Facul y o Medicine o he Uni e si y o Po o
Doc o al P og am in Biomedicine
Regula ion o CDX2 and in es inal di e en ia ion in
homeos asis and ca cinogenesis: emphasis on he
ole o MEX3A
Regulação do CDX2 e di e enciação in es inal em homeos asia e
ca cinogénese: ele ância uncional do MEX3A
B uno Miguel Co eia Pe ei a
IPATIMUP – Di e en ia ion and Cance g oup
Po o, Po ugal
2013
O ien ação
P o esso a Dou o a Raquel Ma ia da Sil a G aça Almeida,
In es igado a e líde do g upo Di e enciação e Canc o do IPATIMUP
P o esso a A iliada da Faculdade de Medicina da Uni e sidade do Po o
Co-o ien ação
P o esso a Dou o a Ma ia Leono Ma ins Soa es Da id,
In es igado a do g upo Di e enciação e Canc o do IPATIMUP
P o esso a Ca ed á ica da Faculdade de Medicina da Uni e sidade do Po o
DISSERTAÇÃO DE CANDIDATURA AO GRAU
DE DOUTOR APRESENTADA À FACULDADE
DE MEDICINA DA UNIVERSIDADE DO PORTO
iii
A igo 48º, § 3º – A Faculdade não esponde pelas dou inas expendidas na
Disse ação (Regulamen o da Faculdade de Medicina da Uni e sidade do
Po o - Dec e o-Lei nº 19337, de 29 de Janei o de 1931).

JÚRI DAS PROVAS DE DOUTORAMENTO
DISSERTATION DEFENSE COMMITTEE
P esiden e: Dou o José Agos inho Ma ques Lopes,
Di ec o da Faculdade de Medicina da Uni e sidade do Po o
(po delegação ei o al)
Vogais: Dou o Ma c Billaud,
In es igado do Ins i u Albe Bonnio , CRI INSERM/UJF U823,
G enoble, F ança
Dou o Pe e Jo dan,
In es igado do Ins i u o Nacional de Saúde D . Rica do Jo ge
de Lisboa
Dou o Manuel Albe o Coimb a Sob inho Simões,
P o esso Ca ed á ico da Faculdade de Medicina da
Uni e sidade do Po o
Dou o a Ca la Isabel Gonçal es de Oli ei a,
P o esso a A iliada da Faculdade de Medicina da
Uni e sidade do Po o
Dou o João An ónio Pin o de Sousa,
P o esso Associado da Faculdade de Medicina da
Uni e sidade do Po o
Dou o a Raquel Ma ia da Sil a G aça Almeida,
P o esso a A iliada da Faculdade de Medicina da
Uni e sidade do Po o, e o ien ado a da ese
ii
LISTA DE PUBLICAÇÕES
LIST OF PUBLICATIONS
Ao ab igo do dispos o no nº 2 do A . 8º do Dec e o-Lei nº 388/70, cons i uem
pa e in eg an e des a Disse ação os seguin es abalhos já publicados:
Pe ei a B, Oli ei a C, Da id L, Almeida R. (2009) CDX2 p omo e
me hyla ion is no associa ed wi h mRNA exp ession. In e na ional Jou nal
o Cance , 125(7):1739-1742
Pe ei a B, Sousa S, Ba os R, Ca e o L, Oli ei a P, Oli ei a C, Cha ie NT,
Pla e o i M, Rouaul JP, F eund JN, Billaud M, Almeida R. (2013) CDX2
egula ion by he RNA-binding p o ein MEX3A: impac on in es inal
di e en ia ion and s emness. Nucleic Acids Resea ch, 41(7):3986-3999
Pe ei a B, Le Bo gne M, Cha ie NT, Billaud M, Almeida R. (2013) MEX-3
p o eins: ecen insigh s on no el pos - ansc ip ional egula o s. T ends in
Biochemical Sciences, 38(10):477-479
Em cump imen o com o dispos o no Dec e o-Lei sup amencionado, o au o
decla a que pa icipou ac i amen e na concepção e execução do
abalho expe imen al, na in e p e ação e discussão dos esul ados, e na
edacção dos espec i os a igos cien í icos.
ix

TABLE OF CONTENTS
LIST OF PUBLICATIONS
FUNDING
ACKNOWLEDGEMENTS
TABLE OF CONTENTS
ABSTRACT
RESUMO
ABBREVIATIONS
CHAPTER 1. GENERAL INTRODUCTION AND AIMS
1.1 Gas oin es inal ca cinogenesis
1.1.1 An o e iew on gas ic cance
1.1.2 In es inal me aplasia
1.1.3 Colo ec al ca cinogenesis
1.1.4 In es inal homeos asis
1.2 The in es inal ansc ip ion ac o CDX2
1.2.1 CDX2 homeobox gene and i s a ge s
1.2.2 Role in homeos asis
1.2.3 In ol emen in ca cinogenesis
1.2.4 CDX2 egula o y ne wo k
1.3 Pos - ansc ip ional egula ion o gene exp ession
1.3.1 F om ansc ip s o p o eins
1.3.2 RNA-binding p o eins and hei biological unc ions
1.4 The MEX-3 amily o RNA-binding p o eins
1.4.1 Caeno habdi is elegans MEX-3
1.4.2 The mammalian MEX3 p o eins
2
4
7
8
11
13
15
17
24
25
27
29
xx
ix
x
xi
x ii
xxiii
xxi
1
x ii
1.5 Long- e m goal and speci ic aims
CHAPTER 2. CDX2 PROMOTER METHYLATION
Pape I – CDX2 p omo e me hyla ion is no associa ed wi h
mRNA exp ession. In e na ional Jou nal o Cance , 2009
CHAPTER 3. CDX2 POST-TRANSCRIPTIONAL REGULATION BY THE
RNA-BINDING PROTEIN MEX3A
Pape II – CDX2 egula ion by he RNA-binding p o ein
MEX3A: impac on in es inal di e en ia ion and s emness.
Nucleic Acids Resea ch, 2013
Pape II – Supplemen a y Da a
CHAPTER 4. THE MAMMALIAN MEX3 PROTEIN FAMILY
Pape III – MEX-3 p o eins: ecen insigh s on no el pos -
ansc ip ional egula o s, T ends in Biochemical Sciences,
2013
CHAPTER 5. DISCUSSION AND CONCLUDING REMARKS
5.1 CDX2 egula ion by p omo e me hyla ion
5.2 3D AGS cell model and loss o CDX2 exp ession
5.3 Mechanis ic aspec s o MEX3A unc ion
5.4 MEX3A and ca cinogenesis
5.5 A conse ed unc ion o MEX3A in mammalian
emb yogenesis?
5.6 Concluding ema ks
37
45
59
67
75
77
78
82
84
87
35
43
65
73
30
REFERENCES
APPENDIX
Appendix A. Lis o an ibodies and p ime s used in his s udy
Appendiz B. Lis o di e en ially exp essed genes be ween 3D
and 2D AGS cell cul u es
119
91
xix
ABSTRACT
The homeodomain ansc ip ion ac o CDX2 is a key playe in in es inal
di e en ia ion. The e o e, i is no su p ising o ind i s exp ession signi ican ly al e ed in
ca cinogenic p ocesses o he gas oin es inal ac . In he s omach, de no o CDX2
exp ession d i es a p eneoplas ic lesion known as in es inal me aplasia ha inc eases
he isk o gas ic cance de elopmen . Qui e he opposi e, in he con ex o
colo ec al cance , CDX2 has been classically desc ibed as a umou -supp esso ,
al hough his iew has been g adually challenged in he las ew yea s.
No wi hs anding, i is known ha umou s e aining CDX2 exp ession a e mo e
di e en ia ed and show be e ou come in e ms o su i al. Thus, a comp ehensi e
unde s anding o CDX2 egula ion s ands ou as a esea ch p io i y, o in he long-
un, he acqui ed knowledge could be in eg a ed in o al e na i e he apeu ic
s a egies ha migh bene i he pa ien . Taking in o conside a ion ha he
ex acellula mic oen i onmen is also impo an o he cellula malignan beha io
as gene ic cons ains, we decided o ackle i s in luence o e CDX2 exp ession in wo
on s:, analyze he possible ole o DNA epigene ic changes, hypo hesizing ha
in ec ion by Helicobac e pylo i and he gene a ion o ch onic in lamma ion could in
some way a ec he CDX2 gene me hyla ion pa e n and induce i s ansc ip ion;
and in a mo e explo a o y app oach, es ablish 3D cul u e models ha be e mimic
he in i o milieu, hypo hesizing ha hey would p o ide new insigh s ega ding
signaling pa hways a ec ing CDX2 le els. We show he e ha he e is a lack o
co ela ion be ween CDX2 me hyla ion s a us and i s exp ession in in es inal
me aplasia and gas ic cance cell lines, excluding his mechanism as a CDX2
egula o y ea u e du ing gas ic malignancy. On he o he hand, h ough genome-
wide sc eening o he 3D cul u e sys em, comp ising a gas ic cance cell line wi h
CDX2 exp ession and he basemen ma ix ma igel, we we e able o iden i y he
RNA-binding p o ein MEX3A as pu a i ely in ol ed in CDX2 egula ion. Fu he
suppo ed by an e olu iona y unc ional link o i s Caeno habdi is elegans
o hologue MEX-3, we demons a e ha MEX3A main ains a conse ed ep essi e
unc ion o e CDX2 in gas ic and in es inal cellula models. This is dependen on he
in e ac ion wi h a speci ic binding de e minan p esen in CDX2 mRNA
3`un ansla ed egion. Mo eo e , MEX3A o e exp ession ca ies pheno ypic
consequences, impai ing in es inal di e en ia ion and cellula pola iza ion, while
p omo ing gain o s emness p ope ies. As a esul , we desc ibe o he i s ime a
xxi

mechanism o CDX2 pos - ansc ip ional con ol, likely con ibu ing o in es inal
homeos asis and ca cinogenesis, and add a new laye o he al eady in ica e CDX2
egula o y ne wo k.
RESUMO
O ac o de ansc ição homeobox CDX2 é um elemen o c í ico na di e enciação
in es inal. Assim, não é inespe ado o ac o de ap esen a ní eis de exp essão
signi ica i amen e al e ados em p ocessos ca cinogénicos do ac o gas oin es inal.
No es ômago, a exp essão de no o de CDX2 induz uma lesão p é-neoplásica
denominada me aplasia in es inal que con e e um isco ac escido de
desen ol imen o de ca cinoma gás ico. Pelo con á io, no con ex o colo ec al,
es e gene em sido ge almen e desc i o como um sup esso umo al, embo a es a
classi icação enha indo a se pos a em causa nos úl imos anos. Mesmo assim,
econhece-se que umo es com exp essão de CDX2 são mais di e enciados e
de êm melho p ognós ico em e mos de sob e ida. To na-se, en ão, undamen al
ob e uma comp eensão ap o undada dos p ocessos de egulação de CDX2, pois a
longo p azo o conhecimen o adqui ido pode se in eg ado em es a égias
e apêu icas al e na i as que pode ão bene icia o pacien e. Tendo em
conside ação que o mic oambien e ex acelula é, al como as al e ações
gené icas, impo an e pa a o compo amen o celula maligno, decidimos
con on a a sua in luência sob e a exp essão de CDX2 em duas pa es: analisa o
possí el papel de al e ações epigené icas ao ní el do p omo o do gene,
colocando a hipó ese de que o p ocesso de in ecção po Helicobac e pylo i e a
subsequen e espos a in lama ó ia pode ão c ia condições que a ec am o pe il de
me ilação de CDX2 induzindo a sua ansc ição; e numa abo dagem de ca ác e
mais explo a ó io, es abelece modelos de cul u a 3D que mime izem o ambien e in
i o, colocando a hipó ese de que es es pe mi i iam ob e no os dados no que
espei a às ias de sinalização que a ec am os ní eis de CDX2. Demons ámos que
não exis e uma co elação en e o es ado de me ilação do p omo o de CDX2 e a
sua exp essão na me aplasia e em linhas celula es de canc o gás ico, excluindo
es e mecanismo de egulação no p ocesso de ca cinogénese gás ica. Po ou o
lado, a a és de um a imen o ansc icional do sis ema de cul u a 3D, cons i uído
po uma linha celula gás ica e a ma iz de memb ana basal ma igel, iden i icámos
uma p o eína de ligação ao ARN designada MEX3A como es ando po encialmen e
en ol ida na egulação de CDX2. Apoiados numa base uncional e olu i a em
elação ao papel do o ólogo MEX-3 em Caeno habdi is elegans, p o ámos que o
MEX3A man ém uma unção conse ada enquan o ep esso da exp essão de
CDX2 em modelos celula es gás icos e in es inais. Es e e ei o é dependen e da
xxiii
in e acção com um mo i o de ligação especí ico p esen e na egião 3` não-
aduzida
do
ARN
mensagei o
de
CDX2.
Adicionalmen e,
a
sob exp esão
de
MEX3A
aca e a
consequências
eno ípicas, a ec ando a di e enciação in es inal e
pola idade celula , p omo endo simul aneamen e o ganho de p op iedades
es aminais. Em conclusão, desc e emos pela p imei a ez um mecanismo pós-
ansc icional de con olo de CDX2, com ele ância pa a a homeos asia in es inal e
p o a elmen e ca cinogénese, adicionando um no o elemen o à complexa ede
de egulação do gene CDX2.
ABBREVIATIONS
The ollowing lis desc ibes ele an abb e ia ions and ac onyms used.
Bcd Bicoid
BMP Bone mo phogene ic p o ein
Cad Caudal
CDX Caudal ype homeobox
CIN Ch omosomal ins abili y
CpG Cy osine guanine dinucleo ide
CRC Colo ec al cance
eIF Euka yo ic ini ia ion ac o
GI Gas oin es inal
GLD-1 De ec i e in ge mline de elopmen
hnRNP K He e ogeneous nuclea ibonucleop o ein K
HOX Homeobox
IM In es inal me aplasia
KH K-homology
LGR5 Leucine ich epea -con aining G-p o ein coupled ecep o 5
LRC Label- e aining cell
mex Muscle excess
MEX3 Mex-3 homologue
miR mic oRNA
MRE MEX-3 ecogni ion elemen
mRNP Messenge ibonucleop o ein
MSI Mic osa elli e ins abili y
MSI1 Musashi-1
OLFM4 Ol ac omedin-4
P body P ocessing body
QKI Quaking
RBP RNA-binding p o ein
RING Really in e es ing new gene
RKHD RING inge and KH domain-con aining
TE T ophec ode m
UTR Un ansla ed egion
xx
p opose ha bone ma ow-de i ed cells migh be he ini ia o cells in he gas ic
ca cinogenic p ocess, including IM and dysplasia, by homing in and eng a ing o
he inju y si es (Hough on e al. 2004; Va on e al. 2012). Al hough en icing as a
heo y, he e has been limi ed ansla ion o his model in o he human se ing.
Whiche e he case, IM is mos p obably he ou come o an adap i e esponse ha
goes amiss, in which he issue ies o cope wi h se e al agg essi e inpu s, bu ends
up wi h he c ea ion o suscep ible g ound o neoplas ic ans o ma ion (Mesqui a e
al. 2006).
In e ms o classi ica ion, wo majo gas ic IM ypes can be ecognized,
aking in o
accoun
no
only
mo phological,
bu
also
molecula
al e a ions,
like
loss
and
gain
o
mucinous
di e en ia ion
ma ke s
and
mucin-associa ed
ca bohyd a e
an igens (Reis e al. 1999; Sil a e al. 2002). The comple e IM o
in es inal ype (p e iously denomina ed ype I) e lec s a comple e swi ch in he
di e en ia ion p og am, wi h loss o gas ic mucins MUC1, MUC5AC, and MUC6, and
de no o exp ession o he in es inal mucin MUC2. I is cha ac e ized by he p esence
o abso p i e cells, Pane h cells and goble cells sec e ing sialomucins, simila o he
small in es inal pheno ype. The incomple e IM o GI-mixed ype e lec s a mix u e o
gas ic and in es inal componen s, bo h a he glandula and cellula le el (Niwa e
al. 2005). I is cha ac e ized by he p esence o columna and goble cells sec e ing
sialomucins and/o sulphomucins (p e iously denomina ed ypes II and III,
espec i ely), simila o he colonic pheno ype. Rema kably, he ec opic in es inal
glands s ill p ese e a no mal cell mig a ion pa e n, which is achie ed by a
edeploymen o he p oli e a i e niche om he middle o he base o he gland
(Inada e al. 2001; Sakamo o e al. 2011). Recip ocal in e ac ions be ween he
epi helium and he mesenchyme migh be behind his a chi ec u al emodelling
(Mu oh e al. 2005a), as he induc ion o a mesenchymal in es inal pheno ype du ing
he ea ly s ages o IM migh lead o he es ablishmen o a posi i e egula o y loop
in ol ing pa ac ine signals (Sakagami e al. 1984). I is no ye clea i he wo IM
ypes can be conside ed sequen ial s eps in a sha ed p ocess o g adual
in es inaliza ion o i hey a ise independen ly. The possibili y exis s ha he
incomple e ype is biologically mo e uns able as i e lec s an abe an di e en ia ion
p og am wi hou pheno ypic pa allel in he adul o ganism. In ag eemen ,
epidemiological da a, hough sca ce, shows ha i con e s inc eased isk o gas ic
cance de elopmen compa ed o he comple e ype (Filipe and Jass 1986; Rokkas
CHAPTER 1. GENERAL INTRODUCTION AND AIMS

e al. 1991; Filipe e al. 1994), highligh ing he impo ance o s a i ica ion conce ning
p ognos ic signi icance (González e al. 2013). Cu iously, bac e ial coloniza ion is
ypically absen in oci o comple e IM (B a o and Co ea 1999), a ou ing a
p esumably p o ec i e unc ion.
1.1.3 Colo ec al ca cinogenesis
Colo ec al cance (CRC) is cu en ly he hi d mos common cance wo ldwide,
as 10% o he newly diagnosed cases a e malignancies o he colon o ec um.
Almos 60% o he cases occu in de eloped egions and he a eas wi h highes
incidence a e No h Ame ica, Aus alia/New Zealand and Eu ope (Fe lay e al. 2010).
Mo e han 600.000 people die each yea , making i he ou h leading cause o
cance - ela ed dea h. In Po ugal,
conside ing
he
o al
numbe
o
cases,
i
places
i s
in
e ms
o
incidence
and
mo ali y
(IARC 2010).
As
o
he
small
in es ine,
i
has
a
ema kably
low
incidence
o p ima y ca cinomas, especially conside ing i s leng h
and su ace a ea, and hose ha do occu a e o en ela ed o he edi a y
synd omes.
Abou 90% o spo adic umou s occu in indi iduals o e he age o i y. O he
isk ac o s include amily his o y, a die low in fibe s and high in ed mea , alcohol,
smoking, and seden a y occupa ion (Johnson e al. 2013). A p esen es ima e is ha
15-30% o CRCs ha e a amilial componen . Less han 5% o hese happen in a
ecognizable se ing o highly pene an cance synd omes due o ge mline
mu a ions, being he mos common he he edi a y nonpolyposis CRC and amilial
adenoma ous polyposis (Fea on 2011). Despi e ad ances in su gical echniques and
adju an he apy, he e has been only a modes imp o emen in su i al o pa ien s
wi h ad anced neoplasms (Edwa ds e al. 2012). Hence, e ec i e p ima y and
seconda y p e en i e app oaches mus be de eloped o educe mo bidi y and
mo ali y.
Since he desc ip ion o he classic adenoma-ca cinoma pa hway (Fea on and
Vogels ein 1990), de ining CRC as he esul o a g adual accumula ion o changes
ha ans o m no mal glandula epi helial cells in o adenoma, ollowed by in asi e
ca cinoma and e en ually me as a ic cance , ou unde s anding o i s molecula
pa hogenesis has ad anced and led o nume ous e isions o his linea umou
p og ession model. I is now ecognized ha loss o genomic s abili y is a hallma k
CHAPTER 1. GENERAL INTRODUCTION AND AIMS
7
ea u e o colo ec al ca cinogenesis (G ady and Ca e he s 2008), and his p ope y
led o he es ablishmen o a classi ica ion sys em: (i) he ch omosomal ins abili y
(CIN) pheno ype, ound in as many as 85% o umou s and de ined by he p esence
o aneuploidy o s uc u al abe a ions; (ii) he MSI pheno ype, de ined by he
p esence o uns able loci due o inac i a ion o genes in he DNA misma ch epai
amily; and (iii) he CpG island me hyla o pheno ype, exhibi ing bo h global DNA
hypome hyla ion and hype me hyla ion o gene p omo e s ha con ain CpG islands
(P i cha d and G ady 2011). I is he accumula ion o mu a ions combined wi h
mul iple cycles o clonal selec ion ha esul s in he de egula ion o signalling
pa hways con olling cell p oli e a ion, di e en ia ion, apop osis, angiogenesis and
in asion, ul ima ely culmina ing in cance de elopmen .
1.1.4 In es inal homeos asis
The in es inal ac is ana omically di ided in o wo well-de ined segmen s, he
small in es ine and la ge in es ine (o colon),
lined by a specialized single laye o
cells o ganized
in o
wo
mo phologically
and
unc ionally
dis inc
compa men s:
lask-shaped submucosal in agina ions known as c yp s o Liebe kühn, and inge -
shaped luminal p o usions e med illi, which d ama ically inc ease he abso p i e
su ace a ea o he small in es ine. The c yp cons i u es he p oli e a i e
compa men o he in es inal epi helium; i is monoclonal and main ained by ou o
six mul ipo en s em cells loca ed in he lowe hi d (Bje knes and Cheng 1999) ha
gi e ise o in e media e descendan s e e ed o as ansi -ampli ying cells. The illus
ep esen s he di e en ia ed compa men and is polyclonal as i s cells de i e om
se e al c yp s (Po en and Loe le 1990). Abso p i e en e ocy es, mucous-p oducing
goble cells, and ho mone-sec e ing en e oendoc ine cells mig a e upwa ds along
he basemen memb ane o he epi helium apex, whe e hey unde go apop osis,
being subsequen ly ex olia ed in o he in es inal lumen (Hall e al. 1994). Pane h cells
a e unusual in ha hey se le a he c yp base and a e he only cell ype mig a ing
downwa ds (B y e al. 1994). The modula o ganiza ion o he small in es ine and
colon is globally compa able. His ologically, he e a e, howe e , wo impo an
di e ences be ween hem. The colon ca ies no illi; ins ead, i has a la su ace
epi helium and la ge colonic c yp s ex ending deep in o he submucosa. The
ela i e abundance o each o he main cell ypes also a ies ma kedly wi hin he
CHAPTER 1. GENERAL INTRODUCTION AND AIMS
di e en in es inal segmen s. En e ocy es a e highly pola ized cells esponsible o
abso bing and anspo ing nu ien s ac oss he epi helium, sec e ing a cock ail o
hyd oly ic enzymes in o he gu . They make up mo e han 80% o all in es inal
epi helial cells. Goble cells sec e e p o ec i e mucins and e oil p o eins equi ed o
he mo emen and e ec i e emo al o luminal con en s, while p o iding p o ec ion
agains shea s ess and chemical damage. Acco dingly, hei numbe s inc ease
om he p oximal (4%) o dis al (16%) in es ine (Ka am 1999). En e oendoc ine cells
coo dina e gu physiology h ough speci ic ho mone p oduc ion (Höcke and
Wiedenmann 1998). They a e sca e ed as indi idual cells h oughou he mucosa,
ep esen ing a small p opo ion (<1%) o he cells lining he epi helium (Schonho e
al. 2004). Finally, Pane h cells ha e a unc ion in inna e immuni y, syn hesizing
bac e icidal agen s such as de ensins and lysozyme (Po e e al. 2002). They a e
absen om he colon and ha e a li e expec ancy o six o eigh weeks ( an de Flie
and Cle e s 2009), much longe han ha o hei e minally di e en ia ed illus
coun e pa s, wi h a u no e a e o oughly h ee o i e days (W igh and I win
1982).
Cu en ly, some con o e sy exis s as o he p esence o dis inc ypes o
in es inal s em cells. The “+4 posi ion” model assumes he c yp base is exclusi ely
popula ed by e minally
di e en ia ed
Pane h
cells
and
ha
s em
cells
a e
loca ed
jus
abo e
hem,
on
a e age
a
he
+4
posi ion (Po en e al. 1974).
These
cells
we e
shown
o
di ide
once e e y day and o be unusually sensi i e o adia ion,
possibly p e en ing he accumula ion o dele e ious genomic changes (Po en
1977). They we e desc ibed o e ain DNA labelling, and a e also called label-
e aining cells (LRCs), a ea u e sugges ed as being he esul o asymme ic s and
seg ega ion (Po en e al. 2002). The “s em cell zone” model s a es ha small,
undi e en ia ed, cycling cells called c yp base columna (CBC) cells, esiding in a
s em cell-pe missi e en i onmen and wedged be ween he Pane h cells a he base
o he c yp s, a e likely o be he ue s em cells (Cheng and Leblond 1974; Bje knes
and Cheng 1999). Ye , de ini i e p oo o s emness equi es pu a i e s em cells o be
expe imen ally linked o hei p ogeny, and his has p o en elusi e due o lack o
speci ic ma ke s (Ba ke e al. 2012). The musashi-1 (MSI1) gene encodes a RNA-
binding p o ein ini ially desc ibed as a egula o o asymme ic di ision in neu al s em
cells (Glaze e al. 2012). La e s udies showed ha i deno es mul ipo en s em cells
in o he se ings, being also highly exp essed a he c yp base, wi h exp ession
CHAPTER 1. GENERAL INTRODUCTION AND AIMS
9
e iden on he CBC cells, as well as in some LRCs (Po en e al. 2003). Howe e ,
i s b oad exp ession domain sugges s ha i is a ma ke o ea ly commi ed
p ogeni o s alike. Lineage acing echniques in inducible mouse models led o he
iden i ica ion o he leucine ich epea -con aining G-p o ein coupled ecep o 5
(LGR5), he i s speci ic CBC cell ma ke (Ba ke e al. 2007). The LGR5 p o ein ac s as
he ecep o o a small amily o Wn agonis s called R-spondins. Lg 5+ cells a e highly
uni o m in mo phology, in a iably ouch Pane h cells, and di ide each day. Ano he
obus ma ke o Lg 5+ s em cells called ol ac omedin-4 (OLFM4) has ecen ly
eme ged. I is a membe o he ol ac omedin domain-con aining amily and
encodes a sec e ed glycop o ein ha appea s o ha e an i-apop o ic and cell
cycle egula o y cha ac e is ics (G o e e al. 2010). Molecula in si u hyb idiza ion
e ealed ha OLFM4 is highly exp essed in no mal CBC cells in human small in es ine
and colon ( an de Flie e al. 2009). The mos eliable candida e as an LRC ma ke
o da e is BMI1, which encodes a componen o he polycomb ep essing complex 1
ha ac s as a ch oma in modi ie , being implica ed in he s able main enance o
gene ep ession (Valk-Lingbeek e al. 2004). I has a ac ed a en ion due o i s ole
in egula ing sel - enewal o neu al and hema opoie ic p ogeni o s. Bmi1 was ound
o ma k a e cells a he +4 cell posi ion uniquely in abou 10% o he p oximal small
in es ine (Sangio gi and Capecchi 2008).
Modelling o he in es inal epi helium is based on a delica e balance be ween
sel - enewal and di e en ia ion, which mus be main ained h oughou li e.
No ewo hy, in all species
s udied,
he
c yp - illus
axis
junc ion
ep esen s
he
physical
h eshold
om
which
in es inal
cells
acqui e
hei
inal
unc ional
cha ac e is ics,
a guing
o
conse ed molecula mechanisms in ol ed in his
p ocess. In ac , in es inal homeos asis is dependen on au oc ine and pa ac ine
in e ac ions be ween he mucosa and he unde lying mesenchyme, and many o
he in e ening signalling pa hways, such as Wn , Bone Mo phogene ic P o ein
(BMP), and No ch, ha e been iden i ied (C osnie e al. 2006). These molecula
signals p o ide some o he basic p inciples h ough which in es inal a chi ec u e is
o ganized, bu i is s ill no clea a wha poin s em cell p ogeny loses i s po ency and
becomes i e e sibly commi ed o di e en ia ion. I espec i ely o how his occu s,
cell a e decisions need o be closely imed in ela ion o he pa e n o cell di isions.
While he mechanisms con olling in es inal cell ansi ions a e a om comple ely
CHAPTER 1. GENERAL INTRODUCTION AND AIMS
unde s ood, i is ob ious ha hey in ol e ansc ip ion ac o s con e ing
compa men -speci ic gene exp ession.
When conside ing he molecula basis o in es inal di e en ia ion, a common
poin o con e gence exis s, independen ly o he biological se ing – he caudal
(cad) ype homeobox 2 gene (CDX2). This ansc ip ion ac o is exclusi ely p esen in
he in es ine and de no o exp essed in e e y oci o ec opic in es inal di e en ia ion
in he body, associa ed wi h ca cinogenic p ocesses. I s emb yonic equi emen and
ansc ip ional ac i i y o e in es ine-speci ic genes inco po a e he p ope ies o a
“mas e egula o ”.
1.2.1 CDX2 homeobox gene and i s a ge s
One o he ea lies isola ed homeobox genes in D osophila showed o he i s
ime ma e nal as well as zygo ic exp ession, accumula ing in a concen a ion
g adien spanning he an e o-pos e io axis o he emb yo. Du ing la e
emb yogenesis, i was exp essed in mo e pos e io s uc u es, he e o e i was named
cad (Mlodzik e al. 1985). Soon a e , h ee mu ine o hologues designa ed Cdx1
(Dup ey e al. 1988), Cdx2 (James and Kazenwadel 1991) and Cdx4 (Game and
W igh 1993) we e cha ac e ized. Wi h he excep ion o Cdx4, hey a e con ined o
he pos e io gu endode m du ing la e de elopmen and he ma u e in es ine a e
bi h.
The
human
CDX2
gene
was
independen ly
cloned
om
an
adul
jejunal
cDNA
lib a y
(D ummond e al. 1997)
and
by
di e en ial
sc eening
o
mRNA
om
CRC (Mallo e al. 1997). I maps o he Pa aHox gene clus e in ch omosome 13q12.3,
has h ee exons and encodes a 313 amino acid p o ein con aining a nuclea
ansloca ion and ac i a ion domain in he amino e minus (T inh e al. 1999), and a
highly conse ed helix- u n-helix DNA-binding mo i called he homeodomain
owa ds he ca boxyl e minus. The CDX2 homeodomain sha es 100% homology wi h
CHAPTER 1. GENERAL INTRODUCTION AND AIMS
11
1.2 THE INTESTINAL TRANSCRIPTION FACTOR CDX2

he hams e CDX3 homeodomain, 96% wi h he mouse CDX2, and e en 88% wi h he
homeodomain om D osophila Cad, implying ecogni ion o simila DNA a ge s.
CDX p o eins ha e been demons a ed o bind as a monome o dime o one o
mo e CDX- esponsi e elemen s, ypically consis ing o he consensus sequence
(A/C)TTTAT(A/G), in di ec o e e se o ien a ion bo h in p omo e and gene
enhance egions (Ma gali e al. 1993; Taylo e al. 1997; Ve zi e al. 2010). These
mo i s a e equen ly jux aposing (T oelsen e al. 1997) o e en in e sec ing (Lambe
e al. 1996) a TATA-box sequence, usually pa o he RNA polyme ase II binding si e.
Al hough some epo s demons a e ha CDX2 can ac as an indi ec ep esso ,
coun e ac ing CDX1 o o he ansc ip ion ac o -media ed ac i a ion, by
compe ing o he same binding si es (Gau ie -S ein e al. 2003; Fu umiya e al. 2013)
o h ough in e ac ion wi h basal componen s o he ansc ip ional machine y (Chun
e al. 2007; Mu oh e al. 2010), mos s udies p o ide s ong e idence o a ole in
ac i a ing gene ansc ip ion (Ve zi e al. 2011). Indeed, CDX2 is de e minan o he
exp ession o nume ous in es inal di e en ia ion ma ke s, and i has been shown o
egula e abso p i e lineage-speci ic ac o s such as suc ase-isomal ase (Suh e al.
1994; Boud eau e al. 2002), lac ase phlo izin hyd olase (T oelsen e al. 1997; Fang e
al. 2000), ca bonic anhyd ase 1 (D ummond e al. 1996), guanylyl cyclase C (Pa k e
al. 2000), calbindin-D9K (Lambe e al. 1996; Wang e al. 2004a), li e -in es ine
cadhe in (Hinoi e al. 2002), and illin (Yamamichi e al. 2009); goble cell-speci ic
ac o s such as MUC2 (Mesqui a e al. 2003; Yamamo o e al. 2003) and e oil
ac o 3 (Shimada e al. 2007); and en e oendoc ine cell-speci ic p oglucagon (Jin
and D ucke 1996). On he con a y, CDX2 le els consis en ly seem lowes in Pane h
cells, a lineage ecen ly shown o be supp essed by CDX2 o e exp ession-media ed
loss o nuclea β-ca enin (C issey e al. 2011). CDX2 is also in ol ed in con olling he
exp ession o addi ional molecules ha con ibu e o cellula dynamics, including
p ocesses o p oli e a ion (Uesaka e al. 2002), g ow h a es (Bai e al. 2003; Aoki e
al. 2011), mig a ion (Coskun e al. 2010), adhesion (Lo en z e al. 1997; Sakaguchi e
al. 2002; Hinkel e al. 2012), me abolism and anspo (Modica e al. 2009; Kakizaki e
al. 2010),
in lamma ion (Wang e al. 2005),
glycop o eome
modula ion (Isshiki e
al. 2003),
and
apop osis (Mallo e al. 1998).
In
any
case,
egula o y
ou come
ul ima ely esul s om he coope a i e balance wi h o he impo an ansc ip ion
ac o s, being mos ly ele an he hepa ocy e nuclea ac o (HNF1 and HNF4) and
GATA-binding ac o (GATA4/5/6) amilies (Boud eau e al. 2002; Ve zi e al. 2010;
CHAPTER 1. GENERAL INTRODUCTION AND AIMS
Ve zi e al. 2013). On he o he hand, hese and o he ansc ip ion ac o s, such as
KLF4, can be di ec ly egula ed by CDX2 (Maha an e al. 1999; Boyd e al. 2010).
Hence, he complex hie a chies o con ol ha go e n gene exp ession du ing
in es inal di e en ia ion and de elopmen a e de e mined by he s oichiome y o
di e en ansc ip ion ac o s and co ac o s wi hin in es inal cells a any gi en ime,
as well as by he ype, numbe , and a angemen o cis-ac ing elemen s in he
egula o y egions o in es inal genes.
1.2.2 Role in homeos asis
Du ing emb yogenesis, CDX homologues pa icipa e in pa e ning o he
e eb al column (Sub amanian e al. 1995; Chawengsaksophak e al. 1997; an Nes
e al. 2006), as well as in haema opoiesis (Wang e al. 2008), ia HOX gene egula ion
and wi h a ce ain deg ee o unc ional edundancy ( an den Akke e al. 2002;
Sa o y e al. 2009). Bo h Cdx1 and Cdx2 a e exp essed du ing endode m
de elopmen and in adul in es ine; howe e , he speci ic ole o each membe and
he ex en o hei unc ional equi alence is s ill no comple ely unde s ood. In he
la e emb yo, CDX1 and CDX2 le els a y quan i a i ely along he os ocaudal axis,
wi h highes exp ession o CDX1 in he dis al po ion o he colon and highes CDX2
exp ession in he p oximal colon, diminishing in ei he di ec ion (James e al. 1994;
Silbe g e al. 2000). A ai ly complemen a y g adien o exp ession has also been
desc ibed along he e ical c yp - illus axis, wi h he o me p ima ily localized o he
c yp , and he la e p ima ily along he illus, al hough wi h less s aining owa ds he
ip (Silbe g e al. 1997; Rings e al. 2001; Kim e al. 2002; Silbe g e al. 2002). These
pa e ns endu e h oughou he li espan o he animal and a e also obse ed in
human issue (Wal e s e al. 1997; Boulange e al. 2005). They a e hough o e lec
in insically di e en unc ionali ies, wi h CDX1 associa ed o a mo e p oli e a i e
pheno ype and CDX2 o a mo e di e en ia ed one, conceding a pa ially
in e changeable ac i i y in ce ain con ex s (Ve zi e al. 2011). Cdx1−/− mu an s a e
iable and e ile, and like ansgenics o e exp essing Cdx1, display no o e
in es inal pheno ype (Sub amanian e al. 1995; Bonhomme e al. 2008; C issey e al.
2008). Cdx2 p ecedes and is needed o Cdx1 onse du ing in es inal de elopmen
(Eda e al. 2002; Silbe g e al. 2002; Mu oh e al. 2009),
and
Cdx1
equi emen
is
only
unmasked
upon
Cdx2
loss,
as
hei combined absence in he adul s age
CHAPTER 1. GENERAL INTRODUCTION AND AIMS
13
signi ican ly enhances le hali y e ec s o isola ed Cdx2 de iciency (Ve zi e al. 2010;
Ve zi e al. 2011; S inge e al. 2012). I he e o e ollows ha CDX2 unc ion in he
adul in es ine is mo e i al han ha o CDX1.
The ole o CDX2 s a ed o be es ablished in i o, when i was obse ed ha
o ced exp ession in he undi e en ia ed in es inal cell line IEC-6 a es s p oli e a ion
and ini ializes an epi helial pola i y p og am (Suh and T abe 1996). Cdx2-/- mice
emb yos display p e-implan a ion le hali y and die in u e o be ween emb yonic day
3.5 and 5.5, whe eas he Cdx2+/- mu an s a e iable, bu exhibi skele al anomalies o
s un ed g ow h (Chawengsaksophak e al. 1997; Tamai e al. 1999). C ucial e idence
ha CDX2 unc ions in speci ying in es inal cell a e was ini ially ob ained by
obse ing ha 90% o he he e ozygous mice de elop mul iple polyps wi hin he i s
h ee mon hs o li e, pa icula ly in he p oximal colon. These polyps p esen he
emaining Cdx2 allele inac i a ed and e eal a homeo ic e e sion owa ds an e io
di e en ia ion (Beck e al. 1999). This p ocess o in e cala y egene a ion means ha
local spo adic Cdx2 haploinsu iciency con eys a signal o a pa hway o os al
pheno ype; hence, a g adien o posi ional in o ma ion is obse ed, wi h a eas o
s a i ied squamous epi helium simila o ha seen in he oesophagus, a eas
esembling he gas ic mucosa, and e en a eas eminiscen o he small in es ine.
Wild- ype male hos s wi h Cdx2–/– cells om mu an emale dono s also de elop
chimae ic in es inal pa ches o o gano ypically no mal s omach epi helium (Beck e
al. 2003). O in e es , he unde lying hos s oma concu en ly assumes a gas ic
pheno ype, p o ing ha endode mal exp ession o CDX2 ini ia es
endode mal/mesode mal c oss- alk and is he p ima y signal o gu di e en ia ion,
subsequen ly in ol ing app op ia e eedback loops (S inge e al. 2008). A
complemen a y app oach, elying in ansgenic exp ession o Cdx2 in he s omach,
demons a ed ha CDX2 is su icien o induce in es inal en e ocy es wi h enzyma ic
and abso p i e unc ions in i o (Mu oh e al. 2005b). This is ein o ced by hese mice
being able o su i e o e one mon h a e ex ensi e small bowel esec ion, when
compa ed o he sho se en day li espan o su ge y-con ols.
O he animal models ha e been independen ly epo ed, in which emb yonic
le hali y o Cdx2 abla ion was ci cum en ed by condi ionally a ge ing i s knockou
a pos e io de elopmen al s ages. Pending on empo al es ic ions, his inac i a ion
di e en ially impac s global in es inal mo phology. Ea ly loss esul s in an e io
ans o ma ion o he small in es ine o an oesophageal pheno ype (Gao e al. 2009),
CHAPTER 1. GENERAL INTRODUCTION AND AIMS
CHAPTER 1. GENERAL INTRODUCTION AND AIMS
whe eas
in
la e
induc ion
he
in es ine
shows
a
mo e
gas ic-like
iden i y,
wi h
impai ed endo-lysosomal a icking and ine icien seg ega ion o apico-basal
memb ane domains (Gao and Kaes ne 2010; G ainge e al. 2010). Condi ional
inac i a ion in he al eady adul mice comp omises en e ocy e unc ion, causing
se e e malnu i ion and dea h in abou h ee weeks (Ve zi e al. 2010; Ve zi e al.
2011). A limi ed abla ion s a egy compa ible wi h long- e m su i al has been
applied in his se ing e ealing he p esence o pa ial gas ic-na u e me aplasias
associa ed wi h loss o all di e en ia ed in es inal cell ypes (H yniuk e al. 2012;
S inge e al. 2012). Hence, CDX2 s ands ou as being he mos c i ical elemen in he
de elopmen , di e en ia ion, and main enance o he in es inal pheno ype.
1.2.3 In ol emen in ca cinogenesis
Beyond i s homeo ic unc ion, CDX2 is also in ol ed in p ocesses o
leukemogenesis (Lenge ke and Daley 2012) and GI ca cinogenesis. Con lic ing da a
ega ding he na u e o CDX2 unc ion in umou ini ia ion and de elopmen exis ,
and mos p obably CDX2 assumes di e en oles in dissimila con ex s.
IM and gas ic cance
An associa ion be ween IM and in es inal- ype gas ic ca cinoma has been
p e iously es ablished (Co ea 1992). I is now widely ecognized ha he main
molecula d i e o his p eneoplas ic condi ion is de no o exp ession o CDX2.
Se e al s udies ha e desc ibed he p esence o bo h CDX1 and CDX2 in nea ly all
gas ic IM oci (Bai e al. 2002; Almeida e al. 2003; Kim e al. 2006; Ba os e al. 2008).
Bu p oo o concep suppo ing CDX2 in ol emen in his p ocess was p o ided by
wo ansgenic mouse models achie ing inapp op ia e Cdx2 exp ession in he gas ic
epi helium. These mice de elop IM, cha ac e ized by he p esence o abso p i e,
goble , and en e oendoc ine cell- ypes (Mu oh e al. 2002; Silbe g e al. 2002). One
model e en p og essed o gas ic cance a e long- e m induc ion (Mu oh e al.
2004), ein o cing he implica ion o IM in he genesis o gas ic ca cinoma. Besides
being ec opically exp essed in IM, i has been epea edly demons a ed ha CDX2
exp ession is down egula ed in he p og ession om IM o gas ic cance (abou 50%
a e posi i e), and ha CDX2 posi i i y signi ican ly co ela es wi h a mo e
di e en ia ed (in es inal) his ology and be e p ognosis (Kaimak chie e al. 2004;
15
CHAPTER 1. GENERAL INTRODUCTION AND AIMS
As o he in luence o s omal elemen s, i was obse ed ea ly on ha epi helial-
mesenchymal cellula in e ac ions can di e en ially a ec he exp ession o CDX1
and CDX2 homeobox genes (Duluc e al. 1997). Fo example, di e en componen s
o he basemen memb ane ma ix, which lie a he in e ace o and a e syn hesized
by epi helial and mesenchymal cells, such as Laminin-α1, can posi i ely modula e
CDX2 exp ession (Lo en z e al. 1997). A s imula ion o CDX2 exp ession by
subepi helial colonic myo ib oblas s was also epo ed, media ed by he non-
canonical Wn amily membe WNT5A and he epi helial ecep o ROR2, con ibu ing
o inhibi ion o he canonical Wn signalling
and
in es inal
di e en ia ion (Pacheco
and Macleod 2008).
On
he
o he
hand, collagen ype I induces pheno ypic
changes in CRC cells h ough he β1-in eg in/FAK signalling pa hway ha in ol e
educed Cdx2 p omo e ac i i y and mRNA exp ession (B able z e al. 2004). In
ag eemen wi h his, a model o o ho opic and he e o opic xenog a s in nude mice
demons a ed ha CDX2 exp ession is adap able and s ongly dependen on he
mic oen i onmen (Benahmed e al. 2007).
Pos - ansc ip ional egula ion by mic oRNAs
Due o he absence o CDX2 exp ession in abou hal o he gas ic cance
cases and he e ogeneous loss in CRCs, i was hypo hesized ha mic oRNAs (miRs)
could also be associa ed wi h CDX2 silencing in hese con ex s. Compu a ional
p edic ion o miR-binding si es, using independen da abases, led o he selec ion o
miR-9 and miR-204 as pu a i e candida es o CDX2 egula ion (Ro k ua e al. 2011).
A compa a i e analysis o CDX2 and miR-9 exp ession in a panel o gas ic cance
issues e ealed an o e all in e se co ela ion be ween bo h, and in i o
expe imen al da a, con i med ha miR-9 in e ac s di ec ly and speci ically wi h he
CDX2 3`un ansla ed egion (UTR), leading o down egula ion o CDX2 a ge genes
and p omo ion o cell g ow h. Mo e ecen ly, i was demons a ed ha exogenous
CDX1-induced exp ession o miR-9, miR-16 and miR-22 supp esses CDX2 mRNA by
a ge ing i s 3`UTR in a CRC cell line (Tagawa e al. 2012).
Pos - ansla ional egula ion
Phospho yla ed o ms o p38 MAPKs we e shown o be mos ly e ained in he
nuclei o illus cells, wi h di e en ial p38α kinase ac i i y cons i u ing an ea ly and
necessa y e en o he ini ia ion o he in es inal di e en ia ion p og am (Houde e

CHAPTER 1. GENERAL INTRODUCTION AND AIMS
al. 2001). This s imula o y e ec is accomplished by CDX2 phospho yla ion,
enhancing i s ansc ip ional abili y wi hou in ol emen in he loss o p oli e a i e
po en ial o cell su i al. On he o he hand, phospho yla ion by ERK1/2 MAPKs o
se ine 60 wi hin he amino- e minal ac i a ion domain o CDX2, educes i s
ansc ip ional capabili y and impai s ce ain in es inal di e en ia ion p ope ies
(Rings e al. 2001; Lemieux e al. 2011). This modi ica ion was mainly ound in he
p oli e a ing compa men o he in es ine, while he nonphospho yla ed and mo e
ac i e CDX2 was p edominan ly ound in he di e en ia ed egion, in ag eemen
wi h he localiza ion o pERK1/2 (Aliaga e al. 1999). In addi ion, ac i a ion o he
ERK1/2 MAPK cascade was shown o p omo e ubiqui in-p o easome-dependen
u no e o he CDX2 p o ein (K uege e al. 2009). Two independen s udies ha e
elucida ed
how
CDX2
egula ion
can
be
coo dina ed
wi h
he
cell
cycle
machine y.
I was obse ed ha CDX2 unde goes CRM1-dependen nuclea expo and
subsequen p o eoly ic deg ada ion by in e ac ion wi h CDK2 in p oli e a i e
in es inal cells (Boulange e al. 2005). The CDK2-media ed phospho yla ion o CDX2
was ound o occu downs eam o he homeodomain a se ine 283, iden i ied as
being pa o a conse ed mo i o ou e enly spaced se ines called he 4S mo i ,
simila o he one con olling β-ca enin deg ada ion by he p o easome (G oss e al.
2005). P e en ing phospho yla ion h ough his si e blocked polyubiqui ina ion and
s abilized CDX2, wi h impac on o e all cell beha iou . In conclusion, CDX2 con ains
mul iple phospho yla ion si es ha ei he posi i ely o nega i ely balance i s ac i i y
and/o s abili y in esponse o di e en signalling pa hways, being concei able ha
hei combined ac ion is equi ed o he onse o he comple e di e en ia ion
p ocess.
P esen ly, i is well es ablished ha gene exp ession is egula ed a mul iple
le els, as p e iously demons a ed o CDX2, and ha he di e se p ocesses in ol ed
a e in eg a ed wi hin each o he . T ansc ip ional con ol is one o he mos impo an
s eps wi hin he gene egula ion cascade. Ne e heless, he signi icance o pos -
23
1.3 POST-TRANSCRIPTIONAL REGULATION OF GENE EXPRESSION
CHAPTER 1. GENERAL INTRODUCTION AND AIMS
ansc ip ional con ol is e ol ing, as he abili y o ep og am p o ein syn hesis is a
common heme in emb yonic de elopmen , wound healing, in lamma ion,
me abolic s ess and aging. An o e iew o he main concep s o pos - ansc ip ional
egula ion is p esen ed, ocusing on RNA-binding p o eins (RBPs) and hei oles in
de elopmen and disease.
1.3.1 F om ansc ip s o p o eins
An inc easing numbe o publica ions show ha a poo co ela ion be ween
s eady-s a e ansc ip abundances and co esponding p o ein pools gene ally exis s
in almos e e y o ganism (de Sousa Ab eu e al. 2009; Maie e al. 2009; Vogel e al.
2010). In acco dance, a ecen s udy comp ehensi ely analysed mRNA and p o ein
le els, hal -li es, ansc ip ion and ansla ion a e cons an s o housands o genes in
NIH3T3 mouse ib oblas s, and ound ha mRNA le els only explain a ound 40% o he
a iabili y in p o ein le els (Schwanhäusse e al. 2011).
Whe he
his
exac
pe cen age
is
alid
o
o he
cell ypes is unknown. Thus, i is clea ha a signi ican
ac ion o Euka yo ic gene egula ion is pos - ansc ip ional in na u e.
Pos - ansc ip ional egula ion encompasses RNA p ocessing, localiza ion,
ansla ion and decay, as well as RNA s abili y h oughou . These in e connec ed
mechanisms p o ide complemen a y quali y-con ol laye s ha collec i ely de ine
he a e o e e y ansc ip (Moo e 2005). Adding o he complexi y, RNAs do no
dwell alone in he cell, as hey a e e e accompanied by ans-ac ing ac o s,
namely RBPs and non-coding RNAs, such as miRs, ha bind cis-elemen s usually
p esen in he 3´UTR (Kue s en and Goodwin 2003; Hun zinge and Izau alde 2011).
These a e capable o adjus ing he amoun o gene p oduc mo e apidly, p ecisely
and wi h a ac ical e e sibili y op ion ha ansc ip ional egula ion alone canno
o e . I is his unique esco , hei ela i e posi ions, and in e ac ions ha c ea e a
highly dynamic web o messenge ibonucleop o ein (mRNP) complexes, uling RNA
li e. Indeed, Euka yo ic mRNPs ha e been unc ionally conside ed “pos -
ansc ip ional ope ons” ha ma kedly expand he egula o y elas ici y o ou
su p isingly small genomes (Keene and Tenenbaum 2002; Keene 2007). E idence in
a ou o his en icing RNA ope on model on a genome-wide scale is moun ing, as
s udies show ha disc e e subse s o mRNAs wi h sha ed sequence elemen s and
CHAPTER 1. GENERAL INTRODUCTION AND AIMS
encoding p o eins wi h common unc ions and loca ions a e coo dina ely egula ed
by speci ic mRNPs (Ge be e al. 2004; Hogan e al. 2008).
RNA p ocessing s a s in he nucleus, whe e p ecu so mRNAs acqui e a 7-
me hylguanosine cap s uc u e a he 5' e minus (Lewis and Izau alde 1997), a
specialized poly(A) ail a he 3` end (Mangus e al. 2003), and in ons a e emo ed
by splicing (Ma lin e al. 2005). A majo emodelling in mRNP composi ion occu s as
ma u e mRNAs pass h ough he nuclea -po e complex (Köhle and Hu 2007), wi h
some ac o s emaining s ably associa ed, whe eas o he s a e dynamically eplaced
by cy oplasmic coun e pa s. Upon expo , se e al mRNAs a e in eg a ed in he
ansla ionally ac i e pool, a p ocess ha emodels he p o ein coa and assembles
polysomes. The canonical mechanism o ansla ion is in ica e and in ol es h ee
coo dina ed e en s: ini ia ion, elonga ion and e mina ion (Jackson e al. 2010). On
he o he hand, some mRNAs a e p og ammed o delayed ansla ion, which allows
ansc ip s o be anspo ed o a speci ic subcellula localiza ion o e en s o ed un il
de elopmen al o en i onmen al cues call o hei p o ein syn hesis. These mRNAs
a e packaged in o cy oplasmic mRNP g anules ha lack a limi ing memb ane and
a e isible unde ligh mic oscopy, called p ocessing bodies (P bodies) and s ess
g anules (Ande son and Kede sha 2006).
1.3.2 RNA-binding p o eins and hei biological unc ions
An ex ensi e compu a ional analysis es ablished ha RBPs comp ise 8 o 15% o
he p o ein coding epe oi e in euka yo ic genomes, highligh ing bo h hei ancien
o igin and he impo ance o RNA egula ion in cell unc ion (Anan ha aman e al.
2002). One possible explana ion is ha as highly speci ic p ocesses o ine- une gene
exp ession e ol ed, a concomi an expansion o he numbe o RBPs needed has
occu ed. Fo example, a leas 74% o human genes exp ess mul iple iso o ms by
using di e en exonic combina ions h ough al e na i e splicing (Johnson e al. 2003).
I s eme gence du ing e olu ion d o e he need o a co esponding inc ease in he
numbe o RBPs, and i is also, in i sel , a mechanism by which cells can expand hei
RBP epe oi e.
A subse o hese p o eins ecognizes common ea u es o almos e e y
message, such as he 5`cap o he 3`poly (A) ail. Howe e , he majo i y ha e a
equi emen o a p ima y sequence o ype o seconda y s uc u e in which he
25
CHAPTER 1. GENERAL INTRODUCTION AND AIMS
o me is embedded, ha a e p esen in some mRNAs bu no o he s. Thei speci ici y
is media ed by unique s uc u al a angemen s o indi idual RNA-binding domains
whose p ope ies a e u he mode a ed by auxilia y domains. This p ope y, coined
as “coope a i e modula i y”, accommoda es di e en unc ionali ies and allows o
eno mous combina o ial po en ial, u he inc easing a ini y owa ds RNA (Lunde e
al. 2007). To da e, mo e han 40 di e en binding domains ha e been p oposed,
being he mos equen he RNA ecogni ion mo i . O he common classes include
he K-homology (KH) domain, zinc- inge s o he CCCH and CCHC ype, and he
double-s anded RNA-binding domain.
RBPs capaci y o i ually egula e e e y aspec o RNA biogenesis and unc ion
is ema kable. In ac , hey play pi o al oles du ing emb yonic de elopmen
(Kue s en and Goodwin 2003), and in a b ea h o se e al homeos a ic p ocesses
such as synap ic plas ici y (Luo e al. 2010), immune esponses (Ande son 2008),
epi helial cell p oli e a ion (Yang e al. 2011), di e en ia ion (Yang e al. 2010) and
pola i y (Nagaoka e al. 2012). Wi h inc easing knowledge on hei impo ance, he
mo e appa en i becomes ha ampe ing wi h RBPs exp ession o unc ion unde lies
he onse o se e al pa hological condi ions, including cance (Lukong e al. 2008).
Membe s o he signal ansduc ion and ac i a ion o RNA (STAR) amily o RBPs play
i al oles in cell p oli e a ion and di e en ia ion. SAM68, o ins ance, is
o e exp essed in b eas (Lukong e al. 2005) and p os a e cance cells (Busà e al.
2007). On he con a y, Quaking (QKI) seems o unc ion as a umou supp esso in
CRCs (Yang e al. 2010) and glioblas omas (Chen e al. 2012).
Membe s o an e olu iona ily-conse ed amily o RBPs, he MEX-3 amily, a e
eme ging as impo an pos - ansc ip ional egula o s o se e al cellula p ocesses in
di e se physiological se ings. Thei unc ions and unde lying molecula mechanisms,
pa icula ly well-known o he ances al mex-3 in he model o ganism
Caeno habdi is elegans, a e now desc ibed.
1.4 THE MEX-3 FAMILY OF RNA-BINDING PROTEINS
CHAPTER 1. GENERAL INTRODUCTION AND AIMS
1.4.1 Caeno habdi is elegans MEX-3
In he wo m emb yo, no mal de elopmen equi es p ecise spa ial and
empo al exp ession pa e ns o ma e nal mRNAs, such as he an e io ly localized
memb ane ecep o glp-1 and he pos e io ly localized ansc ip ion ac o pal-1, he
D osophila no ch and cad o hologues, espec i ely (E ans and Hun e 2005). The
co ec dis ibu ion o hese messages ha ac o di ec lineage-speci ic
commi men pa e ns om indi idual blas ome es, is de e mined by pa i ioning-
de ec i e (pa ) genes, which a e equi ed o es ablish pola i y and whose dis up ion
cause he ea lies and mos ex ensi e emb yonic abno mali ies (Kemphues e al.
1988; Golds ein and Maca a 2007). Molecula e idence places C. elegans MEX-3
amid bo h classes, an in e media e egula o o cell a e de e minan s unde pa -
dependen con ol, hus ac ing as a c i ical componen in he link be ween cell
pola i y and asymme ic gene exp ession (Huang e al. 2002).
mex-3 gene encodes a p o ein wi h wo se en y-amino acid egions ha a e
40% iden ical o each o he . The epea ed sequences co espond o pu a i e RNA-
binding mo i s, ini ially iden i ied in he p e-mRNA-binding he e ogeneous nuclea
ibonucleop o ein (hnRNP) K and named KH domains (Siomi e al. 1993). MEX-3
in e ac s wi h a minimal MEX-3 ecogni ion elemen (MRE), de ined as he
degene a e consensus sequence (A/G/U)(G/U)AGN(0-8)U(U/A/C)UA (Pagano e al.
2009). Mu a ions dis up ing he mex-3 locus a e ully pene an , ecessi e, s ic
ma e nal-e ec and emb yonically le hal, esul ing in emb yos ha abno mally
gene a e body-wall muscle om he an e io blas ome e (AB), hence he name mex
o “muscle excess” (D ape e al. 1996). This homeo ic ans o ma ion is due, in pa ,
o he unc ion MEX-3 exe s o e he ansc ip ion ac o pal-1, he o hologue o
CDX genes in mammals, and he soma ic de e minan o pos e io iden i y (Hun e
and Kenyon 1996). mex-3 mRNA and p o ein accumula e cy oplasmically and a e
une enly dis ibu ed in ea ly emb yos (D ape e al. 1996). A e e iliza ion
and
be ween
he
wo
and
ou -cell
s age,
MEX-3
is
p e e en ially
localized
o
he
AB
lineage,
disappea ing
a e wa ds
in
a
pa e n
simila
o
ha
desc ibed
o
o he
ma e nal mRNAs (Seydoux and Fi e 1994). On he o he hand, while pal-1 mRNA is
p esen h oughou he ea ly emb yo, PAL-1 p o ein is asymme ically localized and
only de ec ed om he ou -cell s age onwa ds in descendan s o he pos e io (P1)
blas ome e lineage, hus co ela ing wi h low MEX-3 le els (Figu e 3A). In
acco dance, PAL-1 is ec opically exp essed in all cells o mex-3 mu an emb yos and
27

CHAPTER 1. GENERAL INTRODUCTION AND AIMS
MEX-3 has been shown o ep ess ansla ion o a lacZ RNA epo e cons uc
con aining he pal-1 3`UTR in an e io blas ome es (Hun e and Kenyon 1996).
The e o e, MEX-3 plays a c ucial ole as a ansla ional ep esso o pal-1, speci ying
p ope blas ome e iden i y du ing ea ly emb yogenesis.
Pos - ansc ip ional egula ion o ma e nal RNAs is also a p ima y mechanism o
con ol gene exp ession in C. elegans ge mline, and MEX-3 con ibu es o he
main enance o ge m cell o ipo ency in he adul wo m (Ciosk e al. 2006). The
he maph odi e ge mline is a highly dynamic o gan p esen ing a s e eo ypical
o ganiza ion o game es commi men : he mos dis al end o he gonad is a
p oli e a i e compa men con aining mi o ic cells ha p og essi ely en e meiosis in
a cen al syncy ial egion. Spon aneous ge m cell dea h by apop osis o
di e en ia ion in o spe m cells (la e L4 la al s age) and oocy es (adul hood) occu s
in he p oximal gonad. Swi ches be ween hese di e en s ages in ol e spa ially non-
o e lapping ansla ional egula ion o
a ge
mRNAs
by
he
RBPs
de ec i e
in
ge mline
de elopmen
(GLD-1)
and
MEX-3 (Lee and Schedl 2001; Moo z e al.
2004)
(Figu e 3B).
In
ma u ing
oocy es,
MEX-3
also media es pal-1 inhibi ion;
combined wi h GLD-1 ac ion, his ensu es ha emb yos do no inhe i ma e nal PAL-1
p o ein and de elop p ope ly (D ape e al. 1996; Moo z e al. 2004). In acco dance,
double mu an s ains o mex-3 and gld-1 de elop a ge mline umou con aining
nume ous cells o muscula , neu onal and in es inal na u e, eminiscen o human
CHAPTER 1. GENERAL INTRODUCTION AND AIMS
e a omas (Ciosk e al. 2006). This ge m cell ansdi e en ia ion seems o be he end
esul o an abno mal exp ession o soma ic de e minan s such as PAL-1.
1.4.2 The mammalian MEX3 p o eins
C. elegans mex-3 was iden i ied and cha ac e ized in humans as a amily o
ou homologous genes called MEX3A o MEX3D (Buche -Poyau e al. 2007). These
a e loca ed a ch omosomic posi ions 1q22, 15q25.2, 18q21.2 and 19p13.3,
espec i ely, and a e composed o wo exons and one in on. The closely ela ed
encoded p o eins con ain wo andemly epea ed KH domains ha pu a i ely
p o ide RNA-binding p ope ies. Addi ionally, hey possess a ca boxy- e minal eally
in e es ing new gene (RING) inge module, no p esen in he nema ode MEX-3 and
belie ed o media e p o ein-p o ein in e ac ions. Fou mouse o hologues we e also
iden i ied displaying s ong simila i y a he amino acid le el o hei human
coun e pa s. Fo hese cha ac e is ics hey a e also known as RING inge and KH
domain-con aining (RKHD) p o eins.
Exp ession analysis o he MEX3 ansc ip s in di e en human issues showed
ha MEX3D is ubiqui ous, while he o he s ha e a a ied exp ession pa e n, wi h he
highes le el ound in e al b ain and es is (Buche -Poyau e al. 2007).
O e exp ession expe imen s demons a ed ha MEX3 a e phosphop o eins ha
shu le be ween he nucleus and he cy oplasm by he CRM1-dependen expo
pa hway and ia an N- e minally loca ed expo signal. Con ocal mic oscopy
analysis e ealed co-localiza ion o MEX3A and MEX3B wi h DCP1A and AGO amily
membe s, being he la e ca aly ic componen s o he RNA-induced silencing
complex (RISC), he key e ec o o miR and RNA in e e ence (RNAi) pa hways. This
associa ion was es ic ed o P bodies, which a e known si es o mRNA u no e
(Eulalio e al. 2007). These esul s oge he wi h he abili y o MEX3 p o eins o in e ac
in i o wi h poly(A) ibonucleo ide homopolyme s and ce ain cellula mRNAs,
indica e ha MEX3 p o eins cons i u e no el human RBPs po en ially in ol ed in pos -
ansc ip ional egula o y ne wo ks (Donnini e al. 2004; Buche -Poyau e al. 2007;
Cou che e al. 2008). Ne e heless, he speci ic biological ole o each membe was
basically unknown du ing he cou se o his wo k, and only ecen ly s a ed o be
explo ed in mo e de ail.
29
CHAPTER 1. GENERAL INTRODUCTION AND AIMS
The homeobox ansc ip ion ac o CDX2 is de e minan o p ope emb yonic
de elopmen , as well as o endode mal induc ion and adul main enance o he
in es inal epi helium. Besides his homeos a ic unc ion, in i o expe imen s, animal
models and human lesions show ha de no o exp ession o CDX2 is associa ed wi h
ec opic oci o in es inal di e en ia ion, which in u n con eys an inc eased isk o
cance de elopmen . A pa adigma ic example o his link is p o ided by gas ic IM,
a lesion ha encompasses a issue adap i e esponse o H. pylo i in ec ion and
subsequen ch onic in lamma o y eac ion. The ole o bac e ial e adica ion as a
common p e en i e s a egy agains gas ic cance de elopmen emains
deba able and la gely dependen on he ex en o p eneoplas ic changes a he
ime o ea men , gi en he appa en s abili y o he CDX2-dependen IM
pheno ype. Mo eo e , he na u e o CDX2 in ol emen in he es ablishmen and/o
p og ession o CRC is a om being consensual. Ea ly da a sugges ed ha loss o
CDX2 was a common e en ; howe e , ensuing s udies ha e shown ha i s exp ession
is e ained and in some cases e en inc eased. The e o e, de ining a ho ough
po ayal o he CDX2 egula o y ne wo k s ands ou as a leading in es iga ion
p io i y, no only o ad ance i s speci ic con ibu ion o hese ca cinogenic
p ocesses, bu mos impo an ly o apply he acqui ed knowledge in he design o
al e na i e and pe haps mo e a ge -o ien ed he apeu ic s a egies.
The p esen wo k, amed wi hin he abo emen ioned concep ions, in ends o
unco e new molecula mechanisms o CDX2 egula ion ocusing on he ole o ye
poo ly-desc ibed mic oen i onmen al in luences as a esea ch guiding line. In his
ega d, he ollowing speci ic objec i es a e p oposed:
1. E alua e i me hyla ion a he p omo e le el is a mechanism in ol ed in he
egula ion o CDX2 gene exp ession
DNA me hyla ion is an epigene ic mechanism o ansc ip ional egula ion and
a di ec measu e o he en i onmen al e ec o e he genome, wi h an in ol emen
in cance a ibu ed o he inapp op ia e silencing o umou supp esso genes
(hype me hyla ion), o loss o oncogene ep ession (hypome hyla ion).
P e ious s udies epo ed ha he me hyla ion s a us o CDX2 migh ha e a
ele an egula o y ole in di e en con ex s. Bu hey p esen disc epancies, bo h
conce ning he egion o que y and he me hods employed o analyse i . The lack o
1.5 LONG-TERM GOAL AND SPECIFIC AIMS
CHAPTER 1. GENERAL INTRODUCTION AND AIMS
a comp ehensi e analysis
led
us
o
e alua e
i
me hyla ion
a
he
p omo e
le el
could
be
a
mechanism in ol ed in he egula ion o CDX2 exp ession, and he
ob ained esul s a e p esen ed in Chap e 2. We hypo hesized ha in in es ine, whe e
CDX2 is exp essed, he gene would be unme hyla ed, while in he no mal gas ic
mucosa, whe e CDX2 is no de ec ed, he gene would be me hyla ed. The p ocess
o H. pylo i in ec ion and accompanying in lamma o y esponse would in some way
be esponsible o p omo e deme hyla ion, cons i u ing he igge ing e en leading
o he de elopmen o IM. The al e a ion in CDX2 me hyla ion p o ile along he
gas ic ca cinogenic p ocess would cons i u e a p oo o concep , undoub edly
es ablishing he ele ance o his mechanism and con ibu ing o se le a con en ious
ques ion in he ield.
2. Assess he ole o cell-ma ix in e ac ions in he egula ion o CDX2
exp ession
Fo many yea s now, adi ional me hods o cell cul u e ha e p oduced
impo an concep ual ad ances in cance esea ch. Ne e heless, cells g own on
la subs a es can di e conside ably in hei mo phology, di e en ia ion, cell-cell
and cell-ma ix in e ac ions om hose g owing in mo e physiological condi ions. A
he o he end o he spec um we ha e whole-animal models, which equen ly
co obo a e he impo ance o pa icula p ocesses. Bu hese a e complex,
expensi e and no easily manipula ed. By mimicking ea u es o he in i o
mic oen i onmen and aking ad an age o he same ools used o s udy cells in
s anda d cul u e, 3D cell/ issue models ha e been b idging he gap be ween bo h,
p o iding unique pe spec i es on he beha iou o s em cells, epi helial issues and
umou s.
Ea lie publica ions desc ibed he ole o epi helial-mesenchymal in e ac ions as
de e minan o he exp ession o CDX2, no only o p ope spa io- empo al
induc ion o in es inal di e en ia ion, bu also in modula ing i s le els du ing
ca cinogenesis. Howe e , he di ec molecula media o s esponsible o his
adap able esponse emained o he mos pa elusi e. In Chap e 3, we p esen
esul s ega ding he es ablishmen o in i o 3D cell cul u e models comp ising
gas ic cance cell lines and an ex acellula ma ix. We hypo hesized ha his
app oach, explo a o y in na u e, would allow pinpoin ing egula o y ac o s and
signalling pa hways in ol ed in he con ol o CDX2 exp ession.
31
CHAPTER 2. CDX2 PROMOTER METHYLATION
1740
PEREIRA ET AL.
F
IGURE
1 – Me hyla ion s a us o CDX2 in a panel o human gas ic cance cell lines and unc ional ela ion wi h CDX2 mRNA exp ession.
(a) Schema ic ep esen a ion o he 5`p oximal lanking egion o CDX2 gene. Thin e ical lines ma k he loca ion o CpG dinucleo ides. A
box indica es he i s exon, including non-coding (whi e) and coding (black) sequences. Two pu a i e CpG islands we e iden i ied wi h he
online bioin o ma ic ool CpGPlo (www.ebi.ac.uk/ ools/emboss/cpgplo ), one in he p omo e egion (–1603bp o –1197bp) and ano he in he
i s exon, including he coding egion (–22bp o +660bp). A ow-heads indica e he posi ion o bisul i e speci ic p ime s. (b) RT-PCR analysis
o CDX2 mRNA exp ession in gas ic cance cell lines. GAPDH mRNA exp ession was used as an in e nal loading con ol and NTC indica es
no empla e con ol. (c) Me hyla ion p o ile o CDX2 in gas ic cance cell lines ob ained by di ec sequencing o bisul i e- ea ed genomic
DNA. M, me hyla ed; U, unme hyla ed. (d) Real- ime PCR o CDX2 exp ession in human gas ic cance cell lines a e ea men wi h he
deme hyla ing agen 5-aza-2`-deoxycy idine (5azaDc, Sigma) du ing di e en ime-poin s. Each expe imen was ca ied ou in iplica e a leas
wice; he esul s a e exp essed as mean
±
SD o biological eplicas. The alues ob ained wi h ehicle- ea ed cells we e e e ed o as 1. CDX2
mRNA le els we e no malized wi h he co esponding 18S RNA le els.

CHAPTER 2. CDX2 PROMOTER METHYLATION
CDX2 PROMOTER METHYLATION AND mRNA EXPRESSION 1741
F
IGURE
2 – Bisul i e DNA sequencing o he i s and second agmen s o CDX2 CpG island 2 in wo specimens o he gas ic mucosa and ad-
jacen IM oci (S1 and S2) and in wo specimens o no mal colonic mucosa (S3 and S4). Only clea ly iden i iable no mal gas ic glands and
me aplas ic glands we e selec ed using a PALM Mic obeam Mic oscope (Zeiss). Wi h his me hodology we we e able o minimize s omal cell
con amina ion in ou issue samples. PCR amplicons om he issues we e cloned in o pCR4-TOPO ec o using he TOPO TA Cloning ki
(In i ogen), and a leas i e indi idual clones om each sample we e sequenced using he ABI P ism BigDye Te mina o 3.1 Cycle Sequenc-
ing ki (Applied Biosys ems) wi h a e e se M13 p ime . Each ho izon al ow o ci cles ep esen s analysis in a single clone o bisul i e- ea ed
DNA o he 42 CpG si es con ained in he men ioned egion. Solid and open ci cles ep esen me hyla ed and unme hyla ed CpG si es, espec-
i ely.
39
CHAPTER 2. CDX2 PROMOTER METHYLATION
1742
PEREIRA ET AL.
Re e ences
1.
Yuasa Y, Nagasaki H, Akiyama Y, Hashimo o Y, Takizawa T,
Kojima K, Kawano T, Sugiha a K, Imai K, Nakachi K. DNA me hyla-
ion s a us is in e sely co ela ed wi h g een ea in ake and physical
ac i i y in gas ic cance pa ien s. In J Cance 2009;124:2677–82.
2.
Almeida R, Sil a E, San os-Sil a F, Silbe g DG, Wang J, De Bol'os C,
Da id L. Exp ession o in es ine-speci ic ansc ip ion ac o s. CDX1
and CDX2, in in es inal me aplasia and gas ic ca cinomas. J Pa hol
2003;199:36–40.
3.
Mesqui a P, Raquel A, Nuno L, Reis CA, Sil a LF, Se pa J, an Seu-
ningen I, Ba os H, Da id L. Me aplasia—a ansdi e en ia ion p o-
cess ha acili a es cance de elopmen : he model o gas ic in es i-
nal me aplasia. C i Re Oncog 2006;12:3–26.
4.
Guo M, House MG, Suzuki H, Ye Y, B ock MV, Lu F, Liu Z, Rus gi
AK, He man JG. Epigene ic silencing o CDX2 is a ea u e o squa-
mous esophageal cance . In J Cance 2007;121:1219–26.
5.
Yuasa Y, Nagasaki H, Akiyama Y, Sakai H, Nakajima T, Ohku a Y,
Takizawa T, Koike M, Tani M, Iwai T, Sugiha a K, Imai K, e al.
Rela ionship be ween CDX2 gene me hyla ion and die a y ac o s in
gas ic cance pa ien s. Ca cinogenesis 2005;26:193–200.
6.
Kawai H, Tomii K, Toyooka S, Yano M, Mu akami M, Tsukuda K,
Shimizu N. P omo e me hyla ion down egula es CDX2 exp ession in
colo ec al ca cinomas. Oncol Rep 2005;13:547–51.
7.
Liu T, Zhang X, So CK, Wang S, Wang P, Yan L, Mye s R, Chen Z,
Pa e son AP, Yang CS, Chen X. Regula ion o Cdx2 exp ession by
p omo e me hyla ion, and e ec s o Cdx2 ans ec ion on mo phol-
ogy and gene exp ession o human esophageal epi helial cells. Ca ci-
nogenesis 2007;28:488–96.
8.
Fujii S, Ochiai A. Enhance o zes e homolog 2 down egula es E-cad-
he in by media ing his one H3 me hyla ion in gas ic cance cells.
Cance Sci 2008;99:738–46.
41
43
CDX2 pos - ansc ip ional egula ion
by he RNA-binding p o ein MEX3A
Chap e 3

CHAPTER 3. CDX2 POST-TRANSCRIPTIONAL REGULATION BY THE RNA-BINDING PROTEIN MEX3A
The esul s conce ning his chap e a e published in:
Pe ei a B, Sousa S, Ba os R, Ca e o L, Oli ei a P, Oli ei a C, Cha ie NT, Pla e o i M,
Rouaul JP, F eund JN, Billaud M, Almeida R. (2013) CDX2 egula ion by he RNA-
binding p o ein MEX3A: impac on in es inal di e en ia ion and s emness. Nucleic
Acids Resea ch, 41(7):3986-3999
doi: 10.1093/na /gk 087
This wo k was suppo ed by Fundação pa a a Ciência e a Tecnologia (FCT) –
P og ama Ope acional Ciência e Ino ação 2010 do Quad o Comuni á io de Apoio
III and FEDER [PTDC/SAU-OBD/64490/2006].
__________________________________________________________________________________
The au ho decla es ha he pe o med and/o was in ol ed in all he expe imen al
wo k, pa icipa ed in he s udy design and w o e he manusc ip . Mic oa ay
expe imen s we e conduc ed a NFDM (Na ional Facili y o DNA Mic oa ays,
Uni e sidade de A ei o, Po ugal) and 3D cell cys assays a Ins i u Albe Bonnio
(INSERM-UJF U823, G enoble, F ance).
CHAPTER 3. CDX2 POST-TRANSCRIPTIONAL REGULATION BY THE RNA-BINDING PROTEIN MEX3A
3986–3999 Nucleic Acids Resea ch, 2013, Vol. 41, No. 7 Published online 13 Feb ua y 2013
doi:10.1093/na /gk 087
CDX2 egula ion by he RNA-binding p o ein
MEX3A: impac on in es inal di e en ia ion
and s emness
B uno Pe ei a
1
, So ia Sousa
1
, Ri a Ba os
1
, Lau a Ca e o
2
, Pa ícia Oli ei a
1
,
Ca la Oli ei a
1,3
, Nicolas T. Cha ie
4
, Michelina Pla e o i
5
, Jean-Pie e Rouaul
6
,
Jean-Noël F eund
7
, Ma c Billaud
4
and Raquel Almeida
1,3,
*
1IPATIMUP – Ins i u e o Molecula Pa hology and Immunology o he Uni e si y o Po o, 4200-465 Po o,
Po ugal, 2Depa men o Biology and CESAM, RNA Biology Labo a o y, Uni e si y o A ei o, 3810-193 A ei o,
Po ugal, 3FMUP – Facul y o Medicine, Uni e si y o Po o, 4200-319 Po o, Po ugal, 4INSERM-UJF U823,
Ins i u
Albe Bonnio , BP 170, 38042 G enoble Cedex 9, F ance, 5Cen e de Géné ique e de Physiologie
Moléculai e e
Cellulai e, Uni e si é Claude Be na d Lyon 1, UMR5534, 69622 Villeu banne, F ance, 6Ins i u de Génomique
Fonc ionnelle de Lyon, UMR5242 CNRS/INRA/UCBL/ENS Ecole No male Supé ieu e de Lyon, 69364 Lyon Cedex
07, F ance and 7INSERM UMR_S1113, Uni e si é de S asbou g, Fédé a ion de Médecine T ansla ionnelle,
67200 S asbou g, F ance
Recei ed No embe 5, 2012; Re ised Janua y 22, 2013; Accep ed Janua y 23, 2013
ABSTRACT
The homeobox ansc ip ion ac o CDX2 plays a
c ucial ole in in es inal cell a e speci ica ion, bo h
du ing no mal de elopmen and in umo igenic
p ocesses in ol ing in es inal ep og amming. The
CDX2 egula o y ne wo k is in ica e, bu i has no
ye been ully unco e ed. Th ough genome-wide
sc eening o a 3D cul u e sys em, he RNA-binding
p o ein MEX3A was iden i ied as pu a i ely in ol ed
in CDX2 egula ion; he e o e, i s biological ele-
ance was add essed by se ing up cell-based
assays oge he wi h exp ession s udies in mu ine
in es ine. We demons a e he e ha MEX3A has a
ep essi e unc ion by con olling CDX2 le els in
gas ic and colo ec al cellula models. This is
dependen on he in e ac ion wi h a speci ic
binding de e minan p esen in CDX2 mRNA
3`un ansla ed egion. We ha e u he de e mined
ha MEX3A impai s in es inal di e en ia ion and
cellula pola iza ion, a ec s cell cycle p og ession
and p omo es inc eased exp ession o in es inal
s em cell ma ke s, namely LGR5, BMI1 and MSI1.
Finally, we show ha MEX3A is exp essed in
mouse in es ine,
suppo ing an in i o con ex o
in e ac ion wi h CDX2 and modula ion o s em cell
p ope ies. The e o e, we desc ibe a no el CDX2
pos - ansc ip ional egula o y mechanism,
h ough he RNA-binding p o ein MEX3A, wi h a
majo impac in in es inal di e en ia ion, pola i y
and s emness, likely con ibu ing o in es inal
homeos asis and ca cinogenesis.
INTRODUCTION
The homeodomain ansc ip ion ac o CDX2 is a c i ical
de e minan o in es inal homeos asis, bo h du ing de el-
opmen and h oughou adul li e. CDX2 is in ol ed in
he an e o-pos e io pa e ning o he mammalian emb yo
and is he key molecula media o o in es inal di e en i-
a ion (1–4). Fu he mo e, mul iple e idences subs an ia e
CDX2 c ucial ole in ca cinogenesis o he diges i e ac .
I was shown o inhibi cell g ow h and mig a ion in i o
as well as dissemina ion o colon umou cells in i o (5).
CDX2 he e ogeneous loss has also been obse ed in colo-
ec al ca cinomas (CRCs), pa icula ly in in asi e cells
a he umou edge (6). Mo eo e , CDX2 educ ion
inc eases he p og ession o chemically induced CRCs
(7). Con e sely, unde ce ain pa hological condi ions,
CDX2 becomes abno mally exp essed in o he o gans o
he diges i e ac besides in es ine, namely he esophagus
*To whom co espondence should be add essed. Tel: +351 2255 70700; Fax: +351 2255 70799; Email: almeida@ipa imup.p
P esen add ess:
Sofia Sousa, School o Pha macy, Facul y o Heal h Sciences, Uni e si y o Eas e n Finland, Yliopis on an a 1 C, FIN-70211 Kuopio, Finland.
©
The Au ho (s) 2013. Published by Ox o d Uni e si y P ess.
This is an Open Access a icle dis ibu ed unde he e ms o he C ea i e Commons A ibu ion Non-Comme cial License (h p://c ea i ecommons.o g/licenses/
by-nc/3.0/), which pe mi s un es ic ed non-comme cial use, dis ibu ion, and ep oduc ion in any medium, p o ided he o iginal wo k is p ope ly ci ed.
45
CHAPTER 3. CDX2 POST-TRANSCRIPTIONAL REGULATION BY THE RNA-BINDING PROTEIN MEX3A
Nucleic Acids Resea ch, 2013, Vol. 41, No. 7 3987
(8) and s omach (9,10), d i ing a p ecance ous lesion
known as in es inal me aplasia, a p ocess confi med in
ansgenic mouse models (11,12).
Owing o he essen ial unc ion in in es inal
de elopmen , di e en ia ion and ca cinogenesis, CDX2
egula ion has been ex ensi ely s udied. We ha e p e iously
iden ified di e en mechanisms in ol ed in he an-
sc ip ional egula ion o his gene such as he Bone
mo phogene ic p o ein (BMP) pa hway (13), SOX2 (14)
and a CDX2 au o egula o y loop (15). Se e al ansc ip ion
ac o s including HNF4a, GATA6, TCF4 and
β-ca enin we e shown o in e ac wi h Cdx2 p omo e
agmen s (16). Howe e , mu a ions a he CDX2 locus
a e a a e e en in CRC (17), and i s exp ession does
no depend on me hyla ion o he p oximal p omo e
(18). On he o he hand, CDX2 p o ein phospho yla ion
has also been shown o modi y i s ac i i y in in es inal
cells (19,20). These and o he s udies suppo he no ion
ha CDX2 egula ion is in ica e and s ic ly con olled.
Du ing he pas wo decades, pos - ansc ip ional egu-
la ion eme ged as a undamen al mechanism guiding gene
exp ession in highe euka yo ic cells, being a he co e o
no mal cellula p ocesses bu also cance ini ia ion and
de elopmen . I is now inc easingly clea ha RNA ma u -
a ion, localiza ion, ansla ion and s abili y p o ide
mul iple laye s o spa io- empo al con ol de e mining a
ansc ip ’s a e (21,22). These coupled e en s a e gene ally
dependen on he coope a ion be ween cis- egula o y
elemen s and ans-ac ing ac o s, such as non-coding
RNAs and RNA-binding p o eins (RBPs). RBPs ha e
been implica ed in i ually e e y aspec o RNA me abol-
ism (22,23), pa icula ly, hei ep essi e ole is c i ical o
es ablish p ecise ansla ional pa e ns ha define de elop-
men al and di e en ia ion swi ches in many o ganisms.
In Caeno habdi is elegans, MEX-3 is a ansla ional
ep esso ha egula es blas ome e iden i y du ing ea ly
emb yogenesis (24) and ge mline o ipo ency in he adul
wo m (25). MEX-3 has wo K homology domains, which
a e conse ed single-s anded RNA-binding mo i s (26).
Mu a ions dis up ing mex-3 locus a e le hal, esul ing in
emb yos ha inapp op ia ely gene a e body-wall muscle
om he an e io blas ome e; hence, he name mex o
‘muscle excess’. This is specified, in pa , by he ep essi e
unc ion ha MEX-3 exe s o e he ansc ip ion ac o
pal-1, he C. elegans o hologue o caudal in D osophila
and CDX in mammals (24,27). In humans, mex-3 was
iden ified and cha ac e ized as ou homologous genes,
MEX3A–D (28,29), whose biological ele ance is s a ing
o be explo ed. Recen ly, he unc ional ole o MEX3C
as a RNA-binding ubiqui in E3 ligase was es ablished,
media ing he pos - ansc ip ional decay o HLA-A
allo ypes (30). I was also shown o be necessa y o
no mal pos na al g ow h in mu an mice by enhancing
he local exp ession o insulin-like g ow h ac o 1 in
bone (31) and appea s o be in ol ed in me abolic
egula ion o ene gy balance (32), h ough ye unknown
e ec o s. A a ian o m o MEX3D called TINO was
shown o nega i ely egula e he an iapop o ic p o ein
BCL-2 in HeLa cells (33). Finally, knockdown o
MEX3A by siRNAs was shown o supp ess cell p oli e -
a ion and mig a ion in human gas ic cance cells, bu he
molecula mechanisms behind hese findings we e no ad-
d essed (34). Pu suing he aim o unco e ing new CDX2
egula o y mechanisms, we explo ed a pu a i e ansla-
ional ep ession by MEX3A, which was in e sely
co ela ed wi h CDX2 in a 3D expe imen al model. By
s udying MEX3A exp ession in i o and using a cell
line-based app oach o modula e i s le els in i o, ou
s udy desc ibes a no el pos - ansc ip ional p ocess by
which CDX2 exp ession is impai ed in he gas oin es inal
se ing and in es inal-like homeos asis comp omised,
h ough al e a ions in di e en ia ion, pola i y and
s emness ea u es. Ano he laye o con ol is hus added
o he complex CDX2 egula o y ne wo k, in ol ing
MEX3A as a key egula o o in es inal homeos asis,
which migh ha e significan implica ions o gas oin es-
inal ca cinogenesis.
MATERIALS AND METHODS
Cell cul u e and ea men s
Human gas ic ca cinoma cell line AGS (ATCC,
Ame ican Type Cul u e Collec ion) and CRC cell line
Caco-2 (ATCC) we e cul u ed unde s anda d condi ions
in RPMI-1640 medium and Dulbecco’s modified Eagle’s
medium, espec i ely, con aining 10% e al bo ine se um,
100 U/ml o penicillin and 100 µg/ml o s ep omycin (Li e
Technologies). Fo he AGS 3D cul u e, flasks we e
coa ed wi h 50 µl/cm2 o ma igel basemen memb ane
(BD Biosciences) a a 1.5:1 p opo ion o se um- ee
medium. A 2 x 104 cells/cm2 suspension was seeded on
op and main ained o 14 days wi h medium change
e e y 2 days. Fo he Caco-2 3D cul u e, co e slips we e
coa ed wi h 60 µl/cm2 o ma igel. A 6 x 103 cells/cm2
suspension plus 2% ma igel was seeded on op and main-
ained o 8 days wi h medium change e e y 2 days.
To quan i y lumen o ma ion, >100 cys s we e mic oscop-
ically examined. Fo p o easome inhibi ion, cells we e
ea ed wi h 25 µM MG132 (Calbiochem) o ehicle
ea ed wi h DMSO. To inhibi ansc ip ion, cells we e
exposed o 10 µg/ml o Ac inomycin D (Sigma).
Cons uc s and si e-di ec ed mu agenesis
The p e iously published pCMV-MEX3A exp ession
ec o (28) was used oge he wi h a pCMV-Tag3B
emp y ec o (Agilen Technologies) in ans ec ions.
A pRLCon ol cons uc con aining a humanized Renilla
luci e ase (Rluc) coding sequence (35) was used as a
backbone o c ea e he pRLCDX2 ec o , encoding a
luci e ase usion ansc ip o he pa en al CDX2
3`un ansla ed egion (UTR). The QuickChange si e-
di ec ed mu agenesis ki (S a agene) was hen used o
in oduce specific mu a ions in he p e ious plasmid, o
gene a e he pRL∆CDX2 cons uc , wi h a mu a ed
MEX-3 ecogni ion elemen (MRE). Oligonucleo ides
con aining he desi ed mu a ions we e designed acco ding
o he manu ac u e ’s ins uc ions (Supplemen a y Table
S1). Taking in o accoun he degene a e consensus
sequence desc ibed o MEX-3 binding in C. elegans, a
mu a ional backg ound o Cy idine was used because p e-
sumably his base is no ole a ed in he MRE (36).
Nucleic Acids Resea ch, 2013, Vol. 41, No. 7 3987
3988 Nucleic Acids Resea ch, 2013, Vol. 41, No. 7
CHAPTER 3. CDX2 POST-TRANSCRIPTIONAL REGULATION BY THE RNA-BINDING PROTEIN MEX3A
T ans ec ions, RNAi and luci e ase assays
T ansien ans ec ions we e done using Lipo ec amine
2000 eagen acco ding o he manu ac u e ’s guidelines
(Li e Technologies). A DNA (µg) o Lipo ec amine 2000
eagen (µl) a io o 1:1.5 in OPTI-MEM medium was
used o ou ine ans ec ion expe imen s o exp ession
ec o s. Fo s able ans ec ions, selec ion was ini ia ed
48h pos - ans ec ion in medium supplemen ed wi h
0.6 mg/ml o G418 (Sigma). Neomycin- esis an posi i e
clones ob ained h ough limi ing dilu ion we e ou inely
main ained wi h 0.2 mg/ml o G418. A comme cial se o
h ee S eal h Selec siRNA duplexes (HSS150674,
HSS150675 and HSS150676) di ec ed agains human
MEX3A (Li e Technologies) and a cus om se o h ee
siRNA duplexes di ec ed agains CDX2 we e used wi h
sc ambled con ols. An siRNA duplexes (pmol) o
Lipo ec amine 2000 eagen (µl) a io o 20:1 in OPTI-
MEM medium was used o inhibi ion expe imen s.
Luci e ase epo e assays we e pe o med wi h he Rluc
Assay Sys em (P omega), and β-galac osidase ac i i y was
used o no maliza ion o expe imen al a ia ions.
RNA isola ion and quan i a i e eal- ime PCR
To al RNA was ex ac ed using TRI Reagen (Sigma) and
e e se ansc ibed using he Supe sc ip II Re e se
T ansc ip ase ki (Li e Technologies). Analysis o BMI1,
CDX2, GAPDH, LGR5, MEX3A and Rluc mRNA
exp ession was pe o med in an ABI P ism 7500 sys em
using SYBRg een eagen (Li e Technologies) and specific
p ime pai s (Supplemen a y Table S1). Each sample was
amplified in iplica e and specifici y confi med by dissoci-
a ion analysis. The 18S RNA exp ession was measu ed o
no maliza ion o a ge gene abundance.
Mic oa ays and da a p ocessing
Expe imen s we e pe o med a he Na ional Facili y o
DNA Mic oa ays (A ei o, Po ugal). Th ee independen
2D and 3D AGS cell cul u es we e selec ed o o al RNA
ex ac ion using TRI Reagen . RNA quan i y and quali y
we e assessed using he Nanod op ND-1000 (The mo
Scien ific) and 2100 Bioanalyze (Agilen Technologies)
sys ems, and only samples wi h a RNA in eg i y numbe
abo e nine we e conside ed o u he s udy. P epa a ion
and labelling o he RNA was pe o med using he
One-Colo Mic oa ay-Based Gene Exp ession Analysis
Quick Amp Labelling ki (Agilen Technologies). B iefly,
600 ng o o al RNA om 2D and 3D biological eplicas
was used as inpu oge he wi h spike-in con ols o
gene a e Cyanine 3-labelled cRNA. The amplified cRNA
samples we e pu ified wi h RNeasy Mini ki (Qiagen) and
hyb idized o Human Gene exp ession 4 x 44K 2
Mic oa ay slides (Agilen Technologies) a 65
o
C o
17h. A e washing p ocedu es, images o he hyb idiza-
ions we e acqui ed using a G2505B Mic oa ay Scanne
(Agilen Technologies). The Fea u e Ex ac ion so wa e
was used o spo iden ifica ion, backg ound sub ac ion
and quan ifica ion o he fluo escen signal. Raw exp es-
sion da a we e p ocessed using BRB-A ayTools 3.8.1
so wa e (37). A e base 2 log ans o ma ion and
a e age o p obe eplica es, no maliza ion was applied
using he median in ensi y o e he en i e a ay o
minimize sys ema ic a iance. Di e en ially exp essed
ansc ip s be ween he wo cul u e condi ions we e
fil e ed using he Class Compa ison ool, pe o ming an
unpai ed sample - es wi h a P < 0.01 and conside ing a
minimal 1.5- old change. Hie a chical clus e ing analysis
o significan ly al e ed genes was conduc ed in TIGR
Mul iExpe imen Viewe 4.8.1 so wa e (38) using
Euclidean co ela ion and a e age linkage clus e ing, and
exp ession alues indica ed colo ime ically. Func ional
anno a ion o di e en ially exp essed genes, iden ified by
ex ending he unpai ed - es pa ame e o P < 0.05 and
main aining he minimal old change was pe o med
wi h DAVID p og am (39). Mic oa ay da a ha e been
submi ed o he A ayExp ess da abase (h p://www.ebi.
ac.uk/a ayexp ess/) and assigned he iden ifie E-MTAB-
1234. The comple e lis o di e en ially exp essed genes is
de ailed in Supplemen a y Table S2.
P o ein ex ac ion and wes e n blo analysis
Cells we e lysed o 30 min on ice in a lysis bu e
con aining 20 mM T is–HCl (pH 7.5), 150 mM NaCl,
2 mM e hylenediamine e aace ic acid and 1% IGEPAL
(Sigma), supplemen ed wi h Comple e p o ease inhibi o
cock ail (Roche Applied Science), 1 mM PMSF and 1 mM
Na
3
VO
4
. Lysa es we e cen i uged a 12 000 pm o 20
min a 4
o
C and he supe na an eco e ed. P o ein con-
cen a ion was de e mined using he BCA P o ein Assay
Reagen (The mo Scien ific). P o ein ex ac s (30–50 µg)
we e un on 10% sodium dodecyl sulpha e–polyac yl-
amide gel elec opho esis, ans e ed o a ni ocellulose
memb ane, blo ed o e nigh wi h app op ia e an ibodies
(Supplemen a y Table S1), and signals e ealed wi h
ECL de ec ion ki (GE Heal hca e Li e Sciences). Ac in
le els we e used o no malize p o ein exp ession, and
quan ifica ion o wes e n blo s was pe o med using Fiji
so wa e (40).
Flow cy ome y
Caco-2 cells we e ha es ed 48 h a e ans ec ion a con-
fluence and fixed wi h 1% pa a o maldehyde o 20 min
a oom empe a u e ollowed by pe meabiliza ion wi h
0.1% T i on X-100 (Sigma) o 5 min on ice. S aining
was pe o med wi h an i-MEX3A an ibody and isualized
wi h goa an i- abbi FITC-conjuga ed seconda y
an ibody. Fo DNA con en assessmen , cells we e
incuba ed wi h a p opidium iodide (50 µg/ml) and
RNAse A (200 µg/ml) solu ion (Sigma) o 30 min a oom
empe a u e. Samples we e ead in a FACSCan o
II (BD Biosciences) flow cy ome e , and analysis was
pe o med using he FlowJo so wa e.
RNA-immunop ecipi a ion assay
Cells we e lysed 48 h a e ans ec ion as indica ed o
p o ein ex ac ion bu wi h he addi ion o 20 U/ml o
RNAseOUT Ribonuclease inhibi o (Li e Technologies).
Be o e he lysis p ocedu e, cells we e washed wi h phos-
pha e bu e ed saline (PBS) and subjec ed o ul a iole
c osslink (254-nm wa eleng h) a an ene gy le el
47
Nucleic Acids Resea ch, 2013, Vol. 41, No. 7 3995
CHAPTER 3. CDX2 POST-TRANSCRIPTIONAL REGULATION BY THE RNA-BINDING PROTEIN MEX3A
Figu e 7. Pola i y al e a ions induced by MEX3A in Caco-2 cells. (A) Immunofluo escence showing ZO-1 exp ession in Caco-2 mock and MEX3A
s ably ans ec ed cell lines a day -2 o cul u e (o iginal magnifica ion, x400). (B) Mo phology o Caco-2 mock and MEX3A cys s in b igh field
mic oscopy du ing 3D cul u e (o iginal magnifica ion, x100) and CDX2/MEX3A exp ession (o iginal magnifica ion, x630). (C) Quan ifica ion o
cys s wi h lumen o no lumen a cul u e day 8. (D) Exp ession o E-cadhe in and Phalloidin s aining in Caco-2 cys s (o iginal magnifica ion, x630;
all scale ba s 20 µm).
3D cell cul u e sys ems ha e been shown o enable
physiological and unc ional di e en ia ion o se e al epi-
helial cell ypes (47,48), cons i u ing a p omising al e na-
i e o o e come s anda d cell cul u e limi a ions.
Acco dingly, ou ansc ip omic analysis pe o med on a
3D model o AGS cells, which ha e a significan le el o
endogenous CDX2 esponsi e o di e en molecula
s imuli (13–15), allowed us o disclose MEX3A as a mo-
lecula playe in ol ed in he egula ion o CDX2 ansla-
ion. The a ay p esen ed an inc eased MEX3A exp ession
in 3D cul u e and no al e a ion in he le els o he o he
MEX3 amily membe s. We u he demons a ed ha
MEX3A o e exp ession leads o ma ked CDX2 p o ein
dec ease in wo cell lines. We ied o o e come he limi-
a ion o using o e exp ession sys ems by using wo di -
e en cell lines ha we e bo h ansien ly and s ably
ans ec ed wi h a MEX3A plasmid, which ga e conco d-
an esul s. In addi ion, CDX2 nega i e egula ion by
MEX3A was confi med in a mo e physiological con ex
using a siRNA app oach owa ds endogenous MEX3A in
Caco-2 cells. We p o ed ha MEX3A is able o in e ac
wi h CDX2 mRNA h ough a canonical MRE p esen

CHAPTER 3. CDX2 POST-TRANSCRIPTIONAL REGULATION BY THE RNA-BINDING PROTEIN MEX3A
3996 Nucleic Acids Resea ch, 2013, Vol. 41, No. 7
Figu e 8. Exp ession pa e ns o MEX3A and CDX2 in mouse no mal in es ine. Rep esen a i e immunofluo escence da a o MEX3A and CDX2 in
small in es ine and colon a e shown (o iginal magnifica ion, x200; scale ba s 50 µm; inse o iginal magnifica ion, x400).
in he 3´UTR. This sequence, which we now show o be
unc ionally ele an in humans, seems o be he single
de e minan o MEX3A binding, independen ly o he
ups eam 5`coding egion. In ac , bioin o ma ics
analysis shows ha he degene a e MRE mo i has been
e olu iona ily conse ed in di e en CDX2 homologues
(Supplemen a y Figu e S3), namely in chimpanzee,
mouse, a , zeb afish, ui fly and og, sugges ing ha
MEX3A is c i ical o CDX2 egula ion.
Endogenously, MEX3A was mainly localized in he
nuclea compa men o in es inal epi helial cells, bo h
in i o and in i o. This esul is c ucial o show ha
a biological backg ound o he egula ion o CDX2 by
MEX3A exis s. In his ega d, a a ian o m o MEX3D
55
Nucleic Acids Resea ch, 2013, Vol. 41, No. 7 3997
CHAPTER 3. CDX2 POST-TRANSCRIPTIONAL REGULATION BY THE RNA-BINDING PROTEIN MEX3A
called TINO, which has been shown o nega i ely egula e
BCL-2 exp ession by ansc ip des abiliza ion, is also p e-
dominan ly localized in he nuclei o HeLa cells (33).
On he o he hand, MEX3A ans ec an s showed p e-
dominan cy oplasmic s aining. A po en ial p oblem
could be an ibody specifici y; howe e , his was success-
ully e alua ed by ans ec ion o siRNA duplexes di ec ed
agains MEX3A (Supplemen a y Figu e S4). The e o e,
he di e en ial localiza ion in dis inc exp ession
backg ounds migh be because a ce ain h eshold in ex-
p ession le els has o be achie ed o cy oplasmic ans-
loca ion o occu , gi en ha MEX3 p o eins a e capable
o pe o ming nucleocy oplasmic shu ling (28). On he
o he hand, specific subcellula dis ibu ion migh be
ela ed wi h p o ein phospho yla ion, in acco dance wi h
published da a desc ibing MEX3 membe s as phospho-
p o eins (28,29). Whiche e he case, his does no con a-
dic pos - ansc ip ional egula ion, as i can be elici ed a
mul iple poin s o he ansc ip li espan, including
p e-mRNA p ocessing in he nucleus, expo om he
nucleus o he cy oplasm and subsequen coo dina ed
a ficking o he ma u e mRNA o he ansla ion ma-
chine y. I also emains o be ully cla ified he conse-
quence o pa ial accumula ion in P bodies, s uc u es
in ol ed in p ocesses o mRNA deg ada ion, nonsense-
media ed mRNA decay, ansla ional ep ession and
RNA-media ed gene silencing (49), al hough he e a e
se e al RBPs wi h es ablished oles in ansla ional egu-
la ion known o colocalize wi h P bodies (50,51).
We used he Caco-2 cell line model o modula e MEX3A
exp ession and assess i s pheno ype. Su p isingly, MEX3A
inhibi ion p oduced dis inc e ec s o e CDX2 le els de-
pending on cellula confluence. MEX3A migh selec i ely
egula e unique subse s o a ge s in di e en cul u e con-
di ions. In ag eemen , i is known ha ansc ip omic and
p o eomic changes occu du ing he p og ession om he
p oli e a i e s a e o spon aneous di e en ia ion o Caco-2
cells. Con e sely, MEX3A migh ha e a dual ole, ac ing
bo h as a ep esso o enhance con ingen on he cellula
mic oen i onmen , as obse ed o o he RBPs, like HuR
(52). I is possible ha in ica e associa ions o MEX3A
wi h o he molecula e ec o s, namely o he p o eins o
mic oRNAs, de e mine di e gen egula o y endings.
MEX3A o e exp ession in Caco-2 cells esul ed in
p onounced pheno ypic al e a ions. CDX2 and Villin
down egula ion we e indica i e o a loss in in es inal di -
e en ia ion, which was u he confi med by he flow
cy ome ic p ofile, showing educed G0/G1 popula ion,
usually associa ed wi h less-di e en ia ed cells. Ano he
hallma k ea u e o MEX3A o e exp ession was he
al e ed cellula pola iza ion in s anda d cul u e, as well
as he impai ed abili y o o m pola ized s uc u es in he
p esence o ma igel. These e ec s may be media ed by
CDX2, as his ansc ip ion ac o was p e iously shown
o egula e in es inal Villin h ough ec ui men o he
B m- ype SWI/SNF complex o i s p omo e (53), and
MEX3A-exp essing cys s closely esemble he ones
ob ained wi h Caco-2 cells in which CDX2 supp ession
was achie ed by len i i al sho -hai pin RNA pa icles
(4). I is, he e o e, impo an o asce ain he biological
se ing whe e his egula ion migh be de e minan ,
which
is sugges ed by he p edominan exp ession o MEX3A in
he s em, ansi -ampli ying and mig a ing pos -mi o ic
cells o he in es ine. Al hough CDX2 p o ein can be
de ec ed in mos o hese cells, i s le el is lowe in he
c yp s compa ed wi h he uppe mos di e en ia ed cells
o he illi (2,19,20). A simila inc easing bo om-up
g adien has been desc ibed along he colonic gland axis
in he dis al colon epi helium. By con as , in si u hyb id-
iza ion e ealed ha CDX2 mRNA was homogeneously
dis ibu ed along he en i e c yp - illus axis (20). Gi en
his CDX2 p o ein exp ession g adien , ha we also
show, and lack o co ela ion wi h mRNA, i is likely
ha MEX3A fine- unes CDX2 le els in i o as well, in a
ansc ip ion-independen manne , p o iding swi a ail-
abili y o he p o ein o mee he physiological equi e-
men s o he con inuously enewed gu epi helium.
Mo eo e , i has been shown ha in es inal s em cells
canno di e en ia e in o any o he in es inal lineages in a
backg ound o Cdx2 abla ion (54), e ealing he need o
igh CDX2 egula ion as de e minan o p ope pheno ype
swi ching. Mos in e es ingly, we obse ed highe exp es-
sion o di e en in es inal s em cell ma ke s when we
o e exp essed MEX3A in Caco-2, sugges ing ha his
p o ein is associa ed wi h s em cell ea u es. Ou AGS 3D
model also showed a significan up egula ion o OLFM4
(Supplemen a y Table S2), p e iously iden ified as a
ma ke o LGR5+ s em cells in human in es ine (46),
al hough his gene was no di ec ly up egula ed in Caco-2
cells, which migh be due o in insic p ope ies o each cell
line. S eng hening he hypo hesis o a ole o MEX3A in
s em cell po en ial, a ecen publica ion showed ha
MEX3A is pa o he molecula signa u e o he LGR5+
in es inal s em cells, p esen ing a 1.64- old inc ease in
ela ion o daugh e cells, along wi h MSI1, LGR5 and
OLFM4 (55). Fu he mo e, ou s udy ein o ces he
inc easing knowledge ha o he egula o y mechanisms
in addi ion o ansc ip ional ones ha e impo an unc-
ions in s em cells. Al hough we do no know ye how
MEX3A ela es wi h he in es inal s em cell pheno ype,
we hypo hesize ha MEX3A o e exp ession in i sel ,
oge he wi h he induc ion o a lessened di e en ia ed
pheno ype and pola i y de ec s media ed by CDX2
down egula ion, migh be c i ical o allow a pe missi e en-
i onmen o he appea ance o s emness ea u es.
Fu he mo e, he MEX3A–CDX2 axis migh be impo an
du ing ea ly emb yogenesis whe e CDX2 is equi ed o
co ec ophec ode m di e en ia ion, while absen om
he inne cell mass, in a p ocess ha equi es igh egula-
ion (56). In e es ingly, he pa e n o exp ession o he C.
elegans o hologues o bo h p o eins was ound o be
mu ually exclusi e in ea ly s ages o emb yogenesis
(24,27). S ill, i emains o be assessed he ele ance o
MEX3A in mul iple pa hological con ex s o he gas o-
in es inal ac whe e di e en ia ion abno mali ies
di ec ed by CDX2 a e key e en s.
In conclusion, we ha e iden ified a no el ole o
MEX3A p o ein in he egula ion o in es inal di e en i-
a ion, pola i y and s emness ea u es, pa ially media ed
by he ep ession o CDX2. This is he fi s desc ip ion o
a CDX2 egula o y mechanism based on i s mRNA
con ol by an RBP, ha ing a significan impac in
CHAPTER 3. CDX2 POST-TRANSCRIPTIONAL REGULATION BY THE RNA-BINDING PROTEIN MEX3A
3998 Nucleic Acids Resea ch, 2013, Vol. 41, No. 7
in es inal homeos asis and likely in gas oin es inal
ca cinogenesis.
ACCESSION NUMBERS
The mic oa ay da a om his publica ion ha e been
submi ed o he A ayExp ess da abase (h p://www.ebi.
ac.uk/a ayexp ess/) and assigned he iden ifie
E-MTAB-1234.
SUPPLEMENTARY DATA
Supplemen a y Da a a e a ailable a NAR Online:
Supplemen a y Tables 1 and 2 and Supplemen a y
Figu es 1–4.
ACKNOWLEDGEMENTS
The au ho s a e g a e ul o P o esso Leono Da id o
ui ul discussion, aluable expe imen al ad ice h ough-
ou he p ojec and c i ical eading o he manusc ip .
They hank D Ca a ina Lei ão o echnical
assis ance
in flow cy ome y and D Pa ícia Cas o
o echnical
assis ance in con ocal mic oscopy. The
o e all s udy
was coo dina ed by R.A. wi h
con ibu ions om M.B.;
B.P., S.S., R.B. and L.C.
pe o med he expe imen s;
M.P., JP.R. and JN.F.
p o ided essen ial eagen s; B.P.
and
R.A. concei ed and designed he expe imen s; B.P.
and
R.A.
w o e he manusc ip ; all au ho s con ibu ed o
di e en aspec s o da a analysis and c i ical e ision o
he manusc ip .
FUNDING
Fundação pa a a Ciência e a Tecnologia
(FCT)—
P og ama Ope acional Ciência e Ino ação 2010 do
Quad o Comuni á io de Apoio III and
FEDER [PTDC/
SAU-OBD/64490/2006]. IPATIMUP
is an Associa e
Labo a o y o he Po uguese
Minis y o Science,
Technology and Highe
Educa ion and is pa ially sup-
po ed by FCT. B.P.
and R.B. acknowledge FCT o fi-
nancial suppo
[SFRH/BD/43168/2008 and SFRH/BPD/
68276/2010,
espec i ely]. M.B. was suppo ed by a
g an om he
Fonda ion ARC, and N.T.C. was he
ecipien o a
ellowship om he Fonda ion pou la
Reche che Médicale. Funding o open access cha ge:
FCT
[SFRH/ BD/43168/2008].
Conflic o in e es s a emen . None decla ed.
REFERENCES
1.
Beck,F., Chawengsaksophak,K., Wa ing,P., Play o d,R.J. and
Fu ness,J.B. (1999) Rep og amming o in es inal di e en ia ion
and in e cala y egene a ion in Cdx2 mu an mice. P oc. Na l
Acad. Sci. USA,
96
, 7318–7323.
2.
Silbe g,D.G., Swain,G.P., Suh,E.R. and T abe ,P.G. (2000)
Cdx1 and cdx2 exp ession du ing in es inal de elopmen .
Gas oen e ology,
119
, 961–971.
3.
Gao,N., Whi e,P. and Kaes ne ,K.H. (2009) Es ablishmen o
in es inal iden i y and epi helial-mesenchymal signaling by Cdx2.
De . Cell, 16, 588–599.
4.
Gao,N. and Kaes ne ,K.H. (2010) Cdx2 egula es endo-lysosomal
unc ion and epi helial cell pola i y. Genes De .,
24
, 1295–1305.
5.
G oss,I., Duluc,I., Benameu ,T., Calon,A., Ma in,E., B able z,T.,
Kedinge ,M., Domon-Dell,C. and F eund,J.N. (2008) The
in es ine-specific homeobox gene Cdx2 dec eases mobili y and
an agonizes dissemina ion o colon cance cells. Oncogene,
27
,
107–115.
6.
B able z,T., Spade na,S., Kolb,J., Hlubek,F., Falle ,G.,
B uns,C.J., Jung,A., Nen wich,J., Duluc,I., Domon-Dell,C. e al.
(2004) Down- egula ion o he homeodomain ac o Cdx2 in
colo ec al cance by collagen ype I: an ac i e ole o he umo
en i onmen in malignan umo p og ession. Cance Res.,
64
,
6973–6977.
7.
Bonhomme,C., Duluc,I., Ma in,E., Chawengsaksophak,K.,
Chena d,M.P., Kedinge ,M., Beck,F., F eund,J.N. and Domon-
Dell,C. (2003) The Cdx2 homeobox gene has a umou
supp esso unc ion in he dis al colon in addi ion o a homeo ic
ole du ing gu de elopmen . Gu ,
52
, 1465–1471.
8.
Eda,A., Osawa,H., Sa oh,K., Yanaka,I., Kihi a,K., Ishino,Y.,
Mu oh,H. and Sugano,K. (2003) Abe an exp ession o CDX2 in
Ba e ’s epi helium and inflamma o y esophageal mucosa. J.
Gas oen e ol., 38, 14–22.
9.
Almeida,R., Sil a,E., San os-Sil a,F., Silbe g,D.G., Wang,J., De
Bolós,C. and Da id,L. (2003) Exp ession o in es ine-specific
ansc ip ion ac o s, CDX1 and CDX2, in in es inal me aplasia
and gas ic ca cinomas. J. Pa hol.,
199
, 36–40.
10.
Ba os,R., Camilo,V., Pe ei a,B., F eund,J.N., Da id,L. and
Almeida,R. (2010) Pa hophysiology o in es inal me aplasia o he
s omach: emphasis on CDX2 egula ion. Biochem. Soc. T ans.,
38, 358–363.
11.
Silbe g,D.G., Sulli an,J., Kang,E., Swain,G.P., Mo e ,J.,
Sund,N.J., Sacke ,S.D. and Kaes ne ,K.H. (2002) Cdx2 ec opic
exp ession induces gas ic in es inal me aplasia in ansgenic mice.
Gas oen e ology,
122
, 689–696.
12.
Mu oh,H., Hakama a,Y., Sa o,K., Eda,A., Yanaka,I., Honda,S.,
Osawa,H., Kaneko,Y. and Sugano,K. (2002) Con e sion o
gas ic mucosa o in es inal me aplasia in Cdx2-exp essing
ansgenic mice. Biochem. Biophys. Res. Commun., 294, 470–479.
13.
Ba os,R., Pe ei a,B., Duluc,I., Aze edo,M., Mendes,N.,
Camilo,V., Jacobs,R.J., Paulo,P., San os-Sil a,F., an
Seuningen,I. e al. (2008) Key elemen s o he BMP/SMAD
pa hway co-localize wi h CDX2 in in es inal me aplasia and
egula e CDX2 exp ession in human gas ic cell lines. J. Pa hol.,
215, 411–420.
14.
Camilo,V., Ba os,R., Sousa,S., Magalhães,A.M., Lopes,T.,
San os,A.M., Pe ei a,T., Figuei edo,C., Da id,L. and Almeida,R.
(2012) Helicobac e pylo i and he BMP pa hway egula e CDX2
and SOX2 exp ession in gas ic cells. Ca cinogenesis,
10
, 1985–
1992.
15.
Ba os,R., da Cos a,L.T., Pin o-de-Sousa,J., Duluc,I.,
F eund,J.N., Da id,L. and Almeida,R. (2011) CDX2
au o egula ion in human in es inal me aplasia o he s omach:
impac on he s abili y o he pheno ype. Gu .,
60
, 290–298.
16.
Benahmed,F., G oss,I., Gaun ,S.J., Beck,F., Jehan,F.,
Domon-Dell,C., Ma in,E., Kedinge ,M., F eund,J.N. and
Duluc,I. (2008) Mul iple egula o y egions con ol he complex
exp ession pa e n o he mouse Cdx2 homeobox gene.
Gas oen e ology,
135
, 1238–1247.
17.
Wood o d-Richens,K.L., Hal o d,S., Rowan,A., Be an,S.,
Aal onen,L.A., Wasan,H., Bicknell,D., Bodme ,W.F.,
Houls on,R.S. and Tomlinson,I.P. (2001) CDX2 mu a ions do no
accoun o ju enile polyposis o Peu z-Jeghe s synd ome and
occu in equen ly in spo adic colo ec al cance s. B . J. Cance ,
84, 1314–1316.
18.
Pe ei a,B., Oli ei a,C., Da id,L. and Almeida,R. (2009) CDX2
p omo e me hyla ion is no associa ed wi h mRNA exp ession.
In . J. Cance ,
125
, 1739–1742.
19.
Rings,E.H., Boud eau,F., Taylo ,J.K., Mo e ,J., Suh,E.R. and
T abe ,P.G. (2001) Phospho yla ion o he se ine 60 esidue
wi hin he Cdx2 ac i a ion domain media es i s ansac i a ion
capaci y. Gas oen e ology,
121
, 1437–1450.
20.
Boulange ,J., Vézina,A., Mong ain,S., Boud eau,F., Pe eaul ,N.,
Auclai ,B.A., Lainé ,J., Asselin,C. and Ri a d,N. (2005)
Cdk2-dependen phospho yla ion o homeobox ansc ip ion
57
Nucleic Acids Resea ch, 2013, Vol. 41, No. 7 3999
CHAPTER 3. CDX2 POST-TRANSCRIPTIONAL REGULATION BY THE RNA-BINDING PROTEIN MEX3A
ac o CDX2 egula es i s nuclea ansloca ion and
p o easome-media ed deg ada ion in human in es inal epi helial
cells. J. Biol. Chem.,
280
, 18095–18107.
21.
Moo e,M.J. (2005) F om bi h o dea h: he complex li es o
euka yo ic mRNAs. Science,
309
, 1514–1518.
22.
Besse,F. and Eph ussi,A. (2008) T ansla ional con ol o localized
mRNAs: es ic ing p o ein syn hesis in space and ime. Na . Re .
Mol. Cell. Biol.,
9
, 971–980.
23.
D ey uss,G., Kim,V.N. and Ka aoka,N. (2002) Messenge -RNA-
binding p o eins and he messages hey ca y. Na . Re . Mol.
Cell. Biol.,
3
, 195–205.
24.
D ape ,B.W., Mello,C.C., Bowe man,B., Ha din,J. and
P iess,J.R.(1996) MEX-3 is a KH domain p o ein ha egula es
blas ome e iden i y in ea ly C. elegans emb yos. Cell,
87
, 205–
216.
25.
Ciosk,R., DePalma,M. and P iess,J.R. (2006) T ansla ional
egula o s main ain o ipo ency in he Caeno habdi is elegans
ge mline. Science,
311
, 851–853.
26.
Siomi,H., Ma unis,M.J., Michael,W.M. and D ey uss,G. (1993)
The p e-mRNA binding K p o ein con ains a no el e olu iona y
conse ed mo i . Nucleic Acids Res., 21, 1193–1198.
27.
Hun e ,C.P. and Kenyon,C. (1996) Spa ial and empo al con ols
a ge pal-1 blas ome e-speci ica ion ac i i y o a single blas ome e
lineage in C. elegans emb yos. Cell,
87
, 217–226.
28.
Buche -Poyau,K., Cou che ,J., Le Hi ,H., Sé aphin,B.,
Scoazec,J.Y., Du e ,L., Domon-Dell,C., F eund,J.N. and
Billaud,M. (2007) Iden ifica ion and cha ac e iza ion o human
Mex-3 p o eins, a no el amily o e olu iona ily conse ed
RNA-binding p o eins di e en ially localized o p ocessing
bodies.
Nucleic Acids Res., 35, 1289–1300.
29.
Cou che ,J., Buche -Poyau,K., Po emski,A., B ès,A.,
Ja iel-Encon e,I. and Billaud,M. (2008) In e ac ion wi h 14-3-3
adap o s egula es he so ing o hMex-3B RNA-binding p o ein
o dis inc classes o RNA g anules. J. Biol. Chem.,
283
,
32131–32142.
30.
Cano,F., Bye,H., Duncan,L.M., Buche -Poyau,K., Billaud,M.,
Wills,M.R. and Lehne ,P.J. (2012) The RNA-binding E3
ubiqui in ligase MEX-3C links ubiqui ina ion wi h MHC-I
mRNA deg ada ion. EMBO J.,
31
, 3596–3606.
31.
Jiao,Y., Bishop,C.E. and Lu,B. (2012) Mex3c egula es
insulin-like g ow h ac o 1 (IGF1) exp ession and p omo es
pos na al g ow h. Mol. Biol. Cell,
23
, 1404–1413.
32.
Jiao,Y., Geo ge,S.K., Zhao,Q., Hul e ,M.W., Hu son,S.M.,
Bishop,C.E. and Lu,B. (2012) Mex3c mu a ion educes adiposi y
and inc eases ene gy expendi u e. Mol. Cell. Biol.,
32
, 4350–4362.
33.
Donnini,M., Lapucci,A., Papucci,L., Wi o ,E., Jacquie ,A.,
B ewe ,G., Nicolin,A., Capaccioli,S. and Schia one,N. (2004)
Iden ifica ion o TINO: a new e olu iona y conse ed BCL-2
AU- ich elemen RNA-binding p o ein. J. Biol. Chem.,
279
,
20154–20166.
34.
Jiang,H., Zhang,X., Luo,J., Dong,C., Xue,J., Wei,W., Chen,J.,
Zhou,J., Gao,Y. and Yang,C. (2012) Knockdown o hMex-3A by
small RNA in e e ence supp esses cell p oli e a ion and mig a ion
in human gas ic cance cells. Mol. Med. Repo .,
6
, 575–580.
35.
Pillai,R.S., Bha acha yya,S.N., A us,C.G., Zolle ,T.,
Cougo ,N.,Basyuk,E., Be and,E. and Filipowicz,W. (2005)
Inhibi ion o ansla ional ini ia ion by Le -7 Mic oRNA in
human cells.
Science,
309
, 1573–1576.
36.
Pagano,J.M., Fa ley,B.M., Essien,K.I. and Ryde ,S.P. (2009)
RNA ecogni ion by he emb yonic cell a e de e minan and
ge mline o ipo ency ac o MEX-3. P oc. Na l Acad. Sci. USA,
106, 20252–20257.
37.
Simon,R., Lam,A., Li,M.C., Ngan,M., Menenzes,S. and Zhao,Y.
(2007) Analysis o gene exp ession da a using BRB-a ay ools.
Cance In o m.,
3
, 11–17.
38.
Saeed,A.I., Sha o ,V., Whi e,J., Li,J., Liang,W., Bhagaba i,N.,
B ais ed,J., Klapa,M., Cu ie ,T., Thiaga ajan,M. e al. (2003)
TM4: a ee, open-sou ce sys em o mic oa ay da a
managemen and analysis. Bio echniques,
34
, 374–378.
39.
Huang,D.W., She man,B.T. and Lempicki,R.A. (2009) Sys ema ic
and in eg a i e analysis o la ge gene lis s using DAVID
bioin o ma ics esou ces. Na . P o oc.,
4
, 44–57.
40.
Schindelin,J., A ganda-Ca e as,I., F ise,E., Kaynig,V.,
Longai ,M., Pie zsch,T., P eibisch,S., Rueden,C., Saal eld,S.,
Schmid,B. e al. (2012) Fiji: an open-sou ce pla o m o
biological-image analysis. Na . Me hods,
9
, 676–682.
41.
She h,U. and Pa ke ,R. (2003) Decapping and decay o messenge
RNA occu in cy oplasmic p ocessing bodies. Science,
300
,
805–808.
42.
Pin o,M., Robine-Lé on,S., Appay,M.D., Kedinge ,M.,
T iadou,N., Dussaulx,E., Lac oix,B., Simon-Assmann,P.,
Ha en,K., Fogh,J. e al. (1983) En e ocy e-like di e en ia ion and
pola iza ion o he human colon ca cinoma cell line Caco-2 in
cul u e. Biol. Cell, 47, 323–330.
43.
Po en,C.S., Boo h,C., Tudo ,G.L., Boo h,D., B ady,G.,
Hu ley,P., Ash on,G., Cla ke,R., Sakakiba a,S. and Okano,H.
(2003) Iden ifica ion o a pu a i e in es inal s em cell and ea ly
lineage ma ke ; musashi-1. Di e en ia ion,
71
, 28–41.
44.
Ba ke ,N., an Es,J.H., Kuipe s,J., Kujala,P., an den Bo n,M.,
Cozijnsen,M., Haegeba h,A., Ko ing,J., Beg hel,H., Pe e s,P.J.
e al. (2007) Iden ifica ion o s em cells in small in es ine and
colon by ma ke gene Lg 5. Na u e,
449
, 1003–1007.
45.
Sangio gi,E. and Capecchi,M.R. (2008) Bmi1 is exp essed in i o
in in es inal s em cells. Na . Gene .,
40
, 915–920.
46.
an de Flie ,L.G., Haegeba h,A., S ange,D.E., an de
We e ing,M. and Cle e s,H. (2009) OLFM4 is a obus ma ke
o s em cells in human in es ine and ma ks a subse o colo ec al
cance cells. Gas oen e ology,
137
, 15–17.
47.
Bissell,M.J., Radisky,D.C., Rizki,A., Wea e ,V.M. and
Pe e sen,O.W. (2002) The o ganizing p inciple:
mic oen i onmen al influences in he no mal and malignan
b eas . Di e en ia ion,
70
, 537–546.
48.
Oo ani,A., Toda,S., Fujimo o,K. and Sugiha a,H. (2003) Fo eola
di e en ia ion o mouse gas ic mucosa in i o. Am. J. Pa hol.,
162, 1905–1912.
49.
Eulalio,A., Behm-Ansman ,I. and Izau alde,E. (2007) P bodies:
a he c oss- oads o pos - ansc ip ional pa hways. Na . Re .
Mol. Cell. Biol.,
8
, 9–22.
50.
Chu,C.Y. and Rana,T.M. (2006) T ansla ion ep ession in human
cells by mic oRNA-induced gene silencing equi es RCK/p54.
PLoS Biol., 4, e210.
51.
Yang,W.H., Yu,J.H., Gulick,T., Bloch,K.D. and Bloch,D.B.
(2006) RNA-associa ed p o ein 55 (RAP55) localizes o mRNA
p ocessing bodies and s ess g anules. RNA,
12
, 547–554.
52.
Kim,H.H., Kuwano,Y., S ikan an,S., Lee,E.K., Ma indale,J.L.
and Go ospe,M. (2009) HuR ec ui s le -7/RISC o ep ess c-Myc
exp ession. Genes De ., 23, 1743–1748.
53.
Yamamichi,N., Inada,K., Fu ukawa,C., Saku ai,K., Tando,T.,
Ishizaka,A., Ha aguchi,T., Mizu ani,T., Fujishi o,M.,
Shimomu a,R. e al. (2009) Cdx2 and he B m- ype SWI/SNF
complex coope a i ely egula e illin exp ession in gas oin es inal
cells. Exp. Cell Res., 315, 1779–1789.
54.
S inge ,E.J., Duluc,I., Saandi,T., Da idson,I., Bialecka,M.,
Sa o,T., Ba ke ,N., Cle e s,H., P i cha d,C.A., Win on,D.J. e al.
(2012) Cdx2 de e mines he a e o pos na al in es inal endode m.
De elopmen , 139, 465–474.
55.
Muñoz,J., S ange,D.E., Schepe s,A.G., an de We e ing,M.,
Koo,B.K., I zko i z,S., Volckmann,R., Kung,K.S., Kos e ,J.,
Radulescu,S. e al. (2012) The Lg 5 in es inal s em cell signa u e:
obus exp ession o p oposed quiescen ‘+4’ cell ma ke s.
EMBO J.,
31
, 3079–3091.
56.
S ump ,D., Mao,C.A., Yamanaka,Y., Rals on,A.,
Chawengsaksophak,K., Beck,F. and Rossan ,J. (2005) Cdx2 is
equi ed o co ec cell a e specifica ion and di e en ia ion
o ophec ode m in he mouse blas ocys . De elopmen ,
132
,
2093–2102.
CHAPTER 3. CDX2 POST-TRANSCRIPTIONAL REGULATION BY THE RNA-BINDING PROTEIN MEX3A
SUPPLEMENTARY DATA
Supplemen a y Figu e S1. Subcellula localiza ion o MEX3A in P bodies (A)
Immuno luo escence o MEX3A s ably ans ec ed AGS cells o myc- ag and o
endogenous DCP1A and EDC4 p o eins. (B) Immuno luo escence o MEX3A s ably
ans ec ed Caco-2 cells o myc- ag and endogenous DCP1A and EDC4 p o eins.
Whi e a ow-heads poin o di e en si es o co-localiza ion (o iginal magni ica ion,
x630; scale ba s 20 µm).
59

CHAPTER 3. CDX2 POST-TRANSCRIPTIONAL REGULATION BY THE RNA-BINDING PROTEIN MEX3A
Supplemen a y Figu e S2. S udy o he exp ession p o ile o endogenous MEX3A in
Caco-2 cells. (A) Wes e n blo o MEX3A and CDX2 exp ession du ing Caco-2
di e en ia ion. The ime-poin in which con luence is achie ed is e e ed o as day 0
(cul u e day 6). (B) qPCR o MEX3A and CDX2 mRNA exp ession du ing he same
ime-poin s. Values o CDX2 and MEX3A a day -2 we e e e ed o as 1.
CHAPTER 3. CDX2 POST-TRANSCRIPTIONAL REGULATION BY THE RNA-BINDING PROTEIN MEX3A
Pan oglody es CDX2 - One p edic ed MRE in he 3`UTR
bp Sequence
1991 AGAGTTTTTA
Mus musculus Cdx2 - Two p edic ed MREs in he CDS
bp Sequence
873 GGAGTTTCACTTTA
1171 GGAGGGGTTTTA
Ra us no egicus Cdx2 - Th ee p edic ed MREs, one in he CDS and wo in he
3`UTR
bp Sequence
1010 GGAGGGGTTTTA
1228 TTAGATTTTTTTTTTA
2027 GGAGCTTTA
Danio e io cdx1a - One p edic ed MRE in he 3`UTR
bp Sequence
1176 TGAGTTTA
Xenopus lae is cdx2 - Se en p edic ed MREs in he 3`UTR
bp Sequence
1269 ATAGACTTTTA
1640 TTAGATCCCTTCTA
1860 GTAGCATTTTA
2251 GTAGGCAGCCTTTA
2355 GGAGACGTTTA
2488 TGAGTGTTTTATA
2546 GGAGGATATATTTA
D osophila melanogas e cad - Fou p edic ed MREs in he 3´UTR
bp Sequence
2235 ATAGCCGCATATATA
2251 AGAGTTTTAACGTTTA
2298 GTAGTTAATATA
2469 ATAGCTATTTA
Supplemen a y Figu e S3. Bioin o ma ics sea ch o MREs in CDX2 homologues o
se e al species. Di e en MRE sequences loca ed in he coding sequence (CDS) o
3`UTR o he ansc ip s a e shown.
61
CHAPTER 3. CDX2 POST-TRANSCRIPTIONAL REGULATION BY THE RNA-BINDING PROTEIN MEX3A
Supplemen a y Figu e S4. Inhibi ion o endogenous MEX3A in Caco-2 cells. (A)
Immuno luo escence o endogenous MEX3A a di e en ime-poin s, upon inhibi ion
wi h speci ic siRNAs o 24h (o iginal magni ica ion, x400; scale ba 20 µm). (B)
Co esponding wes e n blo analysis o MEX3A down egula ion.
63

71
73
Discussion and concluding ema ks
Chap e 5
CHAPTER 5. DISCUSSION AND CONCLUDING REMARKS
GI malignancies emain a leading cause o mo bidi y wo ldwide, a ec ing
almos ou million indi iduals pe yea . This heal h bu den has been in ensi ely
ackled du ing he las decades in he sea ch o new app oaches o p e en ion and
managemen , and hough slow, some p og ess has been achie ed. A majo
ad ancemen in unde s anding cance ae iology is he ecogni ion ha al hough
in insically gene ic in o igin, i s he e ogeneous na u e s ems om complex
in e ac ions be ween en i onmen al and hos ac o s. A he cellula le el, his implies
ha cance cells a e no isola ed en i ies solely de ined by he linea accumula ion
o i e e sible gene ic al e a ions. Ca cinogenesis is a a he dynamic p ocess
cha ac e ized by ongoing adap a ions o he su ounding mic oen i onmen .
The homeobox ansc ip ion ac o CDX2 is a mas e egula o o in es inal
di e en ia ion. No su p isingly, CDX2 de egula ion is associa ed wi h GI ca cinogenic
p ocesses, including IM onse du ing gas ic cance de elopmen and CRC, hough
i s ole in he la e is no consensual. Since s uc u al al e a ions in he CDX2 locus a e
a e, i has become e iden ha egula ion mus accoun o he majo al e a ions
epo ed in CDX2 le els in di e en pa hological condi ions and consequen ly, o
main aining i s no mal homeos a ic balance. Hence o h, e o s ha e been
concen a ed in de ining he egula o y mechanisms unde lying CDX2 exp ession.
Indeed, se e al ansc ip ional, pos - ansc ip ional and pos - ansla ional
mechanisms ha e been desc ibed o con ol CDX2, making his a highly complex
and igh ly o ganized egula o y sys em.
Wi h he objec i e o un eiling new molecula mechanisms o CDX2 egula ion,
we ocused on he ole o mic oen i onmen al in luences as a guiding line. In his
ega d, we ha e s udied he e ec o me hyla ion a he CDX2 p omo e le el and
o MEX3A p o ein o e CDX2 exp ession, an RNA-binding ac o unco e ed in a cell-
ma ix in e ac ion model. The di e en pa s o his wo k a e now deba ed in dis inc
sec ions, being poin ed ou wi hin each one u u e esea ch a enues o in e es . A
he end, a gene al conclusion is p o ided, in eg a ing all da a om a molecula and
e olu iona y s andpoin .
CHAPTER 5. DISCUSSION AND CONCLUDING REMARKS
Ou analysis ocused on wo classically de ined CpG islands, iden i ied in he
5`p oximal lanking egion, and hus, mo e likely in ol ed in CDX2 egula ion gi en
he ansc ip ion s a si e p oximi y. We ini ially chose a panel o gas ic cance cell
lines displaying di e en ial exp ession o CDX2 mRNA o alida e a bisul i e-modi ied
DNA sequencing p o ocol and es ablish possible co ela ions wi h he CDX2 gene
me hyl-pa e n. The choice o s a egy was based on he ac ha me hyla ion-
speci ic PCR uses di e en pai s o p ime s o speci ically ampli y me hyla ed o
unme hyla ed sequences, p o iding a semi-quan i a i e ou pu ha migh no be
ep esen a i e o he whole CpG island, while sequencing o indi idual PCR
amplicons wi h an unbiased p ime pai gene a es ex ensi e me hyla ion maps a
single-nucleo ide esolu ion. He ewi h, we we e able o de e mine ha p omo e
me hyla ion s a us does no co ela e wi h CDX2 exp ession le els, which has been
con i med in ollowing s udies (Va on e al. 2012; Zhang e al. 2013). This is in
acco dance wi h he CDX2 me hyla ion equency no showing any ela ionship o
di e en clinicopa hological cha ac e is ics, like umou his ological ype o in asion
(Yuasa e al. 2005), a ac a odds wi h he knowledge ha gas ic cance s e aining
CDX2 exp ession a e less agg essi e and mo e di e en ia ed (Liu e al. 2007a).
Con adic o y esul s ha e also been published in oesophageal issues, wi h he
p esence o me hyla ed and unme hyla ed alleles in cance , and unme hyla ed in
ma ched no mal epi helia, despi e no de ec able mRNA o p o ein in he la e
(Vanine i e al. 2009).
We we e in e es ed in assessing me hyla ion in IM p e-malignan condi ion
compa ed o he no mal gas ic mucosa. We no iced he uppe CpG island was
hea ily me hyla ed in all cell lines es ed, consis en wi h a p e ious desc ip ion
(Kawai e al. 2005), and hence could no be disc imina i e. As a esul , we limi ed he
issue analysis o he lowe CpG island only. Analysis o no mal colonic mucosa, IM
oci and ma ched adjacen no mal epi helium showed a me hyla ion pa e n
deemed inconsis en wi h he CDX2 issue- ype exp ession. Hence, CDX2 exp ession
in IM is no a ibu able o deme hyla ion, bu o ansc ip ional ac i a ion by o he
mechanisms. This lack o co ela ion has also been obse ed in s omachs om
no mal mice and IM cases om Cdx2- ansgenic mice (Mu oh e al. 2009).
Conce ning he in es inal backg ound, a ecen epo s a ed ha CDX2 p omo e
hype me hyla ion is a e in CRC cases and cell lines (Sala i e al. 2012). The e o e, i
75
5.1 CDX2 REGULATION BY PROMOTER METHYLATION

CHAPTER 5. DISCUSSION AND CONCLUDING REMARKS
seems CDX2 p omo e me hyla ion is no causa i e o i s own le els in in es ine
ei he , and canno accoun o he subse o CRCs p esen ing he e ogeneous CDX2
exp ession.
Mos s udies, including ou own, assumed ha unc ionally ele an DNA
me hyla ion occu s in p oximal p omo e a eas, bu i is possible ha o he si es migh
ha e been neglec ed. In ac , bioin o ma ic analysis e eals ha a leas h ee
addi ional CpG islands exis in mo e dis al 5` in e genic loca ions, app oxima ely 6kb,
8kb and 11kb om he CDX2 ansc ip ional s a si e, he las wo o e lapping he
neighbou ing gene PRHOXNB. CpG sho e me hyla ion is an eme ging concep ha
migh also be wo hwhile explo ing in his con ex . These a e egions o lowe CpG
densi y ha lie in close p oximi y, bu o en no wi hin, CpG islands. No ably, and a
leas o colon, mos cance -associa ed al e a ions in me hyla ion we e
p edominan ly obse ed in hese a eas, a he han es ic ed o CpG islands (I iza y
e al. 2009). In p inciple, hese pu a i e me hyl-si es should be esponsi e o inhibi o s
o DNA me hyl ans e ase ac i i y as well. Ne e heless, he b oad ange na u e o
his ype o ea men s is expec ed o gene a e indisc imina e e ec s on mul iple
a ge s, whose ne balance migh no e lec inc eased CDX2 ansc ip ion. Thus,
me hyla ion p o ile analysis o hese al e na i e egions s ands as a u u e esea ch
goal. Ano he key poin o be conside ed is he ole o ch oma in s a e. Cell ype-
speci ic ch oma in o ganiza ion enables di e en ial access o and ac i i y o
egula o y elemen s and he mani es a ion o unique cellula pheno ypes. Al e a ions
in hese signa u es a e a common ea u e o cance ini ia ion and de elopmen
(Su à e al. 2013). Ac i e p omo e egions include heigh ened nuclease sensi i i y
implying nucleosome deple ion, and his one modi ica ions associa ed wi h
ansc ip ional ac i a ion, such as me hyla ion o his one H3 a lysine 4 (H3K4me1 o
H3K4me3) and his one H3 ace yla ed a lysine 27 (H3K27Ac). Qui e he opposi e,
nucleosome compac ion, me hyla ion o his one H3 a lysine 9 (H3K9me2 o
H3K9me3) and o his one H3 a lysine 27 (H3K27me3) a e essen ially ep essi e ai s
(Zhou e al. 2011). In his ega d, ch oma in changes associa ed wi h CDX1 and CDX2
exp ession we e only desc ibed in one publica ion and in colon cance cell lines (Lu
e al. 2008). The in i o pa e n o hese epigene ic ma ks, pa icula ly in IM
de elopmen , emains o be examined.
CHAPTER 5. DISCUSSION AND CONCLUDING REMARKS
Gi en ha p e ious epo s desc ibed he ole o epi helial-mesenchymal
c oss alk as ele an o CDX2 exp ession, we es ablished in i o 3D cul u e models in
o de o s udy in e ac ions be ween gas ic epi helial cells and s omal elemen s ha
migh egula e CDX2. These sys ems ha e now been applied wi h success o
gene a e and main ain gas ic and in es inal a chi ec u e in he o m o o ganoids
om single Lg 5+ s em cells (Sa o e al. 2009; Ba ke e al. 2010).
Ou ansc ip omic analysis compa ing 3D wi h s anda d AGS cell cul u e
e ealed a emodeling o he gene exp ession p og am. Such adap a ion was
pa icula ly no iceable by al e a ions in ac in eo ganiza ion media ed by inc eased
exp ession o GTPases o he Rho amily, like ARHGEF9, which ac s as a guanine
nucleo ide exchange ac o o he pola i y- ela ed p o ein CDC42. An inc ease in
COL4A5 and LAMB1 ansc ip s, o example, was also obse ed, which encode o
ype IV collagen and laminin, espec i ely, componen s o he basal lamina ha has
been shown o be p ima ily a p oduc o epi helial cells, poin ing owa ds an
induc i e eedback loop be ween he ma ix and epi helial cells. In e es ingly, we
no iced a signi ican inc ease in cell cycle ela ed elemen s, o ins ance in SGOL1,
which encodes a p o ein ha shields he cohesin complex om clea age and is
c ucial o ai h ul ch omosome seg ega ion du ing mi osis and meiosis (Kahyo e al.
2011); ERCC6L, a DNA helicase ha is essen ial o main enance o genome in eg i y
(Baumann e al. 2007); and he polyme ase POLD1, which unc ions in DNA
eplica ion/ epai and whose mu a ions a ec ing he p oo eading domains ha e
ecen ly been shown o inc ease he isk o colo ec al ca cinoma (Palles e al. 2013).
T ansc ip s encoding in lamma o y esponse ac o s, like chemokine ligands,
in e e ons and in e leukins, we e all down egula ed. Fu he mo e, an inc ease in
No ch1, DLL1, and FZD1 was de ec ed. Combina o ial con ol be ween hese No ch
and Wn pa hway membe s seems necessa y o main ain in es inal s em cells (F e e
al. 2009). In line, he a ay showed a 60- old inc ease in he exp ession o OLFM4, a
speci ic ma ke o Lg 5+ in es inal s em cells ( an de Flie e al. 2009).
The p e ious esul s, oge he wi h he dec eased CDX2 exp ession sugges ha
ou AGS 3D cells esemble undi e en ia ed in es inal cells. Since AGS was i s
es ablished om an in es inal- ype gas ic adenoca cinoma, we specula e ha a
pa ial e e sion o he malignan owa ds an in es inal pheno ype migh occu unde
a physiologically mo e ele an mic oen i onmen , eminiscen o wha has been
77
5.2 3D AGS CELL MODEL AND LOSS OF CDX2 EXPRESSION
CHAPTER 5. DISCUSSION AND CONCLUDING REMARKS
obse ed in a mamma y model (Wea e e al. 1997). The ull po en ial o his model
hus emains o be explo ed, as i migh p o ide addi ional insigh s on ac o s
in ol ed in he egula ion o in es inal di e en ia ion.
Th ough mic oa ay analysis o dissec he ansc ip ional egula o y ci cui y o
AGS cells in cul u e wi h an ex acellula ma ix, and u he suppo ed by an
e olu iona y link, we iden i ied and alida ed MEX3A as a CDX2 ep esso .
Conside ing he dis inc expe imen al se ings es ablished, ou in e p e a ion is ha
MEX3A ac i ely con ols CDX2 exp ession du ing p oli e a i e s a es, when ine- uning
o CDX2 a he ansc ip le el seems mo e ele an o couple cell cycle a es wi h
he eme gence o a di e en ia ion p og am (Bai e al. 2003). In subsequen
di e en ia ed s a es, CDX2 exp ession has al eady been demons a ed o ely mos ly
in i s p o ein s abili y (Boulange e al. 2005). Hence, MEX3A migh exhibi a ge
speci ici y, and his hypo hesis is a ou ed by he ac ha i is s ill de ec ed in he
di e en ia ed sec ion o he c yp - illus uni , albei weake han in he lowe po ions,
a guing o some ac i i y in his compa men ha migh no be CDX2-o ien ed.
Rega ding he spa ial compa men aliza ion in P bodies, we did no add ess i
hese a e unc ionally ele an o i MEX3A e ec on mRNA akes place as e icien ly
in he cy oplasm. Ne e heless, e olu iona y compa a i e da a suppo s his speci ic
localiza ion. C. elegans MEX-3 is in ol ed in he co ec seg ega ion o la ge oci
known as P g anules o he inal ge mline p ecu so (D ape e al. 1996; Schisa e al.
2001; Jud e al. 2007). P g anules a e memb ane- ee ibonucleop o ein cy oplasmic
s uc u es ha p ima ily con ain ma e nally exp essed mRNAs alongside componen s
sha ed wi h bo h P bodies and s ess g anules (Updike and S ome 2010). These h ee
disc e e mic odomains a e dynamically and e e sibly induced in esponse o
en i onmen al signals. Thus, hei na u e seems o be in acco dance wi h a unc ion
in main aining o modi ying ce ain RNA p ope ies, delaying o e en p e en ing he
ansla ional p ocess. Inhibi ion o speci ic P body componen s h ough an RNAi
s a egy will help o shed ligh o e MEX3A unc ional equi emen s. We showed ha
MEX3A in e ac s wi h CDX2 mRNA h ough a canonical MRE p esen in he 3`UTR. This
5.3 MECHANISTIC ASPECTS OF MEX3A FUNCTION
CHAPTER 5. DISCUSSION AND CONCLUDING REMARKS
does no exclude he possibili y o MEX3A ecognizing ei he di e en a ia ions o
he degene a e sequence desc ibed o MEX-3 binding in C. elegans (Pagano e al.
2009) o e en o he unknown sequences; howe e , i p o ides an ancho poin o
sea ch o new a ge s. We ha e no assessed i he in e ac ion is di ec o media ed
by ano he RBP ha complexes wi h MEX3A, ei he h ough i s RING domain o e en
h ough he KH domains, as hese ha e also been shown o media e p o ein
oligome iza ion in some ins ances (Chen e al. 1997). RNA elec opho e ic mobili y
gel shi assays
wi h
a
p obe
con aining
he
CDX2
3`UTR
MRE
sequence
oge he
wi h
a
MEX3A ecombinan p o ein will p o ide a de ini i e answe conce ning his
issue. Ano he aspec ha was no ad anced is MEX3A own sequence and/o
s uc u al in e ac ion de e minan s. MEX-3 p o eins possess ype I KH domains, which
consis o h ee-s anded an ipa allel β-shee s, o ien ed agains h ee α-helices. The
s able β-α-α-β-β-α con o ma ion exposes a lexible loop be ween he i s wo
helices, occupied by semi-conse ed posi i ely cha ged esidues in a Gly-X-X-Gly
mo i (Val e de e al. 2008). E en hough he o al numbe o sol ed s uc u es wi h
79
CHAPTER 5. DISCUSSION AND CONCLUDING REMARKS
eigh -cell s age, which p ecedes es ablishmen o dis inc cell popula ions (Rals on
and Rossan 2008; Jed usik e al. 2010). Since hese cells will gi e ise o bo h he inne
cell mass and TE, he co olla y o his delay is ha Cdx2 mus be ep essed du ing
ini ial apola di isions, and upon induc ion i mus be silenced and main ained as
cells a e alloca ed o inside o ou side posi ions, espec i ely. T ansc ip ional con ol
in esponse o lineage seg ega ion is an al eady es ablished means o egula ing
Cdx2 (Nishioka e al. 2009), bu i is no well unde s ood how his is imposed in he i s
place.
Asymme ic cell di isions p oduce daugh e cells wi h dis inc a es, and ely on
he dis inc seg ega ion o key de e minan s, including localized mRNAs.
Acco dingly, i was epo ed ha Cdx2 ansc ip s become p e e en ially localized
apically a he la e eigh -cell s age and asymme ically inhe i ed du ing mouse
de elopmen a he eigh - o six een-cell s age ansi ion (Jed usik e al. 2008). This
was no seen o ansc ip s encoding o he cell commi men ansc ip ion ac o s,
like Nanog. A compelling hypo hesis is ha MEX3A migh con ibu e o he ini ial
Cdx2 mRNA ep ession and possibly o i s apical en ichmen , ecapi ula ing C.
elegans MEX-3 e ec o e pal-1. This possibili y is s eng hened by a epo showing
ha in mouse Cdx2 asymme ic localiza ion depends on a minimal cis-elemen
comp ising he las 97 nucleo ides o he ansc ip open eading ame (Skamagki e
al. 2013), whe e we had al eady iden i ied one MRE and ano he one close
ups eam. Assuming his scena io, MEX3A migh be in ol ed in he egula ion o he
Cdx2 ansc ip ansla ion in an emb yonic se ing o e en in i s anspo , as i was
demons a ed ha in ac mic o ubules and ac in cy oskele on, oge he wi h he
ac i i y o mo o p o eins o he kinesin supe amily a e a equi emen o his
asymme ic localiza ion (Skamagki e al. 2013). Thus, MEX3 p o eins migh ac as
conse ed componen s o he cell pola iza ion pa hway con ibu ing o CDX2
egula ion du ing mammalian emb yogenesis, he eby linking gene egula ion and
posi ional in o ma ion.

CHAPTER 5. DISCUSSION AND CONCLUDING REMARKS
Wi h his wo k, we ha e ad anced he knowledge on he molecula
mechanisms o CDX2 egula ion. On one hand, ou esul s suppo he lack o
e idence in a o o a ole o me hyla ion on de no o CDX2 exp ession in he
gas i is-me aplasia-ca cinoma sequence, con ibu ing o sol e an ambiguous opic
in he ield. On he o he hand, we p o ide e idence o a new mechanism o CDX2
pos - ansc ip ional egula ion media ed by he RNA-binding p o ein MEX3A. The
ele ance o MEX3A jus s a ed o be un a eled, bu ou da a poin s owa ds i s
in ol emen in in es inal homeos asis and possibly gas oin es inal ca cinogenesis,
wi h e ec s in cellula pola i y and s emness. In his ega d, we will now asce ain he
ole o MEX3A by s udying i s exp ession in p eneoplas ic and neoplas ic lesions, as
well as i s co ela ion wi h CDX2 and clinicopa hological pa ame e s. In pa allel, we
will es ablish a ansgenic mouse model wi h condi ional and inducible MEX3A
exp ession in he illi compa men o he in es ine, in o de o assess he e ec s o
ec opic MEX3A o e he in es inal pheno ype. This will be complemen ed by a
ansc ip ome-wide analysis o MEX3A egula o y in e ac ions. O e all, we expec o
signi ican ly con ibu e o he unde s anding o he impac o MEX3A pos -
ansc ip ional con ol on gene exp ession, bo h in homeos asis and disease.
E en conside ing MEX-3 well-desc ibed ole in C. elegans emb yonic
de elopmen and main enance o cell o ipo ency, i is ema kable o ind such a
ma ked deg ee o unc ional pa allelism in highe o ganisms, a ea u e ha one can
p edic o e lec he impo ance o his p o ein amily. Consequen ly, i seems we
ha e disclosed a case o e olu iona y conse a ion ha migh ha e majo
implica ions o basic and clinical esea ch.
87
5.6 CONCLUDING REMARKS
89
Re e ences
91

REFERENCES
Aliaga JC, Deschênes C, Beaulieu JF, Cal o EL, Ri a d N. 1999. Requi emen o he
MAP kinase cascade o cell cycle p og ession and di e en ia ion o human
in es inal cells. Am J Physiol 277: G631-641.
Almeida R, Sil a E, San os-Sil a F, Silbe g DG, Wang J, De Bolós C, Da id L. 2003.
Exp ession o in es ine-speci ic ansc ip ion ac o s, CDX1 and CDX2, in
in es inal me aplasia and gas ic ca cinomas. J Pa hol 199: 36-40.
Anan ha aman V, Koonin E, A a ind L. 2002. Compa a i e genomics and e olu ion
o p o eins in ol ed in RNA me abolism. Nucleic Acids Res 30: 1427-1464.
Ande son P. 2008. Pos - ansc ip ional con ol o cy okine p oduc ion. Na Immunol 9:
353-359.
Ande son P, Kede sha N. 2006. RNA g anules. J Cell Biol 172: 803-808.
Aoki K, Kakizaki F, Sakashi a H, Manabe T, Aoki M, Take o MM. 2011. Supp ession o
colonic polyposis by homeop o ein CDX2 h ough i s non ansc ip ional unc ion
ha s abilizes p27Kip1. Cance Res 71: 593-602.
Aoki K, Tamai Y, Ho iike S, Oshima M, Take o MM. 2003. Colonic polyposis caused by
mTOR-media ed ch omosomal ins abili y in Apc+/Del a716 Cdx2+/- compound
mu an mice. Na Gene 35: 323-330.
A iz M, Mainpal R, Sub amaniam K. 2009. C. elegans RNA-binding p o eins PUF-8 and
MEX-3 unc ion edundan ly o p omo e ge mline s em cell mi osis. De Biol 326:
295-304.
Asonuma S, Ima ani A, Asano N, Oikawa T, Konishi H, Iijima K, Koike T, Oha a S,
Shimosegawa T. 2009. Helicobac e pylo i induces gas ic mucosal in es inal
me aplasia h ough he inhibi ion o in e leukin-4-media ed HMG box p o ein
Sox2 exp ession. Am J Physiol Gas oin es Li e Physiol 297: G312-322.
Bai YQ, Miyake S, Iwai T, Yuasa Y. 2003. CDX2, a homeobox ansc ip ion ac o ,
up egula es ansc ip ion o he p21/WAF1/CIP1 gene. Oncogene 22: 7942-
7949.
Bai YQ, Yamamo o H, Akiyama Y, Tanaka H, Takizawa T, Koike M, Kenji Yagi O, Sai oh
K, Takeshi a K, Iwai T e al. 2002. Ec opic exp ession o homeodomain p o ein
CDX2 in in es inal me aplasia and ca cinomas o he s omach. Cance Le 176:
47-55.
Ba ke N, Huch M, Kujala P, an de We e ing M, Snippe HJ, an Es JH, Sa o T, S ange
DE, Beg hel H, an den Bo n M e al. 2010. Lg 5(+ e) s em cells d i e sel -
enewal in he s omach and build long-li ed gas ic uni s in i o. Cell S em Cell
6: 25-36.
Ba ke N, Ridgway RA, an Es JH, an de We e ing M, Beg hel H, an den Bo n M,
Danenbe g E, Cla ke AR, Sansom OJ, Cle e s H. 2009. C yp s em cells as he
cells-o -o igin o in es inal cance . Na u e 457: 608-611.
REFERENCES
Ba ke N, an Es JH, Kuipe s J, Kujala P, an den Bo n M, Cozijnsen M, Haegeba h A,
Ko ing J, Beg hel H, Pe e s PJ e al. 2007. Iden i ica ion o s em cells in small
in es ine and colon by ma ke gene Lg 5. Na u e 449: 1003-1007.
Ba ke N, an Oudenaa den A, Cle e s H. 2012. Iden i ying he s em cell o he
in es inal c yp : s a egies and pi alls. Cell S em Cell 11: 452-460.
Ba os R, da Cos a LT, Pin o-de-Sousa J, Duluc I, F eund JN, Da id L, Almeida R. 2011.
CDX2 au o egula ion in human in es inal me aplasia o he s omach: impac on
he s abili y o he pheno ype. Gu 60: 290-298.
Ba os R, F eund JN, Da id L, Almeida R. 2012. Gas ic in es inal me aplasia e isi ed:
unc ion and egula ion o CDX2. T ends Mol Med 18: 555-563.
Ba os R, Ma cos N, Reis CA, De Luca A, Da id L, Almeida R. 2009a. CDX2 exp ession
is induced by Helicobac e pylo i in AGS cells. Scand J Gas oen e ol 44: 124-
125.
Ba os R, Mendes N, Howe JR, Reis CA, de Bolos C, Ca nei o F, Da id L, Almeida R.
2009b. Ju enile polyps ha e gas ic di e en ia ion wi h MUC5AC exp ession
and down egula ion o CDX2 and SMAD4. His ochem Cell Biol 131: 765-772.
Ba os R, Pele ei o B, Almeida R, Figuei edo C, Ba os H, Da id L, Lune N. 2010.
Rele ance o high i ulence Helicobac e pylo i s ains and u ili y o CDX2
exp ession o p edic ing in es inal me aplasia a e e adica ion o in ec ion.
Scand J Gas oen e ol 45: 828-834.
Ba os R, Pe ei a B, Duluc I, Aze edo M, Mendes N, Camilo V, Jacobs RJ, Paulo P,
San os-Sil a F, an Seuningen I e al. 2008. Key elemen s o he BMP/SMAD
pa hway co-localize wi h CDX2 in in es inal me aplasia and egula e CDX2
exp ession in human gas ic cell lines. J Pa hol 215: 411-420.
Baumann C, Kö ne R, Ho mann K, Nigg EA. 2007. PICH, a cen ome e-associa ed
SNF2 amily ATPase, is egula ed by Plk1 and equi ed o he spindle
checkpoin . Cell 128: 101-114.
Beck F, Chawengsaksophak K, Lucke J, Gible S, Tucci J, B own J, Poulsom R,
Je e y R, W igh NA. 2003. A s udy o egional gu endode m po ency by
analysis o Cdx2 null mu an chimae ic mice. De Biol 255: 399-406.
Beck F, Chawengsaksophak K, Wa ing P, Play o d RJ, Fu ness JB. 1999.
Rep og amming o in es inal di e en ia ion and in e cala y egene a ion in
Cdx2 mu an mice. P oc Na l Acad Sci U S A 96: 7318-7323.
Beck F, E le T, Russell A, James R. 1995. Exp ession o Cdx-2 in he mouse emb yo and
placen a: possible ole in pa e ning o he ex a-emb yonic memb anes. De
Dyn 204: 219-227.
Benahmed F, G oss I, Gaun SJ, Beck F, Jehan F, Domon-Dell C, Ma in E, Kedinge M,
F eund JN, Duluc I. 2008. Mul iple egula o y egions con ol he complex
93
REFERENCES
exp ession pa e n o he mouse Cdx2 homeobox gene. Gas oen e ology 135:
1238.
Benahmed F, G oss I, Gueno D, Jehan F, Ma in E, Domon-Dell C, B able z T,
Kedinge M, F eund JN, Duluc I. 2007. The mic oen i onmen con ols CDX2
homeobox gene exp ession in colo ec al cance cells. Am J Pa hol 170: 733-
744.
Bje knes M, Cheng H. 1999. Clonal analysis o mouse in es inal epi helial p ogeni o s.
Gas oen e ology 116: 7-14.
Blache P, an de We e ing M, Duluc I, Domon C, Be a P, F eund JN, Cle e s H, Jay P.
2004. SOX9 is an in es ine c yp ansc ip ion ac o , is egula ed by he Wn
pa hway, and ep esses he CDX2 and MUC2 genes. J Cell Biol 166: 37-47.
Bleuming SA, Kodach LL, Ga cia Leon MJ, Richel DJ, Peppelenbosch MP, Rei sma PH,
Ha dwick JC, an den B ink GR. 2006. Al e ed bone mo phogene ic p o ein
signalling in he Helicobac e pylo i-in ec ed s omach. J Pa hol 209: 190-197.
Bonhomme C, Calon A, Ma in E, Robine S, Neu ille A, Kedinge M, Domon-Dell C,
Duluc I, F eund JN. 2008. Cdx1, a dispensable homeobox gene o gu
de elopmen wi h limi ed e ec in in es inal cance . Oncogene 27: 4497-4502.
Bonhomme C, Duluc I, Ma in E, Chawengsaksophak K, Chena d MP, Kedinge M,
Beck F, F eund JN, Domon-Dell C. 2003. The Cdx2 homeobox gene has a
umou supp esso unc ion in he dis al colon in addi ion o a homeo ic ole
du ing gu de elopmen . Gu 52: 1465-1471.
Bo nschein J, Wex T, Pei z U, Kues e D, Roessne A, Mal e heine P. 2009. The
combined p esence o H pylo i in ec ion and gas o-oesophageal e lux
disease leads o an up- egula ion o CDX2 gene exp ession in an um and
ca dia. J Clin Pa hol 62: 254-259.
Bosman FT, Ca nei o F, H uban RH, Theise ND. 2010. WHO classi ica ion o umou s o
he diges i e sys em, 4 h edi ion. IARC P ess, Lyon.
Boud eau F, Rings EH, an We ing HM, Kim RK, Swain GP, K asinski SD, Mo e J,
G and RJ, Suh ER, T abe PG. 2002. Hepa ocy e nuclea ac o -1 alpha, GATA-4,
and caudal ela ed homeodomain p o ein Cdx2 in e ac unc ionally o
modula e in es inal gene ansc ip ion. Implica ion o he de elopmen al
egula ion o he suc ase-isomal ase gene. J Biol Chem 277: 31909-31917.
Boulange J, Vézina A, Mong ain S, Boud eau F, Pe eaul N, Auclai BA, Lainé J,
Asselin C, Ri a d N. 2005. Cdk2-dependen phospho yla ion o homeobox
ansc ip ion ac o CDX2 egula es i s nuclea ansloca ion and p o easome-
media ed deg ada ion in human in es inal epi helial cells. J Biol Chem 280:
18095-18107.
Boyd M, Hansen M, Jensen TG, Pe ea nau A, Olsen AK, B am LL, Bak M, Tomme up N,
Olsen J, T oelsen JT. 2010. Genome-wide analysis o CDX2 binding in in es inal
epi helial cells (Caco-2). J Biol Chem 285: 25115-25125.
REFERENCES
B able z T, Spade na S, Kolb J, Hlubek F, Falle G, B uns CJ, Jung A, Nen wich J, Duluc
I, Domon-Dell C e al. 2004. Down- egula ion o he homeodomain ac o Cdx2
in colo ec al cance by collagen ype I: an ac i e ole o he umo
en i onmen in malignan umo p og ession. Cance Res 64: 6973-6977.
B a o JC, Co ea P. 1999. Sulphomucins a ou adhesion o Helicobac e pylo i o
me aplas ic gas ic mucosa. J Clin Pa hol 52: 137-140.
B own S, Felle s J, Shippy T, Denell R, S aube M, Schmid -O U. 2001. A s a egy o
mapping bicoid on he phylogene ic ee. Cu Biol 11: R43-44.
B y L, Falk P, Hu ne K, Ouelle e A, Mid ed T, Go don JI. 1994. Pane h cell
di e en ia ion in he de eloping in es ine o no mal and ansgenic mice. P oc
Na l Acad Sci U S A 91: 10335-10339.
Buche -Poyau K, Cou che J, Le Hi H, Sé aphin B, Scoazec JY, Du e L, Domon-Dell C,
F eund JN, Billaud M. 2007. Iden i ica ion and cha ac e iza ion o human Mex-3
p o eins, a no el amily o e olu iona ily conse ed RNA-binding p o eins
di e en ially localized o p ocessing bodies. Nucleic Acids Res 35: 1289-1300.
Busà R, Pa one o MP, Fa ini D, Pie an ozzi E, Bo i F, Angelini DF, A isani F, Vespasiani
G, Se e C. 2007. The RNA-binding p o ein Sam68 con ibu es o p oli e a ion
and su i al o human p os a e cance cells. Oncogene 26: 4372-4382.
Camilo V, Ba os R, Sousa S, Magalhães AM, Lopes T, Má io San os A, Pe ei a T,
Figuei edo C, Da id L, Almeida R. 2012. Helicobac e pylo i and he BMP
pa hway egula e CDX2 and SOX2 exp ession in gas ic cells. Ca cinogenesis
33: 1985-1992.
Chawengsaksophak K, James R, Hammond VE, Kön gen F, Beck F. 1997. Homeosis
and in es inal umou s in Cdx2 mu an mice. Na u e 386: 84-87.
Chen AJ, Paik JH, Zhang H, Shukla SA, Mo ensen R, Hu J, Ying H, Hu B, Hu J, Fa ny N
e al. 2012. STAR RNA-binding p o ein Quaking supp esses cance ia
s abiliza ion o speci ic miRNA. Genes De 26: 1459-1472.
Chen T, Damaj BB, He e a C, Lasko P, Richa d S. 1997. Sel -associa ion o he single-
KH-domain amily membe s Sam68, GRP33, GLD-1, and Qk1: ole o he KH
domain. Mol Cell Biol 17: 5707-5718.
Cheng H, Leblond CP. 1974. O igin, di e en ia ion and enewal o he ou main
epi helial cell ypes in he mouse small in es ine. V. Uni a ian Theo y o he o igin
o he ou epi helial cell ypes. Am J Ana 141: 537-561.
Cho PF, Poulin F, Cho-Pa k YA, Cho-Pa k IB, Chicoine JD, Lasko P, Sonenbe g N. 2005.
A new pa adigm o ansla ional con ol: inhibi ion ia 5'-3' mRNA e he ing by
Bicoid and he eIF4E cogna e 4EHP. Cell 121: 411-423.
Chun SY, Chen F, Washbu n JG, MacDonald JW, Innes KL, Zhao R, C uz-Co ea MR,
Dang LH, Dang DT. 2007. CDX2 p omo es ancho age-independen g ow h by
ansc ip ional ep ession o IGFBP-3. Oncogene 26: 4725-4729.
95
REFERENCES
Jackson RJ, Hellen CU, Pes o a TV. 2010. The mechanism o euka yo ic ansla ion
ini ia ion and p inciples o i s egula ion. Na Re Mol Cell Biol 11: 113-127.
James R, E le T, Kazenwadel J. 1994. S uc u e o he mu ine homeobox gene cdx-2.
Exp ession in emb yonic and adul in es inal epi helium. J Biol Chem 269: 15229-
15237.
James R, Kazenwadel J. 1991. Homeobox gene exp ession in he in es inal epi helium
o adul mice. J Biol Chem 266: 3246-3251.
Jed usik A, B uce AW, Tan MH, Leong DE, Skamagki M, Yao M, Ze nicka-Goe z M.
2010. Ma e nally and zygo ically p o ided Cdx2 ha e no el and c i ical oles o
ea ly de elopmen o he mouse emb yo. De Biol 344: 66-78.
Jed usik A, Pa i DE, Guo G, Skamagki M, G aba ek JB, Johnson MH, Robson P,
Ze nicka-Goe z M. 2008. Role o Cdx2 and cell pola i y in cell alloca ion and
speci ica ion o ophec ode m and inne cell mass in he mouse emb yo.
Genes De 22: 2692-2706.
Jiang H, Zhang X, Luo J, Dong C, Xue J, Wei W, Chen J, Zhou J, Gao Y, Yang C. 2012.
Knockdown o hMex-3A by small RNA in e e ence supp esses cell p oli e a ion
and mig a ion in human gas ic cance cells. Mol Med Rep 6: 575-580.
Jin T, D ucke DJ. 1996. Ac i a ion o p oglucagon gene ansc ip ion h ough a no el
p omo e elemen by he caudal- ela ed homeodomain p o ein cdx-2/3. Mol
Cell Biol 16: 19-28.
Johnson CM, Wei C, Enso JE, Smolenski DJ, Amos CI, Le in B, Be y DA. 2013. Me a-
analyses o colo ec al cance isk ac o s. Cance Causes Con ol 24: 1207-1222.
Johnson JM, Cas le J, Ga e -Engele P, Kan Z, Loe ch PM, A mou CD, San os R,
Schad EE, S ough on R, Shoemake DD. 2003. Genome-wide su ey o human
al e na i e p e-mRNA splicing wi h exon junc ion mic oa ays. Science 302:
2141-2144.
Jud M, Razelun J, Bickel J, Cze winski M, Schisa JA. 2007. Conse a ion o la ge oci
o ma ion in a es ed oocy es o Caeno habdi is nema odes. De Genes E ol
217: 221-226.
Kahyo T, Iwaizumi M, Shinmu a K, Ma suu a S, Nakamu a T, Wa anabe Y, Yamada H,
Sugimu a H. 2011. A no el umo -de i ed SGOL1 a ian causes abno mal
mi osis and uns able ch oma id cohesion. Oncogene 30: 4453-4463.
Kaimak chie V, Te acciano L, To nillo L, Spich in H, S oios D, Bundi M, Ko che a V,
Mi lache M, Loda M, Sau e G e al. 2004. The homeobox in es inal
di e en ia ion ac o CDX2 is selec i ely exp essed in gas oin es inal
adenoca cinomas. Mod Pa hol 17: 1392-1399.
Kakizaki F, Aoki K, Miyoshi H, Ca asco N, Aoki M, Take o MM. 2010. CDX ansc ip ion
ac o s posi i ely egula e exp ession o solu e ca ie amily 5, membe 8 in he
colonic epi helium. Gas oen e ology 138: 627-635.

REFERENCES
Ka am SM. 1999. Lineage commi men and ma u a ion o epi helial cells in he gu .
F on Biosci 4: D286-298.
Kawai H, Tomii K, Toyooka S, Yano M, Mu akami M, Tsukuda K, Shimizu N. 2005.
P omo e me hyla ion down egula es CDX2 exp ession in colo ec al
ca cinomas. Oncol Rep 13: 547-551.
Kazumo i H, Ishiha a S, Rumi M, Kadowaki Y, Kinoshi a Y. 2006. Bile acids di ec ly
augmen caudal ela ed homeobox gene Cdx2 exp ession in oesophageal
ke a inocy es in Ba e 's epi helium. Gu 55: 16-25.
Keene JD. 2007. RNA egulons: coo dina ion o pos - ansc ip ional e en s. Na Re
Gene 8: 533-543.
Keene JD, Tenenbaum SA. 2002. Euka yo ic mRNPs may ep esen pos ansc ip ional
ope ons. Mol Cell 9: 1161-1167.
Kemphues KJ, P iess JR, Mo on DG, Cheng NS. 1988. Iden i ica ion o genes equi ed
o cy oplasmic localiza ion in ea ly C. elegans emb yos. Cell 52: 311-320.
Kim BM, Buchne G, Mile ich I, Sha pe PT, Shi dasani RA. 2005. The s omach
mesenchymal ansc ip ion ac o Ba x1 speci ies gas ic epi helial iden i y
h ough inhibi ion o ansien Wn signaling. De Cell 8: 611-622.
Kim HS, Lee JS, F eund JN, Min KW, Lee JS, Kim W, Juhng SW, Pa k CS. 2006. CDX-2
homeobox gene exp ession in human gas ic ca cinoma and p ecu so lesions.
J Gas oen e ol Hepa ol 21: 438-442.
Kim S, Domon-Dell C, Wang Q, Chung DH, Di C is o ano A, Pandol i PP, F eund JN,
E e s BM. 2002. PTEN and TNF-alpha egula ion o he in es inal-speci ic Cdx-2
homeobox gene h ough a PI3K, PKB/Ak , and NF-kappaB-dependen
pa hway. Gas oen e ology 123: 1163-1178.
Ki chne T, Mülle S, Ha o i T, Mukaisyo K, Papadopoulos T, B able z T, Jung A. 2001.
Me aplasia, in aepi helial neoplasia and ea ly cance o he s omach a e
ela ed o dedi e en ia ed epi helial cells de ined by cy oke a in-7 exp ession in
gas i is. Vi chows A ch 439: 512-522.
Köhle A, Hu E. 2007. Expo ing RNA om he nucleus o he cy oplasm. Na Re Mol
Cell Biol 8: 761-773.
K uege F, Madeja Z, Hembe ge M, McMahon M, Cook SJ, Gaun SJ. 2009. Down-
egula ion o Cdx2 in colo ec al ca cinoma cells by he Ra -MEK-ERK 1/2
pa hway. Cell Signal 21: 1846-1856.
Kue s en S, Goodwin EB.
2003. The powe o he 3′ UTR: ansla ional con ol and
de elopmen . Na Re Gene 4: 626-637.
Lambe M, Colno S, Suh E, L'Ho se F, Blin C, Callio ME, Raymondjean M, Thomasse
M, T abe PG, Pe e C. 1996. cis-Ac ing elemen s and ansc ip ion ac o s
in ol ed in he in es inal speci ic exp ession o he a calbindin-D9K gene:
103
REFERENCES
binding o he in es ine-speci ic ansc ip ion ac o Cdx-2 o he TATA box. Eu J
Biochem 236: 778-788.
Lau en P. 1965. The wo his ological main ypes o gas ic ca cinoma: di use and so-
called in es inal- ype ca cinoma. An a emp a a his o-clinical classi ica ion.
Ac a Pa hol Mic obiol Scand 64: 31-49.
Lee MH, Schedl T. 2001. Iden i ica ion o in i o mRNA a ge s o GLD-1, a maxi-KH
mo i con aining p o ein equi ed o C. elegans ge m cell de elopmen . Genes
De 15: 2408-2420.
Lemieux E, Bouche MJ, Mong ain S, Boud eau F, Asselin C, Ri a d N. 2011.
Cons i u i e ac i a ion o he MEK/ERK pa hway inhibi s in es inal epi helial cell
di e en ia ion. Am J Physiol Gas oin es Li e Physiol 301: G719-730.
Lenge ke C, Daley GQ. 2012. Caudal genes in blood de elopmen and leukemia.
Ann N Y Acad Sci 1266: 47-54.
Lewis JD, Izau alde E. 1997. The ole o he cap s uc u e in RNA p ocessing and
nuclea expo . Eu J Biochem 247: 461-469.
Liu Q, Teh M, I o K, Shah N, I o Y, Yeoh KG. 2007a. CDX2 exp ession is p og essi ely
dec eased in human gas ic in es inal me aplasia, dysplasia and cance . Mod
Pa hol 20: 1286-1297.
Liu T, Zhang X, So CK, Wang S, Wang P, Yan L, Mye s R, Chen Z, Pa e son AP, Yang
CS e al. 2007b. Regula ion o Cdx2 exp ession by p omo e me hyla ion, and
e ec s o Cdx2 ans ec ion on mo phology and gene exp ession o human
esophageal epi helial cells. Ca cinogenesis 28: 488-496.
Lo en z O, Cado e A, Duluc I, Capeau J, Gespach C, Che qui G, F eund JN. 1999.
Down egula ion o he colon umou -supp esso homeobox gene Cdx-2 by
oncogenic as. Oncogene 18: 87-92.
Lo en z O, Duluc I, A cangelis AD, Simon-Assmann P, Kedinge M, F eund JN. 1997.
Key ole o he Cdx2 homeobox gene in ex acellula ma ix-media ed in es inal
cell di e en ia ion. J Cell Biol 139: 1553-1565.
Lu X, F eund JN, Mulle M, Ra ey J, Nicolas JP, Guean JL, Namou F. 2008. Di e en ial
egula ion o CDX1 and CDX2 gene exp ession by de iciency in me hyl g oup
dono s. Biochimie 90: 697-704.
Lukong KE, Chang KW, Khandjian EW, Richa d S. 2008. RNA-binding p o eins in
human gene ic disease. T ends Gene 24: 416-425.
Lukong KE, La ocque D, Tyne A, Richa d S. 2005. Ty osine phospho yla ion o sam68
by b eas umo kinase egula es in anuclea localiza ion and cell cycle
p og ession. J Biol Chem 280: 38639-38647.
Lunde BM, Moo e C, Va ani G. 2007. RNA-binding p o eins: modula design o
e icien unc ion. Na Re Mol Cell Biol 8: 479-490.
REFERENCES
Luo Y, Shan G, Guo W, Sm RD, Johnson EB, Li X, P ei e RL, Szulwach KE, Duan R,
Ba kho BZ e al. 2010. F agile x men al e a da ion p o ein egula es p oli e a ion
and di e en ia ion o adul neu al s em/p ogeni o cells. PLoS Gene 6:
e1000898.
Maha an CS, Kaes ne KH, Geiman DE, Yang VW. 1999. Cha ac e iza ion o he
s uc u e and egula ion o he mu ine gene encoding gu -en iched K üppel-like
ac o (K üppel-like ac o 4). Nucleic Acids Res 27: 4562-4569.
Maie T, Güell M, Se ano L. 2009. Co ela ion o mRNA and p o ein in complex
biological samples. FEBS Le 583: 3966-3973.
Mallo GV, Rech eche H, F ige io JM, Rocha D, Zweibaum A, Lacasa M, Jo dan BR,
Duse i NJ, Dago n JC, Io anna JL. 1997. Molecula cloning, sequencing and
exp ession o he mRNA encoding human Cdx1 and Cdx2 homeobox. Down-
egula ion o Cdx1 and Cdx2 mRNA exp ession du ing colo ec al
ca cinogenesis. In J Cance 74: 35-44.
Mallo GV, Soubey an P, Lissi zky JC, And é F, Fa na ie C, Ma aldi J, Dago n JC,
Io anna JL. 1998. Exp ession o he Cdx1 and Cdx2 homeo ic genes leads o
educed malignancy in colon cance -de i ed cells. J Biol Chem 273: 14030-
14036.
Mangus DA, E ans MC, Jacobson A. 2003. Poly(A)-binding p o eins: mul i unc ional
sca olds o he pos - ansc ip ional con ol o gene exp ession. Genome Biol 4:
223.
Ma che i M, Calio E, P ingaul E. 2003. Ch onic acid exposu e leads o ac i a ion o
he cdx2 in es inal homeobox gene in a long- e m cul u e o mouse
esophageal ke a inocy es. J Cell Sci 116: 1429-1436.
Ma gali Y, Ya us S, Shapi a E, G uenbaum Y, Fainsod A. 1993. Isola ion and
cha ac e iza ion o a ge sequences o he chicken CdxA homeobox gene.
Nucleic Acids Res 21: 4915-4922.
Ma lin AJ, Cla k F, Smi h CW. 2005. Unde s anding al e na i e splicing: owa ds a
cellula code. Na Re Mol Cell Biol 6: 386-398.
Ma suda K, Yamauchi K, Ma sumo o T, Sano K, Yamaoka Y, O a H. 2008. Quan i a i e
analysis o he e ec o Helicobac e pylo i on he exp essions o SOX2, CDX2,
MUC2, MUC5AC, MUC6, TFF1, TFF2, and TFF3 mRNAs in human gas ic
ca cinoma cells. Scand J Gas oen e ol 43: 25-33.
Me los-Suá ez A, Ba iga FM, Jung P, Iglesias M, Céspedes MV, Rossell D, Se illano M,
He nando-Momblona X, da Sil a-Diz V, Muñoz P e al. 2011. The in es inal s em
cell signa u e iden i ies colo ec al cance s em cells and p edic s disease
elapse. Cell S em Cell 8: 511-524.
Mesqui a P, Jonckhee e N, Almeida R, Ducou ouble MP, Se pa J, Sil a E, Pigny P,
Sil a FS, Reis C, Silbe g D e al. 2003. Human MUC2 mucin gene is
105
REFERENCES
ansc ip ionally egula ed by Cdx homeodomain p o eins in gas oin es inal
ca cinoma cell lines. J Biol Chem 278: 51549-51556.
Mesqui a P, Raquel A, Nuno L, Reis CA, Sil a LF, Se pa J, Van Seuningen I, Ba os H,
Da id L. 2006. Me aplasia--a ansdi e en ia ion p ocess ha acili a es cance
de elopmen : he model o gas ic in es inal me aplasia. C i Re Oncog 12: 3-
26.
Milano F, an Baal JW, Bu a NS, Rygiel AM, de Ko F, DeMa s CJ, Rosmolen WD,
Be gman JJ, Van Ma le J, Wang KK e al. 2007. Bone mo phogene ic p o ein 4
exp essed in esophagi is induces a columna pheno ype in esophageal
squamous cells. Gas oen e ology 132: 2412-2421.
Mizoshi a T, Inada K-i, Tsukamo o T, Nozaki K, Joh T, I oh M, Yamamu a Y, Ushijima T,
Nakamu a S, Ta ema su M. 2004. Exp ession o he in es ine-speci ic ansc ip ion
ac o s, Cdx1 and Cdx2, co ela es shi o an in es inal pheno ype in gas ic
cance cells. J Cance Res Clin Oncol 130: 29-36.
Mlodzik M, Fjose A, Geh ing WJ. 1985. Isola ion o caudal, a D osophila homeo box-
con aining gene wi h ma e nal exp ession, whose ansc ip s o m a
concen a ion g adien a he p e-blas ode m s age. EMBO J 4: 2961-2969.
Modica S, Mo gano A, Sal a o e L, Pe uzzelli M, Vanie MT, Valanzano R, Esposi o DL,
Palasciano G, Duluc I, F eund JN e al. 2009. Exp ession and localisa ion o
insulin ecep o subs a e 2 in no mal in es ine and colo ec al umou s.
Regula ion by in es ine-speci ic ansc ip ion ac o CDX2. Gu 58: 1250-1259.
Moo e MJ. 2005. F om Bi h o Dea h: The Complex Li es o Euka yo ic mRNAs.
Science 309: 1514-1518.
Moo z D, Ho DM, Hun e CP. 2004. The STAR/Maxi-KH domain p o ein GLD-1 media es
a de elopmen al swi ch in he ansla ional con ol o C. elegans PAL-1.
De elopmen 131: 3263-3272.
Moskaluk CA, Zhang H, Powell SM, Ce illi LA, Hamp on GM, F ie son HFJ . 2003. Cdx2
p o ein exp ession in no mal and malignan human issues: an
immunohis ochemical su ey using issue mic oa ays. Mod Pa hol 16: 913-919.
Mu oh H, Hakama a Y, Sa o K, Eda A, Yanaka I, Honda S, Osawa H, Kaneko Y,
Sugano K. 2002. Con e sion o gas ic mucosa o in es inal me aplasia in Cdx2-
exp essing ansgenic mice. Biochem Biophys Res Commun 294: 470-479.
Mu oh H, Hayakawa H, Sakamo o H, Sashikawa M, Sugano K. 2009. T ansgenic Cdx2
induces endogenous Cdx1 in in es inal me aplasia o Cdx2- ansgenic mouse
s omach. FEBS J 276: 5821-5831.
Mu oh H, Hayakawa H, Sashikawa M, Sakamo o H, Sugano K. 2010. Di ec ep ession
o Sonic Hedgehog exp ession in he s omach by Cdx2 leads o in es inal
ans o ma ion. Biochem J 427: 423-434.
REFERENCES
Mu oh H, Saku ai S, Sa oh K, Osawa H, Tomiyama T, Ki a H, Yoshida T, Tamada K,
Yamamo o H, Isoda N e al. 2005a. Pe ic yp al ib oblas shea h in in es inal
me aplasia and gas ic ca cinoma. Gu 54: 33-39.
Mu oh H, Saku ai S, Sa oh K, Tamada K, Ki a H, Osawa H, Tomiyama T, Sa o Y,
Yamamo o H, Isoda N e al. 2004. De elopmen o gas ic ca cinoma om
in es inal me aplasia in Cdx2- ansgenic mice. Cance Res 64: 7740-7747.
Mu oh H, Sa oh K, Ki a H, Sakamo o H, Hayakawa H, Yamamo o H, Isoda N, Tamada
K, Ido K, Sugano K. 2005b. Cdx2 speci ies he di e en ia ion o mo phological as
well as unc ional abso p i e en e ocy es o he small in es ine. In J De Biol 49:
867-871.
Nagaoka K, Udagawa T, Rich e JD. 2012. CPEB-media ed ZO-1 mRNA localiza ion is
equi ed o epi helial igh -junc ion assembly and cell pola i y. Na Commun 3:
675.
Niessing D, Blanke S, Jäckle H. 2002. Bicoid associa es wi h he 5'-cap-bound
complex o caudal mRNA and ep esses ansla ion. Genes De 16: 2576-2582.
Nishioka N, Inoue K-i, Adachi K, Kiyona i H, O a M, Rals on A, Yabu a N, Hi aha a S,
S ephenson RO, Ogonuki N e al. 2009. The Hippo signaling pa hway
componen s La s and Yap pa e n Tead4 ac i i y o dis inguish mouse
ophec ode m om inne cell mass. De Cell 16: 398-410.
Niwa T, Ikeha a Y, Nakanishi H, Tanaka H, Inada K-i, Tsukamo o T, Ichinose M,
Ta ema su M. 2005. Mixed gas ic- and in es inal- ype me aplasia is o med by
cells wi h dual in es inal and gas ic di e en ia ion. J His ochem Cy ochem 53:
75-85.
Olsen AK, Coskun M, Bzo ek M, K is ensen MH, Danielsen ET, Jø gensen S, Olsen J,
Engel U, Holck S, T oelsen JT. 2013. Regula ion o APC and AXIN2 exp ession by
in es inal umo supp esso CDX2 in colon cance cells. Ca cinogenesis 34: 1361-
1369.
Os a eck DH, Os a eck-Lede e A, Sha sky IN, Hen ze MW. 2001. Lipoxygenase mRNA
silencing in e y h oid di e en ia ion: The 3'UTR egula o y complex con ols 60S
ibosomal subuni joining. Cell 104: 281-290.
Pacheco II, Macleod RJ. 2008. CaSR s imula es sec e ion o Wn 5a om colonic
myo ib oblas s o s imula e CDX2 and suc ase-isomal ase using Ro 2 on
in es inal epi helia. Am J Physiol Gas oin es Li e Physiol 295: G748-759.
Pagano JM, Fa ley BM, Essien KI, Ryde SP. 2009. RNA ecogni ion by he emb yonic
cell a e de e minan and ge mline o ipo ency ac o MEX-3. P oc Na l Acad
Sci U S A 106: 20252-20257.
Palla acchina G, F ançois S, Regnaul B, Cza ny B, Di e V, Cumano A, Mon a as D,
Buckingham M. 2010. An adul issue-speci ic s em cell in i s niche: a gene
p o iling analysis o in i o quiescen and ac i a ed muscle sa elli e cells. S em
Cell Res 4: 77-91.
107

REFERENCES
Palles C, Cazie JB, Howa h KM, Domingo E, Jones AM, B ode ick P, Kemp Z, Spain SL,
Gua ino E, Gua ino Almeida E e al. 2013. Ge mline mu a ions a ec ing he
p oo eading domains o POLE and POLD1 p edispose o colo ec al adenomas
and ca cinomas. Na Gene 45: 136-144.
Pa k J, Schulz S, Waldman SA. 2000. In es ine-speci ic ac i i y o he human guanylyl
cyclase C p omo e is egula ed by Cdx2. Gas oen e ology 119: 89-96.
Po e EM, Be ins CL, Ghosh D, Ganz T. 2002. The mul i ace ed Pane h cell. Cell Mol
Li e Sci 59: 156-170.
Po en CS. 1977. Ex eme sensi i i y o some in es inal c yp cells o X and gamma
i adia ion. Na u e 269: 518-521.
Po en CS, Boo h C, Tudo GL, Boo h D, B ady G, Hu ley P, Ash on G, Cla ke R,
Sakakiba a S-i, Okano H. 2003. Iden i ica ion o a pu a i e in es inal s em cell
and ea ly lineage ma ke ; musashi-1. Di e en ia ion 71: 28-41.
Po en CS, Ko acs L, Hamil on E. 1974. Con inuous labelling s udies on mouse skin
and in es ine. Cell Tissue Kine 7: 271-283.
Po en CS, Loe le M. 1990. S em cells: a ibu es, cycles, spi als, pi alls and
unce ain ies. Lessons o and om he c yp . De elopmen 110: 1001-1020.
Po en CS, Owen G, Boo h D. 2002. In es inal s em cells p o ec hei genome by
selec i e seg ega ion o empla e DNA s ands. J Cell Sci 115: 2381-2388.
P i cha d CC, G ady WM. 2011. Colo ec al cance molecula biology mo es in o
clinical p ac ice. Gu 60: 116-129.
Rals on A, Rossan J. 2008. Cdx2 ac s downs eam o cell pola iza ion o cell-
au onomously p omo e ophec ode m a e in he ea ly mouse emb yo. De
Biol 313: 614-629.
Reis CA, Da id L, Co ea P, Ca nei o F, de Bolós C, Ga cia E, Mandel U, Clausen H,
Sob inho-Simões M. 1999. In es inal me aplasia o human s omach displays
dis inc pa e ns o mucin (MUC1, MUC2, MUC5AC, and MUC6) exp ession.
Cance Res 59: 1003-1007.
Rhoads RE. 2009. eIF4E: new amily membe s, new binding pa ne s, new oles. J Biol
Chem 284: 16711-16715.
Rings EH, Boud eau F, Taylo JK, Mo e J, Suh ER, T abe PG. 2001. Phospho yla ion o
he se ine 60 esidue wi hin he Cdx2 ac i a ion domain media es i s
ansac i a ion capaci y. Gas oen e ology 121: 1437-1450.
Rokkas T, Filipe MI, Sladen GE. 1991. De ec ion o an inc eased incidence o ea ly
gas ic cance in pa ien s wi h in es inal me aplasia ype III who a e closely
ollowed up. Gu 32: 1110-1113.
Ro k ua P, Akiyama Y, Hashimo o Y, O subo T, Yuasa Y. 2011. MiR-9 down egula es
CDX2 exp ession in gas ic cance cells. In J Cance 129: 2611-2620.
REFERENCES
Sakagami Y, Inaguma Y, Sakaku a T, Nishizuka Y. 1984. In es ine-like emodeling o
adul mouse glandula s omach by implan ing o e al in es inal mesenchyme.
Cance Res 44: 5845-5849.
Sakaguchi T, Gu X, Golden HM, Suh E, Rhoads DB, Reinecke HC. 2002. Cloning o he
human claudin-2 5'- lanking egion e ealed a TATA-less p omo e wi h
conse ed binding si es in mouse and human o caudal- ela ed homeodomain
p o eins and hepa ocy e nuclea ac o -1alpha. J Biol Chem 277: 21361-21370.
Sakamo o H, Mu oh H, Hayakawa H, Sashikawa M, Sugano K. 2011. Cell lineage
dynamics in he p ocess leading o in es inal me aplasia. J Gas oen e ol 46:
620-628.
Sakamo o H, Mu oh H, Ido K, Sa oh K, Hayakawa H, Sugano K. 2007. A close
ela ionship be ween in es inal me aplasia and Cdx2 exp ession in human
gallbladde s wi h choleli hiasis. Hum Pa hol 38: 66-71.
Sala i K, Spulak ME, Cu J, Fo s e AD, Giacomini CP, Huang S, Ko ME, Lin AY, an de
Rijn M, Pollack JR. 2012. CDX2 is an ampli ied lineage-su i al oncogene in
colo ec al cance . P oc Na l Acad Sci U S A 109: E3196-3205.
Sampa h P, P i cha d DK, Pabon L, Reinecke H, Schwa z SM, Mo is DR, Mu y CE.
2008. A hie a chical ne wo k con ols p o ein ansla ion du ing mu ine
emb yonic s em cell sel - enewal and di e en ia ion. Cell S em Cell 2: 448-460.
Sangio gi E, Capecchi MR. 2008. Bmi1 is exp essed in i o in in es inal s em cells. Na
Gene 40: 915-920.
Sa o T, V ies RG, Snippe HJ, an de We e ing M, Ba ke N, S ange DE, an Es JH, Abo
A, Kujala P, Pe e s PJ e al. 2009. Single Lg 5 s em cells build c yp - illus s uc u es
in i o wi hou a mesenchymal niche. Na u e 459: 262-265.
Sa oh K, Mu oh H, Eda A, Yanaka I, Osawa H, Honda S, Kawa a H, Kihi a K, Sugano K.
2002. Abe an exp ession o CDX2 in he gas ic mucosa wi h and wi hou
in es inal me aplasia: e ec o e adica ion o Helicobac e pylo i. Helicobac e
7: 192-198.
Sa ou Y. 1999. pos e io end ma k 3 (pem-3), an ascidian ma e nally exp essed gene
wi h localized mRNA encodes a p o ein wi h Caeno habdi is elegans MEX-3-like
KH domains. De Biol 212: 337-350.
Sa o y JG, Pilon N, G ainge S, Syl es e JR, Béland M, Houle M, Oh K, Lohnes D. 2009.
Cdx1 and Cdx2 a e unc ionally equi alen in e eb al pa e ning. De Biol 330:
114-122.
Schisa JA, Pi JN, P iess JR. 2001. Analysis o RNA associa ed wi h P g anules in ge m
cells o C. elegans adul s. De elopmen 128: 1287-1298.
Schonho SE, Giel-Moloney M, Lei e AB. 2004. Mini e iew: De elopmen and
di e en ia ion o gu endoc ine cells. Endoc inology 145: 2639-2644.
109
REFERENCES
Schoppmeie M, Fische S, Schmi -Engel C, Löh U, Klingle M. 2009. An ancien
an e io pa e ning sys em p omo es caudal ep ession and head o ma ion in
ecdysozoa. Cu Biol 19: 1811-1815.
Schwanhäusse B, Busse D, Li N, Di ma G, Schuchha d J, Wol J, Chen W, Selbach
M. 2011. Global quan i ica ion o mammalian gene exp ession con ol. Na u e
473: 337-342.
Selg ad M, Bo nschein J, Rokkas T, Mal e heine P. 2010. Clinical aspec s o gas ic
cance and Helicobac e pylo i--sc eening, p e en ion, and ea men .
Helicobac e 15: 40-45.
Semba S, Sa ake S, Ma sushi a M, Yokozaki H. 2009. Phospha ase ac i i y o nuclea
PTEN is equi ed o CDX2-media ed in es inal di e en ia ion o gas ic
ca cinoma. Cance Le 274: 143-150.
Seydoux G, Fi e A. 1994. Soma-ge mline asymme y in he dis ibu ions o emb yonic
RNAs in Caeno habdi is elegans. De elopmen 120: 2823-2834.
Shimada T, Koike T, Yamaga a M, Yoneda M, Hi aishi H. 2007. Regula ion o TFF3
exp ession by homeodomain p o ein CDX2. Regul Pep 140: 81-87.
Silbe g DG, Fu h EE, Taylo JK, Schuck T, Chiou T, T abe PG. 1997. CDX1 p o ein
exp ession in no mal, me aplas ic, and neoplas ic human alimen a y ac
epi helium. Gas oen e ology 113: 478-486.
Silbe g DG, Sulli an J, Kang E, Swain GP, Mo e J, Sund NJ, Sacke SD, Kaes ne KH.
2002. Cdx2 ec opic exp ession induces gas ic in es inal me aplasia in
ansgenic mice. Gas oen e ology 122: 689-696.
Silbe g DG, Swain GP, Suh ER, T abe PG. 2000. Cdx1 and cdx2 exp ession du ing
in es inal de elopmen . Gas oen e ology 119: 961-971.
Sil a E, Teixei a A, Da id L, Ca nei o F, Reis CA, Sob inho-Simões J, Se pa J, Vee man
E, Bolsche J, Sob inho-Simões M. 2002. Mucins as key molecules o he
classi ica ion o in es inal me aplasia o he s omach. Vi chows A ch 440: 311-
317.
Siomi H, Ma unis MJ, Michael WM, D ey uss G. 1993. The p e-mRNA binding K p o ein
con ains a no el e olu iona ily conse ed mo i . Nucleic Acids Res 21: 1193-
1198.
Skamagki M, Wiche KB, Jed usik A, Ganguly S, Ze nicka-Goe z M. 2013. Asymme ic
localiza ion o Cdx2 mRNA du ing he i s cell- a e decision in ea ly mouse
de elopmen . Cell Rep 3: 442-457.
Slack JM. 2007. Me aplasia and ansdi e en ia ion: om pu e biology o he clinic.
Na Re Mol Cell Biol 8: 369-378.
S ebbins-Boaz B, Cao Q, de Moo CH, Mendez R, Rich e JD. 1999. Maskin is a CPEB-
associa ed ac o ha ansien ly in e ac s wi h elF-4E. Mol Cell 4: 1017-1027.
REFERENCES
S inge EJ, Duluc I, Saandi T, Da idson I, Bialecka M, Sa o T, Ba ke N, Cle e s H,
P i cha d CA, Win on DJ e al. 2012. Cdx2 de e mines he a e o pos na al
in es inal endode m. De elopmen 139: 465-474.
S inge EJ, P i cha d CA, Beck F. 2008. Cdx2 ini ia es his odi e en ia ion o he midgu
endode m. FEBS Le 582: 2555-2560.
S ump D, Mao CA, Yamanaka Y, Rals on A, Chawengsaksophak K, Beck F, Rossan
J. 2005. Cdx2 is equi ed o co ec cell a e speci ica ion and di e en ia ion o
ophec ode m in he mouse blas ocys . De elopmen 132: 2093-2102.
Sub amanian V, Meye BI, G uss P. 1995. Dis up ion o he mu ine homeobox gene
Cdx1 a ec s axial skele al iden i ies by al e ing he mesode mal exp ession
domains o Hox genes. Cell 83: 641-653.
Sub il C, Gué in E, Schneide A, Chena d MP, Ma in E, Domon-Dell C, Duluc I,
B able z T, Kedinge M, Duclos B e al. 2007. F equen ea angemen s and
ampli ica ion o he CDX2 homeobox gene in human spo adic colo ec al
cance s wi h ch omosomal ins abili y. Cance Le 247: 197-203.
Suh E, Chen L, Taylo J, T abe PG. 1994. A homeodomain p o ein ela ed o caudal
egula es in es ine-speci ic gene ansc ip ion. Mol Cell Biol 14: 7340-7351.
Suh E, T abe PG. 1996. An in es ine-speci ic homeobox gene egula es p oli e a ion
and di e en ia ion. Mol Cell Biol 16: 619-625.
Su à ML, Riggi N, Be ns ein BE. 2013. Epigene ic ep og amming in cance . Science
339: 1567-1570.
Tagawa T, Ha aguchi T, Hi ama su H, Kobayashi K, Saku ai K, Inada K-I, Iba H. 2012.
Mul iple mic oRNAs induced by Cdx1 supp ess Cdx2 in human colo ec al
umou cells. Biochem J 447: 449-455.
Tamai Y, Nakajima R, Ishikawa T, Takaku K, Seldin MF, Take o MM. 1999. Colonic
hama oma de elopmen by anomalous duplica ion in Cdx2 knockou mice.
Cance Res 59: 2965-2970.
Taupin D, Podolsky DK. 1999. Mi ogen-ac i a ed p o ein kinase ac i a ion egula es
in es inal epi helial di e en ia ion. Gas oen e ology 116: 1072-1080.
Taylo JK, Le y T, Suh ER, T abe PG. 1997. Ac i a ion o enhance elemen s by he
homeobox gene Cdx2 is cell line speci ic. Nucleic Acids Res 25: 2293-2300.
Tosh D, Slack JM. 2002. How cells change hei pheno ype. Na Re Mol Cell Biol 3:
187-194.
T inh KY, Jin T, D ucke DJ. 1999. Iden i ica ion o domains media ing ansc ip ional
ac i a ion and cy oplasmic expo in he caudal homeobox p o ein Cdx-3. J
Biol Chem 274: 6011-6019.
111

119
Appendix
ANTIBODIES
An igen Applica ion Desc ip ion Dilu ion Sou ce Comme cial e e ence
Ac in WB Rabbi polyclonal 1:8000 San a C uz Bio echnology sc-1616-R
CDX2 IF and WB Mouse monoclonal IgG1 (Clone CDX2-88) 1:50 and 1:1000 Biogenex MU392A-UC
Cyclin D1 WB Rabbi monoclonal (Clone SP4) 1:500 The mo Scien i ic RM-9104
DCP1A IF Rabbi polyclonal 1:500 Sigma Ald ich D5444
E-cadhe in IF Mouse monoclonal IgG1 (Clone HECD-1) 1:300 Taka a Biochemicals M106
EDC4 IF Rabbi polyclonal 1:400 Cell Signaling Technology 2548
F-ac in IF Te ame hyl hodamine B iso hiocyana e (TRITC)-conjuga e o phalloidin 1:10000 Sigma Ald ich 77418
MEX3A IF and WB Rabbi polyclonal 1:600 and 1:1000 Sigma Ald ich PRS4869
MSI1 WB Rabbi polyclonal 1:1000 Millipo e AB5977
c-Myc IF and WB Mouse monoclonal IgG1 (Clone 9E10) 1:600 and 1:1000 Clon ech 631206
Villin WB Mouse monoclonal 1:3000 Kindly p o ided by D . Syl ie Robine, Ins i u e Cu ie, Pa is, F ance ―
ZO-1 IF Rabbi polyclonal 1:50 In i ogen 61-7300
Seconda y
Goa an i-Mouse IgG IF Alexa Fluo 488 o Alexa Fluo 594 conjuga ed 1:100 In i ogen A-11001 o A-11005
Goa an i-Mouse IgG WB Ho se adish pe oxidase (HRP) conjuga ed 1:2000 San a C uz Bio echnology sc-2005
Goa an i-Rabbi IgG IF Alexa Fluo 488 o Alexa Fluo 594 conjuga ed 1:100 In i ogen A-11008 o A-11012
Goa an i-Rabbi IgG WB Ho se adish pe oxidase (HRP) conjuga ed 1:2000 San a C uz Bio echnology sc-2004
PRIMER SEQUENCES (5`- 3`)
Bisul i e sequencing
CpG1 F: TTTTAGAAATGATAGGATGAAGG
R: ACCAAAAAACCTAAAACTAAAAA
CpG2.1 F: GTAGGTTAGAGGGAGGGAT
R: TCCTTATCCAAAAAATAACTCAC
CpG2.2 F: GAGTTATTTTTTGGATAAGGA
R: TAACCATTCCAATCCTCCC
CpG2.3 F: GGGAGGATTGGAATGGTTA
qPCR R: TTTACAACAACCCAAAAAC
18S F: CGCCGCTAGAGGTGAAATTC
R: CATTCTTGGCAAATGCTTTCG
BMI1 F: GTCTACATTCCTTCTGTAAAACG
R: CTTGGAGAGTTTTATCTGACC
CDX2 F: TTCACTACAGTCGCTACATCACCAT
R: TTGTTGATTTTCCTCTCCTTTGCT
GAPDH F: TCAAGGCTGAGAACGGGAAG
R: AGAGGGGGCAGAGATGATGA
LGR5 F: CAGCGTCTTCACCTCCTACCTA
R: CCTTGGGAATGTATGTCAGAGC
MEX3A F: CAAGCTCTGCGCTCTCTACAAA
R: GGCCTTAATCTTGCAGCCTTG
Rluc F: TGCAAGCAAATGAACGTGCTG
R: TCTAGCCACGGGCTCGATGT
Si e-di ec ed mu agenesis
pRL∆CDX2 ec o *S: GTAACATCCAAGCCAGCCTTTTCCAAGCCTTCTGGATCC
AS:GGATCCAGAAGGCTTGGAAAAGGCTGGCTTGGATGTTAC
* Mu a ed nucleo ides a e in bold and unde lined
Appendix A. Lis o an ibodies and p ime s used in his s udy.