in asion o
mammalian cells h ough he egula ion o endogenous c uzipain ac i i y (Lima and
Mo am, 2010, San os e al., 2005).
In Leishmania mexicana he dele ion o ICP p oduced no signi ican pheno ype
in i o wi h null mu an g owing no mally and in ec ing mac ophages as wild ype
pa asi es. Addi ionally, he p ocessing, a icking and ac i i y o cys eine pep idases
om null mu an s was simila o he wild ype and only a small p opo ion o ICP co-
localized wi h he pa asi e’s CPA and CPB, he only pep idases o which ICP binds o.
Howe e , null mu an s we e less i ulen o mice which sugges ed ha ICP plays
a ole in p o ec ing he pa asi e om he hos ’s hos ile en i onmen a he han
modula ing he ac i i y o he pa asi es cys eine pep idases (Lima and Mo am, 2010,
Bes ei o e al., 2004).
43
2.1 Bac e ial Cul u es
2.1.1 S ains used
Fo gene al ecombinan DNA echniques, he cells used we e compe en E. coli
XL1–Blue (S a agene), geno ype ecA1 endA1 gy A96 hi-1 hsdR17 supE44 elA1 lac,
e acycline esis an . As hese cells a e endonuclease and ecombina ion de icien , he
DNA quali y and plasmid hei s abili y is g ea ly imp o ed. Fo he exp ession o
ecombinan p o eins he s ain used was E. coli BL21 (D3) (No agen), an E. coli s ain
con aining an IPTG inducible T7 RNA polyme ase and speci ically designed o high
le el o exp ession o ecombinan p o eins in pET ec o s.
2.1.2 Bac e ial cul u e and s o age
E. coli cells we e sp ead on o aga pla es con aining he app op ia e an ibio ics
(100 µg/ml o ampicillin; 50 µg/ml o kanamycin o 40 µg/ml o chlo amphenicol) and
incuba ed o e nigh a 37°C. Single colonies we e used o inocula e liquid Lu ia-Be ani
b o h medium (LB medium) wi h he app op ia e an ibio ics and g own o e nigh a
37°C, shaking. Fo long e m s o age, 500 µl o an o e nigh cul u e we e mixed wi h
equal olume o 2% (W/V) pep one, 40% (V/V) glyce ol and s o ed a -80°C.
2.1.3 P epa a ion o E. coli compe en cells
Compe en cells we e p epa ed using ubidium chlo ide. A single colony o he
desi ed s ain was inocula ed in o 5 ml o liquid LB medium and g own o e nigh a
37°C, shaking. This o e nigh cul u e was dilu ed 1:1000 in o 50 ml o esh LB
medium and g own a 37°C, shaking, un il i eached an op ical densi y o 0.6 a 600
nm. The cul u e was hen incuba ed on ice o 10 minu es and cen i uged a 2000 g o

44
15 minu es, a 4°C. The bac e ial pelle was gen ly esuspended in 16 ml o cold RF1
solu ion (100 mM RbCl, 50 mM MnCl2.4H2O, 30 mM po assium ace a e pH 7.5, 10
mM CaCl2 (dihyd a e), 15 % glyce ol, adjus ed o pH 5.8 using ace ic acid, il e
s e ilized), incuba ed on ice o 15 minu es and cen i uged as be o e. The pelle was
hen esuspended in 4 ml o RF2 solu ion (10 mM MOPS pH 6.8, 10 mM RbCl, 75 mM
CaCl2 (dihyd a e), 15 % (w/ ) glyce ol, pH adjus ed o 6.8 wi h NaOH, il e -s e ilized)
and incuba ed on ice o 1 hou . The cells we e aliquo ed o single use and snap ozen
in e hanol on d y ice. Aliquo es we e s o ed a -80 °C.
2.2 Molecula Biology Techniques
2.2.1 Polyme ase Chain Reac ion (PCR) and oligonucleo ides used
PCRs o bac e ial colony sc eening, expe imen op imiza ion o o he
expe imen s ha did no equi e p oo eading ac i i y we e pe o med wi h Taq DNA
polyme ase (New England Biolabs). Fo cloning o sequencing, PCRs we e pe o med
using high ideli y p oo eading enzymes such as P uTu bo (S a agene) and Phusion
(Finnzymes).
The s anda d PCR eac ion was ypically pe o med using 2.5 µl o 10× PCR
Mix (1.13 mg/ml BSA, 450 mM T is pH 8.8, 110 mM ammonium sulpha e, 45 mM
MgCl2, 68.3 mM β-me cap oe hanol, 44 mM EDTA pH 8.0, 10 mM dATP, 10 mM
dCTP, 10 mM dGTP, 10 mM dTTP). To each PCR eac ion we e added 10 pmol o
each oligonucleo ide p ime , 100 ng o DNA empla e and 1 uni o Taq DNA
polyme ase, in a inal olume o 25 µl. Fo he PCR eac ions using high ideli y
enzymes, olumes and concen a ions o each componen we e adjus ed acco ding o
he manu ac u e ’s ins uc ions.
PCRs we e pe o med in a Hybaid PCR Exp ess he mocycle and he PCR
condi ions we e op imized o each eac ion, adjus ing he annealing empe a u e
acco ding o he mel ing empe a u e (Tm) o he p ime s and he ex ension ime
45
acco ding o he sequence leng h. The ypical PCR p og am used was composed by an
ini ial dena u a ion s ep o 5 minu es a 95°C ollowed by 25-30 cycles o 30 seconds o
dena u a ion a 95°C, 30 seconds o annealing (Tm o p ime s - 2°C) and ex ension a
72°C (1 minu e o each kb o DNA sequence o ampli y).
All oligonucleo ide p ime s used in his s udy we e designed using Vec o NTI
so wa e (In i ogen) and p oduced by Eu o ins MWG Ope on (Ebe sbe g, Ge many).
De ailed oligonucleo ide p ime s used in his s udy a e lis ed on Table 2.1.
2.2.2 Aga ose gel elec opho esis
DNA analysis by aga ose gel elec opho esis was ca ied ou using 1% gel (w/ )
o Ul aPu e aga ose (In i ogen) in 0.5× TBE bu e (20 mM T is, 20 mM bo ic acid,
0.5 mM EDTA, pH 7.2).
Gels we e p epa ed by boiling he aga ose solu ion in a mic owa e. A e
cooling down, Syb sa e™ DNA s ain (In i ogen) was added o allow DNA
isualiza ion.
The gel was hen cas and le o solidi y. Samples we e p epa ed wi h 6× DNA
loading dye (0.25% (w/ ) b omophenol blue, 0.25% (w/ ) xylene cyanol FF, 30% ( / )
glyce ol, in H2O) and un a 100 V in Li e Technologies Ho izon gel anks.
A 1 kb molecula weigh ma ke (In i ogen) was used a a concen a ion o 0.5
µg pe lane as a e e ence o de e mine DNA size and concen a ion o he DNA
agmen s analyzed.
To isualize he DNA, gels we e exposed o UV ligh using a BioRad Gel-Doc
image wi h Quan i y One so wa e.
Whene e he DNA was o be excised om a gel, a Da kReade blue ligh
ansilumina o was used. DNA ex ac ions om aga ose gels we e pe o med using a
Gel Ex ac ion ki (Qiagen) acco ding o he manu ac u e ’s ins uc ions.
46
Table 2.1 – Oligonucleo ides used in his s udy
2.2.3 Cloning o PCR p oduc s
The PCR p oduc s we e sub-cloned in o comme cial ec o s such as pGEM-T-
Easy (P omega) and pPCR-Sc ip (S a agene) o es ablish s able DNA p opaga ion.
When using he pGEM-T-Easy Vec o Sys em, a e a PCR pe o med wi h a high
ideli y p oo eading enzyme, he PCR p oduc was incuba ed a 72°C o 15 minu es
Oligo
Numbe
Ta ge sequence
Di ec ion
Sequence
Res ic ion
Si es
ISP1 knockou cons uc s
OL2417
Tb927.5.1730
5’ ISP1 lanking egion
Fo wa d
GGCGGCCGCTGCAGTGACAGACGGCAGGAG
No I
OL2418
Re e se
GTCTAGATGTCAGTATTGTGCGAACGGG
XbaI
OL2419
Tb927.5.1730
3’ ISP1 lanking egion
Fo wa d
TGGGCCCCACCGAAAGTTGATCCCGTAC
ApaI
OL 3257
Re e se
CGGGCCCCTCGAGTGAGAAGGGTTCTCCTACCACT
ApaI; XhoI
ISP2 knockou cons uc s
OL2421
Tb927.5.1880
5’ ISP2 lanking egion
Fo wa d
TGCGGCCGCGAGCATGAATTAGGCAGAATG
No I
OL2422
Re e se
GTCTAGATCGCTTCCTTTCGCGGGTAAC
XbaI
OL2423
Tb927.5.1880
3’ ISP2 lanking egion
Fo wa d
TGGGCCCTCGTTACAACAGCCAACTACC
ApaI
OL3258
Re e se
CCGGGCCCCTCGAGACGCACACTGACGGCCACAC
ApaI; XhoI
ISP1 and ISP2 knockou analysis
OL2508
Tb927.5.1730
ISP1 locus
Fo wa d
GCAGTGAATCGCCAAGAATC
OL2509
Re e se
GATTGAAGGAACCAATACAC
OL2510
Tb927.5.1880
ISP2 locus
Fo wa d
GAAGGTGAAGGTGAGGCAAC
OL2511
Re e se
TGCGGAAGGCAACAAAAGAC
OL13
Hyg omycin esis ance
casse e
Re e se
GGTGAGTTCAGGCTTTTTCA
OL14
Fo wa d
CGTCCGAGGGCAAAGGAATA
OL1360
Neomycin esis ance c
asse e
Fo wa d
GTGCTTTACGGTATCGCCGC
OL1361
Re e se
CCGGACAGGTCGGTCTTGAC
OL536
Blas icidin esis ance
casse e
Re e se
TTGAGACAAAGGCTTGGCCAT
OL537
Fo wa d
GGTTATGTGTGGGAGGGCTAA
OL15
Pu omycin esis ance
casse e
Re e se
CCGTGGGCTTGTACTCGGTCA
OL16
Fo wa d
ACCCGCAAGCCCGGTGCCTGA
ISP1 e-exp ession cons uc s
OL3635
Tb927.5.1730
Tb ISP1
Fo wa d
GCGATATCATGTTTGGTTCCCGGAAGGC
EcoRV
OL3636
Re e se
GCGATATCTTATTCTTCGGCTTTCTTGG
EcoRV
ISP2 e-exp ession cons uc s
OL3637
Tb927.5.1880
Tb ISP2
Fo wa d
GCGATATCATGACAGACCGACCTCCGAC
EcoRV
OL3638
Re e se
GCGATATCCTAACCCGCCCTCTCCTCGA
EcoRV
In si u N- e minal YFP agging cons uc s
OL2773
Tb927.5.1730
Tb ISP1
Fo wa d
CCAAGCTTCCGCCACCATGTTTGGTTCCCGG
HindIII
OL2774
Re e se
GCGGATCCAGAACCTTATTCTTCGGCTTTCTTG
BamHI
OL2771
Tb927.5.1880
Tb ISP2
Fo wa d
CCAAGCTTCCGCCACCATGACAGACCGACCT
HindIII
OL2772
Re e se
CGGGATCCAGAACCCTAACCCGCCCTCTCCTC
BamHI
ICP si e di ec ed mu agenesis cons uc
OL2765
Tb927.8.6450
Tb ICP
Fo wa d
CGAAGCCACGTGTAGCCTGGGTTGCTCTCAAG
OL2766
Re e se
CTTGAGAGCAACCCAGGCTACACGTGGCTT
47
wi h 0.5 uni s o Taq DNA polyme ase (A- ailing s ep needed o allow he liga ion o
he A- ail om he PCR p oduc o he T-o e hangs a he end o he ec o ).
The pPCR-Sc ip ec o has blun ends and can be used o subcloning di ec ly
a e he PCR wi h a high ideli y p oo eading polyme ase. Fo ei he subcloning
sys ems, 2 µl o PCR p oduc was liga ed wi h he ec o acco ding o he
manu ac u e ’s ins uc ions and ans o med in o compe en E. coli XL1-Blue cells.
T ans o man s we e hen selec ed as desc ibed on sec ion 2.2.7.
2.2.4 Res ic ion endonuclease diges ion
DNA was diges ed using es ic ion enzymes om New England Biolabs and
hei speci ic bu e s. Diges ion eac ions we e supplemen ed wi h BSA and ca ied ou
a oom empe a u e o 37 °C, o 1-4 hou s acco ding o he manu ac u e ’s
ins uc ions. Diges ed DNA was isualized by aga ose gel elec opho esis as desc ibed
in sec ion 2.2.2, and pu i ied om he gel using a Gel Ex ac ion ki (Qiagen) when
equi ed.
2.2.5 Liga ion o DNA agmen s
Liga ions we e pe o med using T4 DNA ligase and T4 DNA ligase bu e (New
England Biolabs) acco ding o he manu ac u e ’s ins uc ions.
Typically, bo h diges ed plasmid and inse we e pu i ied om aga ose gels
using a Gel Ex ac ion ki (Qiagen) and added o a 10 µl eac ion in se e al inse : ec o
a ios.
Reac ions we e incuba ed o e nigh a 16 °C o 1 hou a oom empe a u e. Fo
blun ended liga ions, diges ed plasmids we e ea ed wi h CIP (cal in es inal alkaline
phospha ase, New England Biolab) o dephospho yla e he DNA ends and p e en sel
liga ion.
48
2.2.6 T ans o ma ion o DNA agmen s in E. coli
T ans o ma ion o plasmid DNA in o compe en E. coli cells was pe o med by
hea shock. 50 µl o compe en cells we e mixed wi h 1 µl o isola ed plasmid o 5 µl o
liga ion eac ion and kep on ice o 20 minu es. The ans o ma ion eac ion was hea
shocked in a wa e ba h a 42 °C o 40 seconds and placed immedia ely on ice o 5
minu es be o e pla ing he cells on aga pla es.
2.2.7 Selec ion o ans o man s
Selec ion o success ul ans o man s was done by an ibio ic selec ion and he
inse ion o a PCR p oduc in he ec o was assessed by blue/whi e colony sc eening.
Aga pla es we e p epa ed wi h he app op ia e an ibio ic (100 µg/ml o ampicillin, 50
µg/ml o kanamycin o 40 µg/ml o chlo amphenicol) and supplemen ed wi h 80 µg/ml
X-Gal and 0.5 mM o IPTG. Pla es we e incuba ed o e nigh a 37 °C and whi e
colonies we e selec ed o u he analysis by colony PCR o plasmid pu i ica ion and
es ic ion diges ion.
2.2.8 Colony sc eening by PCR
To con i m he PCR p oduc in eg a ion, single whi e colonies we e picked om
he aga pla e wi h a s e ile pipe e ip and esuspended in 20 µl o PCR eac ion mix,
a e being pa ched on o a esh aga pla e o e e ence. PCR was pe o med as
desc ibed p e iously (sec ion 2.2.1), using T3/T7 o M13F/M13R oligonucleo ides
when sc eening o an inse in he pPCR-Sc ip o pGEM-T-Easy ec o o speci ic
oligonucleo ides when using di e en plasmids, o de e mine he p esence o an
app op ia e size inse . PCR p oduc s we e analyzed on aga ose gel and he ele an
colonies used o inocula e 5 ml o LB medium. A e an o e nigh incuba ion a 37 °C,
he bac e ial cul u e was s o ed a - 80 °C o used o pu i y he plasmid DNA.

49
2.2.9 Plasmid DNA pu i ica ion
To pu i y he plasmid DNA, 3 ml o bac e ial cul u e o he posi i e clones
p e iously sc eened by colony PCR we e p ocessed wi h a MiniP ep ki (Qiagen),
acco ding o he manu ac u e ’s ins uc ions. DNA was elu ed in wa e , quan i ied using
an Eppendo BioPho ome e and s o ed a - 20 °C. When la ge amoun s o DNA we e
needed, as o DNA ans ec ions o example, 50 ml o bac e ial cul u e was g own
o e nigh a 37 °C and he DNA was ex ac ed using a MidiP ep ki (Qiagen).
2.2.10 DNA sequencing
DNA sequencing was pe o med by he Sequencing Se ice o he Uni e si y o
Dundee (www.dnaseq.co.uk) and esul s we e analyzed using ec o NTI applica ion,
Con igExp ess (In i ogen).
2.2.11 DNA p epa a ion o ans ec ion
Plasmid DNA used o ans ec T. b ucei was linea ised by diges ion wi h he
app op ia e es ic ion enzymes and p ecipi a ed wi h 0.1 olumes o 3 M sodium
ace a e pH 5.2 and 0.7 olumes o isop opanol o e nigh a - 20 °C. The p ecipi a ed
DNA was cen i uged a 13000 × g o 20 minu es a 4 °C and he pelle was washed
wi h cold 70 % e hanol o 15 minu es a 13000 × g. The DNA pelle was hen d ied and
esuspended in s e ile H2O.
2.2.12 Si e di ec ed mu agenesis
To dele e speci ic aminoacids o p e iously exp essed p o eins, a ge ed
mu a ions we e in oduced in he DNA sequence by si e di ec ed mu agenesis, using he
50
Quick Change Mu agenesis Ki (S a agene), acco ding o he manu ac u e ’s
ins uc ions. All DNA sequences gene a ed we e con i med by sequencing be o e
p o ein exp ession.
2.2.13 Plasmid gene a ion
Table 2.2 – Plasmids gene a ed and used in his s udy
2.2.13.1 Mu an ICP cons uc
The dele ion o 2 amino acids in he binding si e, leading o an inac i e ICP, was
pe o med by si e di ec ed mu agenesis o ICP exp ession plasmid, pGL1493, as
desc ibed in sec ion 2.2.12. P ime s used we e OL2765 and OL2766, bo h con aining
he mu a ion o in oduce in he ICP sequence.
The mu an ICP sequence was con i med by sequencing and he plasmid
gene a ed was named pGL1830 (Table 2.2).
Plasmid
Plasmid
Desc ip ion
pGL1830
pGL1493
T. b ucei ICP (Tb927.8.6450) p o ein exp ession mu a ed binding si e; KanR
pGL1688
pGL1224
T. b ucei ISP1 (Tb927.5.1730) knock ou ; AmpR/HygR
pGL1689
pGL1217
T. b ucei ISP1 (Tb927.5.1730) knock ou ; AmpR/NeoR
pGL1947
pGL1689
T. b ucei ISP1 (Tb927.5.1730) knock ou ; AmpR/BsdR
pGL1948
pGL1689
T. b ucei ISP1 (Tb927.5.1730) knock ou ; AmpR/Pu R
pGL1959
pGL1688
T. b ucei ISP2 (Tb927.5.1880) knock ou ; AmpR/HygR
pGL1960
pGL1689
T. b ucei ISP2 (Tb927.5.1880) knock ou ; AmpR/NeoR
pGL2049
pGL884
T. b ucei ISP1 (Tb927.5.1730) e-exp ession; AmpR/PhleoR
pGL2050
pGL884
T. b ucei ISP2 (Tb927.5.1880) e-exp ession; AmpR/PhleoR
51
2.2.13.2 ISP knock ou cons uc s
The 5’ and 3’ ISP1 and ISP2 lanking egions we e ampli ied om T. b ucei
hodesiense genomic DNA by PCR using Taq DNA polyme ase wi h p ime s
OL2417/OL2418 o 5’ISP1, OL2419/OL3257 o 3’ISP1; OL2421/OL2422 o 5’ISP2
and OL2423/OL3258 o 3’ISP2 (Table 2.2). The esul ing PCR p oduc s we e
indi idually sub-cloned in o pGEM-T-Easy ec o and sequences we e con i med by
sequencing. 5´ and 3’ISP1 lanking egions we e diges ed om he sub-cloning ec o s
wi h he enzymes No I/XbaI and ApaI/XhoI, espec i ely, and sequen ially liga ed in o
pGL1224 and pGL1217 p e iously diges ed wi h he same enzymes. Plasmids
gene a ed we e named pGL1688 and pGL1689 (Table 2.2). These plasmids we e hen
used as backbones o he gene a ion o ISP2 knock ou cons uc s and o swi ching he
esis ance ma ke in he ISP1 knock ou cons uc s.
The 5’and 3’ISP2 lanking egions we e diges ed om pGEM-T-Easy ec o
wi h No I/XbaI and ApaI/XhoI, espec i ely, and liga ed in o pGL1688 and pGL1689,
gene a ing pGL1959 and pGL1960 (Table 2.2).
Fo swi ching he esis ance ma ke s, pGL1689 was diges ed wi h EcoRI o
emo e neomycin esis ance gene. In pa allel, pGL1124 and pGL808 we e also diges ed
wi h EcoRI o excise blas icidin esis ance gene and pu omycin esis ance gene,
espec i ely. These wo agmen s we e hen liga ed in o he pGL1689 backbone o
gene a e pGL1947 and pGL1948 (Table 2.2).
2.2.13.3 ISP1 and ISP2 e-exp ession cons uc s
To gene a e ISP1 and ISP2 e-exp ession cons uc s, bo h ISP genes we e
ampli ied om T. b ucei hodesiense genomic DNA using P u Tu bo polyme ase and
cloned in o pPCR Sc ip ec o . A e con i ming he DNA sequence, he ISP1 and ISP2
we e excised om he sub-cloning ec o using EcoRV and liga ed in o pGL884
p e iously ea ed wi h he same enzyme, gene a ing plasmids pGL2049 and pGL2050,
espec i ely (Table 2.2).
52
2.2.14 Sou he n Blo ing
Sou he n Blo ing was used o con i m he ISP1 and ISP2 gene dele ion in he T.
b ucei hodesiense genome. Fo each cell line gene a ed, app oxima ely 5µg o genomic
DNA was diges ed o e nigh wi h he app op ia e enzymes. The enzymes we e chosen
acco ding o he size o agmen s o igina ed, in o de o allow he isualiza ion o he
di e ence be ween wild ype and knock ou alleles in he he e ozygous and
homozygous cell lines. Diges ed DNA om he di e en cell lines analyzed was
elec opho esed a a low ol age in a la ge, hick 0.8% aga ose gel s ained wi h SYBR-
Sa e (In i ogen). The gel was pho og aphed alongside a luo escen ule o allow he
co ela ion o DNA sizes in he ladde wi h he mig a ion dis ance. The gel was washed
o 10 minu es in 0.25 M HCl o emo e pu ines and insed in dis illed wa e . A e
depu ina ed, he gel was washed wi h dena u a ion bu e (1.5 M NaCl, 0.5 M NaOH)
o 15 o 30 minu es be o e insed again wi h dis illed wa e . Finally, he gel was
washed wi h neu aliza ion bu e (3M NaCl, 0.5 M T is-HCl, pH 7.0) o 30 minu es
and insed wi h dis illed wa e . All washings we e pe o med wi h gen le shaking.
DNA was hen ans e ed o e nigh o a nylon memb ane by capilla y o ce.
The gel was placed on a blo ing pape wick, he ends o which we e imme sed in 20×
SSC bu e (3 M NaCl, 0.3 M sodium ci a e pH7.0). The memb ane (Hybond-N nylon
memb ane, GE Heal hca e) was p e-soaked in dis illed wa e and hen in 20× SSC
bu e and hen placed on op o he gel, ollowed by wo laye s o blo ing pape , a
hick s ack o pape owels and a weigh on op o a plas ic pla e. A e he ans e , he
memb ane was washed o 10 minu es in 2× SSC bu e and he DNA was c osslinked
o he memb ane in a UV S a alinke 2400 c osslinke (S a agene) a 1200 mJoules.
Fo he p obing, he Gene Images Alk-Phos Di ec Labelling and De ec ion
Sys em (GE Heal hca e Ame sham) was used, acco ding o he manual, o gene a e a
luo escen -labelled DNA p obe, allowing his o bind he c oss linked DNA on he
memb ane and he e o e isualize i on ilm a e incuba ion wi h a chemiluminescen
subs a e. The p obe used was he 5’ lanking egion o bo h ISP1 and ISP2, diges ed
ou o he espec i e plasmids and pu i ied om aga ose gel. Signal was de ec ed using
CDP-S a de ec ion eagen (GE Heal hca e Ame sham).
59
2.4.4 Isola ion o T. b ucei genomic DNA
Genomic DNA was isola ed om T. b ucei cul u es using DNeasy Blood and
Tissue ki (Qiagen) acco ding o he Cul u ed Animal Cell p o ocol ou lined in he
manu ac u e ’s ins uc ions.
2.4.5 P epa a ion o whole cell ex ac s
2×106 o mid-log phase pa asi es we e cen i uged a 1500 g o 10 minu es. The
supe na an was ca e ully emo ed and he cell pelle was washed 2× in PBS (137 mM
NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, 1.47 mM KH2PO4, pH 7.4) by cen i uga ion a
1500 g o 5 minu es and esuspended in 1× SDS-PAGE loading bu e .
Samples we e boiled a 100 °C o 5 minu es o un in SDS-PAGE gels.
2.4.6 T. b ucei animal in ec ion and pa asi emia de e mina ion
Fo in ec ion wi h T. b ucei hodesiense (IL1852), mice we e p e iously ea ed
wi h cyclophosphamide be o e inocula ed wi h 1×105 cul u ed pa asi es by in a
pe i oneal injec ion.
Pa asi emia was de e mined daily by haemocy ome e cell coun ing o blood
aken om he ail, dilu ed in 0.83% ammonium chlo ide.
Pa asi es aken om a dono mouse we e hen used o in ec 4 ICR mice in each
in ec ion expe imen . To in ec mice wi h T. b ucei, he same p ocedu e was applied,
wi hou he cyclophosphamide ea men .

60
2.5 Monoclonal An ibodies
2.5.1 Gene a ion o hyb idomas
Female BALB/c mice we e immunized in ape i oneally wi h 10 µg o
ecombinan p o ein emulsi ied wi h F eund’s adju an (Sigma-Ald ich), e e y 2-3
weeks un il a sa is ac o y an ibody i e was eached. A e 3 o 5 immuniza ions, blood
samples we e ob ained om mice o se um i e de e mina ion by enzyme-linked
immunoso ben assay (ELISA). I he i e was s ill oo low, mice we e boos ed un il an
adequa e esponse was achie ed. Once he i e was high enough cell usion was
pe o med.
3 days be o e he cell usion, mice we e boos ed wi h he an igen and hen
eu hanized o spleen emo al. Sp2/0 myeloma cells we e cul u ed in 8-azaguanine
(Sigma-Ald ich) medium o ensu e hei sensi i i y o hypoxan hine-aminop e in-
hymidine (HAT) selec ion medium used a e he cell usion has occu ed. A week
be o e he cell usion, he 8-azaguanine was emo ed om he medium and myeloma
cells we e cul u ed in GIBCO® DMEM (Dulbecco’s Modi ied EagleMedium) wi h
10% GIBCO® FBS ( e al bo ine se um). Single spleen cells om immunized mice
we e hen used wi h he myeloma cells by co-cen i uga ion in he p esence o
polye hylene glycol (PEG).
A e being emo ed om he mouse, he spleen was imme sed in DMEM, in a
pe i dish, and he cells we e emo ed by injec ing medium inside he spleen, epea edly
un il all he cellula con en was all in suspension. The spleen cell suspension was hen
cen i uged o 10 minu es a 1200 pm and cells esuspended in 10 ml o DMEM. 10 µl
o esuspended cells we e used o de e mine cell densi y and iabili y wi h T ypan blue
(Sigma-Ald ich) in an Imp o ed Neubaue haemocy ome e coun ing chambe . In
pa allel, he cellula densi y o he Sp2/0 cells was also de e mined and bo h cellula
suspensions we e mixed in a 1:10 p opo ion o Sp2/0:spleen cells. The Sp2/0 and
spleen cells suspension was hen cen i uged a 1200 pm o 10 minu es and he
supe na an disca ded.
61
0.8 ml o PEG-DMSO (Sigma-Ald ich) was slowly added and gen ly mixed wi h
he cell pelle , lea ing i o es o 1 minu e. The PEG-DMSO was hen dilu ed i s by
slowly adding and gen ly mixing 1 ml o DMEM and hen by an addi ional olume o
20 ml o DMEM o e 5 minu es ime.
The suspension was cen i uged a 1200 pm o 10 minu es and he cell pelle
was esuspended in 25 ml o comple e DMEM medium supplemen ed wi h 10% FBS
and HAT 1× (Sigma – Ald ich) and pla ed on ou 96-well pla es. 24 hou s a e he cell
usion, 100 µl o comple e DMEM medium was added o each well and pla es we e le
o g ow a 37 °C in a 5% CO2 incuba o .
2.5.2 Sc eening o an ibody p oducing Hyb idomas
The p inciple o c ea ing an an ibody sec e ing hyb idoma is based on he
cellula usion be ween an ibody p oducing spleen cells, wi h limi ed li e spam, wi h
cells de i ed om an immo al umo o lymphocy es ha do no syn hesize
immunoglobulin, myeloma cells. The esul ing hyb idoma no only is capable o
p oducing and sec e ing an ibodies bu also o unlimi ed g ow h.
As he myeloma cell line is de ec i e in he enzyme
hypoxan hineguanidinephospho ibosyl ans e ase (HGPRT), hey die when cul u ed in
DMEM supplemen ed wi h HAT (aminop e in blocks he main DNA syn hesis pa hway
and he al e na i e pa hway ha equi es he use o exogenous hypoxan hine depends on
he enzyme HGPRT). Only hyb ids be ween myeloma and spleen cells is capable o
su i ing in HAT supplemen ed medium. The i s selec ion ool is hen he cul u e
medium.
A e 4 o 6 days, small g oups o cells s a ed o eme ge om he cellula deb is
in bo om o he pla e and could be isualized unde he mic oscope. A day 10,
supe na an s o he wells con aining hyb idomas (p e iously sc eened unde he
mic oscope) we e es ed by ELISA using he ecombinan p o ein as an igen. 0.1 µg o
an igen was used o coa ELISA mic o i e pla es (Cos a ® 96-Well EIA/RIA pla es)
and pla es we e incuba ed a 4 °C o e nigh .
62
A e being washed once wi h TBS bu e (25 mM T is, 150 mM NaCl, 2 mM
KCl), pla es we e blocked wi h 2% gela in in TBS bu e o 1 hou a oom
empe a u e. Pla es we e hen washed 3× wi h TTBS (25 mM T is, 150 mM NaCl, 2mM
KCl, 0.1% Tween-20) and incuba ed wi h hyb idoma supe na an s o 1 hou a 37 °C.
Pla es we e again washed 3× wi h TTBS and incuba ed wi h An i-Mouse IgG
(whole molecule) Alkaline Phospha ase Conjuga e (Sigma) o 1 hou a 37 °C. A e
washing 5× wi h TTBS, pla es we e incuba ed wi h 1 mg/ml o p-ni ophenil phospha e
in subs a e bu e (100 mM glycine, 1 mM MgCl2, 1 mM ZnCl2, pH 10.4) a oom
empe a u e in he da k, un il he colo yellow is de eloped.
Pla es we e hen ead in a mic opla e eade (BioRad) a a wa eleng h o 405 nm
and analyzed wi h Mic opla e manage 4.0 so wa e (BioRad). A no an igen con ol was
added o he pla e and supe na an s conside ed posi i e wi h abso bance alues 5× he
con ol alue.
The selec ed hib idomas by ELISA we e hen expanded o 24-well pla es and
subsequen ly o 25 cm2 issue cul u e lasks and supe na an s es ed again by ELISA and
also by Wes e n Blo ing as desc ibed in sec ion 2.3.5.
2.5.3 Hyb idomas cul u e and s o age
Hyb idomas we e cul u ed ini ially in comple e DMEM medium (10% FBS and
HAT 1×) a 37 °C in a 5% CO2 incuba o . When expanded om 24-well pla es o 25
cm2 issue cul u e lasks, hib idomas we e cul u ed ei he in DMEM wi h 5% FBS and
HAT 1× o DMEM wi h 5% FBS wi h HT (hypoxan hine- hymidine). All cul u e wo k
was done unde s e ile condi ions in a lamina low hood.
Fo c yop ese a ion, hyb idoma cul u es we e cen i uged a 1200 pm o 10
minu es Cell pelle was esuspended in 1ml o FBS wi h 4% DMSO (dime hyl
sul oxide), aliquo ed in c yo ials and s o ed immedia ely a -80 °C o 24 hou s be o e
being ans e ed o liquid ni ogen anks o long e m s o age.
63
2.5.4 De e mina ion o an ibody iso ype
An ibody iso yping was done wi h Mouse MonoAB ID ki (HRP) (In i ogen)
acco ding o he An igen Dependen P o ocol o Iso yping Mouse Monoclonal
An ibodies. The an igen used in iso yping assays was he ecombinan p o ein agains
which he an ibodies we e gene a ed.
2.5.5 An ibody pu i ica ion
A e de e mined he iso ype, monoclonal an ibodies we e a ini y pu i ied using
a HiT ap™ P o ein G HP column (GE Heal hca e), a p e-packed column wi h 1 ml o
P o ein G Sepha ose™ High Pe o mance, designed o pu i ica ion o IgG om
asci es, se um and cell cul u e supe na an s.
50 ml o cell cul u e supe na an s we e cen i uged a 1200 pm o 10 minu es
and il e ed h ough a 0.45 µm il e o emo e pa icula e ma e ial. Samples we e hen
dialyzed in a dialysis memb ane imme sed in binding bu e (20 mM sodium phospha e,
pH 7.0) a 4 °C o e nigh .
The column was equilib a ed wi h 10 olumes o binding bu e and he sample
was hen applied o he column. Non binding ma e ial was washed wi h 5 olumes o
binding bu e . Elu ion was pe o med wi h 5 olumes o elu ion bu e (0.1 M glycine-
HCl, pH 2.7) and pu i ied an ibody was collec ed in 0.5 ml ac ions. A e he elu ion,
he column was washed wi h 10 olumes o binding bu e .
Pu i ied ac ions we e pooled, concen a ed wi h 4 M ammonium sulpha e and
dialyzed agains PBS bu e a 4 °C o e nigh .
Pu i ied an ibodies we e il e s e ilized, s o ed a 4 °C and used in Wes e n
Blo ing analysis, immuno luo escence assays and also in g ow h inhibi ion (in i o)
and ea men s udies (in i o).
64
2.6 Indi ec Immnuno luo escence Analysis (IFA)
Fo indi ec immuno luo escence analysis, mid-log phase pa asi es we e
ha es ed by cen i uga ion a 1500 g o 10 minu es and washed in ice cold Voo hei’s
modi ied PBS ( PBS) (137 mM NaCl, 3 mM KCl, 16 mM Na2HPO4, 3 mM KH2PO4,
46 mM suc ose, 10 mM glucose, pH 7.6). The cells we e hen ixed on ice in 3%
pa apho maldehyde o 10 minu es. A e ixa ion, an excess o PBS was added o
dilu e he ix solu ion and he cells we e washed wice in PBS, o pa apho maldehyde
emo al.
Fixed cells we e hen applied o mic oscope glass slides p e-coa ed wi h 0.01%
poly-l-lysine and allowed o se le o 20 minu es. To s ain he in e nal s uc u es o he
pa asi e, cells we e pe meabilized in PBS wi h 0.1% T i on X-100 o 10 minu es and
washed h ee imes wi h excess PBS be o e blocking o 1 hou wi h 20% ( / ) FCS in
PBS.
A e washing he slides again wi h excess PBS, p ima y an ibody dilu ed in
blocking solu ion, was applied and he slides incuba ed o 2 hou s a oom empe a u e.
The slides we e hen washed h ee imes wi h PBS and he app op ia e
seconda y an ibody, Alexa Fluo 594 ( ed)-conjuga ed an i-mouse (Molecula P obes),
dilu ed in blocking solu ion was applied and slides incuba ed o 1 hou a oom
empe a u e. A e washing h ee imes wi h PBS, excess liquid was d ained and cells
we e s ained wi h 1 µg/ml DAPI in moun ing solu ion (PBS, 50% ( / ) glyce ol, 2.5%
(w/ ) DABCO) be o e being sealed wi h a co e slip. Slides we e kep in a mois da k
box un il mic oscopic analysis o p e en d ying and luo escence ading.
2.7 Scanning Elec on Mic oscopy
Fo Scanning Elec on Mic oscopy (SEM) pa asi es we e allowed o se le ou
om cul u e medium on o poly-L-lysine coa ed glass co e slips, insed b ie ly wi h
PBS o emo e una ached cells and subsequen ly ixed wi h 2.5% glu a aldehyde in

65
0.1M cacodyla e bu e . The a ached pa asi es we e hen osmica ed, ace one
dehyd a ed and c i ical poin d ied om liquid CO2, spu e -coa ed wi h Au/Pd and
imaged a 6 kV in a JSEM 6400.
2.8 In i o g ow h inhibi ion assays
Fo he g ow h inhibi ion assay, BSF pa asi es we e cul u ed as desc ibed
p e iously on sec ion 2.4.1 and dilu ed o a concen a ion o 1×105 cells/ml. Fo a
p elimina y s udy, 100 µl o supe na an om selec ed cul u es o hyb idomas we e
added o a T. b ucei (s ain 427) cul u e and g own in HMI-9 supplemen ed wi h 10%
FCS and 10% Se um Plus a 37 °C in a 5% CO2 incuba o . Cul u e cell densi y was
de e mined by coun ing he cells e e y 24 hou s un il hey eached s a iona y phase.
One T. b ucei cul u e wi hou an ibodies and one T. b ucei cul u e wi h 100 µl o
comple e DMEM (hyb idoma cul u e medium) we e used as con ol.
Fo he inal in i o g ow h inhibi ion assay, 4 di e en amoun s o pu i ied
an ibody (0 µg, 25 µg, 50 µg and 100 µg) we e added o 1×104 cells/ml o mid log
phase pa asi es and g own as desc ibed p e iously. Cul u e cell densi y was de e mined
by coun ing he cells e e y 24 hou s un il hey eached s a iona y phase. The same
amoun s o a ini y pu i ied p e-immune IgG we e used as a con ol.
2.9 In i o g ow h inhibi ion assays
2.9.1 P o ec ion o T. b ucei in ec ed mice by ISP Immuniza ion
Fo his assay, 4 g oups o 5 speci ic pa hogen ee (SPF) BALB/c mice we e
used. G oup 1 was used as a con ol and was injec ed wi h PBS and F eund’s adju an .
G oup 2 was immunized wi h ecombinan ISP1, g oup 3 was immunized wi h
ecombinan ISP2 and g oup 4 was immunized wi h a mix u e o ISP1 and ISP2.
66
Animals we e immunized 3× wi h 10 µg o each ecombinan p o ein a days 0,
15 and 30. 2 days be o e he inal boos , blood samples we e ob ained o se um i e
de e mina ion by ELISA and 2 days a e he inal boos , mice we e in ec ed wi h 1×103
cul u ed BSF T. b ucei (s ain 427) by in ape i oneal injec ion. Pa asi emia was hen
de e mined daily by haemocy ome e cell coun ing as desc ibed in sec ion 2.4.6.
2.9.2 Neu aliza ion o T. b ucei in in ec ed mice by ISP MAb’s
Fo he neu aliza ion o T. b ucei in ec ion in mice by monoclonal an ibodies, 4
g oups o 5 SPF BALB/c mice we e in ec ed wi h 1×103 pa asi es on day 1. On days 0,
1, 3 and 5 g oup A was inocula ed wi h 25 µg o con ol IgG (pu i ied om p e-immune
se um) and used as con ol g oup. G oup B was inocula ed wi h 25 µg o an i ISP1
pu i ied monoclonal an ibody; g oup C was inocula ed wi h 25 µg o an i ISP2 pu i ied
monoclonal an ibody and g oup D wi h 25 µg o each an ibody. All inocula ions we e
done by in ape i oneal injec ion. Pa asi emia was de e mined daily by haemocy ome e
cell coun ing as desc ibed p e iously (sec ion 2.4.6).
2.10 S a is ical analysis
T. b ucei g ow h cu es we e analysed by wo-way ANOVA wi h Bon e oni's
pos es . All analysis we e done using G aphPad P ism e sion 5.00 o Windows,
G aphPad So wa e, San Diego Cali o nia USA, www.g aphpad.com.
Chap e 3
Resul s
68
3.1 Gene a ion o Monoclonal An ibodies
3.1.1 Gene a ion o MAb’s agains ICP
Fo he gene a ion o monoclonal an ibodies agains T. b ucei ICP, wo emale
BALB/c mice we e immunized wi h 10 µg o ecombinan ICP (p o ided by P o .
Je emy Mo am, Uni e si y o Glasgow) e e y 2 weeks. Du ing he immuniza ion
p ocess, blood samples we e collec ed and he se um i e was de e mined o each
mouse by ELISA, using he ecombinan ICP ( ICP) as an igen. A e a o al o 6
immuniza ions, he immune esponse agains ICP was e y low, wi h OD 405nm
alues o he immune se a simila o he p e-immune se um (Figu e 3.1).
Figu e 3.1 – ICP se um i e de e mina ion by ELISA.
Se um i e was de e mined o each mouse a e 6 immuniza ions wi h ICP. Th eshold le el ep esen s
he iple o he nega i e con ol OD alue
Despi e he low se um i e (1:400), bo h mice we e sac i iced and hei spleens
we e used o pe o m wo sepa a e cell usions. A e 10 days all 96 well pla es we e
obse ed unde he mic oscope o he p esence o hyb idomas. One o he cell usions
was no success ul and a e 20 days all pla es we e disca ded wi hou showing any
cellula g ow h.
75
Figu e 3.6 – Sc eening o an i-ISP1 an ibody p oducing hyb idomas by ELISA and Wes e n
Blo ing.
(A) Supe na an s we e es ed by ELISA using ISP1 as an igen. (B) Wes e n Blo ing. ISP1 o ICP was
used o un a 15% SDS-PAGE gel, ans e ed o a ni ocellulose memb ane and incuba ed wi h he
supe na an s p e iously selec ed by ELISA.
17 kDa
17 kDa
ISP1
ISP1
ICP
A.
B.

76
FIGURE 3.7 – Sc eening o an i-ISP2 an ibody p oducing hyb idomas by ELISA and Wes e n
Blo ing.
(A) Supe na an s we e es ed by ELISA using ISP2 as an igen. (B) Wes e n Blo ing. ISP2 o ICP was
used o un a 15% SDS-PAGE gel, ans e ed o a ni ocellulose memb ane and incuba ed wi h he
supe na an s p e iously selec ed by ELISA.
The iso ype o an i-ISP1 an ibodies designa ed as 3G8 and 4F3 and an i-ISP2
an ibodies 3B5 and 4G7 was de e mined using he An igen Dependen P o ocol o
Iso yping Mouse Monoclonal An ibodies om Mouse MonoAB ID ki (HRP)
(In i ogen).
17 kDa
17 kDa
ISP2
ISP2
ICP
A.
B.
77
ISP1 and ISP2 we e used o coa a mic o i e pla e and a h ee-s ep ELISA
p ocedu e was pe o med using he selec ed supe na an s as p ima y an ibodies,
subclass speci ic abbi an i-mouse an ibodies as seconda y an ibody and a goa an i-
abbi IgG HRP Conjuga e as e ia y an ibody.
No mal abbi se um was used as nega i e con ol and one mouse IgG1
monoclonal an ibody was used as posi i e con ol. Subclass speci ic an ibodies we e
added o each column and p ima y an ibodies we e added o each ow as ep esen ed in
Table 3.2.
TABLE 3.2 – Iso ype de e mina ion scheme.
Schema ic ep esen a ion o he mic o i e pla e layou used o he de e mina ion o class and subclass o
he selec ed an ibodies agains ISP1 and ISP2.
All an ibodies selec ed we e composed o an IgG1 hea y chain pai ed wi h a k
ligh chain, as obse ed in Table 3.3.
Hyb idomas we e le o g ow in 175 cm2 cul u e lasks o 21 o 28 days o
allow maximum p oduc ion o an ibodies.
Cul u es we e cen i uged and a e disca ding cellula deb is, supe na an s we e
il e ed h ough a 45 µm il e . An ibodies we e a ini y pu i ied on a p o ein G column,
p ecipi a ed and dialyzed be o e being il e s e ilized and s o ed o u he use.
1
2
3
4
5
6
7
8
9
10
PBS
No mal
Se um
IgG1
IgG2a
IgG2b
IgG3
IgA
IgM
k ligh
chain
λ ligh
chain
A
Mouse IgG1 mAb
B
α-ISP1 3G8 mAb
C
α-ISP1 4F3 mAb
D
α-ISP2 3B5 mAb
E
α-ISP2 4G7 mAb
78
TABLE 3.3 – Iso ype de e mina ion esul s.
OD 405 nm alues ob ained o he de e mina ion o class and subclass o an ibodies gene a ed agains
ISP1 and ISP2.
To con i m he speci ici y and assess hei sensi i i y, pu i ied an ibodies we e
used o pe o m a Wes e n Blo ing analysis agains bo h ISP1 and ISP2 and also
agains T. b ucei whole cell lysa es (Figu e 3.8).
An ibodies 4F3 and 3G8 agains ISP1 ecognized he espec i e ecombinan bu
no he ISP2. In he whole cell lysa e, bo h an ibodies ecognized a s ong band
be ween 17 and 25 kDa and some ain bands abo e 25 kDa (Figu e 3.8 A.).
As he le el o exp ession o ISP1 and ISP2 in T. b ucei is ex emely low and
an ibodies could no de ec any hing bu backg ound when using he s anda d 1×106
pa asi es pe lane, an inc eased amoun o pa asi es was used o es he an ibodies.
App oxima ely 5×106 pa asi es pe lane we e used. This la ge amoun o p o ein has
implica ions in he ou come o he Wes e n Blo ing and can lead o an inc ease in
backg ound labelling.
Despi e he p esence o some backg ound, he signal co esponden o he ISP1
band is s ong enough o conside ha bo h an ibodies a e speci ic o T. b ucei ISP1.
The same was ound wi h ISP2 an ibodies 4G7 and 3B5. Bo h an ibodies
ecognize ISP2 bu no ISP1. In he whole cell lysa e, bo h an ibodies ecognize a
p o ein wi h he p edic ed size o 17.8 kDa and some accesso y p o eins wi h highe
molecula weigh , especially an ibody 3B5 (Figu e 3.8 B).
Again, his backg ound could be due o an excess o p o ein loaded on he gel,
bu could also be consis en wi h excess o p ima y an ibody.
PBS
No mal
Se um
IgG1
IgG2a
IgG2b
IgG3
IgA
IgM
k ligh
chain
λ ligh
chain
Mouse
IgG1
0.088
0.086
0.215
0.091
0.091
0.093
0.095
0.093
0.188
0.092
α-ISP1
3G8
0.113
0.113
0.208
0.118
0.110
0.124
0.111
0.106
0.242
0.105
α-ISP1
4F3
0.124
0.121
0.283
0.129
0.130
0.131
0.130
0.126
0.296
0.126
α-ISP2
3B5
0.106
0.100
0.204
0.099
0.101
0.115
0.104
0.103
0.218
0.105
α-ISP2
4G7
0.123
0.119
0.258
0.123
0.123
0.121
0.121
0.121
0.262
0.122
79
Di e en dilu ions o an ibody 3B5 we e used and o he pu pose (iden i y a
band co esponding o ISP2 in T. b ucei whole cell lysa es) he dilu ion used was he
one gi ing he bes esul s.
Figu e 3.8 – Wes e n Blo ing analysis o pu i ied an ibodies.
(A) An ibodies 4F3 and 3G8 agains ISP1 and (B) an ibodies 4G7 and 3B5 agains ISP2 es ed agains
ISP1 (lane 1), ISP2 (lane 2) and T. b ucei whole cell lysa e (lane 3)
3.2 Localisa ion o ISP 1 and ISP2 in T. b ucei cells
A ini y pu i ied monoclonal an ibodies an i-ISP1 and an i-ISP2 we e used in
luo escence mic oscopy o de e mine he localiza ion o ISP1 and ISP2 on bloods eam
o m (BSF) T. b ucei. Mid-log phase cells we e ixed in pa apho maldehyde and
pe meabilized wi h T i on X-100. Fixed cells we e hen incuba ed wi h an i-ISP1 and
an i-ISP2 (dilu ed 1/25) o e nigh a 4ºC and an i-mouse Alexa luo 594 conjuga e
(dilu ed 1/4000).
80
Figu e 3.9 – Immuno luo escence analysis o ISPs in BSF T b ucei.
BSF T. b ucei pa asi es we e ha es ed and washed in PBS be o e ixed in 3% pa a o maldehyde in an
eppendo ube. Cells we e hen we e applied o poly-L-lysine ea ed slides and pe meabilized. Slides
we e blocked and subsequen ly incuba ed wi h an i-ISP1 3G8 an ibody o an i-ISP2 4G7 an ibody. An i-
mouse Alexa luo 594 conjuga ed was used as seconda y an ibody and slides we e isualized using
Rhodamine il e se ( ed). Nuclea and kine oplas DNA was s ained wi h DAPI. Scale ba 5 µm.
Expe imen pe o med in collabo a ion wi h D William P o o (Uni e si y o Glasgow)

81
Bo h ISP1 and ISP2 we e ound mainly in he cy osol wi h some punc a e
s uc u es loca ed nea he lagella pocke and he kine oplas (Figu e 3.9).
An ibody speci ici y was con i med by incuba ing wild ype pa asi es only wi h
seconda y an ibody. No luo escence was obse ed in hese slides, showing ha he
signal de ec ed could be a ibu ed o ISP1 and ISP2 speci ic labelling.
3.3 Dele ion o T. b ucei ISP1 and ISP2 by a ge ed gene
eplacemen
3.3.1 Gene a ion o ISP null mu an cell lines o T. b ucei
To in es iga e he unc ion o ISPs, T. b ucei cell lines de icien in ISP1 (isp1),
ISP2 (isp2) and bo h ISP1 and 2 (isp1/2) we e gene a ed by sequen ial eplacemen
o bo h alleles o he wild ype gene loci. The 5’ and 3’ lanking egions o he ISP1 and
ISP2 ORFs we e cloned in o sepa a e knock ou cons uc s con aining a d ug esis ance
ma ke . Fo each gene, wo esis ance ma ke s we e used, esul ing in 4 di e en
cons uc s ha allowed he gene a ion o he isp1/2 cell line.
Ini ially, he plasmids designed o he ISP1 knock ou con ained hyg omycin
(HYG) and neomycin (NEO) as esis ance ma ke s (pGL1688 and pGL1689) and he
plasmids designed o he ISP2 knock ou con ained blas icidin (BSD) and pu omycin
(PAC) as esis ance ma ke s (pGL1690 and pGL1691). Howe e , due o some ini ial
di icul ies wi h cloning he app op ia e lanking egions in he co esponding plasmids
he s a egy had o be e-adjus ed and 4 new cons uc s we e designed: pGL1947 and
pGL1948 o he ISP1 knock ou con aining BSD and PAC as esis ance ma ke s and
o he ISP2 knock ou , pGL1959 and pGL1960 con aining HYG and NEO as esis ance
ma ke s (Figu es 3.10 and 3.11).
pGL1688 and pGL1689 we e c ea ed by cloning 5’ISP1 and 3’ISP1 lanking
egions in o he backbone o plasmids pGL1224 and pGL1217 (p o ided by P o .
Je emy Mo am, Uni e si y o Glasgow).
82
F agmen s we e ampli ied om genomic DNA isola ed om T. b ucei
hodesiense IL1852 and sub-cloned in o pGEM-T-Easy ec o . Once con i med he
igh sequence by DNA sequencing, he 5’ISP1 lanking egion agmen was diges ed
om he sub-cloning ec o using No I and XbaI and liga ed wi h pGL1124 and
pGL1217 p e iously ea ed wi h he same enzymes. A e con i ming he inse ion o
he 5’ISP1 agmen , he 3’ISP1 lanking egion was diges ed om he sub-cloning
ec o wi h ApaI and liga ed o he pGL1224 and pGL1217 con aining he 5’ISP1
lanking egion, also diges ed wi h ApaI, c ea ing pGL1688 and pGL1689.
pGL1947 and pGL1948 we e c ea ed by eplacing he esis ance ma ke in
pGL1688 by BSD and PAC espec i ely. BSD and PAC agmen s we e diges ed om
plasmids pGL1124 and pGL808 (p o ided by P o . Je emy Mo am) using EcoRI and
liga ed wi h pGL1688 p e iously diges ed wi h he same enzyme.
pGL1688 and pGL1689 we e also used as backbone o he cons uc ion o
pGL1959 and pGL1960. 5’ISP2 lanking egion was ampli ied wi h oligonucleo ides
OL2421 and OL2422 and subcloned in o pGEM-T-Easy ec o . The agmen was
diges ed om he sub-cloning ec o using No I and XbaI and cloned in o bo h
pGL1688 and pGL1689 p e iously diges ed wi h he same enzymes. Simila app oach
was done o he cloning o 3’ISP2 lanking egion. The agmen was ampli ied wi h
oligonucleo ides OL2424 and OL3258 and sub-cloned. A e con i ma ion o he igh
sequence, he agmen was diges ed wi h ApaI and cloned in o pGL1688 and pGL1689
con aining he 5’ISP2 agmen , ea ed wi h he same enzyme. All sequences we e hen
con i med by DNA sequencing.
Each esis ance ma ke casse e wi h he cloned 5’ and 3’ lanking egions was
diges ed ou o he plasmid backbone wi h he es ic ion enzymes No I and XhoI and
a e p ecipi a ed, DNA was sepa a ely ans ec ed in o wild ype BSF T. b ucei
hodesiense s ain IL1852 cells, in eg a ing in o he pa asi e’s genome h ough
homologous ecombina ion.
A e he i s ound o ans ec ions, he e ozygous pa asi es esis an o one
an ibio ic we e isola ed and subsequen ly ans ec ed wi h a second esis ance casse e,
p oducing double esis an cell lines.
83
Figu e 3.10 – Gene a ion o ISP1 null mu an s
(A) Schema ic ep esen a ion o T. b ucei ISP1 locus and lanking egions used. (B) Cons uc s used o
he gene a ion o wo di e en isp1 cell lines. Cons uc s pGL1688 and pGL1689 we e used o gene a e
isp1 clones esis an o HYG and NEO and isp1 clones esis an o BSD and PAC we e c ea ed using
cons uc s pGL1947 and pGL1948.
pGL1689
5233 bp
Neomycin
3' ISP1 5' ISP1
No I (1317)
XbaI (1844)
XhoI (3669)
ApaI (3281)
ApaI (3679)
EcoRI (2094)EcoRI (2928)
OL2417
OL2418
OL2419
OL3257
pGL1688
5432 bp
Hyg omycin
3' ISP1
5' ISP1
XhoI (3219)
XbaI (1198)
No I (671)
ApaI (2831)
ApaI (3229)
EcoRI (1447)
EcoRI (2478)
OL2417
OL2418
OL2419
OL3257
ISP1 Locus
2752 bp
ISP1
5' ISP1 3' ISP1
OL2417
OL2418 OL2419
OL3257
527bp 398bp
pGL1948
5009 bp
Pu omycin
3' ISP1
5' ISP1
No I (671)
XbaI (1198)
XhoI (2796)
EcoRI (1447)
EcoRI (2055)
ApaI (2408)
ApaI (2806)
OL2417
OL2418
OL2419OL3257
pGL1947
4805 bp
Blas icidin
3' ISP1
5' ISP1
No I (671)
XbaI (1198)
XhoI (2592) ApaI (2204)
ApaI (2602)
EcoRI (1447)
EcoRI (1851)
OL2417
OL2418
OL2419
OL3257
A
B
84
Figu e 3.11 – Gene a ion o ISP2 null mu an s
(A) Schema ic ep esen a ion o T. b ucei ISP2 locus and lanking egions used. (B) Cons uc s used o
he gene a ion o isp2 cell line
The main pu pose o gene a ing a null mu an cell line is o analyse i he e’s a
modi ica ion o any kind in he o ganism’s pheno ype. In o de o de e mine i ha
modi ica ion can be di ec ly linked o he absence o he dele ed gene, i s exp ession has
o be e-es ablished and he pheno ype o esul ing pa asi es compa ed o he wild ype.
Fo he e-exp ession o he dele ed genes, ISP1 and ISP2 ORFs we e cloned
in o plasmids pGL2049 and pGL2050 and a ge ed in o he ubulin locus o isp1 and
isp2 mu an s, gene a ing he cell lines designa ed espec i ely as isp1:ISP1 and
isp2:ISP2 (Figu e 3.12).
pGL1959
5404 bp
Hyg omycin
3' ISP2
5' ISP2
No I (671)
XbaI (1088)
XhoI (3191)
ApaI (2719)
ApaI (3201)
EcoRI (1337)
EcoRI (2366)
OL2421
OL2422
OL2423
OL3258
pGL1960
5182 bp
Neomycin
3' ISP2
5' ISP2
No I (671)
XbaI (1088)
XhoI (2969)
ApaI (2497)
ApaI (2979)
EcoRI (1337)
EcoRI (2144)
OL2421
OL2422
OL2423OL3258
ISP2 locus
2250 bp
ISP2
5' ISP2 3' ISP2
OL2421
OL2422
OL2423 OL3258
417bp 472bp
A
B
91
FIGURE 3.16 – Con i ma ion o isp1/2 by PCR.
DNA om po en ial isp1/2 clones C1 and C2 was used o con i m he in eg a ion o he 4 an ibio ic
esis ance casse es. Fo he in eg a ion o he BSD allele he oligo combina ions used we e
OL2508/OL536, OL537/OL2509 and OL2508/OL2509 (Lanes 3, 4 and 5); Fo he in eg a ion o he PAC
allele he oligo combina ions used we e OL2508/OL15, OL16/OL2509 and OL2508/OL2509 (Lanes 3, 4
and 5); Fo he in eg a ion o HYG allele he oligo combina ions used we e OL2510/OL13,
OL14/OL2511 and OL2510/OL2511 (Lanes 6, 7 and 10); Fo he in eg a ion o he NEO allele he oligo
combina ions used we e OL2510/OL1361, OL1360/OL2511 and OL2510/OL2511 (Lanes 8, 9 and 10);
Oligo combina ions OL3635/OL3636 and OL3637/OL3638 we e used o ampli y ISP1 and ISP2 ORF
(Lanes 11 and 12)
Figu e 3.17 – Con i ma ion o ISP1 and ISP2 e-exp ession cell lines by PCR.
Oligo combina ion OL3635/OL3636 was used o ampli y ISP1 ORF in Wild Type (Lanes 1 and 9) in
po en ial isp1:ISP1 HYG/NEO clones (Lanes 2 and 3) and in isp1:ISP1 BSD/PAC clones (Lanes 10,
11 and 12). Oligo combina ion OL3637/OL3638 was used o ampli y ISP2 ORF in Wild Type (Lanes 5)
and in po en ial isp2:ISP2 clones (Lane 6 and 7). H2O was used as nega i e con ol (lanes 4, 8 and 13)
506
1018
bp
L 9 10 11 12
ISP1 ORF
13

92
The PCR analysis o ISP1 and ISP2 e-exp ession in isp1 and isp2 cell lines
was pe o med wi h he ampli ica ion o he espec i e ORFs wi h oligos
OL3635/OL3636 (ISP1 ORF) and OL3637/OL3638 (ISP2 ORF) esul ing in PCR
p oduc s o 514 bp and 481 bp espec i ely (Figu e 3.17). All clones analysed e ealed
he p esence o he inse ed ORF.
3.3.2.2 Sou he n Blo ing
The use o PCR is a as way o con i m gene dele ion and disca d clones ha
al hough esis an o selec ion an ibio ics s ill ha bou he a ge gene.
To in es iga e i he an ibio ic esis ance o cells is in ac due o in eg a ion o
he esis ance casse e in he gene locus and no in ano he pa o he genome, e-
con i ma ion was done by Sou he n Blo ing wi h he 5’ lanking egion used in he
knock ou cons uc s as a p obe.
Fo he con i ma ion o isp1 HYG/NEO null mu an s, genomic DNA was
diges ed wi h A aI and BamHI and p obed wi h he 5’ ISP1 (Figu e 3.18 A). One
agmen o 3.1 kb was de ec ed in wild ype and bo h he e ozygo es.
F agmen s co esponding o he HYG and NEO allele wi h p edic ed sizes o 4.4
kb and 2.5 kb could only be de ec ed in he espec i e he e ozygo es and in he 3 clones
analysed, showing co ec in eg a ion o bo h HYG and NEO casse es and loss o wild
ype allele (Figu e 3.18 B).
Simila s a egy was used o con i m ISP1 dele ion in

isp1 BSD/PAC esis an
clones. A aI was used o diges genomic DNA and 5’ ISP1 was used as p obe (Figu e
3.19 A). The 3.1 kb agmen could be de ec ed in he wild ype and bo h he e ozygo es
as expec ed.
The diges ion o BSD and PAC esis an he e ozygo es wi h A aI p oduces
agmen s wi h e y simila sizes (3.7 kb and 3.9 kb espec i ely) bu di e ence can be
dis inguished in he Sou he n Blo ing image (Figu e 3.19 B).
93
Figu e 3.18 – Sou he n Blo ing analysis o isp1 HYG/NEO null mu an s.
(A) G aphic ep esen a ion o ISP1 locus be o e and a e in eg a ion o HYG and NEO esis ance
casse es. Res ic ion si es a e ep esen ed in ed and p edic ed sizes ollowing enzima ic diges ion and
p obing wi h 5’ ISP1 a e displayed on he able nex o he diag am. (B) Genomic DNA was sepa a ed on
a 0.8% aga ose gel and ans e ed o a nylon memb ane be o e hyb idiza ion wi h 5’ ISP1. De ec ion
e ealed 3 di e en agmen sizes. A 3.1 kb agmen co esponding o he wild ype allele, a 4.4 kb
agmen co esponding o he HYG allele and a 2.5 kb agmen co esponding o he NEO allele. Lane 1,
Wild Type T. b ucei hodesiense IL1852; Lane 2, HYG esis an he e ozygo e; Lane 3, NEO esis an
he e ozygo e; Lane 4, isp1 clone1; Lane 5, isp1 clone2; Lane 6, isp1 clone3
The agmen co esponding o he BSD esis an allele could be de ec ed in he
espec i e he e ozygo e and in clones isp1 clone 4, isp1 clone 5 and isp1 clone 6
and al hough clone isp1 clone 4 displayed a 3.9 kb agmen co esponding o he PAC
esis an he e ozygo e, i also showed he p esence o a 3.1 kb agmen co esponding
o he wild ype allele and was no con i med as an ISP1 null mu an . Clones isp1
clone 5 and isp1 clone 6 showed co ec in eg a ion o PAC esis ance casse e by
displaying he co esponding 3.9 kb agmen , and so hey we e bo h con i med o be
ISP1 null mu an (Figu e 3.19 B).
A.
A.
B.
94
Figu e 3.19 – Sou he n Blo ing analysis o isp1 BSD/PAC null mu an s.
(A) G aphic ep esen a ion o ISP1 locus be o e and a e in eg a ion o BSD and PAC esis ance
casse es. Res ic ion si es a e ep esen ed in ed and p edic ed sizes ollowing enzima ic diges ion and
p obing wi h 5’ ISP1 a e displayed on he able nex o he diag am. (B) Genomic DNA was sepa a ed on
a 0.8% aga ose gel and ans e ed o a nylon memb ane be o e hyb idiza ion wi h 5’ ISP1. De ec ion
e ealed 3 di e en agmen sizes. A 3.1 kb agmen co esponding o he wild ype allele, a 3.7 kb
agmen co esponding o he BSD allele and a 3.9 kb agmen co esponding o he PAC allele. Lane 1,
Wild Type T. b ucei hodesiense IL1852; Lane 2, BSD esis an he e ozygo e; Lane 3, PAC esis an
he e ozygo e; Lane 4, isp1 clone 4; Lane 5, isp1 clone 5; Lane 6, isp1 clone 6
In he PAC esis an he e ozygo e only he 3.1 kb ISP1-con aining agmen
could be de ec ed and al hough pa asi es showed esis ance o media con aining he
an ibio ic, he ISP1 gene was no dis up ed and he PAC esis ance casse e mus ha e
been in eg a ed in some o he pa o he pa asi e’s genome.
The Sou he n Blo ing analysis o ISP2 null mu an s was done in a simila way
and e ealed ha he 3 double esis an clones selec ed displayed co ec in eg a ion o
bo h HYG and NEO esis ance casse es and loss o wild ype allele (Figu e 3.20 B).
A.
A.
B.
95
The 1.35 kb agmen co esponding o he wild ype allele was de ec ed in he
wild ype cell line and bo h he e ozygo e cell lines, whe e 2.6 kb and a 2.4 kb agmen s
co esponding o he HYG and NEO esis an he e ozygo es espec i ely could be
de ec ed.
In he double esis an clones, only he 2.4 and he 2.6 kb agmen s we e
de ec ed, con i ming he absence o he wild ype alleles (Figu e 3.20 B)
Figu e 3.20 – Sou he n Blo ing analysis o isp2 null mu an s.
(A) G aphic ep esen a ion o ISP2 locus be o e and a e in eg a ion o HYG and NEO esis ance
casse es. Res ic ion si es a e ep esen ed in ed and p edic ed sizes ollowing enzima ic diges ion and
p obing wi h 5’ ISP2 a e displayed on he able nex o he diag am. (B) Genomic DNA was sepa a ed on
a 0.8% aga ose gel and ans e ed o a nylon memb ane be o e hyb idiza ion wi h 5’ ISP2. De ec ion
e ealed 3 di e en agmen sizes, a 1.35 kb agmen co esponding o he wild ype allele, a 2.6 kb
agmen co esponding o he HYG allele and a 2.4 kb agmen co esponding o he NEO allele. Lane 1,
Wild Type T. b ucei hodesiense IL1852; Lane 2, HYG esis an he e ozygo e; Lane 3, NEO esis an
he e ozygo e; Lane 4, isp2 clone 1; Lane 5, isp2 clone 2; Lane 6, isp2 clone 3
A.
B.
A.
B.
96
As p e iously desc ibed, isp1/2 cell line was gene a ed by ans ec ing he
ISP2 knock ou cons uc s in o isp1 BSD/PAC he cell line. As he absence o ISP1
was al eady con i med in he ans ec ed isp1 cell line (Figu e 3.19), he dele ion o
ISP2 was con i med by Sou he n Blo ing analysis using 5’ ISP2 as p obe.
Al hough wi h a weak signal, he 1.35 kb agmen co esponding o he wild
ype allele could be de ec ed in he Wild Type cell line, in isp1 BSD/PAC cell line and
also in he HYG esis an he e ozygo e (Figu e 3.21, Lanes 1,2 and 4). In Lane 4,
ano he ain band wi h 2.6 kb could also be seen, co esponding o he HYG esis ance
allele. The di e ence in he sample’s signal s eng h was expec ed as he quan i y o
DNA used was no uni o m. While 5 µg o DNA om he emaining samples was used,
he a ailable amoun o DNA om he Wild Type, isp1 BSD/PAC and HYG esis an
he e ozygo e samples o diges and load on he aga ose gel was signi ican ly lowe (± 2
µg) esul ing in such disc epancy.
The absence o he 1.35 kb agmen in associa ion wi h he appea ance o 2
agmen s wi h 2.4 and 2.6 kb in lanes 5 and 6 indica es ha bo h esis ance casse es
we e co ec ly in eg a ed in he ISP2 locus (Figu e 3.21).
Figu e 3.21 – Sou he n Blo ing analysis o isp1/2 null mu an s.
Genomic DNA was diges ed wi h A aI and sepa a ed in a 0.8% aga ose gel and ans e ed o a nylon
memb ane be o e hyb idiza ion wi h 5’ ISP2. De ec ion e ealed 3 di e en agmen sizes, a 1.35 kb
agmen co esponding o he wild ype allele, a 2.6 kb agmen co esponding o he HYG allele and a
2.4 kb agmen co esponding o he NEO allele. Lane 1, Wild Type T. b ucei hodesiense IL1852; Lane
2, isp1 clone 6; Lane 3, isp2 clone 3; Lane 4, HYG esis an he e ozygo e; Lane 5, isp1/2 clone 1;
Lane isp1/2 clone 2

97
As ISP1 dele ion had al eady been con i med in he cell line used o ans ec he
ISP2 cons uc s (isp1 clone 6 cell line), isp1/2 clone 1 and isp1/2 clone 2 can be
posi i ely con i med as double ISP1 and ISP2 null mu an s.
3.3.2.3 Wes e n Blo ing
An ibodies gene a ed in sec ion 3.1.2 we e used o co obo a e he success ul
dele ion o ISP1 and ISP2 genes in he isp1, isp2 and isp1/2 cell lines by Wes e n
Blo ing. An ibody an i-ISP1 3G8 ecognized a band co esponding o ISP1 in he wild
ype and in isp1:ISP1 cell lines. As expec ed, no p o ein exp ession could be de ec ed
by he an i-ISP1 an ibody in isp1 cell lines o in he isp1/2 cell lines (Figu e 3.22).
Figu e 3.22 – Wes e n Blo ing analysis o

isp1 cell lines.
Whole cell lysa es we e ob ained om 5×106 pa asi es and analysed by Wes e n Blo ing wi h an i-ISP1
an ibody o assess p o ein exp ession in di e en cell lines. An i EF1-α an ibody was used as loading
con ol. Lanes 1, 7 and 13 – Wild Type T. b ucei hodesiense IL1852; Lanes 2, 3 and 4 – isp1 clones 1,2
and 3; Lane 5 and 6 - isp1:ISP1 clone 1 and 2; Lane 8 and 9 – isp1 clones 5 and 6; Lanes 10, 11 and 13
– isp1:ISP1 clone 3, 4 and 5; Lanes 14 and 15 – isp1/2 clone 1 and 2.
The absence o ISP2 p o ein exp ession in isp2 and isp1/2 cell lines was also
con i med by Wes e n Blo ing using an ibody an i-ISP2 4G7. The band co esponding
o ISP2 was only de ec ed in he wild ype and isp1/2 cell lines, con i ming once again
he success ul gene a ion o null mu an and e-exp esso cell lines (Figu e 3.23).
25
17
46
kDa 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
ISP1
EF1α
98
Figu e 3.23 – Wes e n Blo ing analysis o

isp2 cell lines.
Whole cell lysa es we e ob ained om 5×106 pa asi es and analysed by Wes e n Blo ing wi h an i ISP2
an ibody o assess p o ein exp ession in di e en cell lines. An i EF1-α an ibody was used as loading
con ol. Lane 1 – Wild Type T. b ucei hodesiense IL1852; Lanes 2, 3 and 4 – isp2 clones 1,2 and 3;
Lane 5 and 6 - isp2:ISP2 clone 1 and 2; Lane 7 and – isp1/2 clone 1 and 2.
3.3.3 In i o analysis o null mu an cell lines
The analysis o all clones con i med o be ISP1, ISP2 and ISP1 and 2 de icien
e ealed no g oss mo phological de ec s. In o de o assess i he absence o ISPs has
any impac on he cell’s g ow h a e, cul u e cell densi y was de e mined daily o 4
days. Cells we e seeded a 1×105 cells/ml e e y 24 hou s and densi y was de e mined by
haemocy ome e coun ing a egula ime in e als o 48 hou s.
Resul s show ha all clones we e iable in cul u e and no signi ican di e ence
in he g ow h a es o isp1, isp2 and isp1/2 cell lines when compa ed o he wild
ype (Figu e 3.24).
Despi e he absence o mo phological de ec s obse ed in all cell lines, isp1/2
cell clones showed an in e es ing pheno ype in cul u e. Mic oscopic obse a ion o
hese pa asi es and compa ison wi h he emaining cell lines e ealed a mo ili y de ec .
Speci ically, isp1/2 pa asi es a e unable o di ec ional cell mo ili y and a g ea
pe cen age o cells showed uncoo dina ed bea ing o he lagellum wi h pa asi es
mo ing e a ically in a “chasing he ail” manne .
99
Figu e – 3.24 In i o g ow h analysis o ISP null mu an cell lines.
(A) G ow h a e o Wild Type, isp1, isp2 and isp1/2 cell lines was de e mined by haemocy ome e
cell coun s a 8, 24, 32 and 48 hou s a e cell we e seeded a 1×105 cells/ml (B) Cul u es we e dilu ed o
1×105 cells/ml e e y 24 hou s and g ow h a es e alua ed o e a pe iod o 4 days. All da a a e ep esen ed
as mean ± SD o isp1, isp2 and isp1/2 clones.
010 20 30 40 50
0
100
200
300
Wild Type
isp1
isp1:ISP1
Time (h)
104pa asi es/ml
020 40 60 80 100
0
20
40
60
80
100
120
Time (h)
104pa asi es/ml
010 20 30 40 50
0
100
200
300
Wild Type
isp2
isp2:ISP2
Time (h)
104pa asi es/ml
020 40 60 80 100
0
20
40
60
80
100
120
Time (h)
104pa asi es/ml
010 20 30 40 50
0
50
100
150
200
250
Wild Type

isp1/2
Time (h)
104pa asi es/ml
020 40 60 80 100
0
20
40
60
80
100
120
Time (h)
104pa asi es/ml
A. B.
100
Wild ype ypanosomes exhibi a dis inc i e bi-helical mo ion wi h he
lagellum leading and d i ing he cell body owa ds i s ip in a well-de ined di ec ion
(Walke , 1961). In con as , isp1/2 pa asi es ba ely mo e o wa d in a speci ic
di ec ion, spinning cons an ly wi hou g ea ly al e ing hei loca ion.
The e a ic mo emen displayed by isp1/2 pa asi es, al hough e y dis inc
om he auge -like mo ion cha ac e is ic o wild ype pa asi es, esembles he
pheno ype p esen ed by ypanin knockdown mu an s, which a e also incapable o
di ec ional mobili y (Hu chings e al., 2002).
3.3.4 In i o analysis o null mu an cell lines
Gi en he appa en absence o se ine pep idases sensi i e o he ac ion o ISP1
and ISP2 in he genome o T. b ucei he unc ion o hese inhibi o s a e mos likely
associa ed wi h he in ec ion o he hos .
To in es iga e a po en ial ole o ISP1 and ISP2 in he in ec ion o mammalian
hos s, he in ec ion p o ile o isp1, isp2 and isp1/2 in mice was compa ed o he
wild ype T. b ucei hodesiense IL1852 (Figu e 3.25).
G oups o 4 ICR mice we e injec ed in ape i oneally wi h 5×103 pa asi es om
a dono mouse and pa asi emia was moni o ed by haemocy ome e coun ing o pa asi es
in blood samples collec ed by ail p ick.
All mice p esen ing se e e clinical symp oms o pa asi emia abo e 1×108
cells/ml we e culled o ensu e animal wel a e.
Su i al a es we e de e mined (Figu e 3.25) and esul s show ha indi idual
dele ion o ei he ISP1 o ISP2 does no comp omise in i o in ec i i y, wi h isp1 and
isp2 pa asi es displaying simila i ulence o he wild ype o isp1:ISP1 in ICR mice.
No signi ican di e ence was obse ed in he cou se o in ec ions and mice
su i al, wi h mean su i al imes o 17 days o mice in ec ed wi h isp1 o isp2
pa asi es and 18 days o mice in ec ed wi h wild ype and isp1:ISP1 cell lines (Figu e
3.25A).
107
The use o 25 µg o an ibody was su icien o p oduce an e ec on he
pa asi e’s g ow h a es. When compa ed o he non ea ed con ol, pa asi es ea ed
wi h bo h an i-ISP1 and an i-ISP2 an ibodies displayed signi ican ly educed g ow h. I
we compa e he g ow h o an i-ISPs IgG ea ed pa asi es wi h he ones ea ed wi h p e-
immune IgG, he di e ence is less p onounced bu s ill s a is ical signi ican (Figu e
3.29).
Since he e a e no pep idases sensi i e o he ac ion o ISPs p edic ed in he
genome o T. b ucei, i is likely ha hese inhibi o s exe hei inhibi o y ole on he
hos ’s se ine pep idases. This obse a ion allied o he ac ha ISP null mu an cell
lines show no g ow h de ec in cul u e would sugges ha he incuba ion o T. b ucei
cul u es wi h an i-ISP an ibodies didn’ p oduce any e ec on he pa asi e’s g ow h
a es.
Howe e , esul s ob ained a e con adic o y and he p esence o an i-ISP
an ibodies esul s in slowly g owing pa asi es a e 48 hou s ha each s a iona y phase
a lowe densi iy han non ea ed o p e-immune IgG ea ed pa asi es.
A e 48 hou s, pa asi es we e dilu ed in esh HMI-9 medium o he
concen a ion o 1×104 cell/ml and no mal g ow h was es o ed o bo h cul u es ea ed
wi h α-ISP1 and α-ISP2 an ibodies ( esul s no shown).
3.4.2 In i o g ow h inhibi ion assay
To s udy he e ec o monoclonal an ibodies agains ISP1 and ISP2 on
expe imen al T. b ucei in ec ion, mice we e di ided in 4 di e en g oups and injec ed
in ape i oneally wi h PBS (con ol g oup), an i-ISP1 an ibody (α-ISP1 3G8 IgG g oup),
an i-ISP2 an ibody (α-ISP2 4G7 IgG g oup) and bo h an ibodies simul aneously (α-ISP1
3G8 IgG + α-ISP2 4G7 IgG g oup) one day be o e being challenged wi h 1×104
cul u ed T. b ucei 427 and on days 0 and 2 pos challenge.
Pa asi emia was de e mined daily by haemocy ome e coun ing a e day 2 pos
challenge.

108
Figu e – 3.30 An ibodies agains ISP1 and ISP2 ha e no e ec on T. b ucei in ec ion in i o.
G oups o 4 mice we e injec ed in ape i oneally wi h α-ISP1 Mab, α-ISP2 Mab and bo h α-ISP1 and α-
ISP2 Mabs simul aneously a day –1, 0 and 2 and challenged wi h 1×104 pa asi es. (A) Mouse su i al
a es. Su i al a es o in ec ed mice we e de e mined and ep esen ed in a Kaplan-Meie su i al cu e.
(B) Mouse in ec ion p o ile. Each mouse was labeled 1–5 and pa asi emia was moni o ed and egis e ed
indi idually wi hin each g oup and mice p esen ing se e e clinical symp oms o pa asi emia abo e 1×108
cells/ml we e culled.
0 2 4 6
0
20
40
60
80
100
Con ol
-ISP1 3G8
-ISP2 4G7
-ISP1 IgG + -ISP2 IgG
Days Pos In ec ion
Su i al (%)
IgG
IgG
Con ol
0 2 4 6 8 10 12 14
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Mouse 1 Mouse 2 Mouse 3 Mouse 4 Mouse 5
Days pos in ec ion
Pa asi es/ml
Con ol
0246810 12 14
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Mouse 1 Mouse 2 Mouse 3 Mouse 4 Mouse 5
Days pos in ec ion
Pa asi es/ml
Con ol
0 2 4 6 8
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Mouse 1 Mouse 2 Mouse 3 Mouse 4 Mouse 5
Days pos in ec ion
Pa asi es/ml
 - ISP1 3G8 IgG
0 2 4 6 8
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Days pos in ec ion
Pa asi es/ml
 - ISP2 4G7 IgG
0 2 4 6 8
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Days pos in ec ion
Pa asi es/ml
 - ISP1 3G8 IgG +  - ISP2 4G7 IgG
0 2 4 6 8
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Days pos in ec ion
Pa asi es/ml
 - ISP1 3G8 IgG +  - ISP2 4G7 IgG
0 2 4 6 8
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Days pos in ec ion
Pa asi es/ml
A.
B.
0 2 4 6
0
20
40
60
80
100
Con ol
-ISP1 3G8
-ISP2 4G7
-ISP1 IgG + -ISP2 IgG
Days Pos In ec ion
Su i al (%)
IgG
IgG
Con ol
0 2 4 6 8 10 12 14
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Mouse 1 Mouse 2 Mouse 3 Mouse 4 Mouse 5
Days pos in ec ion
Pa asi es/ml
Con ol
0246810 12 14
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Mouse 1 Mouse 2 Mouse 3 Mouse 4 Mouse 5
Days pos in ec ion
Pa asi es/ml
Con ol
0 2 4 6 8
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Mouse 1 Mouse 2 Mouse 3 Mouse 4 Mouse 5
Days pos in ec ion
Pa asi es/ml
 - ISP1 3G8 IgG
0 2 4 6 8
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Days pos in ec ion
Pa asi es/ml
 - ISP2 4G7 IgG
0 2 4 6 8
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Days pos in ec ion
Pa asi es/ml
 - ISP1 3G8 IgG +  - ISP2 4G7 IgG
0 2 4 6 8
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Days pos in ec ion
Pa asi es/ml
 - ISP1 3G8 IgG +  - ISP2 4G7 IgG
0 2 4 6 8
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Days pos in ec ion
Pa asi es/ml
A.
B.
0 2 4 6
0
20
40
60
80
100
Con ol
-ISP1 3G8
-ISP2 4G7
-ISP1 IgG + -ISP2 IgG
Days Pos In ec ion
Su i al (%)
IgG
IgG
Con ol
0 2 4 6 8 10 12 14
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Mouse 1 Mouse 2 Mouse 3 Mouse 4 Mouse 5
Days pos in ec ion
Pa asi es/ml
Con ol
0246810 12 14
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Mouse 1 Mouse 2 Mouse 3 Mouse 4 Mouse 5
Days pos in ec ion
Pa asi es/ml
Con ol
0 2 4 6 8
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Mouse 1 Mouse 2 Mouse 3 Mouse 4 Mouse 5
Days pos in ec ion
Pa asi es/ml
 - ISP1 3G8 IgG
0 2 4 6 8
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Days pos in ec ion
Pa asi es/ml
 - ISP2 4G7 IgG
0 2 4 6 8
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Days pos in ec ion
Pa asi es/ml
 - ISP1 3G8 IgG +  - ISP2 4G7 IgG
0 2 4 6 8
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Days pos in ec ion
Pa asi es/ml
 - ISP1 3G8 IgG +  - ISP2 4G7 IgG
0 2 4 6 8
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Days pos in ec ion
Pa asi es/ml
A.
B.
109
Gi en he esul s ob ained in he g ow h inhibi ion assay o T. b ucei in cul u e,
i would be expec ed ha an ibodies agains ISP1 and ISP2 had an inhibi o y o
neu alizing e ec on he in ec ion by T. b ucei in mice.
Howe e such e ec could no be obse ed in any o he g oups injec ed wi h
an i-ISPs an ibodies and he expe imen was concluded on day 6 pos challenge wi h he
dea h o all mice.
No di e ence was obse ed be ween he su i al a es o he g oups injec ed
wi h an i-ISP an ibodies when compa ed o he con ol g oup. On day 4 pos challenge
80% o he con ol g oup was dead wi h he emaining mouse dying on day 5. Highe
pe cen ages o su i al we e egis e ed a day 4 pos -in ec ion in he α-ISP1 3G8 IgG
g oup (60% su i al) and α-ISP2 4G7 IgG g oup (40% su i al). Howe e , he
ou come was simila o he con ol g oup wi h 100% o mice om bo h g oups dying on
day 5 pos -in ec ion. The α-ISP1 3G8 IgG + α-ISP2 4G7 IgG g oup had a sligh ly
di e en cou se wi h 80% su i al on day 4 pos -in ec ion bu wi h simila mo ali y
since no mice su i ed he day 6 pos in ec ion (Figu e 3.30A).
The analysis o in ec ion p o iles e ealed ha he pa asi emia pa e ns we e
simila in all g oups wi h he numbe o pa asi es pe ml o blood inc easing
consis en ly and apidly as was expec ed o he con ol g oup, gi en he high le el o
i ulence o T. b ucei s ain 427 in mice (Figu e 3.30B) (Lan e i e al., 2006).
3.5 Immuno-p o ec ion assay
To de e mine i he immuniza ion o mice wi h ISPs con e s any p o ec ion o
he in ec ion wi h T. b ucei, 4 g oups consis ing o 5 mice each we e c ea ed. The ISP1
g oup was immunized wi h ecombinan ISP1, ISP2 g oup was immunized wi h
ecombinan ISP2 and he ISP1 + ISP2 g oup was immunized wi h bo h inhibi o s. Each
g oup was immunized wi h 10 µg o ecombinan combined wi h F eund’s comple e
adju an a days 0, 15 and 30 and se um i e was de e mined by ELISA a e he hi d
injec ion.
110
Mice we e in ec ed wi h 1×104 cul u ed T. b ucei 427 a e ecei ing a inal
boos o he espec i e ecombinan s. Pa asi emia was de e mined by haemocy ome e
cell coun ing as desc ibed p e iously. The con ol g oup, also composed by 5 mice, was
injec ed wi h PBS and F eund’s comple e adju an , ollowing he immuniza ion scheme
de eloped o he s udy g oups.
Resul s show ha he immuniza ion wi h ISP1, ISP2 o bo h ISPs did no con e
any kind o p o ec ion o he in ec ion wi h T. b ucei 427. Kaplan-Meye cu e analysis
de e mined ha no di e ence was obse ed in mice su i al wi h mean su i al imes
o 6.2 days o he con ol g oup, 7 days o he ISP1 g oup, 6.6 days o he ISP2 g oup
and 7 days o he ISP1+ISP2 g oup (Figu e 3.31A).
One single mouse om he ISP1+ISP2 g oup su i ed he expe imen wi hou
p esen ing de ec able le els o pa asi emia o showing signs o clinical symp oms.
Al hough no s a is ically ele an , his esul could indica e ha he combined
immuniza ion wi h ISP1 and ISP2 can con e p o ec ion o T. b ucei in ec ion in mice.
In ac , his mouse e ealed highe se um i e s han he es o he g oup
sugges ing ha he immune esponse was mo e e ec i e in his animal jus i ying a
possible p o ec ion agains in ec ion. I is also possible ha du ing he inocula ion no
iable pa asi es we e injec ed due o inadequa e homogeniza ion o some o he
manipula ion inaccu acy.
The analysis o in ec ion p o iles showed no di e ence in he pa asi emia
pa e ns om he di e en g oups. Consis en wi h he pa e n cha ac e is ic o in ec ion
wi h wild ype T. b ucei 427, pa asi emia was es ablished 3 days a e inocula ion and
inc eased d as ically eaching alues abo e 1×108 pa asi es/ml wi hin 5 o 6 days
(Figu e 3.31B).
111
Figu e 3.31 – Immuniza ion o mice wi h ISP1 and ISP2 doesn’ con e p o ec ion o T. b ucei
in ec ion.
(A) Mouse su i al a es. G oups o 4 mice we e immunized wi h ISP1, ISP2 and ISP1 and ISP2
simul aneously and subsequen ly in ec ed wi h 1×104 pa asi es. Su i al a es o in ec ed mice we e
de e mined and ep esen ed in a Kaplan-Meie su i al cu e. (B) Mouse in ec ion p o ile. Each mouse
was labeled 1–4 and pa asi emia was moni o ed and egis e ed indi idually wi hin each g oup and mice
p esen ing se e e clinical symp oms o pa asi emia abo e 1×108 cells/ml we e culled
A.
B.
0 5 10 15
0
20
40
60
80
100
Con ol
ISP1
ISP2
ISP1 + ISP2
Days pos in ec ion
Su i al (%)
Con ol
0 2 4 6 8 10 12 14
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Mouse 1 Mouse 2 Mouse 3 Mouse 4 Mouse 5
Days pos in ec ion
Pa asi es/ml
Con ol
0246810 12 14
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Mouse 1 Mouse 2 Mouse 3 Mouse 4 Mouse 5
Days pos in ec ion
Pa asi es/ml
Con ol
0 2 4 6 8 10 12 14
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Mouse 1 Mouse 2 Mouse 3 Mouse 4 Mouse 5
Days pos in ec ion
Pa asi es/ml
ISP1
0 2 4 6 8 10 12 14
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Days pos in ec ion
Pa asi es/ml
ISP2
0 2 4 6 8 10 12 14
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Days pos in ec ion
Pa asi es/ml
ISP1 + ISP2
0 2 4 6 8 10 12 14
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Days pos in ec ion
Pa asi es/ml
A.
B.
0 5 10 15
0
20
40
60
80
100
Con ol
ISP1
ISP2
ISP1 + ISP2
Days pos in ec ion
Su i al (%)
Con ol
0 2 4 6 8 10 12 14
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Mouse 1 Mouse 2 Mouse 3 Mouse 4 Mouse 5
Days pos in ec ion
Pa asi es/ml
Con ol
0246810 12 14
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Mouse 1 Mouse 2 Mouse 3 Mouse 4 Mouse 5
Days pos in ec ion
Pa asi es/ml
Con ol
0 2 4 6 8 10 12 14
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Mouse 1 Mouse 2 Mouse 3 Mouse 4 Mouse 5
Days pos in ec ion
Pa asi es/ml
ISP1
0 2 4 6 8 10 12 14
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Days pos in ec ion
Pa asi es/ml
ISP2
0 2 4 6 8 10 12 14
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Days pos in ec ion
Pa asi es/ml
ISP1 + ISP2
0 2 4 6 8 10 12 14
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Days pos in ec ion
Pa asi es/ml
A.
B.
0 5 10 15
0
20
40
60
80
100
Con ol
ISP1
ISP2
ISP1 + ISP2
Days pos in ec ion
Su i al (%)
Con ol
0 2 4 6 8 10 12 14
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Mouse 1 Mouse 2 Mouse 3 Mouse 4 Mouse 5
Days pos in ec ion
Pa asi es/ml
Con ol
0246810 12 14
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Mouse 1 Mouse 2 Mouse 3 Mouse 4 Mouse 5
Days pos in ec ion
Pa asi es/ml
Con ol
0 2 4 6 8 10 12 14
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Mouse 1 Mouse 2 Mouse 3 Mouse 4 Mouse 5
Days pos in ec ion
Pa asi es/ml
ISP1
0 2 4 6 8 10 12 14
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Days pos in ec ion
Pa asi es/ml
ISP2
0 2 4 6 8 10 12 14
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Days pos in ec ion
Pa asi es/ml
ISP1 + ISP2
0 2 4 6 8 10 12 14
1.0×1000
1.0×1002
1.0×1004
1.0×1006
1.0×1008
1.0×1010
Days pos in ec ion
Pa asi es/ml
Chap e 4
Discussion and Conclusions

113
The genome o T. b ucei encodes wo pu a i e inhibi o s o se ine pep idases
(Be iman e al., 2005), belonging o he amily o eco in (I11) (Rawlings, 2010). Eco in
was i s iden i ied in he pe iplasmic space o E. coli and desc ibed as a dime ic low
molecula weigh p o ein capable o inhibi ing ypsin-like pep idases belonging o he
S1A amily (Chung e al., 1983).
Since hen, homologues o eco in ha e been iden i ied in ela ed G am-nega i e
bac e ia including Pseudomonas, Salmonella and Ye sinia and in he ypanosoma id
pa asi ic p o ozoa (Eschenlaue e al., 2009).
The biological ole o eco in in E. coli and eco in-like inhibi o s in T. b ucei
emains unknown bu he absence o S1A amily pep idases om he genome o bo h
o ganisms sugges s ha hese inhibi o s a e mos likely a ge ing he hos ’s se ine
pep idases and p o ec ing he cell om he exogenous pep idic ac i i y (Eschenlaue e
al., 2009).
The only published s udies on ISPs om ypanosoma ids ela e o Leishmania
and e ealed some in e es ing insigh s o hese inhibi o s and hei possible ole on
p o ec ing he cell agains he hos ’s immune sys em (Fa ia e al., 2011, Eschenlaue e
al., 2009) and on he lagella pocke dynamics and pa asi e’s di e en ia ion (Mo ison
e al., 2012).
In an a emp o unde s and he exis ence o ISP1 and ISP2 in T. b ucei and wha
possible oles hey may play in he pa asi e’s biology o in he in ec ion o he
mammalian hos , wo di e en app oaches we e made.
Fi s , monoclonal an ibodies we e gene a ed agains T. b ucei ISP1 and ISP2 and
used in Immunolocaliza ion and immuno-p o ec ion s udies. The second app oach
consis ed o he use o e e se gene ics o gene a e ISP null mu an cell lines and
subsequen analysis o he espec i e pheno ypes.
Al hough he possibili y o T. b ucei ISPs ha ing a ole wi hin he insec ec o
was no discoun ed, his in es iga ion was conduc ed only on BSF pa asi es and all he
esul s ob ained only apply o he mammalian in ec i e o m o he pa asi e.
114
4.1 ISP1 and ISP2 ha e an in acellula unc ion associa ed wi h
he lagellum and he lagella pocke
The gene a ion o ISP null mu an cell lines e ealed some in e es ing ea u es o
T. b ucei ISPs. The success ul gene a ion o Δisp1 and Δisp2 pa asi es iable in cul u e
indica es ha ISP1 and ISP2 a e no essen ial genes o he BSF cell di ision and
g ow h. Analysis o g ow h a es in i o e ealed no mal g ow h o all clones om
Δisp1 and Δisp2 cell lines when compa ed o he wild ype T. b ucei hodesiense
IL1852 cell line.
Addi ionally, no g oss mo phology de ec could be de ec ed among he Δisp1
and Δisp2 pa asi es by mic oscopic e alua ion and compa ison o he wild ype
pa asi es.
The wo clones om he Δisp1/2 cell line also displayed no mal g ow h and
g oss mo phology bu he mic oscopic obse a ion o hese pa asi es disclosed an
in e es ing mo ili y pheno ype.
Ins ead o he bi-helilcal, co k-sc ew ype mo emen wi h he lagellum leading
he cell body in a well de ined di ec ion, ha cha ac e izes T. b ucei (Walke , 1961),
Δisp1/2 pa asi es p esen a diso ganized and uncoo dina ed kind o mo emen , spinning
cons an ly wi hou being able o mo e hemsel es in a de e mined di ec ion. This
inabili y o mo e in a ce ain di ec ion esembles he pheno ype displayed by ypanin
knockdown mu an s desc ibed by (Hu chings e al., 2002).
T ypanin is a highly conse ed p o ein among lagella ed o ganisms ha is
associa ed wi h he lagella ac ion o he cy oskele on in T. b ucei (Hill e al., 2000).
In PCF cells ypanin is localised along he leng h o he lagellum and ep esen s pa
o he lagella dynein egula o y complex.
RNAi knock down o ypanin in p ocyclic T. b ucei esul ed in a se e e mo ili y
de ec in which pa asi es, al hough no pa alyzed, we e incapable o di ec ional cell
mo ili y, spinning and umbling an ically, ba ely wi hou changing hei loca ion and
e en mo ing backwa ds some imes (Hu chings e al., 2002).
115
Like in ypanin knock down mu an s, Δisp1/2 cells e ained a igo ously bea ing
lagellum bu ha e los he abili y o coo dina e he lagella bea and ac i ely p oduce
di ec ional mo emen . This esul s ongly sugges s ha ISPs ha e a ole wi hin he
pa asi e i sel , possibly in he egula ion o lagella bea .
An associa ion o T. b ucei ISPs wi h a lagella unc ion is no a all a su p ise,
al hough he ac ha hey ha e an in acellula unc ion pe se can be a bi su p ising
gi en he appa en lack o S1A endogenous SPs. In ac , T. b ucei ISP1 and ISP2 ha e
been iden i ied in he lagella p o eome in wild ype T. b ucei (B oadhead e al., 2006)
and ecen s udies on leishmanial ISPs e ealed ha bo h ISP1 and ISP2 a e essen ial
o lagellum homeos asis (Mo ison e al., 2012).
L. majo Δisp1/2/3 pa asi es displayed se e al ea u es ha associa e hese
inhibi o s wi h an in insic unc ion linked o he lagellum. T iple null mu an
p omas igo es de eloped a g ow h pheno ype in cul u e, p esen ing educed g ow h
a es in mid-log phase and eaching s a iona y phase ea lie and a hal he densi y o
wild ype pa asi es. Addi ionally, hese pa asi es showed abno mal mo phology ma ked
by an enla ged lagella pocke egion and a endency o o m unusually la ge
agg ega es. Finally, Δisp1/2/3 pa asi es ha e signi ican ly longe lagella han wild ype
pa asi es in la e-log phase and show educed mo ili y. These indings, allied o he ac
ha ISP1 and ISP2 a e localised o he lagella colla in hap omonad p omas igo es, an
in e media e s age in he di e en ia ion o p ocyclic in o in ec i e me acyclic
p omas igo es, sugges ha ISPs ha e a p ima y ole in lagellum homeos asis and
pa asi e di e en ia ion (Mo ison e al., 2012).
The immuno luo escence s udy done in T. b ucei using he an ibodies p oduced
speci ically agains ISP1 and ISP2 has shown ha bo h p o eins a e mainly cy osolic,
p esen ing a punc a e s aining pa e n. This localiza ion is dis inc om he localiza ion
along he lagellum obse ed o ypanin in PCF (Hu chings e al., 2002) o BSF
ypanosomes (Rals on and Hill, 2006) and o he lagella p o eins. Ne e heless, some
o hose punc a e s uc u es obse ed in he immuno luo escence assay appea o be
ex emely close o he kine oplas and he lagellum and could ep esen a disc e e
localiza ion o ISP1 and ISP2 in he lagella pocke , which could be con i med by co-
s aining wi h FM4-64 (Field e al., 2004).
116
Se e al o he s udies co ela e he abla ion o lagella p o eins wi h loss o
lagella mo ili y in T. b ucei. Fo example, he RNAi knock down o he wo
homologues o he pa kin co- egula ed gene p oduc PACRG (PACRG-A and PACRG-
B) simul aneous leads o de ec i e mo ili y while he indi idual knockdown o ei he
PACRG-A o PACRG-B does no p oduce any e ec on he cell’s mo ili y (Dawe e al.,
2005). Also, he knockdown o he p o o ilamen ibbon p o ein Rib 72 esul s in
impai ed mo ili y (Ba on e al., 2007b) and he deple ion o ou e a m dynein subuni s
LC1, IC78 and o he axoneme p o eins leads o he loss o ip- o-base bea , causing he
cell o mo e backwa ds and o he se e e mo ili y de ec s (Ba on e al., 2007a, B anche
e al., 2006). Common o all his s udies is he use o p ocyclic ypanosomes and show
ha lagella mo ili y can be comp omised wi hou a ec ing he pa asi e’s p oli e a ion.
Simila s udies ha e been conduc ed using BSF pa asi es ins ead o p ocyclics
and pheno ype consis ency indica es ha lagella mo ili y is essen ial o BSF
pa asi e’s iabili y. In an ex ensi e s udy by B odhead e al, i e p o eins iden i ied as
pa o he lagella p o eome we e s udied by RNAi.
The knockdown o each one o he selec ed p o eins e ealed ha all i e
p o eins we e essen ial o BSF T. b ucei. Allied o se e e mo ili y pheno ypes
de eloped by RNAi knockdown mu an s, i was obse ed ha ypanosomes ailed o
comple e cy okinesis bu con inued o p og ess h ough he cell cycle, con inuing o
eplica e hei o ganelles and leading o la ge dis o ed cells wi h mul iple nuclei and
kine oplas s unable o p oli e a e (B oadhead e al., 2006).
Se e al o he s udies using BSF lagella p o eins ha e shown simila
pheno ypes including he silencing o MCA4 (P o o e al., 2011) o ypanin (Rals on
and Hill, 2006) by RNAi.
This essen iali y is no obse ed o ISP1 o ISP2 since he Δisp1/2 pa asi es
ha e no mal g ow h in cul u e. Howe e , he use o a dis inc gene ic app oach can be
he esponsible o his, once he gene ic dele ion o ISP1 and ISP2 was pe o med
opposing o he RNAi silencing s a egy common o all he s udies men ioned abo e.
Thus, i is possible ha he le hal pheno ypes desc ibed a e associa ed wi h RNAi
mu an s in gene al (whe e he apid deple ion o a gene occu s wi hou p e ious
adap a ion o he pa asi e) and no wi h he lagella unc ion i sel .
123
Addi ionally, NETs may unc ion as a physical ba ie , p e en ing he
dissemina ion o he pa hogen (B inkmann e al., 2004). Mo e ecen ly, i has also been
shown ha NETs a e induced no only by bac e ia, bu also by pa hogenic ungi such as
Candida albicans (U ban e al., 2006) and Leishmania amazonensis (Guima ães-Cos a
e al., 2009).
Al hough no published s udy on he subjec is a ailable un il now, i is possible
ha T. b ucei also induces he neu ophils o sec e e NETs and ha du ing he in ec ion
wi h Δisp1/2 ypanosomes, in he absence o inhibi ion, NE may ha e a ypanocidal
ac i i y o modula e he hos ’s immune sys em in a way ha p e en s he es ablishmen
o he in ec ion in mice.
In L. majo , he inhibi ion o NE by a speci ic NE inhibi o abolished
leishmanicidal ac i i y in mac ophages and esul ed in enhanced in ec i i y in i o,
sugges ing a ole o NE in he mac ophage ac i a ion (Ribei o-Gomes e al., 2004).
The i s ba ie agains T. b ucei in ec ion o he mammalian hos is he inna e
immune esponse, in which di e en hos cells a e ac i a ed ini ia ing an acu e
in lamma o y esponse. Mac ophages a e ac i a ed, ia classical ac i a ion, leading o
he sec e ion o p o-in lamma o y molecules such as TNF and ni ic oxide (NO) ha a e
in ol ed in he con ol o he i s peak o pa asi emia ( ype I in lamma o y esponse).
The ini ial in lamma o y p ocess is bene icial o he hos bu sus ained
in lamma ion can cause pa hology and so he hos educes in lamma ion by down-
egula ing he classical ac i a ion o mac ophages and p omo ing he ac i a ion o an i-
in lamma o y ype mac ophages ha a e in ol ed in a longe su i al o he hos ( ype
II in lamma o y esponse) (Ba al, 2010, S e nbe g, 2004).
In mice i has been shown ha cy okine esponses o VSGs associa ed wi h
esis ance agains mu ine A ican ypanosomiasis a e dependen on he in ec ion s age,
wi h ype-I cy okine esponses being c i ical in he ea ly in ec ion and ype-II cy okine
esponses being mo e impo an in he ch onic in ec ion and he la e s age disease
(Namangala e al., 2009). Howe e he in luence o cy okines and hei esponses on he
ou come o he in ec ion is unclea and may be dependen on he pa asi e s ain, he
mouse model o bo h.

124
Gi en he ex acellula na u e o he pa asi e, a s ong humo al esponse is
expec ed du ing he cou se o in ec ion wi h T. b ucei. Mu ine ypanosomiasis is
cha ac e ized by ac i a ion o polyclonal B-cells and al hough VSG-speci ic an ibodies
can be p o ec i e by p omo ing he clea ance o pa asi es du ing he ea ly s ages o
in ec ion, a conside able amoun o he an ibodies p oduced is ei he poly-speci ic o
au o- eac i e (Ba al, 2010, S e nbe g, 2004).
Addi ionally, as he in ec ion p og esses, B-cells become supp essed o
exhaus ed, esul ing in he o al absence o IgG esponses and he ex eme educ ion o
IgM esponses (Hudson and Te y, 1979). Mac ophages play a cen al ole in his
d ama ic immunosup ession, media ing he inhibi ion o bo h B- and T-cell p oli e a i e
esponses by he elease o ni ic oxide, p os aglandin and TNF-α (S e nbe g, 2004).
F om he g oup in ec ed wi h Δisp1/2 pa asi es h ee mice su i ed and only one
e ealed de ec ed pa asi emia along he s udy pe iod. Tha mouse had a pa asi emia
peak a day 17 and didn’ show any signs o pa asi es ci cula ing in he blood du ing he
es o he expe imen . I ’s possible ha he o he 2 mice also had a leas one peak o
pa asi emia du ing he expe imen . Howe e pa asi e coun ing was no ca ied ou e e y
day and he peaks may ha e passed unno iced.
Gi en he absence o successi e peaks o pa asi emia i is likely ha he
in ec ion was con olled in i s ea ly s ages du ing he mac ophage ac i a ion phase
p omo ing he al e na i e ins ead o he classical mac ophage ac i a ion. Due o a
possible modula ion o he mac ophage ac i a ion by and he espec i e cy okine elease
by NE, he supp ession o humo al esponse may ha e also been inhibi ed and an ibody-
media ed pa asi e clea ance may ha e occu ed esul ing in unde ec able le els
pa asi emia o in he o al e adica ion o T. b ucei in ec ion.
Apa om he con ol o in ec ion media ed by he hos ’s immune sys em, he
ini ial se ing o pa asi emia le els is egula ed by he pa asi e i sel . A ican
ypanosomes use an igenic a ia ion as p ima y s a egy o e ade he mammalian
hos ’s immune sys em.
By cons an ly changing hei VSG coa , he pa asi e is capable o escaping he
immune sys em (Vicke man, 1978) and main ain a s a e o ch onic in ec ion in he hos ,
cha ac e ized by ascending le els o pa asi emia, whe e he majo i y o he popula ion is
125
cons i u ed by long slende di iding o ms o he pa asi e exp essing he same an igenic
ype (homo ype), ollowed by a pe iod in which pa asi emia goes in o emission due o
he elimina ion o pa asi es o he majo a iable an igenic ype (VAT) by he hos ’s
immune sys em. Du ing his descenden phase he pa asi es exp essing a new VSG a e
mul iplying and become he new homo ype.
T ypanosomes can be e icien ly opsonized by mammalian an i-VSG an ibodies
bu , o escape om complemen -media ed elimina ion, ypanosomes de eloped a
mac omolecula a icking mechanism by which VSG-an ibody complexes a e apidly
endocy osed, occu ing an ibody deg ada ion and VSG ecycling (Field e al., 2009,
Engs le e al., 2007).
I has been demons a ed ha no mal lagella bea is needed o he VSG-
an ibody complexes up ake by he pa asi e implying ha no mal lagella mo ili y is
equi ed o he immune e asion and pe sis en in ec ion o he mammalian hos
(Engs le e al., 2007).
This a icking mechanism makes i ha de o he immune sys em o play i s
pa in elimina ing he pa asi es. So, e en wi h he humo al immuni y mechanisms
being po en ially unsupp essed, he VSG ecycling would enable he pa asi es o a oid
des uc ion by he hos ’s immune sys em and main ain a s a e o ch onic in ec ion.
Howe e , since no pa asi es could be de ec ed in he blood o su i o mice, i is
possible ha he inabili y o Δisp1/2 pa asi es o in ec mice is due o a combina ion o
di e en ac o s ha may include impai ed lagella mo ili y, de ec i e endocy ic
mechanism and lack o inhibi ion o he hos ’s NE o o he se ine pep idase in ol ed in
he hos ’s immune esponse.
Fu he s udies a e equi ed o de e mine exac ly which se ine pep idases a e he
T. b ucei ISPs a ge ing in he hos and de e mine wha mechanisms unde lie he
p olonged su i al o he hos in ec ed wi h ISP null mu an pa asi es.
Howe e he esul s ob ained by e e se gene ics indica e ha T. b ucei ISP1
and ISP2 could ep esen good a ge s o he apy.
126
4.3 Monoclonal an ibodies agains ISP1 and ISP2 do no con e
p o ec ion agains T. b ucei in ec ion in i o
The e adica ion o he en i e ypanosome ese oi om li es ock and game
popula ion as a way o con ol A ican ypanosomiasis is no easible wi h cu en ly
a ailable con ol measu es and so ea men is he s a egy o ollow. While he
de elopmen o new d ugs e ec i e agains HAT is he main esea ch a ge ,
accina ion has aised some in e es by in es iga o s. Howe e , he sea ch o a sui able
accine candida e has been unsuccess ul so a (La G eca and Magez, 2011).
In he li e a u e he e a e se e al e e ences o immuniza ion s udies o
monoclonal an ibody he apy in di e en pa hogens, such as Plasmodium (Reddy e al.,
2012, Feng e al., 2012, Zhang e al., 2001), Schis osoma (Xu e al., 2011, Zhang e al.,
2001), Toxoplasma (Cos a-Sil a e al., 2008, Cha e al., 2001), T ichinella (Wei e al.,
2011), Leishmania (Zanin e al., 2007, Bimal e al., 2001), T. c uzi (Buschiazzo e al.,
2012), and Bo elia (LaRocca e al., 2009, Ku enbach e al., 1997) wi h ela i e
success in e ms o p o ec ion agains in ec ion.
Howe e , he peculia i ies o T. b ucei cellula o ganiza ion hampe he pu sui
o a ge molecules o use as an igens in he de elopmen o an e ec i e accine o
an ibody-based he apy. A e abandoning he idea o c ea ing an an i-VSG accine,
se e al o he molecules we e conside ed as po en ial a ge s o he de elopmen o a
accine. Flagella pocke p o eins we e he i s o be conside ed due o he impo ance
o his s uc u e in he pa asi e’s i ulence and immune e asion. In 1995 an
immuniza ion s udy o ca le wi h a lagella pocke an igen om T. b ucei hodesiense
showed de elopmen o pa ial p o ec ion o T ypanosoma congolense and
T ypanosoma i ax a e na u al exposu e in he ield (Mkunza e al., 1995).
S uc u al p o eins such as ac in and ubulin ha e also been p oposed as
accina ion candida es. Two di e en s udies by Li e al., sugges ed ha immuniza ion
wi h ecombinan ac in and ecombinan β- ubulin om T ypanosoma e ansi induces
p o ec i e immuni y agains T. e ansi, T. equipe dum and T. b. b ucei in mice (Li e al.,
2009, Li e al., 2007).
127
In a simila app oach, he immuniza ion o mice wi h a ubulin- ich p epa a ion
om T. b ucei also e ealed o con e p o ec ion agains in ec ion and u he s udies on
his ma e showed ha an i- ubulin an ibodies speci ically inhibi T. b ucei in cul u e
(Lubega e al., 2002a, Lubega e al., 2002b).
O he molecules we e also add essed in immuniza ion and an ibody-media ed
he apy s udies, such as he plasma memb ane componen ganglioside (Uemu a e al.,
2005, Tsujimu a e al., 2005), asns-sialidases (Sil a e al., 2009), ca ion pumps
(Ramey e al., 2009), in a ian su ace glycop o eins (Lança e al., 2011) and
lymphocy e igge ing ac o (TLTF) (Hamadien e al., 1999, Bakhie e al., 1993)
ISPs a e kine oplas id speci ic inhibi o s wi h no homologues in mammals wi h
an appa en ly impo an ole in he hos -pa asi e in e ac ion and in ec ion o he
mammalian hos . Thei localiza ion on he lagella pocke egion allied o hei
speci ici y makes hem po en ial a ge s o immune-p o ec ion s udies. Gi en he
se e i y o he pheno ype p esen ed by Δisp1/2 pa asi es in he mouse in ec ion
expe imen we sough o de e mine i he immuniza ion wi h ecombinan ISP1 and
ISP2 would elici an immune esponse s ong enough o g an p o ec ion owa ds a
challenge wi h a le hal dose o T. b ucei in mice.
Fou di e en s udy g oups composed by 5 mice each ecei ed h ee boos s o
10 µg o ecombinan p o ein by in ape i oneal injec ion wi h 15 days apa and we e
subsequen ly challenged wi h 1×104 cells. The con ol g oup ecei ed PBS emulsi ied
wi h adju an and he o he g oups ecei ed ei he ISP1, ISP2 o bo h ecombinan
p o eins. No di e ence could be de ec ed in he su i al o in he pa asi emia le els o
he g oups wi h all mice dying wi h high pa asi e loads wi hin a pe iod o 7 days.
The e o e, he immuniza ion o mice wi h ISP1, ISP2 o ISP1 and ISP2 oge he
doesn’ con e any p o ec ion o T. b ucei 427 in ec ion in mice.
I was no expec ed ha he immuniza ion o mice wi h ISP1 o ISP2 alone
would ha e any e ec on he in ec ion ou come since we had p e iously es ablished ha
bo h ISPs a e equi ed o he no mal unc ion o he pa asi e and i was p edic ed ha
only he inhibi ion o bo h p o eins would esul in a immune-p o ec i e esponse
agains he in ec ion.
128
Howe e he g oup immunized wi h bo h ecombinan s didn’ show he expec ed
esponse and he in ec ion was equally le hal o hese mice. Se e al ac o s may ha e
in luenced he ou come o he expe ience.
Fi s ly, he amoun o ecombinan injec ed may ha e been insu icien o igge
an immune esponse s ong enough o be p o ec i e agains he in ec ion. In simila
s udies mice we e immunized wi h amoun s anging om 20 o 40 µg o ecombinan
(Li e al., 2009, Li e al., 2007, Lubega e al., 2002a) and his can be an impo an
ac o . Al hough he se um i e was de e mined be o e he challenge i is impossible o
p edic which se um i e would be high enough o g an p o ec ion agains he
in ec ion.
A second ac o is he use o a p epa a ion con aining wo di e en p o eins o
injec he mice. The se um i e was de e mined o bo h ISP1 and ISP2 and e ealed
subs an ially lowe alues compa ed wi h he alues ob ained o he se um i e
de e mina ion o ISP1 in he ISP1 g oup and ISP2 in he ISP2 g oup. This may e lec
some kind o compe i i e esponse om he hos ’s immune sys em ha comp omises
he concen a ion o each an ibody in he bloods eam. The s ain used in his
expe imen may also be impo an . Mice we e in ec ed wi h T. b ucei 427, a s ain mo e
i ulen o mice han he s ain used o gene a e he null mu an s. Di e en s ains can
ha e di e en suscep ibili ies o he e ec o he inhibi ion o ISPs ac i i y and e en
hough he absence o ISP 1 and ISP2 in T. b ucei hodesiense esul s in educed
in ec i i y in mice he e is no ce ain y ha he same would happen i he s ain used o
gene a e he knockou s was T. b ucei 427.
Finally, he subcellula localiza ion o T. b ucei ISP1 and ISP2 may be he key
ac o in luencing his expe imen . Al hough ISP1 and ISP2 ha e been localized in he
lagella pocke egion, hei p esence was also de ec ed in he cy osol and he e o e
inaccessible o he ci cula ing an ibodies explaining why he immuniza ion wi h ISP1
and ISP2 has no p o ec i e e ec on mice.
In an immuniza ion s udy i is impossible o de e mine he exac amoun o
an ibodies being p oduced and eleased in o he bloods eam in esponse o he an igen.
Thus, an ibodies gene a ed agains ISP1 and ISP2 we e used o es hei p o ec i e
e ec on T. b ucei in ec ion in mice.

129
The g ow h inhibi ion by an i-ISP1 and an i-ISP2 an ibodies was i s assessed in
cul u ed pa asi es. Using di e en amoun s o an ibody i was de e mined ha 25 µg o
pu i ied an i-ISP1 IgG and an i-ISP2 IgG was enough o inhibi he g ow h o T. b ucei
in cul u e. When compa ed o he non ea ed pa asi es o o he pa asi es ea ed wi h
p e-immune IgG con ol, pa asi es ea ed wi h an i-ISP1 3G8 an ibody and wi h an i-
ISP2 4G7 an ibody displayed signi ican ly educed g ow h a e 48h.
Al hough an in acellula unc ion o T. b ucei ISPs has been p oposed ea lie in
his s udy, his esul is o ally unexpec ed. The gene a ion o indi idual ISP null mu an
cell lines didn’ e eal any g ow h pheno ype in i o sugges ing ha wha e e
in acellula unc ion ISPs may ha e, i is independen o he pa asi e’s g ow h.
These esul s show ha he pa asi e’s g ow h is in ac inhibi ed by he p esence
o he an ibody, al hough he mechanism by which his inhibi ion occu s is a om
clea . The only plausible explana ion is adap a ion, o he lack o i . As discussed
ea lie , he dele ion o one gene ORF by a ge ed gene eplacemen o bo h alleles and
he deple ion o he same gene e eal dis inc pheno ypes ha can be much mo e se e e
in he RNAi silencing. The sequen ial eplacemen o bo h alleles o a gene p o ides he
pa asi e enough ime o i o adjus o he le els o gene exp ession while he RNAi
silencing esul s in he apid deple ion o he gene wi hou p e ious adap a ion o he
pa asi e.
Likewise, in his expe imen i is possible ha he g ow h inhibi ion obse ed in
he p esence o an i-ISP1 and an i-ISP2 an ibodies is due o a blockage o ISP1 and
ISP2 occu ing be o e he pa asi e has ime o adap o i s new condi ion. The chemical
balance o he cul u e medium can also in e e e wi h he g ow h o he pa asi es. The
pa asi es a e well adap ed o g ow in cul u e medium wi h de e mined cha ac e is ics
and composi ion. The addi ion o he an ibodies o he cul u e medium can al e ha
composi ion and a ec he en i onmen , causing s ess o he pa asi es and he e o e
in e e e wi h he g ow h. To minimize his p oblem, solu ions con aining he an ibodies
ep esen ed less han 1% o he o al olume o HMI-9 bu s ill i was possible o see an
e ec on pa asi es ea ed wi h he p e-immune IgG ha p esen ed educed g ow h
when compa ed wi h he wild ype pa asi es. Also, highe amoun s o an ibody esul ed
in d ama ic inhibi ion o cell g ow h a e 24 hou s and lowe amoun s p oduced no
130
e ec on he pa asi e’s g ow h a es, sugges ing ha he change o he pa asi e’s
en i onmen can accoun o he educed g ow h o T. b ucei in he p esence o an i-
ISP1 and an i-ISP2 an ibodies.
The same an ibodies we e used in he in i o assay. Fou g oups o 5 mice each
we e injec ed in ape i oneally wi h PBS (con ol g oup), 25 µg o an i- ISP1 an ibody
(α-ISP1 3G8 IgG g oup), 25 µg o an i-ISP2 an ibody (α-ISP2 4G7 IgG g oup) and 25
µg o bo h an ibodies in simul aneous (α-ISP1 3G8 IgG + α-ISP2 4G7 IgG g oup) on
he day be o e being challenged wi h 1×104 cells. All g oups ecei ed 2 addi ional
injec ions o an ibody on days 0 and 2 pos challenge.
Resul s ob ained we e e y simila o he ones ob ained in he immune-
p o ec ion s udy. All mice we e dead on day 6 pos -in ec ion and no di e ence could be
obse ed in he pa asi emia le els o mice om di e en s udy g oups, sugges ing ha
he ea men o mice wi h an ibodies agains ISP1 and ISP2 doesn’ ha e a p o ec i e
e ec o mice in ec ed wi h T. b ucei 427.
Again, i was no expec ed ha he adminis a ion o an i-ISP1 o an i-ISP2
an ibodies alone would ha e a p o ec i e o neu alizing e ec , bu we expec ed some
isible e ec on he animals injec ed wi h bo h an ibodies oge he .
The analysis o hese esul s is e y analogous o he analysis o he esul s
ob ained in he immuno-p o ec ion assay. E en hough a p elimina y assay in i o was
done o de e mine he op imal amoun o an ibody o use in he p esen assay, i was no
ully es ablished ha he educed g ow h o he cul u es in i o was indeed a di ec
e ec o he an ibody blocking ac ion and so, he amoun o an ibody used may ha e
been insu icien o ha e a p o ec i e o neu alizing e ec on mice.
Also, i was di icul o p edic i he numbe o doses adminis a ed would be
he ideal o i a ou h dose would bene icial o he ea men .
The ac o s ha a ec ed he immuno-p o ec i e s udy ha e o be aken in o
conside a ion in he p esen assay. So, apa om he amoun o an ibodies
adminis a ed o he animals, he T. b ucei s ain used in he in ec ion, he cy osolic
localiza ion o ISPs and he use o a mix u e con aining bo h an ibodies may ha e
in luenced he ou come o he expe imen .
131
4.4 Conclusions and inal conside a ions
This is he i s s udy on T. b ucei ISPs and, al hough u he analysis o hese
inhibi o s and hei ole is equi ed, some in e es ing indings esul ed om his s udy. I
is now clea ha ISP1 and ISP2 ha e an in acellula unc ion ha is independen o he
inhibi ion o se ine pep idase ac i i y. Tha unc ion, no ye clea , seems o be
associa ed wi h he lagellum, gi en he loss o no mal mo ili y by he Δisp1/2 pa asi es
gi en he localiza ion o ISP1 and ISP2 nea he lagella pocke egion and he
exis ence o possible endocy osis/exocy osis de ec in he null mu an cell lines.
I has also become clea wi h his s udy ha ISPs a e associa ed wi h he immune
e asion o he pa asi e since hei loss esul s in educed in ec i i y in mice. The
mechanism by which he loss o ISP1 and ISP2 in he null mu an cell line has such a
d ama ic e ec on he in ec ion’s ou come is unknown and new insigh s on his ma e
could be p o ided by he s udy o he inhibi o y ac i i y o ISP1 and ISP2. The e a e no
s udies pe o med on his subjec and al hough i is p edic ed ha T. b ucei ISPs indeed
inhibi se ine pep idases om amily S1A, we s ill don’ know which enzymes hey
inhibi , i bo h inhibi o s ha e he same a ge s o e en i hey ha e an inhibi o y
ac i i y a all. The ecen s udies on Leishmania ha e e ealed ha ISP1 and ISP2 ha e
di e en inhibi o y p ope ies and di e en biological oles as well wi h one being
in ol ed in he hos ’s in ec ion and immune e asion and he o he in ol ed in he
lagellum homeos asis and lagella pocke dynamics.
Con as ing wi h he indings o he Leishmania in es iga ion, he p esen s udy
e eals some unc ional edundancy o ISP1 and ISP2 in T. b ucei, wi h bo h being
equi ed o he pa asi e o in ec he mammalian hos e icien ly. Fu he mo e, esul s
ob ained e ealed ha he dele ion o one ISP esul s in he down egula ion o he
o he , h ough some mechanism ha we we e unable o de e mine.
Finally, immuniza ion o mice wi h ISP1 and ISP2 didn’ ha e any p o ec i e
e ec on mice in ec ed wi h T. b ucei. Simila ly, he ea men o T. b ucei in ec ed
mice wi h an ibodies speci ic agains ISP1 and ISP2 had no p o ec i e o neu alizing
e ec . The e o e, he immune-p o ec i e s udies show ha ISP1 and ISP2 a e no good
candida es o an an i-disease accine o o an ibody base he apy.
132
Fu he s udies a e equi ed on he ISPs and hei biological oles. Wi h he
in o ma ion p o ided by his s udy and he in o ma ion o he p o eomic s udies
a ailable, new leads on hei possible oles and he mechanisms by which hey exe
hei unc ion may a ise. ISP1 and ISP2 ha e been iden i ied in se e al sub-p o eomes:
hey we e iden i ied in he lagella p o eome as p e iously e e ed (B oadhead e al.,
2006); in he plasma memb ane subp o eome (B idges e al., 2008); in he
phosphop o eome o BSF T. b ucei (Ne e al., 2009); The iden i ica ion o a
phospho yla ion si e in ISP1, o example, may ha e an impo an biological
signi icance and i may be wo h explo ing.
P o ein phospho yla ion by p o ein kinases is one o he mos s udied pos -
ansla ional modi ica ions in euka yo ic cells, mainly due o i s signi ican ole in he
egula ion o a wide ange o cellula p ocesses including enzyme ac i a ion, p o ein-
p o ein in e ac ion and p o ein deg ada ion (Cohen, 2000). In T. b ucei he e a e 170
con en ional p o ein kinases and 12 a ypical p o ein kinases (Ne e al., 2009) and mos
esea ch has been ocused on cell cycle egula ing p o ein kinases (Hamma on, 2007,
Naula e al., 2005).
The un a eling o complex signaling pa hways can be ex emely di icul bu he
g owing numbe o phosphop o eome s udies ha e shed some ligh on he unc ion o
p o ein phospho yla ion in se e al o ganisms (Ne e al., 2009). Pe haps iden i ying he
kinases in ol ed in he phospho yla ion o T. b ucei ISP1 would be help ul in
de e mining he exac ole o his inhibi o .
Also, he iden i ica ion o ISP1 and ISP2 in he sec e ion p oduc s o PCF
ypanosome s ains (A yame N en e al., 2010) and he p edic ion o a palmi oyla ion
si e also in p ocyclics (Emme e al., 2011) is sugges i e o ISPs playing a ole in he
insec ec o , a ole possibly ela ed o he p o ein a icking, p o ein-p o ein
in e ac ions and hos -pa asi e in e ac ion by neu aliza ion o se ine pep idases p esen
in he midgu o he se se ly. I would be in e es ing o de e mine i p ocyclic pa asi es
de icien in ISPs would de elop simila pheno ypes o he BSF and hus i he absence
o ISPs in PCF T. b ucei would ha e any impac on he cell de elopmen and also in he
in ec ion o he insec hos .