scieee Science in your language
[en] (orig)

An evolutionary approach to endocrine disruption: the mechanisms of reprodutive toxicity of androgenic chemicals in the gastropod Nucella lapillus and the fish Danio rerio.

Read accessible full text

An evolutionary approach to endocrine disruption: the mechanisms of reprodutive toxicity of androgenic chemicals in the gastropod Nucella lapillus and the fish Danio rerio.

Author: Daniela da Silva Lima
Year: 2012
DOI: 10.34626/yn1n-mj10
Source: https://repositorio-aberto.up.pt/bitstream/10216/75034/2/30557.pdf
An e olu iona y app oach o endoc ine dis up ion: he
mechanisms o ep oduc i e oxici y o and ogenic
chemicals in he gas opod Nucella lapillus and he ish
Danio e io
Daniela da Sil a Lima
Tese de Dou o amen o em Ciências Biomédicas
2012
Daniela da Sil a Lima
An e olu iona y app oach o endoc ine dis up ion: he
mechanisms o ep oduc i e oxici y o and ogenic chemicals in
he gas opod Nucella lapillus and he ish Danio e io
Tese de Candida u a ao g au de Dou o em
Ciências Biomédicas subme ida ao Ins i u o de
Ciências Biomédicas Abel Salaza da Uni e sidade
do Po o.
O ien ado : Dou o Miguel Machado San os
In es igado Auxilia
Labo a ó io de Toxicologia Ambien al, Cen o
In e disciplina de In es igação Ma inha e
Ambien al
Co-o ien ado es:
P o esso a Dou o a Ma ia A manda Reis Hen iques
P o esso a Ca ed á ica
Ins i u o de Ciências Biomédicas Abel Salaza
Dou o Luís Filipe Cos a Cas o
In es igado Auxilia
Labo a ó io de Es udos Celula es, Molecula es e
Analí icos, Cen o In e disciplina de In es igação
Ma inha e Ambien al
Es a ese oi inanciada po uma bolsa de dou o amen o da Fundação pa a a Ciência e a
Tecnologia (SFRH/BD/41561/2007) e pelos p ojec os PTDC/MAR/68106/2006,
PTDC/MAR/105199/2008 e PTDC/MAR/115199/2009.

À minha amília.
“Will you walk a li le as e ?” said a whi ing o a snail […]
“See how eage ly he lobs e s and he u les all ad ance! […]
Then u n no pale, belo ed snail, bu come and join he dance.”
Alice in Wonde land, he lobs e quad ille,
Lewis Ca oll
Na u e s udy will show you how ull o beau i ul and wonde ul hings God has made he
wo ld o you o enjoy. […] T y and lea e his wo ld a li le be e han you ound i and
when you u n come o die, you can die happy in eeling ha a any a e you ha e no
was ed you ime bu ha e done you bes .
Si Baden-Powell
i
e inoid signaling ha e ne e been desc ibed in mollusks. These knowledge gaps we e
add essed in his hesis and esul ed in he isola ion o ou po en ial candida es o
pa icipa e in e inoid cascades in N.lapillus: Re inoid X Recep o (NlRXR), Re inoic Acid
Recep o (NlRAR), Cy och ome P26 (NlCyp26) and Alcohol Dehyd ogenase 3 (NlAdh3).
Thei molecula cha ac e iza ion was pe o med and inally modula ion by TBT exposu e
assessed. A pha macological app oach was conduc ed o cla i y he mode o ac ion o
TBT ocusing in h ee di e en a ge s: in e e ence wi h neu oendoc ine ac o s,
modula ion o e inoid and s e oid signaling.
O e all, he indings o he p esen wo k clea ly link TBT-induced imposex wi h he
modula ion o RXR and e inoid signaling pa hways. The in ol emen o RXR in imposex
induc ion was expe imen ally demons a ed, gi en ha bo h i s pu a i e endogenous
ligand, 9-cis e inoic acid (RA), and he syn he ic agonis me hop ene acid (MA), we e
able o induce imposex in N. lapillus. De ailed analysis o RXR ansc ip ion in di e en
o gans sugges s he exis ence o issue-speci ic e ec s, since NlRXR mRNA le els we e
speci ically and di e en ially modula ed in he CNS and in he penis/PFA, highligh ing he
pi o ole o he cen al ne ous sys em in imposex de elopmen . The opposi e pa e n o
gene ansc ip ion obse ed o NlCyp26 and NlRXR in ma u e/do man emale gonads
and in penis de elopmen in TBT-exposed animals poin s o a coo dina ed ac ion be ween
NlRXR and NlCyp26 in con olling local e inoid signaling, which may ul ima ely egula e
he de elopmen o penis in bo h male and emales and gonad ec udescence in emale.
The dis inc pa e n o mRNA ansc ip ion obse ed o NlRXR, NlRAR, NlCyp26
and NlAdh3 sugges s hei in ol emen in di e en biological p ocesses. Fu he mo e, i
p o ides an indica ion ha N. lapillus does possess, a leas pa ially, he gene ic oolki
necessa y o me abolize and ansduce e inoid signals, al hough NlAdh3 could no be
unmis akably linked wi h RA signaling.
Explo a ion o o he possibly a ec ed pa hways by TBT in N. lapillus led o he
iden i ica ion o a no el a ge , 17-β Hyd oxys e oid Dehyd ogenase 12 (Hsd17b12), which
codes o an enzyme po en ially in ol ed in s e oid o lipid me abolism. In addi ion o he
isola ion and molecula cha ac e iza ion o NlHsd17b12, i was demons a ed he e ha
NlHsd17b12 mRNA le els a e impac ed by TBT exposu e and signi ican ly dec eased in
diges i e glands.
Following he hypo hesis ha endoc ine dis up ion by TBT may in ol e he
in e e ence wi h conse ed e inoid signaling, he modula ion o e inoid signaling by TBT
and o he e inoid subs ances in he zeb a ish model was also in es iga ed he e.
Exposu e o D. e io o TBT om 5 dp un il adul hood signi ican ly impac ed ish ecundi y.
Analysis o key signaling pa hways e ealed a signi ican dec ease in he mRNA le els o

ii
Cy och ome P19a1b (Cyp19a1b) in emale b ain and in pe oxisome p oli e a o ac i a ed
ecep o gamma (PPARγ), an he e odime ic pa ne o RXR, in b ain o bo h males and
emales. Unexpec edly, TBT al e ed zeb a ish sex a io owa ds emales, con adic ing
p e ious esul s and sugges ing a mo e complex mechanism in he so a epo ed
masculinizing e ec s in zeb a ish.
Al hough addi ional s udies should ocus on he de ailed biological implica ions o
TBT wi h he signaling pa hways epo ed he e, his wo k p o ides ele an insigh s o he
cla i ica ion o mollusks e inoid signaling sys ems. In addi ion o con ibu e o he
unde s anding o he possible nega i e ou comes esul ing om TBT exposu e in wo
di e en g oups, his s udy adds subs an ial knowledge on e inoid signaling pa hway
e olu ion. He e is epo ed o he i s ime he cloning o a p o os ome RAR and Cyp26
o hologues, which we e conside ed o be a cho da e no el y. Knowledge on he e olu ion
and unc ionali y o endoc ine sys ems and hei molecula pa hways (such as e inoid
acid signaling) in me azoans is c ucial o unde s and and an icipa e he impac o he
nume ous compounds ha a e con inuously being in oduced in he ecosys ems.
Resumo
Nas úl imas décadas em-se e i icado um aumen o signi ica i o do núme o de
es udos sob e os e ei os ad e sos da exposição a dis up o es endóc inos (EDCs). Sabe-
se que os EDCs podem in e e i com a ligação das ho monas aos seus ecep o es
(mime izando-as ou an agonizando-as) e com o uncionamen o no mal do sis ema
endóc ino (in e e indo com a sín ese, o anspo e e o me abolismo ho monal). Uma ez
que a in e acção ho mona/ ecep o é um mecanismo undamen al pa a a manu enção da
homeos asia ho monal, a sua des egulação po EDCs em sido pa icula men e es udada.
T adicionalmen e, a maio ia dos es udos sob e EDCs em-se ocado no impac o
de compos os es ogénicos nos ecossis emas aquá icos, enquan o os dis up o es que
ac uam em ou as ias, ais como compos os com capacidade and ogénica, êm ecebido
ela i amen e menos a enção.
Ou o aspec o impo an e que em sido negligenciado po es es es udos p ende-se
com a in luência dos p ocessos e olu i os na uncionalidade dos ac uais sis emas
endóc inos dos animais. Tendo em con a que na maio ia dos casos se usam como
modelo espécies de e eb ados, os e ei os dos EDCs em ou os g upos ilogené icos em
sido amplamen e sub-a aliado. As ias de sinalização dos e inóides são disso exemplo,
uma ez que du an e mui o empo se pensou se em exclusi as dos animais co dados.
Toda ia, oi ecen emen e demons ado que um dos enómenos de dis upção endóc ina
mais conhecidos, o imposex, que se ca ac e iza pela supe imposição de ca ac e ís icas
iii
sexuais masculinas (pénis e canal de e en e) em êmeas de gas ópodes ma inhos,
en ol e a ac i ação a ípica do Recep o X Re inóico (RXR). Em mamí e os, os e inóides
es ão en ol idos na egulação de impo an es unções biológicas e a sua pe u bação
pode o igina , en e ou as consequências, al e ações nos p ocessos ep odu i os. Des e
con ex o su giu a hipó ese de que os e ei os nega i os esul an es da exposição ao TBT,
obse ados em á ias espécies (incluindo peixes), possam en ol e a des egulação das
ias de sinalização dos e inóides. Pa a a alia es a ideia, o am escolhidas duas
espécies ilogene icamen e dis an es, o peixe eleós eo Danio e io e o gas ópode
Nucella lapillus.
A N. lapillus em sido uma espécie mui o u ilizada em es udos sob e imposex mas
os mecanismos en ol idos nes e enómeno es ão ainda po escla ece . Além disso, a
maio ia dos genes que se sabe es a em en ol idos nas ias de sinalização dos e inóides
em mamí e os nunca o am ca ac e izados em moluscos. Es as lacunas o am ambém
objec o de es udo des a ese. Como esul ado, isola am-se em N. lapillus qua o genes
po encialmen e en ol idos nas casca as de sinalização dos e inóides: o Recep o do
Ácido X Re inóico (NlRXR), o Recep o do Ácido Re inóico (NlRAR), o ci oc omo P26
(NlCyp26) e a álcool desid ogenase 3 (NlAdh3). A sua ca ac e ização molecula oi
e ec uada e a suscep ibilidade a modulação pelo TBT a aliada. Foi u ilizada ainda uma
abo dagem a macológica pa a escla ece o modo de acção do TBT no enómeno de
imposex, nomeadamen e, a in e e ência com ac o es neu oendóc inos, com as ias de
sinalização dos e inóides e dos es e óides.
Os esul ados do p esen e abalho apon am cla amen e a in e e ência do TBT
com o RXR e com as ias de sinalização do ácido e inóico na indução de imposex. O
en ol imen o do RXR nes e p ocesso oi expe imen almen e demons ado, uma ez que
que o seu p esumí el ligando na u al, o ácido 9-cis e inóico (9-cis RA), que o seu
agonis a sin é ico, o ácido me op énico (MA), induzi am signi ica i amen e imposex em N.
lapillus. A análise de alhada dos ní eis de mRNA do RXR em di e en es ó gãos suge e a
exis ência de e ei os especí icos em cada ecido e ealça o papel undamen al do sis ema
ne oso cen al (CNS) no desen ol imen o de imposex. O pad ão de ansc ição opos o
do RXR e da Cyp 26, obse ado nas gónadas de êmeas madu as/ima u as e nos pénis
em desen ol imen o nos animais expos os a TBT, apon am ainda pa a uma acção
coo denada en e NlRXR e NlCyp26 no con olo local da sinalização po e inóides. Des e
modo, es es genes podem es a en ol idos na egulação do desen ol imen o do pénis,
an o em machos como em êmeas, bem como no ec udescimen o das gónadas
emininas.
ix
O pad ão de ansc ição dis in o obse ado pa a o NlRXR, NlRAR, NlCyp26 e
NlAdh3 suge e o seu en ol imen o em di e en es p ocessos biológicos. Mais ainda, a
p esença des es genes em N. lapillus indica que es a espécie possui, pelo menos em
pa e, a maquina ia gené ica necessá ia pa a me aboliza e inóides e sinaliza a a és
des es compos os, podendo po encialmen e aduzi-los em sinais biológicos. No en an o,
não é ainda cla o o en ol imen o da NlAdh3 nas ias de sinalização dos e inóides.
A explo ação de ou as ias passí eis de se em a ec adas po TBT em N. lapillus
esul ou na iden i icação de um gene que codi ica uma enzima en ol ida no me abolismo
lipídico ou dos es e óides, a 17-β Hid oxies e óide desid ogenase ipo 12 (NlHsd17b12).
A NlHsd17b12 oi ca ac e izada e a sua in e e ência pelo TBT a aliada, endo-se
obse ado uma diminuição signi ica i a nos seus ní eis de exp essão nas glândulas
diges i as após exposição ao TBT.
Pa a a alia a hipó ese de que o TBT in e e e com as ias de sinalização dos
e inóides, e es as são conse adas nos me azoá ios, os e ei os do TBT e de ou os
e inóides no peixe zeb a ambém o am al o de es udo. A exposição de D. e io ao TBT,
desde os 5 dias após a e ilização (dp ) a é à idade adul a, esul ou numa diminuição
signi ica i a da sua ecundidade. A a aliação da ansc ição de genes possi elmen e
a ec ados pelo TBT no peixe-zeb a e elou uma diminuição signi ica i a nos ní eis de
ansc i os de ci oc omo P19a1b (Cyp19a1b) no cé eb o das êmeas, e de p oli e ado es
de pe oxissoma gamma (PPARg) no cé eb o dos machos e das êmeas. Con a iamen e
ao que es á desc i o na li e a u a a é ao momen o, o TBT al e ou o ácio en e os sexos a
a o das êmeas, o que pa ece suge i que um mecanismo mais complexo es á na
o igem dos e ei os masculinizan es a ibuídos ao TBT no peixe-zeb a.
Es udos u u os de e ão cen a -se nas implicações biológicas po encialmen e
esul an es da in e e ência do TBT com as ias de sinalização aqui desc i as. Pa a além
de con ibui pa a a comp eensão dos e ei os ad e sos esul an es da exposição ao TBT
em o ganismos de dois g upos axonómicos di e en es, es e abalho ac escen a um
conhecimen o subs ancial sob e a e olução das ias de sinalização dos e inóides. Es e
es udo desc e e pela p imei a ez a clonagem de o ólogos do RAR e da Cyp26 em
p o os ómios, genes que a é há ela i amen e pouco empo e am conside ados
exclusi os dos co dados. O conhecimen o sob e a e olução e a uncionalidade dos
sis emas endóc inos e ias de sinalização associadas (como po exemplo, as que
en ol em o ácido e inóico) é c ucial pa a comp eende e an ecipa o impac o dos
inúme os compos os que es ão con inuamen e a se in oduzidos nos ecossis emas.
x
xi
Ac onyms Lis
ADHs
Alcohol Dehyd ogenases
AKR
Aldo-Ke o-Reduc ase
ALDHs
Aldehyde Dehyd ogenases
AR
And ogen Recep o
ARAT
Acyl-coenzyme A: Re inol Acyl ans e ase
ATAT
Acyl-coenzyme A: Tes os e one Acyl ans e ase
BCO
β-Ca o ene Oxygenase
BPA
Bisphenol-A
CNS
Cen al Ne ous Sys em (head ganglia complex)
CPA
Cyp o e one Ace a e
CRBPs
Cellula Re inol Binding P o eins
CYP
Cy och ome P450
Dax1
Dosage-sensi i e sex e e sal, ad enal hypoplasia c i ical egion,
on ch omosome X, gene 1
DBD
DNA Binding Domain
DGAT1
Diacylglice acyl ans e ase 1
DHA
Docosahexaenoic Acid
DMSO
Dime hyl sul oxide
Dp
Days Pos Fe iliza ion
DR
Di ec Repea
E1
Es one
E2
Es adiol
EDCs
Endoc ine Dis up ing Chemicals
EE2
E hinyles adiol
EFSA
Eu opean Food Sa e y Au ho i y
ER
Es ogen ecep o

xii
FABPs
Fa y Acid Binding P o eins
FBS
Fe al Bo ine Se um
GnRH
Gonado opin Releasing Ho mone
GnRHR
Gonado opin Releasing Ho mone Recep o
HEK-293
Human Emb yonic Kidney -293
HSD
Hyd oxys e oid Dehyd ogenase
HUFA
Highly Unsa u a ed Fa y Acids
IMO
In e na ional Ma i ime O ganiza ion
IPCS
In e na ional P og amme on Chemical Sa e y
KAR
3-Ke oacyl-CoA Reduc ase
LBD
Ligand Binding Domain
LC/MS/MS
Liquid Ch oma og aphy/Tandem Mass Spec ome y
LRAT
Leci hin:Re inol Ace yl ans e ase
MA
Me hop ene Acid
MDR
Medium-chain Dehyd ogenases/Reduc ases
MEHP
Mono-(2-e hylhexyl) Ph hala e
MEPC
Ma ine En i onmen P o ec ion Commi ee
MS-222
E hyl 3 - aminobenzoa e me henesul o a e sal
NR
Nuclea Recep o
ORF
Open Reading F ame
p38MAPK
P38 Mi ogen-Ac i a ed P o ein Kinases
PFA
Penis Fo ming A ea
PMF
Penis Mo phogene ic Fac o
PPAR
Pe oxisome P oli e a o Ac i a ed Recep o
PUFA
Polyunsa u a ed Fa y Acid
PVC
Poly inyl Chlo ide
RA
Re inoic Acid
xiii
RALDH
Re inal Dehyd ogenase
RAR
Re inoic Acid Recep o
RAREs
Re inoic Acid Response Elemen s
REs
Response Elemen s
RBP
Re inol Binding P o ein
RDH
Re inol Dehyd ogenase
REHs
Re ynil Es e s Hyd olases
RF
Re og essi e Fac o
RXR
Re inoic X Recep o
SDRs
Sho -chain Dehyd ogenases/Reduc ases
TBT
T ibu yl in
TDI
Tole able Daily In ake
TPT
T iphenyl in
TR
Thy oid Recep o
TTR
T ans hy e in
USP
Ul aspi acle
UTR
Un ansla ed Region
VAD
Vi amin A De icien
VDR
Vi amin D Recep o
VDSI
Vas De e ence Sequence Index
VTG
Vi ellogenin
WHO
Wo ld Heal h O ganiza ion
xi
x
INDEX
CHAPTER 1 ...................................................................................................................... 1
1. In oduc ion .................................................................................................................. 3
1.1 Gene al In oduc ion ................................................................................................ 3
1.1.1 Imposex in gas opod mollusks: a s iking case o endoc ine dis up ion ............ 4
1.1.2 TBT: biological e ec s ....................................................................................... 6
1.2.3 TBT: legisla ion and cu en en i onmen al s a us ............................................. 8
1.2 The imposex unde lying mechanisms: an his o ical accoun ................................... 9
1.2.1 Imposex model 1: abno mal elease o neu oho mones ...................................10
1.2.2 Imposex model 2: in e e ence wi h s e oid pa hways ......................................11
1.2.3 Imposex model 3: in e e ence wi h e inoid signaling pa hways ......................15
1.3 The e inoid signaling pa hway ...............................................................................17
1.3.1 Re inoid anspo and s o age .........................................................................19
1.3.2 Re inoid syn hesis: canonical o classical pa hway ..........................................20
1.3.3 Re inoid syn hesis: non-canonical pa hway ......................................................21
1.3.4 Re inoid deg ada ion ........................................................................................22
1.3.5 Re inoic acid ecep o s.....................................................................................23
1.4 E olu ion o e inoid signaling .................................................................................27
1.5 E olu ion mee s oxicology .....................................................................................30
1.6 The animal models .................................................................................................32
1.6.1 The dogwhelk, N. lapillus .................................................................................32
1.6.2 The zeb a ish, D. e io......................................................................................33
1.7 Objec i es ..............................................................................................................35
1.8 Re e ences ............................................................................................................38
CHAPTER 2 .................................................................................................................... 51
2. Re inoid signaling and imposex in Nucella lapillus ................................................ 51
xxii
glands a e one and wo mon hs o exposu e o TBT.
5.1
Schema ic ep esen a ion o he expe imen al se up used o zeb a ish
ep oduc i e ials.
182
5.2
Sex a io obse ed o each expe imen al g oup.
188
5.3
mRNA le els o male and emale zeb a ish de e mined in b ain
(Cyp19a1b and PPARγ) and gonads (Cyp19a1a and PPARγ) a e TBT
exposu e.
189

xxiii
Lis o ables
2.1.1
Oligonucleo ide p ime sequences used o isola e and cha ac e ize
NlRXR.
59
2.2.1
P ime sequences used o isola e 18s in N. lapillus.
82
3.1.1
Expe imen al pa ame e s measu ed in he exposed N. lapillus a
di e en ea men s, h ee days and wo mon hs a e he beginning o
he expe imen .
107
3.3.1
Pai wise % iden i y o he dogwhelk RAR p o ein sequence o o he
RAR genes.
141
3.3.2
Amino acid esidues wi hin he ligand-binding pocke o RAR ha
in e ac wi h he ligand.
145
4.1
Imposex pa ame e s in emale N. lapillus a e one and wo mon hs o
exposu e: VDSI, imposex equency and penis leng h.
164
5.1
P ime sequences and annealing empe a u es used in qPCR
de e mina ions in D. e io.
184
5.2
Mo phome ic pa ame e s a he end o he zeb a ish expe imen .
186
5.3
Zeb a ish ep oduc i e pa ame e s om he b eeding ials pe o med a
he end o he expe imen al pe iod.
187
5.4
Summa y o qPCR gene ansc ip ion esul s o zeb a ish ER2a, ER2b,
V g1 and RXRβa.
190
xxi
CHAPTER 1
CHAPTER 1
Chap e 1
3
1. In oduc ion
1.1 Gene al In oduc ion
In he las couple o decades a signi ican e o has been made o s udy and
acknowledge he ad e se e ec s esul ing om en i onmen al con aminan exposu e.
Some o hese compounds ha e he abili y o in e e e wi h he endoc ine sys em, and a e
gene ically e e ed o as endoc ine dis up o s o endoc ine dis up ing chemicals
(EDCs;WHO / IPCS, 2002). T adi ionally, s udies on EDCs ha e ocused on iden i ying
hese compounds, hei e ec s and he a ec ed species. Nowadays, i has been
ecognized ha such s udies should also add ess o he ele an aspec s, in pa icula he
mechanisms in ol ed in endoc ine dis up ion phenomena and hei abili y o induce
ele an ecological consequences (Guille e, 2005). Among he mos common ad e se
e ec s a ibu ed o EDCs a e al e a ions in sexual and ep oduc i e de elopmen ,
changes in immune and ne ous sys em and inc eased incidence o cance and hy oid
me abolism diso de s (WHO / IPCS, 2002). In many cases EDCs in e e e wi h ecep o -
media ed mechanisms, mimicking o an agonizing endogenous ho mones, o by de-
egula ing hei signaling, syn hesis, anspo and/o me abolism (WHO / IPCS, 2002;
Sump e , 2005).
Aqua ic ecosys ems a e adi ionally he mos a ec ed, since hey a e he inal
des ina ion o mos o he compounds esul ing om human ac i i y. Rega ding pollu an s,
he ini ial ocus o a en ion was channeled o he e ec s o hea y me als. Howe e , he
eme gence o new indus ial chemicals and pha maceu ical p oduc s, which a e o en no
e ec i ely emo ed by was e wa e ea men , also b ough mo e ele ance o he s udy o
hei e ec s and he mechanisms by which hey ac
(h p://www.epa.go /bioindica o s/aqua ic/pollu ion.h ml).
Since a la ge p opo ion o po en ial EDCs end up in su ace wa e s, aqua ic
species a e pa icula ly ulne able o hei po en ial ad e se e ec s. His o ically, mos
s udies ha e ocused on he impac o es ogenic compounds in aqua ic ecosys ems,
while in o ma ion on o he EDCs, such as compounds wi h and ogenic p ope ies, is much
sca ce (Sump e , 2005). Pa adoxically, one o he mos ubiqui ous phenomena o
endoc ine dis up ion in ma ine o ganisms is p ecisely he masculiniza ion o emales o
se e al gas opod species. This phenomenon, designa ed imposex, is known o be
caused by exposu e o ibu yl in (TBT), a compound used in an i ouling pain s on boa s
(Smi h, 1971, 1981c; Gibbs and B yan, 1986; Ma hiessen and Gibbs, 1998; Ba oso e
al., 2002; San os e al., 2005). O he s udies ha e desc ibed he dele e ious e ec s o

Chap e 1
4
TBT in se e al Me azoan g oups, such as mammals, ish, annelids and c us aceans
(Fen , 1996; Jane , 2005). Despi e he p ominen numbe o species and he di e si y o
g oups a ec ed by TBT, i s exac mode o ac ion is ye o be asce ained. Fu he mo e,
unde s anding he mechanisms in ol ed in pa icula endoc ine dis up ion cases, such as
hose ela ed o TBT, may help o p edic , p e en and minimize he impac o o he
chemicals ac ing on he same pa hways. This may be o pi o al impo ance, especially i
we ake in o conside a ion ha o e 87 000 syn he ic subs ances a e cu en ly being
comme cialized, and du ing hei manu ac u e many mo e housands a e p oduced and
eleased o he en i onmen (Tho n on, 2003). I is he e o e possible ha a leas some o
hese compounds a e ac ing as endoc ine dis up o s and a ec ing non- a ge species,
simila o wha occu ed wi h TBT and o he o gano ins.
1.1.1 Imposex in gas opod mollusks: a s iking case o endoc ine dis up ion
In 1960, in a ou ine examina ion o a ba ch o Nucella lapillus (Figu e 1. 1A)
collec ed in Plymou h Sound, England, Blabe (Blabe , 1970) did a a he in iguing
disco e y: he no iced he p esence o an “ou g ow h behind he igh cephalic en acle” in
emales, a s uc u e esembling a male penis bu sligh ly smalle (Figu e 1.1 B, C). While
his would no ha e been su p ising o o he species o he maph odi e mollusks, N.
lapillus was known o be a gonocho is ic species. Howe e , gi en ha he obse ed his
condi ion (wi h a ying incidence) in he ollowing sampling campaigns along di e en
si es, he concluded ha i could be a na u al phenomenon, a leas o a pe cen age o he
popula ion close o he b eeding season. This was he i s desc ip ion o he phenomenon
designa ed “imposex” one yea la e by Smi h, a e obse ing a simila condi ion a ec ing
emales o he Ame ican mud-snail, Ilyanassa obsole a. Smi h hen de ined imposex as
he “supe imposi ion o male cha ac e s on o pa asi ized and unpa asi ized emales” o
ma ine gas opods (Smi h, 1971). I ook Smi h app oxima ely en yea s o demons a e a
co ela ion be ween imposex equency and he dis ance o shipping ha bo s and ma inas
(Smi h, 1981b), and o es ablish ha his was an abno mal phenomenon caused by
exposu e o componen s o an i ouling pain s used in ships’ hulls (Smi h, 1981a), mo e
speci ically, o he biocide TBT (Smi h, 1981c).
Bu his s o y had s a ed way be o e, in he 1940s, when he indus y disco e ed
TBT as a po en biocide agen and i s cos -e ec i e p ope ies soon u ned i ou e y
popula . TBT’s oxici y a low concen a ions owa ds animals and plan s in combina ion
wi h i s low mammalian oxici y (in compa ison wi h me cu y, lead and a senic, used
Chap e 1
5
p e iously) was conside ed a ue e olu ion o he ma ke o an i ouling pain s in he
1950s (San illo, 2001). G ow h o ba nacles, clams and o he o ganisms in hulls
diminished ships’ pe o mance, inc eased uel consump ion, and i s mechanical emo al
was cos ly and ime consuming. TBT, i s used in “con ac leaching” an i ouling pain s,
and la e coupled wi h a soluble ma ix, which allowed i o dissol e g adually in wa e , no
only educed he cos s caused by ouling, bu also he need o equen epain boa s, as
i s e ec s could las up o 4 yea s (Hall e al., 1987).
TBT is commonly e e ed o as an o gano in, which is a g oup o compounds,
ypically o an h opogenic o igin, ha encloses molecules consis ing o an a om o in (Sn)
bound o an o ganic g oup (Figu e 1.1 D). F om all he de i a i es o in, o gano ins a e
comme cially he mos ele an , being used as Poly inyl Chlo ide (PVC) s abilize s,
ca alys s o polyu e hane and silicon elas ome s, and pes icides (Fen , 1996). Howe e ,
he oxici y o o gano ins inc eases wi h he numbe o o ganic g oups bound o he in
a om, eaching i s maximum in ialkyla ed compounds such as ibu yl-, iphenyl- and
icyclohexyl in, which is p ecisely he case o TBT (Fen , 1996). Thus, when he i s
epo s o se ious dele e ious e ec s in aqua ic animals appea ed, TBT, ubiqui ously
p esen in aqua ic ecosys ems, wi h ele a ed and b oad spec um oxici y, became one o
he main suspec s. In addi ion o he cases o imposex and se e e diminu ion o N. lapillus
popula ions in B i ish coas al a eas, ano he ea ly ala ming sign came om he A cachon
Bay, in he F ench A lan ic coas , an impo an loca ion o oys e p oduc ion. He e,
imposex was obse ed in Oceneb a e inacea, lea ing local popula ion close o ex inc ion,
while oys e p oduc ion dec eased d ama ically (E ans and Nicholson, 2000; San illo,
2001). Al hough no mal spawning seasons we e epo ed a he ime, oys e la ae
displayed high mo ali y, di icul y in se lemen and de o med shells in adul hood (Alzieu
e al., 1989). The ep oduc i e ailu e and shell de o mi ies epo ed he e ma ched hose
ound in B i ish coas s and coincided wi h an inc ease use o o gano in con aining pain s
in ships hulls (San illo, 2001). Meanwhile, ac oss he A lan ic, Smi h demons a ed ha I.
obsole a was indeed a gonocho is ic gas opod, and ha he induc ion o male
cha ac e is ics in emales was an abe an phenomenon caused by exposu e o TBT
(Smi h, 1981c). On he Eu opean coas , analy ical da a showed a clea co ela ion
be ween issue o gano in le els and imposex se e i y, again pinpoin ing TBT as he
causa i e agen (B yan e al., 1986). The inal p oo was p esen ed by Gibbs and B yan
(Gibbs and B yan, 1986), who demons a ed expe imen ally ha exposu e o TBT a
concen a ions as low as 0.5 ng TBT Sn/L could induce imposex in N. lapillus (Figu e 1.1
E, F) and cause, a ad anced s ages, emale ep oduc i e ailu e.
Chap e 1
6
Figu e 1.1 Adul N. lapillus (A). De eloping penis in an imposex a ec ed N. lapillus emale (B). Male N.
lapillus penis (C). Chemical s uc u e o ibu yl in chlo ide (D). Schema ic ep esen a ion o a no mal (E) and
an imposex a ec ed emale whelk (F; adap ed om B igh and Ellis, 1990).
1.1.2 TBT: biological e ec s
As a esul o widesp ead con amina ion o TBT h oughou aqua ic ecosys ems,
imposex a ec ed species ha e been de ec ed wo ldwide. Imposex is no , howe e , he
sole example o he ad e se e ec s o o gano ins in aqua ic animals, hough i is ce ainly
he mos imp essi e and well-s udied. O he mollusks, o ye unknown easons, do no
de elop imposex when exposed o TBT. Ins ead, ano he phenomenon has been
obse ed in some species, such as he pe iwinkle Li o ina li o ea: he ans o ma ion o
emale pallial o gans in o male mo phological s uc u es (Baue e al., 1997; Ke a a e al.,
2008). This has been designa ed as in e sex, and, a ad anced s ages, a p os a e gland
and a spe m g oo e de elops, comp omising hei ep oduc i e abili y (Oehlmann e al.,
1998). S ill, he g ow h o a penis is a a e e en in his species (Ma hiessen and Gibbs,
1998). In mollusks, o he e ec s ha ha e been a ibu ed o TBT exposu e a e: educed
a es o e iliza ion and de elopmen (Fen , 1996); shell hickening (Fen , 1996);
al e a ions in s e oid and lipid me abolism (Jane e al., 2006; San os e al., 2011);
in e e ence wi h he immune sys em (causing dec ease in o al hemocy e coun ,
phagocy osis, memb ane s abili y and lysozyme ac i i y, o ins ance; Gopalak ishnan e
al., 2011).
Mollusks a e no he only phylum a ec ed by TBT exposu e. In ac , o gano ins a e
known oday o ha e di e se consequences on species ha belong o di e en
Chap e 1
7
phylogene ic g oups, om mammals o algae and bac e ia (Fen , 1996; Jane , 2005).
Since aqua ic ecosys ems a e adi ionally he mos a ec ed by pollu ion, s udies on he
e ec s o TBT ha e also been pe o med in ish, specially add essing consequences a
he ep oduc i e le el. Fo ins ance, exposu e o zeb a ish (Danio e io) o TBT du ing
ea ly de elopmen al s ages has esul ed in al e ed sex a io owa ds males (McAllis e
and Kime, 2003; Shimasaki e al., 2003; San os e al., 2006a) and low quali y spe m
(McAllis e and Kime, 2003). Diminished e ili y (Nakayama e al., 2004, 2005),
al e a ions in ollicula de elopmen (Zhang e al., 2007), dec ease in o al and iable
ha chabili y in Sillago japonica (Shimasaki e al., 2006; Nakayama e al., 2005) and
accumula ion o TBT in medaka (O yzias la ipes) eggs (Nakayama e al., 2005) a e some
o he consequences obse ed in TBT-exposed emales. Male ish a e also a ec ed,
showing al e ed sexual beha io (Nakayama e al., 2004), dis up ed spe ma ogenesis
(Zhang e al., 2009a), educed gonadal de elopmen , dec eased spe m le els (Haub uge
e al., 2000; Zhang e al., 2009b) and his ological damage in he es es (Zhang e al.,
2009b). Dec eased gonadossoma ic index is a common consequence in bo h sexes
(Zhang e al., 2009b). TBT was also shown o inc ease swimup ailu e and la al eyes
de ec s in medaka (Nakayama e al., 2005), and mo phological abno mali ies such as
do sal cu a u e, wis ed ails and pe ica dial edema in S. ma mo a us (Zhang e al.,
2011). Fu he mo e, TBT exposu e esul ed in inc eased le els o es os e one and lowe
es adiol le els in o a ies and es es o S. ma mo a us. The la e was accompanied by a
dec ease in Se oli cells ma ke and inc ease in lipid d ople s (Zhang e al., 2007, 2009a).
Finally, i has also been demons a ed ha TBT in e e es wi h he exp ession o genes
belie ed o be in ol ed in ish ep oduc ion and/o sex de e mina ion, such as Sox9, Dax1,
Cyp19a, SF1, ER, PPARγ, RXR α, β and γ (Pa liko a e al., 2010; McGinnis and C i ello,
2011; Zhang e al., 2009a, 2011).
Al hough ea lie s udies indica ed a low oxici y o TBT in mammalian cells
(San illo, 2001), subsequen e idence indica es ha mammals a e also sensi i e o TBT
exposu e. Some o he desc ibed e ec s a e simila o hose obse ed in ish: in e e ence
wi h s e oid me abolism (Jane , 2005), dec eased es adiol le els and ERα and ERβ
exp ession (Chen e al., 2008), imuno oxici y (Chen e al., 2011). Mo eo e , ecen da a
sugges ed he in ol emen o o gano ins in he de elopmen o obesi y (G ün e al., 2006).
Indeed, TBT has ecen ly been conside ed an “en i onmen al obsesogen” (G ün and
Blumbe g, 2009) as i causes he induc ion o adipogenesis in bo h cell cul u e models
and in i o: inc eases adipose mass in ogs and mice (G ün e al., 2006), induces he
di e en ia ion o p eadipocy e 3T3-L1 cells in o adipocy es and exp ession o adipogenic
gene ma ke (Kanayama e al., 2005; Li e al., 2011), inc eases iglyce ide s o age (Li e
Chap e 1
14
Figu e 1.3 Diag am illus a ing imposex model 2. I assumes ha in mollusks, es os e one induces male
ep oduc i e ac de elopmen . TBT would block es os e one syn hesis by inhibi ing a oma ase (A),
sul o ans e ase (B) o ATAT (C).
Despi e he di e en a emp s o explain he highe le els o es os e one in
imposex a ec ed emales, his imposex mechanism heo y has a majo d awback: he
absence o e idence o p o e ha sexual di e en ia ion in mollusks is d i en by
e eb a e-like s e oids such as es os e one and/o es adiol, which ac h ough hei
espec i e and ogen and es ogen ecep o s. Al hough ac i a ion o and ogen ecep o -
media ed ansc ip ion and cell p oli e a ion by TBT has been desc ibed in human cell
lines (Yamabe e al., 2000), he exis ence o a unc ional and ogen signaling pa hway in
mollusks, which is also ac i a ed by TBT, emains con o e sial (San os e al., 2005;
S e nbe g e al., 2008; Ma ko e al., 2009). Mo eo e , he in ol emen o s e oids in he
ep oduc ion o mollusks emains unclea , as no sex speci ic di e ences on es os e one
le els h oughou he ep oduc i e cycle we e ound in he mud-snail I. obsole a
(S e nbe g e al., 2008). The e o e, al hough di e en s udies con i m ha s e oids in
mollusks may ha e biological e ec s (such as oogenesis s imula ion, ma u a ion o

Chap e 1
15
es icula elemen s and p ecocious spe ma ogenesis (Siah, e al., 2003; Oehlmann e al.,
2006), he e is no e idence o indica e ha unc ional e eb a e-like s e oid ecep o s
exis in his g oup. These puzzling obse a ions sugges ha s e oid signaling, i p esen
in mollusks, migh ope a e in a dis inc way o ha o e eb a es (Ma ko e al., 2009) and
emphasize he need o deepe s udies on he endoc inology o mollusks.
1.2.3 Imposex model 3: in e e ence wi h e inoid signaling pa hways
A a he di e en p oposal on he mechanism o imposex induc ion by TBT
esul ed om an a emp o iden i y he a ini y o known EDCs owa ds human nuclea
ecep o s (Nishikawa e al. al., 1999; Nishikawa e al., 2004; Kanayama e al., 2005;
Figu e 1.4). Recep o -media ed mechanisms a e one o he possible means by which
EDCs exe hei e ec s, by mimicking o an agonizing endogenous ho mones. Nuclea
ecep o s a e a supe amily o ansc ip ion ac o s ac i a ed by ligands o di e se
chemical na u e (such as lipophilic ho mones, i amins, lipids o o he in acellula signals)
ha unc ion as an in e ace be ween he cellula en i onmen / body and he genome;
hey in eg a e ups eam signals in o coo dina ed gene exp ession and adequa e cellula
esponses (Sonoda e al., 2008). Nishikawa and co-wo ke s (2004) showed ha bo h TBT
and TPT we e able o inc ease he in e ac ion be ween human e inoic X ecep o (RXR)
and he co-ac i a o TIF2. This induc ion o ligand-dependen in e ac ion was somewha
highe han he one caused by RXR’s pu a i e na u al ligand 9-cis e inoic acid (9-cis RA).
Since his in e ac ion was known o be co ela ed wi h ansc ip ional ac i i y, soon a e ,
Nishikawa and co-au ho s hypo hesized ha his could be one o he molecula pa hways
in ol ed in imposex induc ion by o gano ins (Nishikawa e al., 2004). The e o e, in pu sui
o his hypo hesis, hese esea che s success ully cloned he RXR o hologue om he
mollusk T. cla ige a (TcRXR). TcRXR displayed a basic s uc u e simila o ha o o he
NR, consis ing o six modula uni s, wo o which highly conse ed: he DNA binding
domain (DBD) and he ligand binding domain (LBD). The DBD and LBD o TcRXR
p esen ed 89.6 % and 83.9 % o amino acid iden i y wi h hRXRa, espec i ely. Nishikawa
and co-au ho s u he demons a ed ha , simila o he human o hologue, TcRXR LBD
could bind in i o o 9-cis RA and o he o gano ins TBT and TPT. Finally, hey
success ully demons a ed ha exposu e o 9-cis RA signi ican ly induced imposex in T.
cla ige a.
Chap e 1
16
Figu e 1.4 Imposex model 3. Ac i a ion o RXR would induce male geni alia de elopmen . This pa hway
would be ep essed in no mal emales, bu exposu e o TBT would abno mally ac i a e RXR signaling and
induce he g ow h o male ep oduc i e ac .
These indings p o ided a comple ely dis inc pe spec i e on he imposex
phenomenon, bu hey also aised a se ies o o he pe inen ques ions. Is he
de elopmen o masculine s uc u es in emales caused by 9-cis RA induc ion
ep oducible in o he species o mollusks? Since i is known ha in e eb a es 9-cis RA
can also bind e inoic acid ecep o (RAR), is his phenomenon speci ically media ed by
RXR? Do e inoids exe biological unc ions in mollusks? I so, do mollusks possess he
enzyma ic machine y equi ed o syn hesise, s o e, signal and me abolize e inoids?
Add essing hese ques ions is essen ial o ully co obo a e his hypo hesis, and
comp ehend he imposex mechanism.
The absence o a ull unde s anding o he mechanisms o ac ion o TBT is he eal
d awback o p e en simila imposex-like scena ios. I is he e o e c ucial o cha ac e ize
he basic mechanisms like e inoid o s e oid signaling in animals o he han mammals in
o de o ecognize hei biological signi icance and sensi i i y o endoc ine dis up ing
chemicals.
Chap e 1
17
1.3 The e inoid signaling pa hway
“Re inoid” is a e m used by IUPAC-IUB (1982) o designa e ‘‘compounds
consis ing o ou isop enoid uni s joined in a head- o- ail manne ; all e inoids may be
o mally de i ed om a monocyclic pa en compound con aining i e ca bon-ca bon
double bonds and a unc ional e minal g oup a he e minus o he acyclic po ion.’’ This
ea ly de ini ion included all compounds, biologically ac i e o inac i e, s uc u ally ela ed
o i amin A, bu no syn he ic compounds ha displayed e inoid-like ac i i y. Some
au ho s use a b oade de ini ion o “ e inoid” ha also accommoda es compounds ha do
no esemble e inol bu elici e inoid-like ac i i y (Theodosiou e al., 2010).
In he con ex o his hesis, he e m “ e inoid” is used o designa e a g oup o
na u al and syn he ic compounds s uc u ally ela ed o i amin A ( e inol), which egula e
impo an cellula unc ions including mo phogenesis and emb yogenesis in e eb a es,
cell p oli e a ion, di e en ia ion and apop osis and homeos asis p ocesses (MacLean e
al., 2007; Albala , 2009). Re inoid unbalance has been associa ed wi h clinical condi ions
such as obesi y, diabe es, ca dio ascula disease, leukemia and skin diso de s (Kane e
al., 2008; Ziouzenko a and Plu zky, 2008). S udies in ol ing dis up ion o e inoic acid
(RA) signaling ha e demons a ed ha i amin A is undamen al o p ope emb yonic
de elopmen , namely o co ec pa e ning and neu al di e en ia ion, o neu al ube,
hea , eye, kidney and u ogeni al ac de elopmen , and o he ini ia ion o di e en ia ion
o he an e io egion o he p esomi ic mesode m ha o igina es new somi es (Clage -
Dame and Knu son, 2011).
In addi ion o e inol, he e inoid amily also includes e inaldehydes ( e inals),
e inyl es e s and e inoic acids (RAs; Figu e 1.5). Re inyl es e s a e he mos abundan in
animal issues, being ound mainly as e inyl palmi a e ( hough e inyl olea e and e inyl
s ea a e ha e also been ound; Theodosiou e al., 2010). Re inol, e inal and e inyl es e s
a e p ecu so s o he mos ac i e o m o i amin A, RA, which includes all h ee
s e eoisome s: all- ans, 9-cis and 13-cis RA (Campo-Paysaa e al., 2008). The p esence
o he isome s all- ans and 13-cis has been unequi ocally de ec ed in i o, being all- ans
he mos abundan in mice and humans (Tha che and Isohe anen, 2009). As o 9-cis
RA, un il e y ecen ly, i s p esence in biological samples had no been de ec ed and i s in
i o ole was ques ioned. Howe e , 9-cis RA has been de ec ed in mouse panc eas
(Kane e al., 2010), in ainbow ou issues (Ges o e al., 2012a), in iddle c abs (Albala ,
2009), in he mollusk hick op shell (Ges o e al., 2012b) and in insec emb yos (Nowickyj
e al., 2008).
Chap e 1
18
Figu e 1.5 S uc u es o some na u al e inoids and β-ca o ene (adap ed om Theodosiu e al., 2010 and
Ross e al., 2000).
Re inoids’ biological unc ions and mode o ac ion esembles ha o endogenous
ho mones. Howe e , since animals canno syn hesize e inol de no o and need o ob ain
i om he die , e inoids a e some imes called “die a y ho mones” (No ák e al., 2008).
Animals ob ain hese necessa y compounds ei he by di ec ly inges ing e inol and e ynil
es e s s o ed in o he animal issues o indi ec ly om ca o enoids exis en in plan s
(Theodosiou e al., 2010). Plan s, as well as some mic oo ganisms, ha e he abili y o
syn hesize ca o enoids (α-ca o ene, β-ca o ene, and β-c yp oxan hin). β-ca o ene can
hen be clea ed symme ically in o wo molecules o e inaldehyde (which can be ei he
educed o e inol o oxidized o RA) o asymme ically in o a iable chain leng h
apoca o enals, whose unc ion has no been deciphe ed so a (al hough i s p esence has
been de ec ed in issues; Simões-Cos a e al., 2008).
Re inoid homeos asis is main ained by a delica e balance in ol ing he syn hesis
and s o age o e inoid p ecu so s, hei ans o ma ion in o he biologically ac i e RA and
i s p ecise deg ada ion o ensu e speci ic esponses (Figu e 1.6). In addi ion o his
complex ne wo k o enzymes, e inoid signaling also equi es he exis ence o unc ional
nuclea ecep o s, able o in eg a e e inoid signals in o adequa e gene exp ession
pa e ns (Figu e 1.6). The e o e, e inoid ac ions in e eb a es can be egula ed a wo
le els: me abolism and signaling. The enzyma ic machine y esponsible o he
coo dina ion o spa ial and empo al le els o e inoids includes enzymes o syn hesis,
deg ada ion and possibly o s o age. As o signaling, e inoid unc ions a e media ed by
Chap e 1
19
he binding o RA o homodime s o he e odime s o med by membe s o wo amilies o
nuclea ecep o s, RAR and RXR (Ma lé az e al., 2006). This in u n egula es he
exp ession o genes in ol ed in hei own signaling pa hways (RA syn hesis, me abolism
and signaling) and in o he s pa hways as well (eg, homeobox genes; Schube e al.,
2005; Ma lé az e al., 2006).
1.3.1 Re inoid anspo and s o age
Re inoid le els a e kep cons an by he equilib ium be ween hei a ailabili y in
a ge issues, ci cula ion in he blood and s o age in li e and adipose issue. This
balance is kep by he ac ion o p o eins in ol ed in i s anspo a ion and by enzymes ha
es e i y o dees e i y e inol, mobilizing i as needed. All die a y e inoids a e enzyma ically
con e ed in o e inol in he in es ine lumen be o e up ake by he en e ocy es (Blomho
and Blomho , 2006). The e, e inol binds o speci ic p o eins om he amily o a y acid
binding p o eins (FABPs) called cellula e inol binding p o eins (CRBPs). CRBPs
in luence e inol a ailabili y and physiological unc ion, acili a ing cellula up ake and
s o age as e inyl es e s. In mos issues, he e inol-CRBPII complex, also called holo-
CRBP, deli e s e inol o leci hin: e inol ace yl ans e ase (LRAT) o be es e i ied wi h
long-chain a y acids, mainly palmi a e (Blomho and Blomho , 2006). In o he issues,
such as he mamma y gland and skin, his eac ion is pe o med by acyl-CoA: e inol
acyl ans e ase (ARAT) o diacylglice acyl ans e ase (DGAT1), espec i ely (No ák e al.,
2008; Napoli, 2012). I has been sugges ed ha he a io apo-CRBP1/holo-CRBP1
egula es LRAT con e sion o e inol in o e inyl-es e s. This eac ion, pe o med by LRAT,
ypically (bu no exclusi ely) occu s in in es inal cells, a e which mos e inol es e s a e
inco po a ed in o chylomic ons and anspo ed o a ge issues o o he li e , whe e hey
a e s o ed. When necessa y, e inol es e s can be me abolized back o e inol by e inyl
es e s hyd olases (REHs; Theodosiou e al., 2010). In his case, e inol binds o a di e en
p o ein, he e inol binding p o ein (RBP), ha appea s o keep endogenous e inoid le els
s able, o holo-RBP p esen s a concen a ion o 2 µM ega dless o luc ua ions in e inol
in ake (Theodosiou e al., 2010). In a no mal i amin A su iciency s a us, mos o he
e inol is anspo ed o speci ic li e cells, called s ella e cell, whe e i is s o ed in he o m
o e inyl es e s in cy oplasmic lipid d ople s (Blomho and Blomho , 2006; No ák e al.,
2008). To al e inol ( e inyl es e s plus e inol) in he s ella e cells accoun s o 50-80 % o
he o e all amoun p esen in he whole body, and abou 95% o he e inol is in he o m
o e inyl es e s in he abo emen ioned lipid d ople s (Blomho and Blomho , 2006).

Chap e 1
20
When e inol is equi ed in pe iphe al issues, Holo-RBP en e s he blood ci cula ion o be
dis ibu ed o issues and associa es o ans hy e in (TTR), a p o ein ha p e en s e inol
om being deg aded by he kidney. In he a ge cells, a memb ane ecep o (S a6)
ecognizes RBP, allowing he complex o en e he cell and deli e e inol o be p ocessed
in o biologically ac i e e inoids (Blomho and Blomho , 2006; Theodosiou e al., 2010).
1.3.2 Re inoid syn hesis: canonical o classical pa hway
In a ge issues, he ans o ma ion o e inol in o i s ac i e o m, RA, in ol es wo
successi e dehyd ogena ion s eps: i s , he con e sion o e inol in o e inaldehyde, and
hen, he con e sion o he la e in o e inoic acid. The i s eac ion is ca abolized by
alcohol dehyd ogenases (ADHs), cy osolic enzymes classi ied as medium-chain
dehyd ogenases/ educ ases (MDRs), and by e inol dehyd ogenases (RDHs), mic osomal
enzymes o he sho chain dehyd ogenases/ educ ase (SDRs) amilies. F om a
biochemical poin o iew, his is conside ed he a e-limi ing s ep in RA syn hesis
(Simões-Cos a e al., 2008). The second eac ion, which is in pa esponsible o he
egula ion o RA le els in a ge cells, equi es he ac ion o enzymes ha belong o he
aldehyde dehyd ogenases (ALDHs).
ADHs/RDHs
In i o, he oxida ion o e inol in o e inaldehyde is a e e sible eac ion ha can
be pe o med by ADHs o by RDHs, he di ec ion o he eac ion depending on he a io o
he co- ac o s NAD/NADH. Howe e , he main esponsible o e inal syn hesis in i o is
s ill a subjec o in ense deba e. Fo a long ime, i seemed ha ADHs, especially he
ubiqui ously exp essed ADH3, would be he mos ele an in p ocessing e inol (Simões-
Cos a e al., 2008). Dis up ion o mice Adh3 gene caused educed iabili y and g ow h,
bu hese e ec s could be escued by e inol supplemen a ion, indica ing ha in he
absence o ADH3 o he enzymes could compensa e i s unc ion in e inol me abolism.
Howe e , hese Adh3 null mice died when kep in a i amin A de icien die (VAD), hus
sugges ing ha when e inol quan i y is es ic ed ADH3 unc ion canno be compensa ed
by o he enzymes (Theodosiou e al., 2010). The appa en c ucial in ol emen o Adh3
gene in e inal syn hesis was ecen ly challenged by he inding ha an enzyme o he
mic osomal SDR amily, RDH10, migh play a mo e ele an ole (Sandell e al., 2012).
An Rdh10 null mouse model p esen ed emb yos wi h sho e an e opos e io axes, dila ed
and un-looped hea s, smalle somi es, de ec s in emb yo u ning and o elimbs g ow h,
Chap e 1
21
dying be o e g ow h (Sandell e al., 2012). Mo e s udies a e he e o e needed o add ess
he in i o po en ial o hese and o he candida e enzymes in modula ing e inol/ e inal
in e con e sion.
ALDHs/RALDHs
ALDHs a e a supe amily o enzymes wi h he abili y o me abolize aldehyde
subs a es, including e inaldehyde, bo h in he all- ans and 9-cis con o ma ion (Campo-
Paysaa e al., 2008). In e eb a es, membe s o he ALDH1A a e in ol ed in he
i e e sible con e sion o e inal in RA, a eac ion ha coincides wi h he signaling
ac i a ion by RA. Ve eb a es possess se e al ALDH genes, he bes s udied being
ALDH1A1, ALDH1A2, ALDH1A3 and ALDH8, coding o RALDH1, RALDH2, RALDH3,
RALDH4, espec i ely (Theodosiou e al., 2010). Roden s ha e an addi ional ALDH1A,
called ALDH1A4 in a and ALDH1A7 in mice. Knockou o Raldh2 in mice sugges s ha
i s main unc ion is o p o ide RA du ing de elopmen , as aldh2 -/- die be o e bi h bu
can be escued by RA supplemen a ion. All he o he RALDHs a e in ol ed in RA
syn hesis, al hough Knockou expe imen s sugges ha hei ole is less impo an han
Raldh2 (Theodosiou e al., 2010).
1.3.3 Re inoid syn hesis: non-canonical pa hway
An al e na i e pa hway o RA syn hesis has been p oposed a e he disco e y o
a gene encoding he enzyme β-ca o ene-15,15’-oxygenase, BCO-I, ha can clea e β-
ca o ene a he cen al double bond, p oducing wo e inal molecules in he all- ans
con igu a ion (Von Lin ig and Vog , 2000; Wyss e al, 2000). Re inaldehyde can hen be
ans o med in o e inol o in o RA and his is he eason why β-ca o ene is some imes
designa ed as p o i amin A (Ziouzenko a and Plu zky, 2008). I is belie ed ha BCO-I
may play an impo an ole in he isual cycle, pe haps in he syn hesis o e inaldehyde,
which is equi ed o pho o ecep ion. BCO-I KO in zeb a ish lead o mal o ma ions in he
e ina bu also caused se e al mo phogene ic mal o ma ions du ing emb yonic
de elopmen , hus poin ing o a majo ole o BCO-I as a sou ce o e inoid p ecu so s
du ing e eb a e de elopmen (Simões-Cos a e al., 2008).
Ano he enzyme, named BCO-II, is also a candida e o ha e a unc ion in RA
syn hesis, as i is able o asymme ically clea e β-ca o ene in o a β-ca o enal molecule
plus one o β-ionone (Kie e e al., 2001), al hough i s exac ole is ye o be cha ac e ized.
Chap e 1
22
β-apoca o enal is con e ed i s o β-apoca o enoic acid and subsequen ly o RA, bu he
enzymes in ol ed in his p ocess a e s ill unknown (Theodosiou e al., 2010).
1.3.4 Re inoid deg ada ion
Fine- uned egula ion o e inoic acid biological e ec s is achie ed by enzymes o
he cy och ome P450 amily and belonging o he CYP26 sub amily. These enzymes ha e
been implica ed in he ca abolism o e inoic acid in o a ious me aboli es wi h mino
biological ac i i y (such as 4-oxo-RA, 4-OH-RA o 18-OH-RA): pe haps by hyd oxyla ion
on C4 o C18 o he β-ionone ing o RA (Theodosiou e al., 2010). Fo a while, some
con o e sy su ounded he ole o CYP26: would i gene a e hese me aboli es, assuming
hey could play a ole, o es ic RA e ec s by deg ading i . S udies using Cyp26 KO
animals ha e con i med he la e hypo hesis, as dis up ion o he RA syn he ic enzyme
RALDH2 in mice escued he se e e pheno ypes obse ed in Cyp26 null animals
(Tha che and Isohe anen, 2009). I is now widely accep ed ha Cyp26 and RA syn hesis
enzymes ac in opposi e spa ial dis ibu ion, allowing he c ea ion o RA g adien s
esponsible o speci ic cellula unc ions (Simões-Cos a e al., 2008; Theodosiou e al.,
2010).
Figu e 1.6 O e iew o he e inoids and he enzyma ic machine y in ol ed in e eb a e e inoid syn hesis,
s o age, me abolism and signaling pa hways. In he amnio es canonical syn hesis pa hway e inol is e e sibly
oxidized o e inal by ADHs/RDHs. The e inal is i e e sibly con e ed o RA by ALDHs. RA in he 9-cis
con o ma ion binds RXR and RAR, while all- ans RA binds RAR only and ac i a ion o he RAR-RXR
he e odime egula es gene ansc ip ion. Re inoids a e s o ed mainly in he o m o e inyl es e s, which can
be con e ed back o e inol e inyl es e hyd olases (REHS). Ci cula ing e inol binds o Rbp and T , and
en e s he cells by binding o S a6. Wi hin he cell, e inol is usually bound o C bp. The acens al RA
syn he ic ou e in ol es he deg ada ion o β-ca o ene o e inal by BCO enzymes. RA is inac i a ed by CYP26
enzyma ic me aboliza ion, yielding o he me aboli es (adap ed om Albala , 2009 and Simões-Cos a e al.,
2008).
Chap e 1
23
1.3.5 Re inoic acid ecep o s
Wha was o a long ime a subjec o in ense specula ion is nowadays consensual:
mos RA biological ac i i y in e eb a es is media ed by he he e odime RAR/RXR (Ma k
e al., 2009). Bo h RAR and RXR sha e a simila s uc u e o ha o o he nuclea
ecep o s consis ing o i e o six modula uni s: A / B, C, D, E and F (Ge main e al.,
2003; Figu e 1.7). The AB egion con ains he ligand independen ac i a ion unc ion 1
(AF1), o which coac i a o binds (Ge main e al., 2003). Nex , he e is he C egion o
DBD ha ecognizes esponse elemen s hal si es in he p omo e s o he genes. This
ecogni ion is media ed h ough wo s uc u es, named zinc inge s, consis ing o a
complex o 4 cys eines su ounding a zinc ion (ZnII;Dawson and Xia, 2012). In he
junc ion be ween he DBD and he LBD ( egion E), is loca ed he D egion, an a ea ha is
belie ed o beha e as a hinge, con e ing lexibili y o he ecep o and enabling i o bind
o di e en NRs. The LBD is a e y conse ed s uc u e composed o 12 α helixes and a
small β-shee be ween H5 and H6, ha , in he absence o a ligand, o ms wha is
gene ally called an “an i-pa allel helical sandwich” (Pé ez e al., 2011; Sama u and
Roche e-Egly, 2011). This cen al hyd ophobic ca i y is also known as he "ligand-
pocke ”; he speci ici y o he ligand owa ds he ligand pocke de e mines a pa icula
physiological esponse (Sama u and Roche e-Egly, 2011). Upon ligand binding, α
helixes su e a con o ma ional shi ha allows he elease o co- ep esso s, binding o
co-ac i a o s and consequen ec ui men o o he egula o y p o eins (de G oo e al.,
2005). Besides in e ac ing wi h he ligand and he coac i a o s, he LBD also unc ions as
a dime iza ion in e ace be ween NRs. Finally, in he C- e minal end o he ecep o , is he
F egion, no e y conse ed and s ill o unknown unc ion.
Chap e 1
30
1.5 E olu ion mee s oxicology
The implica ions o he exis ence o unc ional e inoid signaling ou side
deu e os omes a e impo an no only o he unde s anding o he e olu ion o he
species, bu also om a oxicological pe spec i e. In pa icula , comp ehension o he
e olu iona y p ocess esponsible o he in e - and in a-speci ic genomic di e si ica ion o
NR is o majo impo ance and hus he ull ange o me azoan phyla mus be conside ed
(Figu e 1.10). As a o emen ioned, a ious classes o ecep o s ha e been ound in
diploblas ic (Cnida ia) and in iploblas ic animals, indica ing ha conside able a ia ion
al eady exis ed in his supe - amily be o e he appea ance o he bila e al symme y in
me azoans (Tho n on, 2003). This ances y makes he as majo i y o animal species
po en ial a ge s o NR-media ed endoc ine dis up ion. Howe e , i is he same
e olu iona y di e si y ha mines he ex apola ion o he unc ions o ecep o s (and
compounds capable o dis up ing hem) om e eb a es o o he g oups. Hence, when
he model s udies a e e eb a e-speci ic and hei e ec s a e no known in in e eb a es,
i is abusi e o assume ha a pa icula compound is a uni e sal endoc ine dis up o .
(Tho n on, 2003). Con e sely, a compound designed o bind o a speci ic e eb a e NR
may end up ac i a ing unknown signaling pa hways in non- a ge in e eb a es.
In e eb a es, i is known ha RA is in ol ed in nume ous physiological
p ocesses, including he es ablishmen o an e io -pos e io pa e ning in emb yos (Whi e
e al., 2007), he egula ion o he immune sys em, ep oduc ion and ision (Simões-Cos a
e al., 2008). Di ec o indi ec dis u bance o his signaling pa hway esul s in bi h
de ec s, e ili y p oblems, ision cons ain s, umo s and neu odegene a i e diseases
(Niede ei he and Dollé, 2008). As a co olla y, one may hypo hesize ha he highe
ances y o he e inoid signaling pa hway u ns a g ea e numbe o me azoan species
han p e iously an icipa ed suscep ible o EDCs, ac ing ia his e inoid signaling pa hway.
The TBT case is he pe ec example o such si ua ions. E en i labo a o y s udies
had been pe o med o de ec i s binding abili ies owa ds e eb a e’s nuclea ecep o s,
one could ne e p edic such dele e ious e ec s in aqua ic mollusks, o e inoid signaling
in his g oup had no been disco e ed.
Two species ha belong o phylogene ically dis an g oups (mollusks and
e eb a es, Figu e 1.10) ha e been selec ed o s udy he p oposed hypo hesis:
endoc ine dis up ion caused by TBT in ol es modula ion o conse ed e inoid signaling
pa hways. The selec ed species, N. lapillus and D. e io ha e long been used in
oxicological s udies and biological impac has been epo ed upon TBT exposu e. Apa
om RXR, no gene in ol ed in e inoid signaling has been cloned in mollusks. The e o e,

Chap e 1
31
he s udy o his signaling pa hway is a p e- equisi e o be ul illed, be o e he assessmen
o he impac o TBT exposu e. As such, his s udy will also con ibu e o he
unde s anding o e inoid signaling e olu ion h oughou me azoans.
Figu e 1.10 Phylogene ic ela ionships be ween Me azoan phyla. Blue boxes indica e animal lineages whe e
NR media ed endoc ine dis up ion has been sugges ed. No e: he cephalocho da e phylogene ic posi ion
wi hin cho da es has been e iewed in he pas yea s. They a e now conside ed basal cho da es and he
u ocho da es he sis e clade o e eb a es. Modi ied om Holland (1999).
Chap e 1
32
1.6 The animal models
1.6.1 The dogwhelk, N. lapillus
N. lapillus (Linnaeus, 1758) is a mollusk ha belongs o he Gas opoda (o de
Neogas opoda and amily Mu icidae), he la ges and mo e di e se class o he phylum
Mollusca, wi h o e 62 000 desc ibed species. N. lapillus has a wide geog aphical
dis ibu ion and can be ound all along he A lan ic coas o Eu ope ( om he 73oN in he
Ba en s Sea o 37oN in sou he n Po ugal) and on he A lan ic coas o No h Ame ica
(since 50oN No e Dame Bay o 41oN Long Island; C o he s, 1985).
This species is e y common in he in e idal zone o ocky sho es, bo h in
exposed and shel e ed a eas, which, acco ding o se e al s udies, in luences he shape o
he shell (C o he s, 1975, 1977, 1983, 1985).
N. lapillus is a e y common ac i e p eda o in he in e idal zone and he e o e o
g ea impo ance in con olling he majo occupie s o ha en i onmen (Menge, 1976;
Bu ows and Hughes, 1991). I eeds mos ly on mussels (My ilus sp) and ba nacles
(Semibalanus balanoides, Balanus sp, Elminius modes us, C hamalus sp), bu also on
limpe s and o he mollusks, hough in less quan i ies (eg, Pa ella sp, Gibulla sp,
Monodon as linea a, Os ea edulis and Li o ina sp; C o he s, 1985).
In hese gas opods, he sexes a e sepa a ed (gonocho ic) and e iliza ion is
in e nal (F e e , 1953). In he b eeding season, hey o m agg ega es o up o 30 adul s in
c e ices and pools. Rep oduc ion seems o occu h oughou he yea , al hough in he
B i ish sho es a peak in sp ing and win e is e iden (Moo e, 1936; Hughes and Bu ows,
1993). A e ma ing, emales lay eggs in p o ec i e capsules which can con ain up o 600
eggs. Only 6% he eggs a e iable and de elop in o emb yos which eed on he o he s:
he so-called “nu se eggs”. Emb yonic de elopmen can las up o i e mon hs in
empe a e zones (Fea e, 1970), and comp ises a ochopho e s age, ollowed by he
elige , a e which he ju eniles ha ch. These a e e y simila o adul s, di e ing in size
and ep oduc i e capabili y (Fea e, 1970). Thei ecology has been ho oughly s udied and
hey ha e been used o se e al decades as a sen inel species in moni o ing s udies,
mos ly associa ed wi h TBT con amina ion. In addi ion, he a ious s ages o imposex
de elopmen ha e been ho oughly desc ibed in he li e a u e and hei se e i y can be
classi ied acco ding o he gene al scheme p oposed by Be in e al., (1996), displayed in
Figu e 1.11. Hence, he la ge body o a ailable li e a u e a o s he use o his species as
a model o ganism in he p esen wo k.
Chap e 1
33
Figu e 1.11 Gene al scheme o imposex e olu ion in p osob anchs. Abb e ia ions: ac, abo ed capsules; cg,
capsule gland; gp, geni al papilla; obc, open bu sa copula ix; ocg, open capsule gland; oc , occlusion o he
ul a; p, penis; pd, pems duc ; p , p os a e; e, en acle; d, as de e ens; dp, as de e ens passage in o
capsule gland; ds, as de e ens sec ion (Be in e al., 1996).
1.6.2 The zeb a ish, D. e io
D. e io, also known as zeb a ish, is a eshwa e ish o he Cyp inidae amily,
na i e o no heas e n India and adjacen egions (Engesze e al., 2007). This species
has been widely used as model in many s udies due o he la ge numbe o ad an ageous
ea u es, bo h om a echnical and concep ual pe spec i e.
F om a p ac ical poin o iew, i s ands ou om o he animal models o i s easy
and low main enance cos s, high ecundi y, sho li e-cycle (comple ed in 10-12 weeks),
sho and ully desc ibed emb yonic de elopmen (Kimmel e al., 1995; Dooley and Zon,
2000; Hill e al., 2005; Spence e al., 2008). Fu he mo e, nume ous ools and in o ma ion
Chap e 1
34
a e a ailable o zeb a ish s udies, including he comple ely sequenced genome
(h p://www.ensembl.o g/index.h ml) and a his ological a las o he gonads
(h p://www. i m.nl/ ish oxpa ). In he en i onmen , zeb a ish has a seasonal ep oduc ion,
bu unde op imal labo a o y condi ions, emales can deposi be ween 50-200 eggs, 3-4
imes pe week. Fe iliza ion is ex e nal; eggs a e anspa en and de elop apidly: 24
hou s a e e iliza ion (hp ) he main body plan is es ablished and 96 hp mos o gans a e
al eady ully de eloped (Spence e al., 2008). Zeb a ish is conside ed an undi e en ia ed
gonocho ic species, meaning ha all indi iduals unde go an ini ial phase in which hei
gonads a e non unc ional o a ies wi h only imma u e oocy es I (Ö n e al., 2003). By he
23 h day, 50% o he animals de elop ma u e and unc ional o a ies, while he emaining
o a ian issues eg ess and p oduce unc ional es es (Hill and Janz, 2003).
Exposu e o es ogens has been epo ed o al e zeb a ish sexual di e en ia ion,
bu he mechanisms unde lying his phenomenon a e unknown (Van den Bel e al., 2003;
Soa es e al., 2009). Simila ly, masculinizing e ec s ha e also been desc ibed, again
wi hou explana ion (McAllis e and Kime, 2003; San os e al., 2006a). The unde s anding
o such e ec s is delayed by he lack o knowledge on he molecula ac o s egula ing i s
no mal sexual de e mina ion and di e en ia ion. I has been sugges ed ha au osomal
genes as Sox9a and Sox9b ( his species has no iden i ied sex ch omosomes) o an i-
Muelle ian ho mone (Segne , 2009) a e in ol ed, bu hei ole in sexual di e en ia ion
and in media ing he impac o EDCs is s ill unclea .
F om a concep ual s andpoin , and despi e he addi ional genome duplica ion ha
occu ed in eleos ish (Hill e al., 2005), he use o ish species in he s udy o EDCs
e ec s a e ele an , since eleos and mammal’s close phylogene ic ela ionship acili a es
he ex apola ion o knowledge on diseases, biology, gene ic p ocesses and oxicology
s udies (Dooley and Zon, 2000; Spence e al., 2008). Howe e , he need o u he
cha ac e ize he molecula and gene ic mechanisms ha egula e he sexual
di e en ia ion in zeb a ish emains o be elucida ed.
Chap e 1
35
1.7 Objec i es
The cen al aim o his hesis is o add ess he mechanisms o endoc ine dis up ion
o a p io i y and ogenic chemical, TBT. Gi en ha he majo d awback o add ess he
mode o ac ion o EDCs in in e eb a es lies on he lack o knowledge o hei
endoc inology and molecula signaling pa hways, i is an objec i e o his hesis o
elucida e he p esence o molecula signaling pa hway in ol ed in e inoid and, o a lesse
ex en , s e oid me abolism. These wo pa hways we e selec ed since hey ha e been
sugges ed o be majo a ge s o TBT. Unde s anding he mode o ac ion o endoc ine
dis up o s such as TBT is essen ial no only o imp o e isk assessmen o he chemical
unde s udy, bu also o an icipa e he impac o o he chemicals ac ing h ough he same
signaling pa hways. The ini ial sec ions add ess he molecula a ge o TBT in N. lapillus,
while also dissec ing some o he molecula componen s o he e inoid and s e oid
signaling pa hway in gas opod mollusks. The second sec ion analyses he impac s o
TBT in RA signaling in he eleos D. e io. Gi en ha bo h species belong o dis inc
phyla, hei s udy is expec ed o p o ide insigh s in o he e olu ion o his signaling
pa hway, and i s exploi a ion by he ubiqui ous con aminan TBT.
In o de o accomplish hese gene ic aims, ou speci ic objec i es we e de ined:
1. To add ess he possible in e e ence o TBT wi h e inoid signaling ela ed
genes in mollusks, in pa icula wi h RXR. N. lapillus RXR was i s isola ed
and a pha macological app oach was used o cha ac e ize i s in ol emen
in he imposex de elopmen . In o de o ge u he insigh s in o he
mechanisms o imposex induc ion by TBT, he ansc ip ion le els o RXR
in di e en issues a e TBT exposu e we e quan i ied (Chap e 2);
2. To iden i y genes hypo he ically in ol ed in e inoid signaling in mollusks,
as his pa hway is ye o be desc ibed ou side cho da es, and gain mo e
insigh s on hei possible biological unc ion. Two key genes hypo he ically
in ol ed in e inoid me abolism in e eb a es (Adh3 and Cyp26) we e
isola ed, i s basal ansc ip ion pa e ns de e mined and possible
modula ion a e TBT exposu e assessed (Chap e 3). Since he RAR/RXR
is he he e odime media ing e inoid signaling in e eb a es, he i s RAR

Chap e 1
36
o hologue in a p o os ome species was isola ed and i s hypo he ical
unc ion discussed (Chap e 3);
3. To iden i y o he possible signaling pa hways a ec ed by TBT exposu e,
such as genes in ol ed in s e oid me abolism in mollusks. The 17β
hyd oxys e oid dehyd ogenase ype 12 (Hsd17b12) was cloned and i s
unc ional and oxicological aspec s we e e alua ed (Chap e 4).
4. To e alua e he ep oduc i e e ec s caused by abno mal exposu e o
zeb a ish o e inoid agonis s, wi h special emphasis on he consequences
o TBT exposu e in i o, namely, in unde s anding he molecula pa hways
a ec ed. In o de o achie e his, a zeb a ish li e-cycle exposu e o e inoid
agonis s was pe o med, hei e ec s in ep oduc ion assessed, and he
possible impac ed molecula pa hways in es iga ed (Chap e 5).
The objec i es o his hesis a e explo ed h ough he ollowing chap e s and pa ly
published in in e na ional jou nals, as indica ed nex :
Chap e 1: In oduc ion
Chap e 2: Re inoid signaling and imposex in N. lapillus
2.1 Imposex induc ion is media ed h ough he Re inoid X Recep o signaling
pa hway in he neogas opod Nucella lapillus, Cas o, L. Filipe C., Lima, D., Machado, A.,
Melo, C., Hi omo i, Y., Nishikawa, J., Nakanishi, T., Reis-Hen iques, M. A., San os, M. M.,
2007. Aqua . Toxicol. 85, 57–66. (adap ed om)
2.2 T ibu yl in-induced imposex in ma ine gas opods in ol es issue-speci ic
modula ion o he Re inoid X Recep o , Lima, D., Reis-Hen iques, M.A, Sil a, R., San os,
A.I., Cas o, L. Filipe C., San os, M.M., 2011. Aqua . Toxicol. 101, 221–227.
Chap e 3: Re inoid signaling in N. lapillus: Adh3, Cyp26 and RAR
Chap e 1
37
3.1 Molecula cha ac e iza ion o Adh3 om he mollusk Nucella lapillus: issue
gene exp ession a e ibu yl in and e inol exposu e, Lima, D., Coelho, I., And é, A.,
Melo, C., Rui o, R., Reis-Hen iques M.A., San os, M.M., Cas o, L.F.C (accep ed by he
Jou nal o Molluscan S udies)
3.2 Isola ion o he i s p o os ome cy och ome P26 o hologue in he imposex-
sensi i e gas opod Nucella lapillus: molecula and oxicological insigh s
Daniela Lima e al. (in p epa a ion)
3.3 Isola ion and basal cha ac e iza ion o he Re inoic Acid Recep o (RAR) in he
gas opod mollusk Nucella lapillus
Daniela Lima e al. (in p epa a ion)
Chap e 4: The 17β hyd oxys e oid dehyd ogenase ype 12 in he
neogas opod Nucella lapillus: unc ional and oxicological insigh s
Lima, D., Machado, A., Reis-Hen iques, M. A., Rocha, E., San os, M. M., Cas o,
L. F. C (accep able pending e isions by he Jou nal o S e oid Biochemis y)
Chap e 5: E alua ion o he ep oduc i e impac o TBT and o he e inoid
ecep o s agonis s in he zeb a ish, Danio e io
Daniela Lima e al. (in p epa a ion)
Chap e 6: Gene al discussion, Final conside a ions and conclusions, Fu u e
pe spec i es, Re e ences
Chap e 1
38
1.8 Re e ences
Albala , R. 2009. The e inoic acid machine y in in e eb a es: ances al elemen s and
e eb a e inno a ions. Mol. Cell. Endoc inol. 313, 23–35.
Albanis, T., Alle a, A., Bachmann, J., Ba baglio, A. B. P., Di mann, N., Ca ne ali, D. C.,
Cice i, F., Dagnac, T. D. M., Falandysz, J., Galassi, S., Hala, D., Jane , G.,
Jeanno , R., J., S, King, I., Klingmulle , D., Kloas, W., Kusk, K.O., La ado, R. L. S,
Lu z, I., Oehlmann, J., O edsson, S., Po e, C., R.-W., M, Sakkas, V., Schmi , C.,
Schul e-Oehlmann, U., S. M., and Tyle X, an Ae le, R., an Ballegoy, C. W.,
2006. Execu i e summa y on he p ojec esul s o COMPRENDO - Compa a i e
Resea ch on Endoc ine Dis up e s.
Alzieu, C. l., Sanjuan, J., Michel, P., Bo el, M., D eno J. P., 1989. Moni o ing and
assessmen o bu yl ins in A lan ic coas al wa e s, Ma ine Pollu ion Bulle in. Ma ine
Pollu ion Bulle in 20.
Ba oso, C. M., Mo ei a, M.H., 2002. Spa ial and empo al changes o TBT pollu ion along
he Po uguese coas : inefficacy o he EEC di ec i e 89/677. Ma . Pollu . Bull. 44,
480-486
Ba oso, C. M., Mo ei a, M. H., Bebianno, M. J., 2002. Imposex, emale s e ili y and
o gano in con amina ion o he p osob anch Nassa ius e icula us (L.) om he
Po uguese coas . Ma . Ecol. P og. Se . 230, 127-135.
Baue , B., Fio oni, P., Schul e-Oehlmann, U., Oehlmann, J., Kalb us, W. 1997. The use o
Li o ina li o ea o ibu yl in (TBT) e ec moni o ing - Resul s om he Ge man
TBT su ey 1994/1995 and labo a o y expe imen s. En i on. Pollu . 96, 299–309.
Be o, D., Giani, M., Boscolo, R., Co elli, S., Gio ana di, O., Massi oni, M., G assia, L.,
2007. O gano ins (TBT and DBT) in wa e , sedimen s, and gas opods o he
sou he n Venice lagoon (I aly). Ma . Pollu . Bull. 55, 425-435.
Be in, C., Oehlmann, J., S oben, E., 1996. TBT-induced imposex in ma ine
neogas opods is media ed by an inc easing and ogen le el. Helgol. Ma . Res. 50,
299-317.
Biddie, S. C., John, S., Hage , G. L., 2010. Genome-wide mechanisms o nuclea ecep o
ac ion. T ends Endoc in. Me . 21, 3-9.
Blabe , S. J. M., 1970. The occu ence o a penis-like ou g ow h behing he igh en acle in
spen emales o Nucella lapillus (L.) P oc. Malacol. Soc. London 39, 231-233.
Blomho , R., Blomho , H. K., 2006. O e iew o e inoid me abolism and unc ion. J.
Neu obiol, 606–630.
Chap e 1
39
B igh , D. A., Ellis, D. V., 1990. A compa a i e su ey o imposex in no heas Paci ic
neogas opods (P osob anchia) ela ed o ibu yl in con amina ion, and choice o a
sui able bioindica o . Can. J. Zool. 68: 1915-1924.
B uck, N., Vi oux, D., Fe y, C., Duong, V., Baue , A., de Thé, H., Roche e-Egly, C., 2009.
A coo dina ed phospho yla ion cascade ini ia ed by p38MAPK/MSK1 di ec s RAR
alpha o a ge p omo e s. Embo. J. 28, 34-47.
B yan G. W., Gibbs P. E., Humme s one L. G., Bu . G. R., 1986. The decline o he
gas opod Nucella lapillus a ound sou h-wes England: E idence o he e ec o
ibu yl in om an i ouling pain s. J. Ma . Biol Assoc. UK. 66, 611–640.
Bu ows, M. T., Hughes, R. N., 1991. Op imal o aging decisions by dogwhelks, Nucella
lapillus (L.): In luences o mo ali y isk and a e-cons ained diges ion. Func . Ecol.
5, 461.
Campo-Paysaa, F., Ma lé az, F., Laude , V., Schube , M., 2008. Re inoic acid signaling in
de elopmen : issue-speci ic unc ions and e olu iona y o igins. Genesis. 46, 640-
656.
Cañes o, C., Pos le hwai , J. H., Gonzàlez-Dua e, R., Albala , R., 2006. Is e inoic acid
gene ic machine y a cho da e inno a ion? E ol. De . 8, 394-406.
Chen, Y., Zuo, Z., Chen, S., Yan, F., Chen, Y., Yang, Z., Wang, C., 2008. Reduc ion o
spe ma ogenesis in mice a e ibu yl in adminis a ion. Toxicology, 251, 21-27.
Chen, Q.; Zhang, Z.; Zhang, R.; Niu, Y.; Bian, X., Zhang, Q., 2011. T ibu yl in chlo ide-
induced immuno oxici y and hymocy e apop osis a e ela ed o abno mal Fas
exp ession. In . J. Hyg. En i . Heal., 214, 145-50.
Clage -Dame, M., Knu son, D., 2011. Vi amin A in ep oduc ion and de elopmen .
Nu ien s. 3, 385-428.
Cooke, G. M., 2002. E ec o o gano ins on human a oma ase ac i i y in i o. Toxicol.
Le . 25, 121-130.
Co ay, C., Ba d, S., 2007. Pe sis ence o ibu yl in-induced imposex in dogwhelks
(Nucella lapillus) and in e sex in pe iwinkles (Li o ina li o ea) in A lan ic Canada.
Wa e Qual. Res. J. Can. 42, 111-122.
C o he s, J. H., 1975. On a ia ion in Nucella lapillus (L): shell shape in popula ions om
he sou h coas o England. P oc. Malacol. Soc. London 41, 489-498.
C o he s, J. H., 1977. On a ia ion in Nucella lapillus (L): shell shape in popula ions
owa ds he Sou he n limi o i s Eu opean ange. J. Mollus. S ud. 43, 181-188.
C o he s, J. H., 1983. Va ia ion in dog-whelk shells in ela ion o wa e ac ion and c ab
p eda ion. Biol. J. Linn. Soc. 20, 85-102.
Chap e 1
46
issues by ibu yl in and he second messenge ac i a o , o skolin. Chem-Biol
In e ac . 185, 119-127.
Pé ez, E., Bou gue , W., G onemeye , H., Le a, A. R. D., 2012. Modula ion o RXR
unc ion h ough ligand design. BBA- Lipid Lipid Me . 1821, 57-69.
Ronis, M. J. J., Mason, A.Z., 1996. The me abolism o es os e one by pe iwinkle (Li o ina
li o ea) in i o and in i o: e ec s o ibu yl in. Ma . En i on. Res. 42, 161-166.
Sai oh, M., Yanase, T., Mo inaga, T., Tanabe, M., Mu, Y-M., Nishi, Y., Nomu a, M.,
Okabe, T., Go o, K., Takayanagi, R., 2001. T ibu yl in o iphenyl in inhibi s
a oma ase ac i i y in he human g anulosa-like umo cell line KGN. Biochem.
Biophys. Res. Commun. 289, 198-204.
Sama u , E., Roche e-Egly, C., 2011. Nuclea e inoic acid ecep o s: conduc o s o he
e inoic acid symphony du ing de elopmen . Mol. Cell. Endoc inol. 1-13.
Sandell, L. L., Lynn, M. L., Inman, K. E., McDowell, W., T aino , P. A., 2012. RDH10
Oxida ion o i amin A is a c i ical con ol s ep in syn hesis o e inoic acid du ing
mouse emb yogenesis. PloS one 7, e30698. doi:10.1371/jou nal.pone.0030698.
San os, M. M., Halle s-Tjabbes, T. C., San os, A., Viei a, N., 2002. Imposex in Nucella
lapillus, a bioindica o o TBT con amina ion: e-su ey along he Po uguese
coas o moni o he e ec i eness o EU egula ion. J. Sea Res. 48, 217-223.
San os, M. M., Cas o, L. F. C., Viei a, M. N., Micael, J., Mo abi o, R., Massanisso, P.,
Reis-Hen iques, M. A., 2005. New insigh s in o he mechanism o imposex
induc ion in he dogwhelk Nucella lapillus. Comp. Biochem. Physiol. C. 141, 101-
109.
San os, M. M., Micael, J., Ca alho, A. P., Mo abi o, R., Booy, P., Massanisso, P.,
Lamo ee, M., Reis-Hen iques, M. A., 2006a. Es ogens coun e ac he
masculinizing e ec o ibu yl in in zeb a ish. Comp. Biochem. Physiol. Toxicol.
Appl. Pha m. 142, 151-155.
San os, M. M., Reis-Hen iques, M. A., Viei a, M. N., Solé, M., 2006b. T iphenyl in and
ibu yl in, single and in combina ion, p omo e imposex in he gas opod Bolinus
b anda is. Eco ox. En i on. Sa e. 64, 155-162.
San os, M. M., Enes, P., Reis-Hen iques, M. A., Kuballa, J., Cas o, L. F. C., Viei a, M. N.,
2009. O gano in le els in sea ood om Po uguese ma ke s and he isk o
consume s. Chemosphe e. 75, 661-666.
San os, M. M., Reis-Hen iques, M. A., Cas o, L. F. C., 2011. Lipid homeos asis
pe u ba ion by o gano ins: e ec s on e eb a es and in e eb a es. In
Biochemical and biological e ec s o o gano ins, Ben ham Science Publishe s,
115-134.

Chap e 1
47
San illo, P. J., 2001. Chap e 13 - T ibu yl in (TBT) an i oulan s: a ale o ships, snails and
imposex. In La e lessons om ea ly wa nings: he p ecau iona y p inciple 1896-
2000, EEA, En i onmen al issue epo No 22/2001 135–148.
Schube , M., Yu, J.-K., Holland, N. D., Esc i a, H., Laude , V., Holland, L. Z., 2005.
Re inoic acid signaling ac s ia Hox1 o es ablish he pos e io limi o he pha ynx
in he cho da e amphioxus. De elopmen 132, 61-73.
Segne , H., 2009. Zeb a ish (Danio e io) as a model o ganism o in es iga ing endoc ine
dis up ion. Comp. Biochem. Physiol.. Toxicol. Appl. Pha m. 149, 187–195.
Shimasaki, Y., Ki ano, T., Oshima, Y., Inoue, S., Imada, N., Honjo, T., 2003. T ibu yl in
causes masculiniza ion in ish. En i on. Toxicol. Chem. 22, 141-144.
Shimasaki, Y., Oshima, Y., Inoue, S., Inoue, Y., Kang, I. J., Nakayama, K., Imo o, H.,
Honjo, T., 2006. E ec o ibu yl in on ep oduc ion in Japanese whi ing, Sillago
japonica. Ma . En i on. Res. 62, Suppl, S245–8.
Siah, A., Pelle in, J., Amia d, J.-C., Pelle ie , E., Viglino, L., 2003. Delayed game ogenesis
and p oges e one le els in so -shell clams (Mya a ena ia) in ela ion o in si u
con amina ion o o gano ins and hea y me als in he S . Law ence Ri e (Canada).
Comp. Biochem. Phys. C. 135, 145-156.
Simões-Cos a, M., Azambuja, A. P., Xa ie -Ne o, J., 2008. The sea ch o non‐cho da e
e inoic acid signaling: lessons om cho da es. J. Exp. Zool. 310B, 54-72.
Smi h, B. S., 1971. Sexuali y in he ame ican mud snail, Nassa ius obsole us Say. J.
Molluscan S ud. 39, 377-378.
Smi h, B. S., 1981a. Male cha ac e is ics on emale mud snails caused by an i ouling
bo om pain s. J. Appl. Toxicol. 1, 22-25.
Smi h, B. S., 1981b. Rep oduc i e anomalies in s enoglossan snails ela ed o pollu ion
om ma inas. J. Appl. Toxicol. 1, 15-21.
Smi h, B. S., 1981c. T ibu yl in compounds induce male cha ac e is ics on emale mud
snails Nassa ius obsole us (Ilyanassa obsole a). J. Appl. Toxicol. 141-144.
Soa es, J., Coimb a, A. M., Reis-Hen iques, M. A., Mon ei o, N. M., Viei a, M. N., Oli ei a,
J. M. A., Guedes-Dias, P., Fon aínhas-Fe nandes, A., Pa a, S. S., Ca alho, A.
P., Cas o, L. F. C., San os, M. M., 2009. Dis up ion o zeb a ish (Danio e io)
emb yonic de elopmen a e ull li e-cycle pa en al exposu e o low le els o
e hinyles adiol. Aqua . Toxicol. 95, 330-338.
Sonoda, J., Pei, L., E ans, R. M., 2008. Nuclea ecep o s: decoding me abolic disease.
FEBS le e s. 582, 2–9.
Spence, R., Ge lach, G., Law ence, C., Smi h, C., 2008. The beha iou and ecology o he
zeb a ish, Danio e io. Biol. Re . 83, 13–34.
Chap e 1
48
Spoone , N., Gibbs, P. E., B yan, G. W., Goad, L. J., 1991. The e ec o ibu yl in upon
s e oid i e s in he emale dogwhelk, Nucella lapillus, and he de elopmen o
imposex. Ma . En i on. Res. 2, 37-49.
S e nbe g, R. M., LeBlanc, G., 2006. Kine ic cha ac e iza ion o he inhibi ion o acyl
coenzyme A: s e oid acyl ans e ases by ibu yl in in he eas e n mud snail
(Ilyanassa obsole a). Aqua . oxicol. 78, 233-242.
S e nbe g, R.M., Ho chkiss, A.K., LeBlanc, G.A., 2008. The con ibu ion o s e oidal
and ogens and es ogens o ep oduc i e ma u a ion o he eas e n mud snail
Ilyanassa obsole a. Gen. Comp. Endoc inol. 156, 15-26.
S e nbe g, R., Gooding, M., Ho chkiss, A., LeBlanc, G., 2010. En i onmen al-endoc ine
con ol o ep oduc i e ma u a ion in gas opods: implica ions o he mechanism o
ibu yl in-induced imposex in p osob anchs. Eco oxicology 19, 4-23.
S e nbe g, R. M., 2012. O gano ins as endoc ine dis up o s: an examina ion o ibu yl in-
induced imposex in Neogas opods. In Biochemical and biological e ec s o
o gano ins, Ben ham Science Publishe s, 75-82.
S oben, E., Oehlmann, J, B. C., 1991. TBT-induced imposex and he ole o s e oids in
ma ine snails. P oceedings o he 10 h Wo ld Mee ing o he ORTEP Associa ion,
68-73.
Sump e , J. P., 2005. Endoc ine Dis up e s in he Aqua ic En i onmen : An O e iew.
Ac a Hyd ochim. Hyd obiol. 33, 9-16.
Tha che , J. E., Isohe anen, N., 2009. The ole o CYP26 enzymes in e inoic acid
clea ance. Expe Opinion D ug. Me ab.. Toxico., 1-21.
Theodosiou, M., Laude , V., Schube , M., 2010. F om ca o o clinic: an o e iew o he
e inoic acid signaling pa hway. Cell. Mol. Li e Sci. 67, 1423-1445.
Tho n on, J. W., 2003. Nonmammalian nuclea ecep o s: e olu ion and endoc ine
dis up ion. Pu e Appl. Chem. 75, 1827-1839.
Tillmann, M., Schul e-Oehlmann, U., Du , M., Ma ke , B., Oehlmann, J., 2001. E ec s o
endoc ine dis up o s on p osob anch snails (Mollusca: Gas opoda) in he
labo a o y. Pa III: Cyp o e one ace a e and inclozolin as an iand ogens.
Eco oxicology. 10, 373–388.
U quiza, A. M., Liu, S., Sjöbe g, M., Ze e s öm, R. H., G i i hs, W., Sjö all, J., Pe lmann,
T. P., 2000. Docosahexaenoic acid, a ligand o he e inoid X ecep o in mouse
b ain. Science. 290, 2140-2144.
Van den Bel , K., Ve heyen, R., Wi e s, H., 2003. E ec s o 17alpha-e hynyles adiol in a
pa ial li e-cycle es wi h zeb a ish (Danio e io): e ec s on g ow h, gonads and
emale ep oduc i e success. Sci. To al En i on. 309, 127-137.
Chap e 1
49
Vasiliou, V., Pappa, A., Es ey, T., 2004. Role o human aldehyde dehyd ogenases in
endobio ic and xenobio ic me abolism. D ug. Me ab. Re . 36:279-299.
Viglino, L., Pelle ie , E., S -Louis, R., 2004. Highly pe sis en bu yl ins in no he n ma ine
sedimen s: a long- e m h ea o he Saguenay Fjo d (Canada). En i on. Toxicol.
Chem. 23, 2673-2681.
Von Lin ig, J., Vog , K., 2000. Filling he gap in i amin A esea ch. molecula iden i ica ion
o an enzyme clea ing be a-ca o ene o e inal. The J. Biol. Chem. 275, 11915-
11920.
Whi e, R. J., Nie, Q., Lande , A. D., and Schilling, T. F., 2007. Complex egula ion o
cyp26a1 c ea es a obus e inoic acid g adien in he zeb a ish emb yo. PLoS
Biology. 5, 12.
Wyss, A, Wi z, G, Woggon, W, B ugge , R, Wyss, M, F iedlein, A, Bachmann, H,
Hunzike , W., 2000. Cloning and exp ession o be a,be a-ca o ene 15,150-
dioxygenase. Biochem. Bioph. Res. Commun. 271, 334-336.
Yamabe, Y., Hoshino, A., Imu a, N., Suzuki, T., Himeno, S., 2000. Enhancemen o
and ogen-dependen ansc ip ion and cell p oli e a ion by ibu yl in and
iphenyl in in human p os a e cance cells. Toxicol. Appl. Pha m. 169, 177–184.
Zhang, J., Zuo, Z., Chen, Y., Zhao, Y., Hu, S., Wang, C., 2007. E ec o ibu yl in on he
de elopmen o o a y in emale cu ie (Sebas iscus ma mo a us). Aqua . Toxicol.
83, 174-179.
Zhang, J., Zuo, Z., He, C., Cai, J., Wang, Y., Chen, Y., Wang, C., 2009a. E ec o
ibu yl in on es icula de elopmen in Sebas iscus ma mo a us and he
mechanism in ol ed. En i on. Toxicol. Chem. 28, 1528-1535.
Zhang, J., Zuo, Z., He, C., Wu, D., Chen, Y., Wang, C., 2009b. Inhibi ion o hy oidal
s a us ela ed o dep ession o es icula de elopmen in Sebas iscus ma mo a us
exposed o ibu yl in. Aqua . Toxicol. 94, 62-67.
Zhang, J., Zuo, Z., Wang, Y., Yu, A., Chen, Y., Wang, C., 2011. T ibu yl in chlo ide esul s
in do sal cu a u e in emb yo de elopmen o Sebas iscus ma mo a us ia
apop osis pa hway. Chemosphe e. 82, 437-442.
Zheng, R., Wang, C., Zhao, Y., Zuo, Z., Chen, Y., 2005. E ec o ibu yl in,
benzo(a)py ene and hei mix u e exposu e on he sex ho mone le els in gonads
o cu ie (Sebas iscus ma mo a us). En i on. Toxicol. Pha m. 20, 361-367.
Ziouzenko a, O., Plu zky, J., 2008. Re inoid me abolism and nuclea ecep o esponses:
New insigh s in o coo dina ed egula ion o he PPAR-RXR complex. FEBS
Le e s. 582, 32-38.
Chap e 1
50
Anonymous, 1990. Repo o he Mee ing MEPC (Ma ine En i onmen P o ec ion
Commi ee) 30/24, IMO, London.
MEPC., 2001. In e na ional Con en ion on he Con ol o Ha m ul An i- ouling Sys ems on
Ships, IMO, London, 5 Oc obe 2001
WHO/IPCS epo (In e na ional P og am on Chemical Sa e y), 2002. Global Assessmen
o he s a e-o -science o endoc ine dis up o s.
CHAPTER 2
CHAPTER 2
2. Re inoid signaling and imposex in Nucella lapillus
2.1 Imposex induc ion is media ed h ough he Re inoid X Recep o signaling
pa hway in he neogas opod Nucella lapillus
Cas o, L. Filipe C., Lima, D., Machado, A., Melo, C., Hi omo i, Y., Nishikawa, J.,
Nakanishi, T., Reis-Hen iques, M. A., San os, M. M., 2007. Aqua . Toxicol. 85, 57–66.
(adap ed om)
2.2 T ibu yl in-induced imposex in ma ine gas opods in ol es issue-speci ic
modula ion o he Re inoid X Recep o
Lima, D., Reis-Hen iques, M.A, Sil a, R., San os, A.I., Cas o, L. Filipe C., San os, M.M.,
2011. Aqua . Toxicol. 101, 221–227.

Chap e 2
52
Chap e 2
53
2.1 Imposex induc ion is media ed h ough he Re inoid X Recep o
signaling pa hway in he neogas opod Nucella lapillus
2.1.1 Abs ac
The imposex phenomenon in emale p osob anch gas opods p o ides one o he
bes documen ed examples o endoc ine dis up ion in wildli e. While many ield s udies
ha e demons a ed he nega i e impac o ibu yl in (TBT) upon emale gas opods, he
mechanism(s) unde lying imposex de elopmen has no ye been ully cla i ied. O e he
yea s se e al hypo heses ha e been aised o de e mine he biochemical and molecula
de e minan s o his p ocess. Ne e heless, he in e play be ween he di e en sugges ed
pa hways (neu oendoc ine, s e oid and e inoid) is s ill unknown. Hence, h ough a
combina ion o exposu e expe imen s, we show ha he 9-cis e inoic acid (9-cis RA), he
p oposed na u al ligand o he e inoic X ecep o (RXR), induces imposex in emales
Nucella lapillus o he same deg ee o ibu yl in, when adminis e ed a simila
concen a ions (1µg/g body weigh ). Me hop ene acid, a selec i e ligand o RXR, also
induces imposex, albei o lowe deg ee han ha o he posi i e con ol. In con as ,
es os e one signi ican ly induced imposex, bu had no e ec on emale penis induc ion,
while he neu opep ide APGWamide had no e ec on imposex de elopmen . These
esul s clea ly demons a e ha imposex induc ion in N. lapillus is media ed h ough he
modula ion o he e inoic acid signaling pa hways. In addi ion o he e ec s epo ed in
emale dogwhelks, bo h TBT and RA signi ican ly inc eased male penis leng h, hus
sugges ing ha TBT may also impac male seconda y sex o gans h ough he e inoic acid
signaling pa hways. As a s ep o u u e s udies, we ha e cloned he o hologue o N.
lapillus RXR and p o ide expe imen al e idence ha i binds 9-cis RA. Finally, he basal
exp ession le el o RXR in se e al issues o N. lapillus was de e mined h ough Real
Time PCR, hus showing ha RXR is ubiqui ously exp essed in mollusk issues, wi h he
highes exp ession le els being eco ded in emale and male gonads. The mechanis ic
impac s o he o e all indings o he imposex p ocess a e discussed.
Chap e 2
54
2.1.2 In oduc ion
The de elopmen o male accesso y sex o gans in emale p osob anch
gas opods, a phenomenon e med imposex, p o ides a s iking example o endoc ine
dis up ion. I is now well es ablished ha exposu e o o gano in compounds (e.g. ibu yl in
– TBT and o some species iphenyl in - TPT) is he p oximal cause o his
phenomenon. While he ecological and popula ion impac o hese compounds is well
s udied, he mechanism h ough which hey induce and p omo e he de elopmen o a
penis-like s uc u e and a as de e ens in emale snails is s ill o be deciphe ed. In ac ,
he molecula pa hways con olling he de elopmen o seconda y sexual o gans in
mollusks a e poo ly unde s ood.
His o ically, se e al hypo heses ha e been aised o explain he chain o e en s
and molecula ac o s leading o imposex de elopmen in gas opods. The o iginal wo k o
Fé al and Le Gall (1983) wi h ansplan a ion expe imen s sugges ed he hie a chic
in ol emen o wo illusi e molecules, named he e og essi e ac o (RF) and he penis
mo phogene ic ac o (PMF). This s udy also sugges ed he undamen al ole o wo
ana omical s uc u es, he pedal and ce eb opleu al ganglia. In an expe imen eminiscen
o he wo k o Fé al and Le Gall (1983), Obe dö s e and McClellan-G een (2000)
p oposed ha he neu opep ide APGWamide is he PMF since i induces imposex in
Ilyanassa obsole a. Despi e hese obse a ions, APGWamide ailed o p omo e imposex
in he p osob anch gas opod Bolinus b anda is (San os e al., 2006).
The dis up ion o s e oid signaling and physiological balance has also been
p oposed as a po en ial d i e o imposex de elopmen . Some s udies indica e ha he
and ogenic e ec s o TBT appea o be caused by in e e ence wi h s e oid biosyn hesis.
Ele a ion o es os e one and/o es os e one/es adiol a io has been epo ed in TBT
labo a o y exposed snails (Spoone e al., 1991; Schul e-Oehlmann e al., 1995; Be in e
al.,1996; San os e al., 2005) and clams (Mo cillo e al., 1998). This imbalance would be
caused by TBT inhibi ion o a oma ase, an enzyme esponsible o he a oma iza ion o
and ogens o es ogens (Be in e al., 1996). This was u he suppo ed by he
obse a ions ha an a oma ase inhibi o was able o induce imposex unde labo a o y
condi ions (Be in e al., 1996), and by he dep essed a oma ase ac i i y in wild
popula ions o Buccinum unda um a ec ed by imposex (San os e al., 2002). Howe e , in
emale Nucella lapillus a selec i e a oma ase inhibi o was also shown o induce imposex
bu o a signi ican lowe ex en han TBT, which sugges s ha a oma ase inhibi ion may
no be he p ima y mechanism in ol ed in he de elopmen o imposex (San os e al.,
2005). O he hypo heses ha e been pu o wa d o explain he s e oid imbalance induced
Chap e 2
55
by TBT. Hence, Ronis and Mason (1996) ha e demons a ed ha TBT dec eased he
amoun o es os e one sulphu -conjuga es in he pe iwinkle (Li o ina li o ea), leading o
an inc ease in he le els o ee es os e one in he issues. As his expe imen has been
pe o med unde ex emely high TBT le els, i may no e lec ealis ic exposu e condi ions
in he ield. Mo e ecen ly, Gooding e al. (2003) ha e demons a ed ha TBT dec eases
he es e i ica ion o es os e one wi h a y acids in he mud snail Ilyanassa obsole a, hus
leading o an inc ease in ee es os e one which could hen induce imposex. This
obse a ion has been pa ially co obo a ed by San os e al. (2005) o N. lapillus.
Recen ly, Nishikawa e al. (2004) demons a ed ha TPT e icien ly binds he Thais
cla ige a o hologue o he nuclea ecep o Re inoid X Recep o (RXR). Mo eo e , an
injec ion expe imen wi h 9-cis RA, he sugges ed na u al ligand o RXR, p omo ed he
de elopmen o imposex in 50% o he injec ed emales. In his con ex , o gano ins would
mimic he endogenous ligand o RXR, and hus ac i a e he signaling cascades which a e
e inoic acid dependen . This hypo hesis has been con adic o ily es ed in N. lapillus,
when compa ed o T. cla ige a, since no imposex ou g ow h was obse ed ollowing 9-cis
RA injec ion (Oehlmann e al., 2007).
The in e play be ween he di e en sugges ed pa hways (neu oendoc ine, s e oid
and e inoid) is s ill unknown. Fu he mo e, mos o he molecula a ge s p oposed o be
in ol ed in his mechanism o da e ha e no been desc ibed in mollusks. Fo example, he
CYP19 gene has no been ound ou side cho da es (Calla d e al., 1984; Cas o e al.,
2005; Mizu a and Kubokawa, 2007). Finally, he di e en esponses be ween species o 9-
cis RA and APGWamide exposu e highligh he need o a mo e comp ehensi e
eassessmen o he mechanisms unde lying imposex induc ion.
Th ough a combina ion o exposu e expe imen s, we show ha he p oposed
na u al ligand o RXR (9-cis RA) induces imposex in N. lapillus o he same deg ee o he
posi i e con ol (TBT), when adminis e ed a simila concen a ions (1µg/g body weigh ).
Me hop ene acid, a selec i e ligand o RXR, also induces imposex, albei o lowe deg ee
han ha obse ed o e inoic acid and TBT, while he neu opep ide APGWamide had no
e ec wi h espec o imposex induc ion. Tes os e one signi ican ly induced imposex, bu
had no e ec on emale penis leng h inc emen . As a s ep o u u e s udies, we ha e
cloned he o hologue o N. lapillus RXR and p o ide expe imen al e idence ha i binds
9-cis RA. Finally, we de e mined he basal exp ession le el o RXR in se e al issues o
N. lapillus h ough Real Time PCR. The mechanis ic impac s o he o e all indings o he
imposex p ocess a e discussed.
Chap e 2
62
Figu e 2.1.2 Imposex equency (A), VDSI (B), male penis leng h (C) and emale penis leng h (imposex; D) in
N. lapillus a e 2 mon h-exposu e o he di e en ea men s (2 eplica es pe ea men ). Values a e mean
±S.E. (n males= 14-25, n emales= 19-28). * p<0.05; ** p<0.01; ***p<0.001, signi ican ly di e en om sol en
con ol.
2.1.4.2 N. lapillus RXR (NlRXR)
Th ough a combina ion o PCR s a egies we isola ed he o hologue o RXR in he
gas opod N. lapillus (Figu e 2.1.3). Ou 5’RACE PCR unco e ed wo sequence a ian s
wi h di e en sizes. The analysis o one o he PCR agmen s wi h app oxima ely 1Kb
sugges s ha his is p obably an incomple ely spliced ansc ip . The sequence con ains a
signi ican numbe o a epe i i e elemen ypical o in on sequences (no shown), and
hus will no be analysed u he . To demons a e he in eg i y o he cDNA assembled
con ig, a PCR wi h speci ic p ime s lanking he coding egion was pe o med (Figu e
2.1.1). The en i e ORF encodes a po en ial p o ein wi h 441 amino acids. Unexpec edly,
he sequencing o se e al clones demons a ed he exis ence o ye ano he a ian . An
in- ame 15 bp inse ion in he T-box egion is esponsible o his a ia ion (Figu e
2.1.3A). This di e ence is mos p obably due o al e na i e splicing, al hough we ha e no
con i med his. The sequences we e named NlRXRa (441 amino acids) and NlRXRb (446
amino acids) and ha e been deposi ed in GenBank (Accession numbe s EU024473,
EU024474).
The sequence now e ie ed has all he main ea u es ypical o he RXR nuclea
ecep o (Figu e 2.1.3B and 2.1.3C). The deg ee o conse a ion is pa icula ly e iden in
he DNA binding domain (DBD) and he ligand binding domain (LBD) wi h he p e iously
desc ibed T. cla ige a RXR (Figu e 2.1.3). We nex unde ook phylogene ics o ully
de e mine he o hology o he isola ed sequence. The Maximum Likelihood analysis
shows ha he N. lapillus RXR sequence obus ly g oups wi h o he desc ibed mollusk
RXR sequences (Figu e 2.1.4).

Chap e 2
63
Figu e 2.1.3 Alignmen o he T-box egion o he wo a ian s ound in N. lapillus (A), he DNA-binding
domain (B), and he ligand-binding domain (C). The T-box inse ion is shown in bold; box delimi a es he P-
box and he D-box; AF2 egion is unde lined; black ci cles abo e sequence indica e esidues known o in e ac
wi h 9-cis RA; do s indica e inse ion. Accession numbe s: T. cla ige a (TcRXR) AAU12572; B. glab a a
(BgRXR) AAL86461; and Homo sapiens RXR alpha (HsRXRa) NP_002948.
Chap e 2
64
Figu e 2.1.4 Molecula Phylogene ic analysis o RXR by Maximum Likelihood me hod. The pe cen age o
ees in which he associa ed axa clus e ed oge he is shown nex o he b anches.
2.1.4.3 Ligand Binding Assay
The LBD o NlRXR p o ein was exp essed in E.coli as a usion wi h GST and
es ed he binding abili y o 9-cis RA. As esul s, we ound ha NlRXR e icien ly binds o
9-cis RA. Sca cha d analysis o he binding o [3H]9-cis RA o NlRXR yielded Kd alues o
12.9 nM (Figu e 2.1.5), ha is simila o he alue o T. cla ige a RXR (15.2 nM;
Nishikawa e al., 2004). The c ys al s uc u e o he human RXRa LBD bound o 9-cis RA
has been epo ed (Egea e al., 2000). In his pape , Egea e al. (2000) demons a ed ha
9-cis RA is bu ied in a hyd ophobic pocke o med by esidues loca ed on helices H3, H5,
H7 and H11, and he β- u n. 9-cis RA con ac s o amino acids o hRXR including I268,
C269, A271, A272, Q275, W305, N306, L309, F313, R316, L326, A327, V342, I345,
V349, R371, C432 and H435. Recen ly, a simila inding has been epo ed o he RXR
LBD 9-cis RA-bound o he mollusk B. glab a a (de G oo e al., 2005). Because hese
Chap e 2
65
esidues a e comple ely conse ed in NlRXR (Figu e 2.1.3C), i is easonable ha NlRXR
binds o 9-cis RA.
Figu e 2.1.5 The LBD o N. lapillus RXR exp essed in E. coli was incuba ed wi h inc easing concen a ions o
3H-labeled 9-cis RA in he absence ( o al binding) o p esence o 400- old nonlabeled 9-cis RA (nonspeci ic
binding) – uppe panel. Nonspeci ic binding was sub ac ed om o al binding and plo ed as speci ic binding.
Sca cha d analysis, speci ic 9-cis RA binding o dogwhelk RXR was ans o med by Sca cha d analysis and
plo ed – lowe panel. Linea eg ession yielded Kd = 12.9 nM.
2.1.4.4 Tissue exp ession
The exp ession o NlRXR was de e mined in se e al adul N. lapillus issues
h ough Real Time PCR (Figu e 2.1.6). Gi en he e y small deg ee o sequence a ia ion
be ween N. lapillus RXR iso o ms, we designed p ime s which de e mine he combined
exp ession o bo h NlRXRa and NlRXRb. P elimina y semi-quan i a i e PCR wi h p ime s
lanking he epo ed T-box a ia ion si e showed ha hey a e bo h exp essed in all he
es ed issues, al hough iso o m a has a highe exp ession le el han b (no shown). This
app oach shows ha RXR is ubiqui ously exp essed in all he es ed issues. Howe e ,
clea di e ences we e obse ed be ween issues, wi h he highes le els localized o he
o a y and es is (Figu e 2.1.6).
Chap e 2
66
Figu e 2.1.6 NlRXR issue exp ession h ough Real Time PCR (see ex o de ails). P – penis, IFA – imposex
o ming a ea, ApsF – emale man le and accesso y pallial sex glands, GdM – male man le and pallial po ion
o geni al duc s, DgF – emale diges i e gland, DgM – male diges i e gland, GF - emale ce eb al ganglia, GM
– male ce eb al ganglia, T – es is, and O- o a y.
2.1.5 Discussion
The imposex mechanism is s ill poo ly unde s ood. Al hough many hypo heses
ha e been pu o wa d, he key molecula de e minan s ha e emained elusi e.
His o ically, he mos impo an p oposals ha e been he a oma ase inhibi ion, which leads
o es os e one issue concen a ions imbalance and he abno mal elease o he
neu opep ide APGWamide in esponse o ele a e le els o TBT (Be in e al., 1996;
Obe dö s e and McClellan-G een, 2000). Mo e ecen ly, Nishikawa e al. (2004) clea ly
poin ed o he unique ole o he nuclea ecep o RXR in he ini ia ion o he imposex
de elopmen . In pa icula , o gano ins appa en ly mimic he ole o he na u al ligand,
binding RXR wi h high a ini y (Nishikawa e al., 2004). Despi e hese indings, Oehlmann
e al. (2007) con adic o ily showed ha in N. lapillus 9-cis RA (a sugges ed na u al RXR
ligand) had no signi ican e ec s on imposex pa ame e s a e almos wo mon hs upon
injec ion. This concep ual amewo k (in e play be ween e inoids, s e oids and
neu oendoc ine ac o s), leads us o es he in i o impac on imposex pa ame e s o a
numbe o compounds: (a) es os e one, (b) APGWamide, (c) wo concen a ions o 9-cis
RA, (d) me hop ene acid, and (e) TBT. The pe cen age o imposex-bea ing emales
eached 100% in he posi i e con ol (TBT) and in he g oups injec ed wi h wo 9-cis RA
Chap e 2
67
concen a ions. Signi ican imposex induc ion was also obse ed in he me hop ene acid
injec ed animals (63%). To a lesse ex end es os e one ele a ed as well he numbe o
imposex emales (30%).
In a p e ious s udy wi h T. cla ige a, a 9-cis RA (1µg/g body weigh ) injec ion
clea ly induced imposex (50% o imposex emales, 1 mon h a e injec ion), bu his
compound was sligh ly less e ec i e han he posi i e con ol iphenyl in (Nishikawa e
al., 2004). In he p esen s udy, no only all N. lapillus emales injec ed wi h 9-cis RA
de eloped imposex, as he se e i y o imposex de elopmen was iden ical o hose
emales injec ed wi h 1µg/g body weigh o TBTCl. These esul s con i m he ea ly indings
o Nishikawa e al. (2004) o T. cla ige a, hus sugges ing ha he imposex induc ion
e ec s o TBT in emale gas opods is media ed h ough RXR. The selec ed TBT
concen a ion (1µg/g body weigh ) is o en i onmen al ele ance and was used because i
had p e iously been demons a ed o induce maximum emale penis g ow h in N. lapillus
o e a wo mon h pe iod a e injec ion (S oben e al., 1992). The lowes 9-cis RA dose
adminis e ed in he p esen s udy was iden ical o he TBT concen a ion used, and
ende s he same se e i y o imposex de elopmen , u he sugges ing ha bo h
compounds ac a he same signaling pa hway. Mo eo e , since in he p e ious s udy wi h
T. cla ige a no all emales de eloped imposex a e being injec ed wi h 1 µg/g body
weigh o 9-cis RA, we ha e selec ed wo concen a ions le els o he p esen s udy, 1
and 2 µg/g body weigh . The lack o di e ences in he imposex pa ame e s be ween he
wo 9-cis RA es ed dosed is mos likely associa ed wi h he ac ha in N. lapillus 1µg/g
body weigh o 9-cis RA is enough o elici maximum imposex de elopmen o e he
du a ion o he expe imen . On he con a y, a ecen ly epo ed expe imen wi h simila
condi ions wi h he dogwhelk e ie ed non-signi ican imposex induc ion (Oehlmann e al.,
2007). This appa en con adic ion is puzzling, gi en he deg ee o simila i y in he
expe imen al se up (e.g. 9-cis RA concen a ion). We p opose ha his di e ence is mos
likely due o he use o di e en ca ie s, i.e. i amin A ee peanu oil in Oehlmann e al.
(2007) s udy, and FBS as ca ie in ou s and Nishikawa e al. (2004) s udies. Pe haps
dosing 9-cis RA in peanu oil a ec s i s biodisponibili y du ing he cou se o he
expe imen , ende ing i less bioac i e. The induc ion o imposex ia RXR signaling is
u he con i med by he injec ion wi h me hop ene acid. I has been showed ha
me hop ene acid di ec ly binds o RXR and is a ansc ip ional ac i a o in bo h insec and
mammalian cells (Ha mon e al., 1995). Fu he mo e, his ac i i y is RXR-speci ic unlike
he 9-cis RA, which binds weakly o RAR nuclea ecep o s (Ha mon e al., 1995). Animals
injec ed wi h me hop ene signi ican ly showed imposex induc ion. Howe e , VDSI and
emale penis leng h did no a ain he se e i y obse ed in animals exposed o 9-cis RA

Chap e 2
68
and TBT, which sugges s a subop imal RXR binding and ac i a ion. This scena io is
suppo ed by binding assays wi h he mollusk B. glab a a RXR (Bou on e al., 2005).
Th ough p o eolysis p o ec ion assay, me hop ene acid binds he ecep o bu only a
highe concen a ions sugges ing ha i can en e he ligand pocke bu he binding is no
wi h high a ini y (Bou on e al., 2005). Thus, he loosely binding o me hop ene acid mos
likely impac s he abili y o ully p omo e imposex de elopmen . Despi e hese ca ea s,
hese esul s indica e ha RXR is he p ima y a ge o TBT -media ed endoc ine
dis up ion in gas opods.
A g owing body o e idences indica es ha es os e one may also ha e a
physiological ole in gas opod ep oduc ion simila o ha in e eb a es. Based on his
assump ion, wo ea ly s udies on he mechanisms o TBT-induced imposex we e able o
demons a e ele a ed le els o es os e one in N. lapillus imposex bea ing emales
(Spoone e al., 1991; Be in e al., 1996), and he abili y o es os e one (ei he
adminis e ed h ough injec ion o wa e ) o p omo e emale penis g ow h. Ye , bo h s udies
ha e used animals ha al eady had imposex a he s a o exposu e, and hus imposex
induc ion by es os e one could no be es ed. Because emale N. lapillus a P aia da
Apúlia show a e y low pe cen age o imposex (app oxima ely 15%), i was possible o
es his hypo hesis. The expe imen al p ocedu e including he es os e one
concen a ions selec ed we e simila o hose epo ed by Spoone e al. (1991). Ou da a
co obo a es p e ious s udies showing ha es os e one is able o induce imposex in N.
lapillus, bu i was a less e ec i e han TBT and 9-cis RA in he inc easing o imposex
se e i y. In he Spoone e al. (1991) s udy, 0.1 and 10 µg es os e one adminis e ed
h ough injec ion we e able o p omo e penis g ow h a e 42 days, which is no suppo ed
by he p esen s udy, whe e 1 µg es os e one adminis e ed wice did no show he
capabili y o inc ease emale penis leng h. As he dogwhelk emales’ used in he Spoone
e al. (1991) expe imen al eady had a penis a he s a o he expe imen , one
explana ion o he obse ed di e ences may lie on he ac ha penis p omo ion may
equi e lowe concen a ions o es os e one han induc ion. Recen s udies ha e
demons a ed ha ee es os e one le els in mollusks a e mainly con olled h ough
es e i ica ion wi h a y acids, which is media ed by a mic osomal acyl-coenzyme A:
es os e one acyl ans e ase (ATAT; Gooding and LeBlanc, 2001; Jane e al., 2005).
Simila o o he mollusks, es os e one in emale N. lapillus issues is mainly s o ed in he
es e i ied o m, which sugges s ha ATAT is equally ac i e in dogwhelks (San os e al.,
2005). This p ocess was shown o be one o he a ge s o TBT, as in he mud snail (I.
obsole a), TBT seems o in e e e wi h es os e one es e i ica ion leading o a dec ease o
es os e one- a y acid es e s and o a concomi an inc ease amoun o ee es os e one
Chap e 2
69
(Gooding e al., 2003). In a ollow-up s udy, Gooding and Leblanc (2004) ha e ecen ly
demons a ed ha no mal I. obsole a injec ed wi h es os e one (0.5 µg) can apidly
con ol excess ee es os e one le els o concen a ions simila o non-exposed animals.
This may be one o he explana ions why in ou s udy only 35% o es os e one-injec ed
emales de eloped ea ly imposex s ages. In e es ingly, in mammals, e inoids a e mainly
s o ed as e inyl es e s by he ac ion o leci hin: e inol acyl ans e ase (LRAT). Mo e
ecen ly, i has been demons a ed he exis ence o an acyl-coenzyme A: e inol
acyl ans e ase (ARAT) which is equally in ol ed in e inyl es e s syn hesis (Kaschula e
al., 2006). While he me abolism o e inoids in mollusks has ne e been s udied, one
canno exclude he possibili y ha ARAT can also be p esen in mollusks, and may also
be TBT sensi i e. As has been shown in ou s udy, po en ial al e a ions in e inoic acid
me abolism could lead o imposex induc ion. Addi ionally, in mammals, s e oids ho mones
such as p oges e one ha e been demons a ed o inhibi ARAT (Kaschula e al., 2006).
Fu he mo e, i has been demons a ed ha e inoic acid is in ol ed in he egula ion o
es icula unc ions in oden s, such as in e e ing wi h es os e one p oduc ion. Whe he
ARAT is in ac p esen in mollusks, and whe he any c oss- alk be ween s e oid
ho mones and e inoids do exis in gas opods should be add essed in u u e s udies.
The APGWamide injec ions had no e ec on imposex pa ame e s. This esul
ollows simila indings epo ed by San os e al. (2006) o imposex p omo ion wi h B.
b anda is, which oge he do no suppo hose ob ained in I. obsole a (Obe dö s e and
McClellan-G een, 2000). Al hough his ou come migh be in e p e ed as con lic ing esul s,
hey could be explained by species-speci ic esponse di e ences. In ac , he injec ed
APGWamide (he e and in o he expe imen s) ep esen s a syn he ic pep ide om
Lymnaea s agnalis and no he endogenous pep ide. Recen ly, i was sugges ed ha
mollusk APGWamide amily membe s could signal h ough he gonado opin eleasing
ho mone ecep o (GnRHR) along wi h he gonado opin eleasing ho mone (GnRH;
Rode e al., 2005). This possibili y implies ha he APGWamide desc ibed imposex
induc ion (Obe dö s e and McClellan-G een, 2000), could esul om GnRhR ac i a ion.
In his con ex , he po en ial in ol emen o a ecep o could also explain he di e en
epo ed sensi i i ies gi en he expec ed di e ences in ecep o p o ein sequence
be ween species. In e es ingly, he Oc opus GnRH-like pep ide has been shown o
pa icipa e in s e oidogenesis ia GnRHR in he male and emale ep oduc i e issues
(Kanda e al., 2006). This obse a ion is e en mo e ele an when we ake in o accoun
he ac ha TBT al e s s e oid i e s in mollusks (Spoone e al., 1991). Finally, 9-cis RA
is a egula o ( hough nega i e) o GnRH gene exp ession in immo alized GnRH neu ons
(Cho e al., 2001). Likewise, in he in e eb a e cho da e Ciona in es inalis emb yo
Chap e 2
70
exposu e o all- ans RA induces GnRH-II up- egula ion (Ishibashi e al., 2005). The
in e cep ion o hese lines o e idence ep esen s a scena io ha in eg a es he in e ac ion
be ween 3 cascades ( e inoic, neu oendoc ine and s e oid) on imposex induc ion. We
p opose ha he endogenous ac ion o APGWamide and GnRH (bo h p o ein and mRNA)
should be cha ac e ized in he con ex o imposex de elopmen o ully de e mine hei
ole in he ou g ow h o male geni alia in emale gas opods.
The leng h o male penises was also ound o be signi ican ly ele a ed in he
specimens injec ed wi h ei he TBT o 9-cis RA. This esul highligh s he p ocess
simila i y be ween imposex o ma ion and accesso y sex o gan de elopmen in male
gas opods. Taking oge he hese indings and he ac ha e inoids a e also known o
play an impo an ole in mammalian male ep oduc i e o gan de elopmen (Ogino e al.,
2001; Li e a e al., 2002), i may be sugges ed ha male ep oduc i e con ol mechanisms
in ol ing e inoid signaling pa hways a e ancien and ha e been conse ed h oughou
Me azoa e olu ion. This hypo hesis is cu en ly being add essed in mo e de ail a ou
labo a o y.
To de e mine whe he NlRXR binds 9-cis RA (as sugges ed in i o) we pe o med
an in i o analysis o es his possibili y. Ou esul s indica e ha indeed ha is he case
since he LBD o NlRXR binds wi h s ong a ini y o he sugges ed endogenous ligand.
This pa e n is simila o ha epo ed o o he mollusk species like T. cla ige a and B.
glab a a (Nishikawa e al., 2004; Bou on e al., 2005). We should no e howe e ha he
ole o 9-cis RA as RXR’s na u al ligand has been ques ioned. In mouse ke a inocy es, a
c i ical expe imen demons a ed ha 9-cis RA is no he ligand o RXR (Callejá e al.,
2006). Thus, u u e s udies should also app oach whe he 9-cis RA in mollusks and in he
con ex o imposex ep esen s he physiological RXR ligand o no .
The nuclea ecep o RXR has been cha ac e ized in se e al in e eb a e species,
bu hese a e mos ly a h opods. In mollusks, only o T. cla ige a and B. glab a a has he
cDNA been isola ed, bu wi hou a p ecise documen a ion on basal issue exp ession. We
ha e isola ed he o hologue o his gene amily in N. lapillus. Ou PCR s a egy
unco e ed wo sequence a ian s, which di e in an inse ion/dele ion o 5 amino acids in
he T-box ( egion adjacen o he DBD, Figu e 2.1.4A), p obably due o al e na i e
splicing. A simila inding has been epo ed o he RXR sequence o c us aceans (Du ica
e al., 2002; Wu e al., 2004; Kim e al., 2005). The T-box, which is loca ed in he N-
e minal pa o he D domain, is also impo an o DNA binding (O lowski e al., 2004). I
plays an impo an ole media ing ho mone esponse elemen binding in e ac ions wi h
RXR homodime s (Zhao e al., 2000). In c us aceans his di e ence in p o ein sequence
impac s DNA-binding kine ics (Wu e al., 2004). We ound he sequence ca ying he
Chap e 2
71
inse ed 5 amino acids o ha e a lowe exp ession le el, when assayed h ough semi-
quan i a i e PCR (no shown). The biological ele ance o his inding in he con ex o
imposex will be in es iga ed in he u u e, in pa icula i hey in ol e di e ences on
downs eam RXR esponsi e elemen selec ion o he e odime pa ne ec ui men .
As a amewo k o u u e s udies, we analysed he basal issue exp ession p o ile
o NlRXR h ough Real Time PCR. Al hough RXR mRNA was ound in e e y es ed
issue, a s ong di e en ial exp ession was de ec ed in he gonads, in pa icula he o a y.
While compa able da a is absen ega ding mollusks, in a h opods he gonads a e
simila ly majo exp ession o gans (e.g. Du ica e al., 2004). In e eb a es, RXR has been
implica ed in ep oduc ion, wi h male RXRB null mice being s e ile (e.g. Kas ne e al.,
1996). Apa om imposex, o gano ins ha e been shown o elici abno mal o a ian
spe ma ogenesis in se e al mollusk species, like he abalone and he dogwhelk
(Ho iguchi e al., 2002; Ho iguchi e al., 2006; Gibbs e al., 1988). In e es ingly, o gano in
concen a ion in he gonads is posi i ely co ela ed wi h imposex leng h in he emales o
Babylonia japonica (Ho iguchi e al., 2006). Whe he o gano in accumula ion in he
gonads impac s cell di e en ia ion ia RXR o he p ecise ole o he gonads in he
imposex induc ion is s ill o be add essed.
In summa y, he indings epo ed he e clea ly suppo he p emise ha RXR is a
molecula a ge o o gano ins in N. lapillus. In his con ex , imposex de elopmen begins
wi h he ac i a ion o a signaling cascade which is dependen o he RXR
ac i a ion/inhibi ion. Fu he mo e, he ac ha male penises a e also a ec ed ei he by
TBT o 9-cis RA, sugges s ha he no mal p ocess o accesso y sex o gan de elopmen
in gas opods is e inoic dependen . To de e mine he empo al RXR exp ession pa e n
on p ecise ana omical s uc u es upon o gano in s imula ion, RXR gene a ge s (e.g.
gonado opin eleasing ho mone), as well as in es iga ing po en ial RXR he e odime ic
pa ne s emains a u u e challenge.
2.1.6 Acknowledgmen s
We acknowledge Hugo San os o his help wi h he aqua iums main enance. The
au ho s hank wo anonymous e e ees o hei insigh ul commen s. This esea ch has
been suppo ed by p ojec POCI/MAR/59462/2004 (Po ugal). Daniela Lima was unded
by Fundação pa a a Ciência e a Tecnologia (SFRH / BD / 41561 / 2007).
Chap e 2
78
2.2.2 In oduc ion
Imposex is one o he bes documen ed examples o endoc ine dis up ion in
wildli e. I is cha ac e ized by he supe imposi ion o male cha ac e is ics, such as a penis
and a as de e ens, on o emales o ma ine gas opods. E e since i was i s desc ibed
in Nucella lapillus (Blabe , 1970), nume ous s udies ha e been published on he subjec .
A clea associa ion be ween exposu e o ibu yl in (TBT), he ac i e ing edien in
an i ouling pain s, and imposex has been demons a ed o se e al species. Cu en ly, a
leas 195 species o p osob anch gas opods a e known o be a ec ed, albei he
mechanisms esponsible o i a e ye o be ully elucida ed (S e nbe g e al., 2010). A
basic unde s anding on mollusks’ endoc inology is s ill oday a om achie ed, which
hinde s ou comp ehension o he imposex p ocess.
Se e al hypo heses ha e been aised o e he yea s o explain his condi ion. A
se ies o in i o ansplan a ion expe imen s using he p osob anchs Oceneb a e inacea
and C epidula o nica a a e s ill oday pa icula ly in o ma i e (Fé al and Le Gall, 1983a).
This ea ly s udy indica ed ha TBT, a en i onmen ally ele an le els, ac s on he
ce eb opleu al ganglia, h ough he ac ion o a “ e og essi e ac o ” (RF), leading o he
abno mal elease o a “penis mo phogene ic ac o ” (PMF) by he emale pedal ganglia.
This wo k highligh ed he pi o al ole ha he cen al ne ous sys em (CNS) has in emale
gas opod masculiniza ion by TBT. O he issues did no in e ene di ec ly in imposex
induc ion. Simila ly, a ailable e idences indica e ha male penis o ma ion in gas opods
is unde he con ol o he CNS (Fé al and Le Gall, 1983b). In a s udy eminiscen o he
wo k o Fé al and Le Gall (1983a), Obe dö s e and McClellan-G een (2000) p oposed
ha he PMF could be he neu opep ide APGWamide, as i was able o induce imposex in
Ilyanassa obsole a and APGWamide immuno eac i e neu ons we e de ec ed in he CNS
o se e al gas opods’ species (de Lange and an Minnen, 1998). Howe e , expe imen s
conduc ed by (San os e al., 2006) and (Cas o e al., 2007) showed ha APGWamide
ailed o induce imposex in Bolinus b anda is and N. lapillus.
Since es os e one i sel was shown o induce imposex in se e al gas opod
species, some al e na i e hypo hesis pos ula ed ha TBT may impac es os e one
me abolism (Spoone e al., 1991). I has also been sugges ed ha TBT would
compe i i ely inhibi P450 a oma ase ac i i y, he eby p e en ing he con e sion o
and ogens o es ogens (and consequen ly inc easing es os e one le els; Be in e al.,
1996; San os e al., 2002); al e na i ely, TBT would inhibi es os e one exc e ion (Ronis
and Mason, 1996). Recen ly, he in e e ence o TBT in s e oid balance was p oposed o
be due o a dec ease in he es e i ica ion o es os e one, hus leading o an inc ease in
ee es os e one which could hen induce imposex (Gooding e al., 2003). Despi e hese

Chap e 2
79
obse a ions, he exis ence o a unc ional and ogen signaling pa hway in mollusks
emains con o e sial (Cas o e al., 2005; Ma ko e al., 2009; S e nbe g e al., 2008a).
The disco e y o he in iguing abili y o TBT o bind and ac i a e he human
e inoid X ecep o (RXR) a he same le els o i s na u al ligand 9-cis e inoic acid (9-cis
RA) has expanded ou unde s anding o he p ocess (Nishikawa e al., 2004). In he wild
ock shell Thais cla ige a, injec ion o 9-cis RA in o emales was able o induce he
de elopmen o imposex (Nishikawa e al., 2004). This inding was u he con i med wi h
he dogwhelk N. lapillus, whe e injec ions o 9-cis RA and a selec i e RXR agonis ,
me hop ene acid, induced imposex (Cas o e al., 2007), hus ein o cing he hypo hesis o
an RXR-media ed induc ion o imposex by TBT.
In e eb a es, he e inoic acid signaling pa hways egula e genes in ol ed in
many biological p ocesses, such as cell p oli e a ion, di e en ia ion and apop osis du ing
emb yonic de elopmen and o he physiological p ocesses in adul s (Albala and
Cañes o, 2009; MacLean e al., 2007). The male ep oduc i e di e en ia ion also seems
o be unde con ol o e inoid ac ion, as 50% o RXRβ dis up ed mice die be o e o a
bi h, and hose ha su i e become s e ile (Kas ne e al., 1996). RXR iso o ms a e also
di e en ially exp essed du ing mice ex e nal geni alia o ma ion (Ogino e al., 2001). In
in e eb a es, e inoic acid signaling is less known, al hough RXR has been iden i ied in a
wide ange o me azoans, i.e., sponges (Wiens e al., 2003), a h opods, nema odes,
pla yhelmin hes and mollusks (Simões-Cos a e al., 2008).
So a , RXR has been cha ac e ized in a ious mollusks’ species, namely, T.
cla ige a, Biomphala ia glab a a, N. lapillus and I. obsole a (Nishikawa e al., 2004;
Bou on e al., 2005; Cas o e al., 2007; S e nbe g e al., 2008b). P e iously, we ha e
isola ed he o hologue o RXR in N. lapillus and demons a ed ha NlRXR e ec i ely
binds o 9-cis RA in i o (Cas o e al., 2007). NlRXR gene exp ession le els we e
de e mined h ough qPCR, showing RXR o be exp essed ubiqui ously. In addi ion, RXRs
p oposed ligand 9-cis RA and an RXR agonis me oph ene acid induced imposex in
emale N. lapillus and impac ed male penis ou g ow h (Cas o e al., 2007). He e, we es
whe he TBT exposu e would al e RXR le els in a ious a ge issues. We hypo hesize
ha he pa e ns o RXR exp ession upon TBT exposu e may p o ide signi ican insigh s
in o he in ol emen o RXR in no mal male penis de elopmen and imposex induc ion,
elucida ing namely he imings and issues a ge ed by o gano ins. Thus, in he p esen
s udy, N. lapillus specimens we e exposed o an en i onmen ally ele an concen a ion o
TBT (100 ng Sn/L TBT; Be o, 2007), and RXR exp ession de e mined be o e and a e
imposex ini ia ion. RXR gene exp ession was e alua ed in po en ial a ge issues: he
CNS, penis/penis o ming a ea (PFA), gonads, a issue which p e iously indica ed a ole
Chap e 2
80
o RXR in ep oduc i e ec udescence (S e nbe g e al., 2008b) and diges i e gland, a
me abolic issue. The biological ele ance o he indings is discussed wi h espec o
imposex and male penis de elopmen in gas opod mollusks.
2.2.3 Ma e ial and Me hods
2.2.3.1 Chemicals
TBTCl (96%) and DMSO we e pu chased om Sigma-Ald ich.
2.2.3.2 Expe imen al condi ions and dosing
Adul N. lapillus we e collec ed in Janua y 2009 a p aia da Apúlia, an a ea in he
No h o Po ugal known o display an imposex incidence below 5% (San os e al.,
unpublished da a). Animals we e allowed o acclima ize o labo a o y condi ions o one
week be o e he onse o he expe imen .
A e his pe iod, abou 35 specimens pe eplica e ( h ee eplica e pe ea men )
we e placed in 30 L aqua ia illed wi h a i icial sal wa e (salini y 35 ppm, pH 8.3,
conduc i i y = 48 ms/cm, edox po en ial =−76 mV), and main ained a 16.5 oC ± 1 in an
acclima ized oom unde a pho ope iod o 12 hou s ligh : 12 hou s da k, wi h a i icial
ai ing. Sal wa e was p epa ed wi h se a p emium sal and ca bon ac i a ed il a ed ap
wa e , and changed h ee imes a week. Animals we e ed wi h mussels om hei o igin
si e once a week.
Two ea men g oups we e se : sol en con ol (DMSO) and TBT Cl a 100 ng
Sn/L TBT. The pe cen age o sol en in he aqua ia did no exceed 0.0002%, a
concen a ion known o ha e no e ec in imposex de elopmen (San os e al., 2005).
The kine ics o imposex induc ion a e TBT exposu e has p e iously been s udy in
N. lapillus specimens om Apúlia (San os e al., unpublished da a; Cas o e al., 2007). A
he TBT concen a ions and wa e empe a u e used in he p esen s udy, he i s signs o
imposex appea a ound week i e pos -exposu e. Hence, we selec ed sac i icing animals
a one mon h exposu e (be o e he i s signs o imposex) and a e wo mon hs, whe e he
majo i y o emales is expec ed o ha e de eloped imposex. A e one mon h o exposu e,
24 animals ( wel e males and wel e emales) pe ea men we e sac i iced. Sex,
ma u a ion s a us and penis size/imposex we e e alua ed unde a binocula mic oscope.
The selec ed issues (i.e., CNS, gonad, diges i e gland, penis/PFA) we e dissec ed wi h
he help o a su gical scisso unde he binocula mic oscope (80 x ampli ica ion), and
s o ed sepa a ely in RNAla e (Sigma) a -80 oC. The dissec ion s a ed wi h he collec ion
Chap e 2
81
o penis o PFA which a e loca ed behind he igh en acle. To collec he CNS, a cu
be ween bo h en acles was pe o med in he do sal a ea allowing he collec ion o he
CNS. Finally, app oxima ely 50 mg o gonad and diges i e gland we e dissec ed. In o de
o a oid RNA deg ada ion o con amina ion among issues, he dissec ion ma e ial was
cleaned wi h wa e and RNase away. The CNS and he emale PFA weigh ed
app oxima ely 2-3 mg, whe eas male and emale penis weigh a ied be ween 3-7 mg.
Two mon hs a e he ini ia ion o exposu e, he emaining animals we e sac i iced and he
same pa ame e s e alua ed. The se e i y o imposex (measu ed as Vas De e ence
Sequence Index-VDSI) was de e mined using he imposex scheme o (Be in e al., 1996).
No di e ences in mo ali y a es we e obse ed be ween ea men g oups.
2.2.3.3 Tissue RNA ex ac ion
RNA ex ac ion in gonads, diges i e gland and CNS was pe o med using he Ki
illus a RNAspin Mini RNA Isola ion, GE Heal hca e (animal issues p o ocol), wi h on
column DNAseI diges ion. Gi en he low amoun o issue and RNA concen a ion in penis
and PFA, RNA was ex ac ed using he ki Qiagen RNeasy® Plus Mic o, which is
adequa e o samples wi h less han 5 mg o issue. The cDNA syn hesis was pe o med
wi h he iSc ip ™cDNA Syn hesis Ki (Bio-Rad) acco ding o he manu ac u e ’s
ins uc ions, using 500 ng o o al RNA o gonad, diges i e gland and CNS and 50 ng o
o al RNA o penis and PFA.
2.2.3.4 qPCR assays
Tissue exp ession le els o NlRXR we e de e mined by qPCR (Bio-Rad, iQ5).
B ie ly, 0.8 µL cDNA was added o a eac ion mix u e con aining 1x iQ SYBR G een
supe mix (Bio-Rad) 2 µM o each p ime , in a inal olume o 20 µL. In each pla e, a “no
empla e con ol” was included, and samples we e un in duplica e. qPCR p o ile and
p ime s used we e p e iously desc ibed (see Cas o e al., 2007). 18s was used as
e e ence gene, and p ime s sequences and annealing empe a u e used in he di e en
PCR eac ions a e gi en in Table 2.2.1. Real ime PCR p ime s we e designed using he
So wa e Beacon Designe 5. PCR p o ile had he ollowing condi ions: 95 oC o ini ial
dena u a ion du ing 10 min; 95 oC 15s, 56 oC annealing 30 s, and 72 oC ex ension 30 s
(da a collec ion) o o y cycles. A mel ing cu e was gene a ed o e e y un o con i m
he speci ici y o he assays. Rela i e gene exp ession was calcula ed using he 2-∆∆C
o mula (Li ak and Schmi gen, 2001). NlRXR gene exp ession in each o gan was
no malized o 18s, excep o gonads, o which we could no ind a s able e e ence gene,
and he e o e da a is p esen ed wi hou no maliza ion (2-∆C ).
Chap e 2
82
Table 2.2.1 P ime sequences used o isola e 18s in N. lapillus.
P ime name
Sequence
Annealing empe a u e
(oC)
18s F
5’-CTATTGGAGGGCAAGTCTGG-3’
50
18s R
5’-GGTGAGTTTTCCCGTGTTGA-3’
18s eal ime F
5’-ATTCGCTGGTGTTGCTTCATC-3’
56
18s eal ime R
5’-TCCTGGTGGTGCCCTTCC-3’
2.2.3.5 S a is ical analysis
S a is ical analyses we e pe o med using he so wa e S a is ica 7.0. Mann-
Whi ney U- es was used o compa e, o each ime-poin and sex, s a is ical di e ences
be ween sol en con ol and TBT exposed g oups. One-way ANOVA, ollowed by a
S uden -Newman-Keuls mul iple compa ison es was used o compa e RXR gene
exp ession in emale PFA a he end o exposu e and male penis leng hs. Chi-squa e es
was used o compa ing imposex equency be ween g oups, using imposex equency o
he con ol g oup as expec ed alues.
2.2.4 Resul s
2.2.4.1 Imposex and expe imen al pa ame e s
Figu e 2.2.1 (A, B and C) displays imposex indexes (VDSI, imposex equency and
emale penis leng h, espec i ely) in N. lapillus du ing he cou se o he expe imen . No
di e ences we e obse ed in any o he analyses indexes a e one mon h. Howe e ,
exposu e o TBT signi ican ly induced imposex in emale N. lapillus a e wo mon hs, i
compa ed wi h he con ol g oup. Simila ly, male penis leng hs om he TBT exposed
g oups we e signi ican ly inc eased a he end o he expe imen in compa ison wi h he
con ol g oup (Fig. 2.2.2).
Chap e 2
83
Figu e 2.2.1 Imposex pa ame e s in N. lapillus a e one and wo mon hs o exposu e: VDSI (A), Imposex
equency (B) and emale penis leng h (C). Values a e mean ± S.E. (n= 12- 46). *** p ≤ 0.001, signi ican ly
di e en om con ol.

Chap e 2
84
Figu e 2.2.2 Tempo al change o male a e age penis leng h h oughou he expe imen . Values a e mean ±
S.E. (n= 12- 27). Di e en le e s indica e signi ican di e ences, p ≤ 0.05.
2.2.4.2 NlRXR exp ession
Figu es 2.2.3-5 display N. lapillus RXR gene exp ession du ing he cou se o he
expe imen . TBT-exposed animals displayed a dec ease in RXR gene exp ession in he
CNS, ei he a e one o wo mon hs, which was s a is ically signi ican in emales (P ≤
0.01 and P ≤ 0.05, espec i ely) and a simila end in RXR mRNA le els was obse ed in
males, hough di e ences we e no signi ican (P = 0.059; Fig. 2.2.3). Rega ding RXR
gene exp ession in penis and PFA, signi ican di e ences be ween con ol and TBT
exposed snails we e no obse ed a e one mon h exposu e o emales (Fig. 2.2.4A) and
du ing he en i e expe imen o males (Fig. 2.2.4). In con as , a e wo mon hs o
exposu e o TBT a signi ican (P ≤ 0.001) inc ease in RXR gene exp ession was obse ed
in emales wi h imposex VDS 3-4 in compa ison wi h bo h con ol and imposex emales
wi h VDS 1-2 (Fig. 2.2.4B). The absolu e le els o no malized RXR gene exp ession in he
penis o emales displaying imposex VDS le els o 3-4 we e compa able o hose o male
penis om he TBT ea men g oup. In con as o he CNS and PFA, RXR gene
exp ession in gonads and diges i e gland was no a ec ed by TBT, a any o he analyzed
ime-poin s (Fig. 2.2.5).
Chap e 2
85
Figu e 2.2.3 No malized RXR gene exp ession in male and emale CNS a e one (A) and wo (B) mon hs o
exposu e. Values a e mean ± S.E. (n= 6-9). * p ≤ 0.05; ** p ≤ 0.01, signi ican ly di e en om sol en con ol.
Chap e 2
86
Figu e 2.2.4 No malized RXR gene exp ession in male penis and emale penis/PFA a e one (A) and wo (B)
mon hs o exposu e. Values a e mean ± S.E. (n= 5-12). ***p ≤ 0.001 indica es signi ican di e ences.
Chap e 2
87
Figu e 2.2.5 RXR gene ansc ip ion in male and emale gonad (A) and no malized RXR gene ansc ip ion in
male and emale diges i e gland (B). Values a e mean ± S.E. (gonad: n= 7-8; diges i e gland: n= 5-8).
2.2.5 Discussion
I has ecen ly been shown ha TBT causes ligand dependen ansac i a ion o
he human RXRα and ha i binds wi h high a ini y o bo h human and ock shell RXR
(Kanayama e al., 2005). Injec ion o emales wi h i s suspec ed na u al ligand, 9-cis RA,
demons a ed ha 9-cis RA induces imposex bo h in T. cla ige a (Nishikawa e al., 2004)
and N. lapillus (Cas o e al., 2007), o he same ex en o TBT and wi hin he same ange
o concen a ions (Cas o e al., 2007). Hence, compiling e idence indica es ha he
p ima y a ge o TBT in gas opods, in he con ex o imposex induc ion, in ol es an
inapp op ia e egula ion o RXR signaling pa hways. To de e mine he cascade o
molecula and physiological e en s leading o imposex and male penis de elopmen , we
mus i s unde s and (a) which o gans a e a ge ed by TBT media ed-dis up ion in ol ing
Chap e 2
94
Du ica, D. S., Wu, X., Anilkuma , G., Hopkins, P.M., Chung, A. C. K., 2002.
Cha ac e iza ion o c ab EcR and RXR homologs and exp ession du ing limb
egene a ion and oocy e ma u a ion. Mol. Cell. Endoc inol. 189, 59-76.
Fé al, C., Le Gall, S., 1983a. The in luence o a pollu an ac o ( ibu yl in) on he
neu oendoc ine mechanism esponsible o he occu ence o a penis in he
emales o Oceneb a e inacea. In: Le e , J., Boe , H.H. (Eds.), Molluscan
Neu oendoc inology, No h Holland, Ams e dam, 173-175.
Fé al, C., Le Gall, S., 1983b. The neu oendoc ine mechanism esponsible o penis
di e en ia ion in C epidula o nica a. In: Le e , J., Boe , H.H. (Eds.), Molluscan
Neu oendoc inology. No h Holland, Ams e dam. 169-173.
Gooding, M. P., Wilson, V. S., Folma , L. C., Ma co ich, D. T., LeBlanc, G. A., 2003 The
biocide ibu yl in educes he e en ion o es os e oneas a y acid es e s in he
mud snail (Ilyanassa obsole a). En i on. Heal h Pe spec . 111, 426-30.
G un, F., Wa anabe, H., Zamanian, Z., Maeda, L., A ima, K., Cubacha, R., Ga dine , D.
M., Kanno, J., Iguchi, T., Blumbe g, B., 2006. Endoc ine-dis up ing o gano in
compounds a e po en induce s o adipogenesis in e eb a es. Mol. Endoc inol.
20, 2141-2155.
Ho iguchi, T., Nishikawa, T., Oh a, Y., Shi aishi, H., Mo i a, M., 2010. Time cou se o
exp ession o he e inoid X ecep o gene and induc ion o imposex in he ock
shell, Thais cla ige a, exposed o iphenyl in chlo ide. Anal. Bioanal. Chem. 396,
597-607.
Kanayama, T., Kobayashi, N., Mamiya, S., Nakanishi, T., Nishikawa, J-I., 2005. O gano in
Compounds P omo e Adipocy e Di e en ia ion as Agonis s o he Pe oxisome
P oli e a o -Ac i a ed Recep o γ/Re inoid X Recep o Pa hway. Mol. Pha macol.
67, 766-774.
Kas ne , P., Ma k, M., Leid, M., Gansmulle , A., Chin, W., G ondona, J. M., Décimo, D.,
K ezel, W., Die ich, A., Chambon, P., 1996. Abno mal spe ma ogenesis in RXR
be a mu an mice. Genes De . 10, 80-92.
Le Gall, S., Fe al, C., Leng onne, C., Po che , M., 1987. Pa ial pu i ica ion o he
neu oendoc ine mi ogenic ac o in he mollusc C epidula o nica a L. Comp.
Biochem. Physiol. B Biochem. Mol. Biol. 86, 393-396.
Lin, Y. Q., Zhuang, H. L., Yang, G. S., 2007. The ole o 9-cis RA in he egula ion o pig
p eadipocy e di e en ia ion. Fen Zi Xi Bao Sheng Wu Xue Bao 40, 211-6.
Li ak, K. J., Schmi gen, T.D., 2001. Analysis o ela i e gene exp ession da a using eal-
ime quan i a i e PCR and he 2-[Del a][Del a]CT me hod. Me hods 25, 402-408.

Chap e 2
95
MacLean, G., Li, H., Me zge , D., Chambon, P., Pe ko ich, M., 2007. Apop o ic ex inc ion
o ge m cells in es es o Cyp26b1 knockou mice. Endoc inology 148, 4560-4567.
Maden, M., Co co an, J., 1996. Role o hy oid ho mone and e inoid ecep o s in he
homeo ic ans o ma ion o ails in o limbs in ogs. De . Gene . 19, 85-93.
Maden, M., Hind, M., 2003. Re inoic acid, a egene a ion-inducing molecule. De . Dyn.
226, 237-244.
Ma ko , G. V., Ta a es, R., Dauphin-Villeman , C., Demeneix, B. A., Bake , M. E., Laude ,
V., 2009. Independen elabo a ion o s e oid ho mone signaling pa hways in
me azoans. P oc. Na l. Acad. Sci. U.S.A. 106, 11913-11918.
Ma le az, F., Holland, L. Z., Laude , V., Schube , M., 2006. Re inoic acid signaling and
he e olu ion o cho da es. In . J. Biol. Sci. 2, 38-47.
Nishikawa, J-I., Mamiya, S., Kanayama, T., Nishikawa, T., Shi aishi, F., Ho iguchi, T.,
2004. In ol emen o he e inoid X ecep o in he de elopmen o imposex
caused by o gano ins in gas opods. En i on. Sci. Technol. 38, 6271-6276.
Nowickyj, S. M., Chi halen, J. V., Came on, D., Tyshenko, M. G., Pe ko ich, M., Wya , G.
R., Jones, G., Walke , V. K., 2008. Locus e inoid X ecep o s: 9-Cis- e inoic acid
in emb yos om a p imi i e insec . P oc. Na l. Acad. Sci. U.S.A. 105, 9540-9545.
Ogino, Y., Suzuki, K., Ha aguchiI, R., Sa oh, Y., Dolle, P., Yamada, G., 2001. Ex e nal
geni alia o ma ion. Ann. N. Y. Acad. Sci. 948, 13-31.
Ronis, M. J. J., Mason, A. Z., 1996. The me abolism o es os e one by he pe iwinkle
(Li o ina li o ea) in i o and in i o: E ec s o ibu yl in. Ma . En i on. Res. 42,
161-166.
San os, M. M., Ten Halle s-Tjabbes, C.C., Viei a, N, Boon, J.P., Po e, C., 2002.
Cy och ome P450 di e ences in no mal and imposex-a ec ed emale whelk
Buccinum unda um om he open No h Sea. Ma . En i on. Res. 54, 661-665.
San os, M. M., Cas o, L. F. C., Viei a, M. N., Micael, J., Mo abi o, R., Massanisso, P.,
Reis-Hen iques, M.A., 2005. New insigh s in o he mechanism o imposex
induc ion in he dogwhelk Nucella lapillus. Comp. Biochem. Physiol. C Toxicol.
Pha macol. 141, 101-109.
San os, M. M., Reis-Hen iques, M. M., Viei a, M. N., Solé, M., 2006. T iphenyl in and
ibu yl in, single and in combina ion, p omo e imposex in he gas opod Bolinus
b anda is. Eco oxicol. En i on. Sa . 64, 155-162.
Simões-Cos a, M. S., Azambuja, A. P., Xa ie -Ne o, J., 2008. The sea ch o non-
cho da e e inoic acid signaling: lessons om cho da es. J. Exp. Zool. B Mol. De .
E ol. 310B, 54-72.
Chap e 2
96
Spoone , N., Gibbs, P. E., B yan, G. W., Goad, L. J., 1991. The e ec o ibu yl in upon
s e oid i es in he emale dogwhelk, Nucella lapillus, and he de elopmen o
imposex. Ma . En i on. Res. 32, 37-49.
S e nbe g, R. M., Ho chkiss, A. K., LeBlanc, G. A., 2008a. The con ibu ion o s e oidal
and ogens and es ogens o ep oduc i e ma u a ion o he eas e n mud snail
Ilyanassa obsole a. Gen. Comp. Endoc inol. 156, 15-26.
S e nbe g, R. M., Ho chkiss, A. K., LeBlanc, G.A., 2008b. Synch onized Exp ession o
Re inoid X Recep o mRNA wi h Rep oduc i e T ac Rec udescence in an
Imposex-Suscep ible Mollusc. En i on. Sci. Technol. 42, 1345-1351.
S e nbe g, R., Gooding, M., Ho chkiss, A., LeBlanc, G., 2010. En i onmen al-endoc ine
con ol o ep oduc i e ma u a ion in gas opods: implica ions o he mechanism o
ibu yl in-induced imposex in p osob anchs. Eco oxicology 19, 4-23.
Wan, Y-J. Y., Cai, Y., Magee, T. R., 1998. Re inoic acid di e en ially egula es Re inoic
Acid Recep o -media ed pa hways in he HEP3B cell line. Exp. Cell Res. 238, 241-
247.
Wan, Y-J. Y., Wang, L., Wu, T-C. J., 1994. The exp ession o e inoid X ecep o genes is
egula ed by all- ans-and 9-cis- e inoic acid in F9 Te a oca cinoma Cells. Exp.
Cell Res. 210, 56-61.
Wiens, M., Ba el, R., Ko zhe , M., Mulle , W. E. G., 2003. Re inoid X ecep o and e inoic
acid esponse in he ma ine sponge Sube i es domuncula. J. Exp. Biol. 206, 3261-
3271.
CHAPTER 3
3. Re inoid signaling in Nucella lapillus: Adh3, Cyp26 and RAR
CHAPTER 3
3.1 Molecula cha ac e iza ion o Adh3 om he mollusk Nucella lapillus: issue
gene exp ession a e ibu yl in and e inol exposu e
Lima, D.*, Coelho, I.*, And é, A., Melo, C., Rui o, R., Reis-Hen iques M.A., San os, M.M.,
Cas o, L.F.C (accep ed by he Jou nal o Molluscan S udies) *equally con ibu ed
3.2 Isola ion o he i s p o os ome cy och ome P26 o hologue in he imposex-
sensi i e gas opod Nucella lapillus: molecula and oxicological insigh s
Daniela Lima e al. (in p epa a ion)
3.3 Isola ion and basal cha ac e iza ion o he Re inoic Acid Recep o (RAR) in he
gas opod mollusk Nucella lapillus
Daniela Lima e al., (in p epa a ion)
Chap e 3
98
Chap e 3
99
3.1 Molecula cha ac e iza ion o Adh3 om he mollusk Nucella
lapillus: issue gene exp ession a e ibu yl in and e inol
exposu e
3.1.1 Abs ac
O gano in in e e ence wi h animal endoc ine sys ems ep esen s a no able case
o physiological dis up ion. Neogas opod mollusks a e pa icula ly sensi i e o he
exposu e o hese compounds, de eloping a condi ion e med imposex, he supe -
imposi ion o male sexual seconda y ea u es on o emales. Recen ly, a ious s udies
ha e shown ha he Re inoic X Recep o (RXR) is a high a ini y ligand o ibu yl in (TBT),
while simul aneously hampe ing he ecep o gene exp ession. Cu iously, TBT has been
shown o down egula e Adh3 in ascidians, an enzyme con o e sially linked wi h e inol
oxida ion. He e we isola ed he Adh3 o hologue in Nucella lapillus, cha ac e ized i s basal
issue exp ession p o ile and add essed he gene exp ession dynamics in gonads and
diges i e gland upon TBT and e inol exposu e. We ind ha TBT does no a ec Adh3
exp ession in N. lapillus es ed issues. Howe e , he exposu e o e inol, he p ecu so o
e inoic acid in e eb a es, caused a signi ican down- egula ion o Adh3 le els in emale
gonads.
3.1.2 In oduc ion
The las decades ha e wi nessed a signi ican and haza dous inc ease in he
con amina ion o aqua ic en i onmen s by endoc ine dis up ing chemicals (EDCs).
Al hough he de e mina ion o he biological impac o EDCs in ma ine ecosys ems is now
an es ablished app oach o and ogenic and es ogenic chemicals, a ull comp ehension
o he e ec s on ma ine li e is a om achie ed (Blys one e al., 2008; Sump e e al.,
2005). Howe e , sound and i e u able e idence indica e ha EDCs, a ec he no mal
endoc ine sys em o se e al g oups o o ganisms, hus leading o impai men o impo an
physiological unc ions. In ac , ep oduc i e p oblems, ca cinogenesis and o he oxic
e ec s ha e been desc ibed in wildli e auna (Sump e , 2005). Due o i s widesp ead use
in ag icul u e, indus y and as an i ouling pain s o ships, boa s and ishing ne s, o gano in
compounds ep esen one o he mos haza dous pollu an s in ma ine en i onmen s and

Chap e 3
100
a e o pa icula conce n due o hei bioaccumula ion abili y and pe sis ence (Fen , 1996;
San os e al., 2009).
The e ec s o o gano in compounds in ep oduc i e and non- ep oduc i e ela ed-
pa ame e s ha e been desc ibed in bo h in e eb a es and e eb a es (An iza -Ladislao,
2008). The mos s iking example o endoc ine dis up ion in wildli e is he phenomenon o
imposex in neogas opods cha ac e ized by he de elopmen o male seconda y sexual
o gans in emales, namely he penis and a as de e ens, due o exposu e o ibu yl in
(TBT; Gibbs and B yan, 1986). In ad anced s ages o imposex he as de e ens migh
block he o iduc , comp omising no mal b eeding ac i i y which may lead o popula ion
decline (S e nbe g e al., 2010). Thus, he unde s anding o he molecula pa hways
unde lying he ac ion o hese compounds is o c ucial impo ance.
I has been demons a ed ha TBT is a high a ini y ligand o bo h e inoid X
ecep o s (RXRs) and pe oxisome p oli e a o -ac i a ed ecep o gamma (PPARγ). In
mammals, PPARγ plays an impo an ole in lipid homeos asis, p omo es adipocy e
di e en ia ion and egula es adipogenesis (Kanayama e al., 2005). Recen ly, RXR has
been sugges ed o media e he imposex de elopmen in p osob anch gas opods
(Nishikawa, 2006; Cas o e al., 2007; Nakanishi, 2008). Indeed, TBT seems o bind bo h
human and ock shell (Thais cla ige a) RXR wi h he same a ini y as i s endogenous
ligand, 9-cis e inoic acid (9-cis RA), which induces imposex in T. cla ige a and Nucella
lapillus, and causes ligand dependen ansac i a ion o he human RXRα (Nishikawa e
al., 2004). Hence, he e inoid signaling cascades migh cons i u e one o he p ima y
biological a ge s o o gano in compounds.
The impac o o gano ins on o e all gene exp ession is, none heless, a om
unde s ood. In mollusk gas opods TBT has been shown o al e RXR issue gene
exp ession (Lima e al., 2011). Howe e , downs eam e ec o s o RXR media ed signaling
ha e no been ully disclosed. In e es ingly, in TBT-exposed ascidian Ciona in es inalis, a
cDNA mic oa ay echnique has e ealed a s ong di e en ial exp ession in o e 200
genes ( hough wi hou a ull desc ip ion o he impac ed gene amilies; Azumi e al., 2004).
Among hose, he alcohol dehyd ogenase class III (Adh3) gene, he sugges ed ances al
o m o he medium-chain dehyd ogenase- educ ase amily, was s ongly down- egula ed.
Con as ing wi h e eb a es, which ha e se e al ADHs, ADH3 is he ypical and unique
ADH o m obse ed in in e eb a es (Godoy e al., 2007). Adh3 shows con as ing gene
exp ession pa e ns in dis inc animal lineages. While in e eb a e ADH3 seems o p esen
a speci ic exp ession pa e n, gene ally in he diges i e ac , e eb a e Adh3 is
ubiqui ously exp essed (Cañes o e al., 2003). In ag eemen wi h he la e , Adh3, whose
biological ac i i y has been p ese ed om p o os omes o deu e os omes, has been
Chap e 3
101
sugges ed o pe o m housekeeping unc ions namely oles in ni ic acid homeos asis and
egula ion o o maldehyde le els (Cañes o e al., 2003). Howe e , in mammals, his
basic unc ion was challenged. Indeed, he dis up ion o he Adh3 gene in mice led o
nega i e (bu e e sible h ough e inol supplemen a ion) e ec s on RA me abolism and
g ow h sugges ing a ole o ADH3 in RA syn hesis as he sough e inol dehyd ogenase,
which con e s e inol o e inal la e supplying he e inaldehyde dehyd ogenases
(RALDHs; Molo ko e al., 2002).
In he cu en wo k we p o ide he cha ac e iza ion o a mollusk Adh3 and
add essed he gene exp ession dynamics, using eal- ime PCR, in he gas opod N.
lapillus upon exposu e o TBT and e inol. Al hough TBT was success ul a inducing
imposex a e 2 mon hs exposu e, ADH3 exp ession was no signi ican ly al e ed. In
con as , e inol, he p ecu so o RA in e eb a es, caused a signi ican down- egula ion
o ADH3 le els in emale gonads.
3.1.3 Me hods
3.1.3.1 Expe imen al exposu e condi ions
Adul N. Lapillus we e collec ed in Feb ua y 2008 a P aia de Apúlia, Po ugal,
whe e imposex incidence among he popula ion is below 5% (San os e al., unpublished
da a). The animals we e b ough o labo a o y and we e allowed o acclima e o 1 week
p io o he onse o he expe imen . The expe imen was ca ied ou wi h abou 27
animals pe eplica e, placed in 15L aqua ia illed wi h a i icial sal wa e main ained a 15
◦C ± 1 in an acclima ized oom unde a pho ope iod o 12 hou s ligh : 12 hou s da k and
a i icial ai ing. Sal wa e (salini y 35ppm, pH 8.3, conduc i i y = 48 ms/cm, edox
po en ial =−76 mV) was p epa ed using se a p emium sal and ca bon ac i a ed il a ed
ap wa e . Wa e was changed wice a week, and animals we e ed wi h mussels om
hei o igin si e once a week.
The ollowing expe imen al condi ions we e es ed in duplica e: All- ans e inol
(sigma) 1 µg/g body weigh (b.w.), TBTSn (Ald ich) 1 µg/g b.w. and con ol e al bo ine
se um (FBS; sigma), which was used as a ca ie o bo h e inol and TBT. The
concen a ions used we e selec ed based in p e ious s udies (Cas o e al., 2007). A e
he acclima iza ion pe iod, animal we e anes he ized o 30 min in 7% MgCl2 and we e
injec ed in o he oo wi h one o he expe imen al compounds, e inol, TBT and FBS.
Animals we e sac i iced 3 days a e he beginning o he expe imen and a e wo
mon hs (n=6/12). Shell weigh was measu ed p io o c acking and emo ing o snails.
Chap e 3
102
O he pa ame e s such as sex, ma u a ion s a us and penis size we e e alua ed unde a
binocula mic oscope. Imposex in TBT-exposed emales was de e mined as a posi i e
con ol, o alida e he injec ion p ocedu e. The se e i y o imposex (measu ed as Vas
De e ence Sequence Index-VDSI) was de e mined using he imposex scheme o Be in e
al. (1996). Samples we e collec ed and s o ed in RNA la e (Sigma) a -80ºC. The
emaining animals we e sac i iced a e wo mon hs o exposu e and he same pa ame e s
we e e alua ed. The mo ali y a e anged om 11% (Con ol FBS) o 18% (TBT
exposed).
3.1.3.2 Field popula ion sampling
Fo he cha ac e iza ion o basal issue exp ession le els o Adh3, samples we e
collec ed om P aia da Apúlia. Specimens we e collec ed in Ap il 2008, aken o
labo a o y and analysed unde a binocula s e eoscope o he de e mina ion o sex and
p esence o imposex in emales (again using he imposex scheme o Be in e al., 1996).
As expec ed, imposex equency in hese animals was below 5%. O gans common o bo h
sexes (diges i e gland, gonads, head ganglia complex, en acles, kidney, and gills), male-
(p os a e and penis) and emale-speci ic issues (albumen gland, capsule gland, spe m
inges ing gland and penis o ming a ea) we e emo ed and s o ed in RNAla e a -80o C
un il u he analysis.
3.1.3.3 Tissue RNA ex ac ion
To al RNA ex ac ion om he di e en s udied issues was pe o med using he
“illus a RNAspin Mini RNA Isola ion Ki ”, GE Heal hca e (animal issues p o ocol), wi h
on-column DNase I diges ion. RNA quali y was assessed in a 1% aga ose gel and i s
concen a ion was de e mined by luo escence (Fluo oskan Ascen , Labsys ems) using
he “Quan -iT RiboG een RNA Assay Ki ” (In i ogen). Fi s s and cDNA syn hesis was
pe o med using he iSc ip ™ cDNA Syn hesis Ki (Bio-Rad), acco ding o he
manu ac u e ’s ins uc ions, using i e hund ed nanog ams o o al RNA o each sample.
3.1.3.4 ADH3 isola ion and cha ac e iza ion
We used a combina ion o PCR p ime s designed in conse ed egions o he
Adh3 om a ious species o isola e he Adh3 o hologue om N. lapillus. Ini ially, we
used p ime s ADH3F 5’ GGCTACTGGRGTGTGCCA 3’ and ADH3R 5’
AGTTGAGGGCAGCWCCGT 3’. The PCR p o ile was as ollows: 95°C 5 minu es, wi h 35
cycles a 94°C 30 seconds, 50°C 30 seconds and 72°C 30 seconds. A band o
app oxima ely 400bp was isola ed om he aga ose gel and cloned using he pGEM-T
Chap e 3
103
easy ec o sys em (P omega). Sequencing o he isola ed clones was pe o med wi h he
M13Fowa d and M13 e e se p ime s (S ab ida). To ex end he ini ial sequence we
p epa ed 5’ and 3’ RACE cDNA om a pool o a ious N. lapillus RNAs using he
Clon ech ki and ollowing he manu ac u e ins uc ions (Taka a Bio USA). Race p ime s
we e designed om he ini ial sequence (ADHRACER 5’
GGAATTCGATTAGTTGAGGGCAGCTC 3’ and ADHRACEF 5’
AAGACCAACCTGTGCCAGAAGATCAG 3’). Howe e , while 3’RACE PCR was
success ul, 5’RACE PCR was ine ec i e.
3.1.3.5 Real ime PCR Assays
The exp ession o Adh3 in he a ious issues was de e mined by eal- ime PCR.
An ini ial dilu ion o he cDNA (1:4) was done, o which 5µL we e added o a eac ion
mix u e con aining 1x iQ SYBR G een supe mix (Bio-Rad) and 2 µM o o wa d and
e e se p ime in a inal olume o 25µL. A “no empla e con ol” was included in each
eac ion 96-well pla e, and all samples we e un in duplica e. Quan i a i e PCR p ime s
we e designed using he So wa e Beacon Designe 5: ADHRTF 5’
GGCAGGTCAGGAAATATC 3’ and ADHRTR 5’ CTCGTTGATCTTCTCCAG 3’.
The Real Time PCR p o ile was ini ia ed a 95ºC o 5 min, ollowed by o y cycles
o dena u a ion a 95 oC o 10s, annealing a 58 oC o 30s, and ex ension a 72 oC o 30s
(da a collec ion). A mel ing cu e was gene a ed o e e y un o con i m he speci ici y o
he assays. The PCR e iciency o he gene o in e es was de e mined h ough a
s anda d cu e, using six 5- old se ial dilu ions (e iciency o 94.8%). Rela i e gene
exp ession was calcula ed wi h using he 2-∆∆C o mula and. Rpl8 was used as e e ence
gene. P ime sequences as ollows: NlRpl8RTF 5’ GCATCATCATCAGCCACAAC 3’ and
NlRpl8RTR 5’ ACCACCACCAGCAACAATG 3’. Real ime ampli ica ion e iciency was
calcula ed using se en 5- old se ial dilu ions (e iciency 95.1%) wi h he ollowing PCR
p o ile: 95°C 10 minu es, wi h 40 cycles 95°C 10 s, 60°C 30 seconds and 72°C 30
seconds.
3.1.3.6 S a is ical Analysis
S a is ical analysis o he esul s was pe o med using he so wa e S a is ica 7.0.
Imposex equency was es ed by a Chi-Squa e es using he esul s o he sol en
con ol ea men as he expec ed esul s. A e es ing o ANOVA assump ions
(homogenei y o a iances and no mali y o da a), s a is ical di e ences in Adh3 gene
exp ession in he h ee ea men g oups we e e alua ed h ough a one-way ANOVA,
Chap e 3
110
causing imposex (Nishikawa e al., 2004; Cas o e al., 2007). Signi ican ly, ep oduc i e
ec udescence in gas opods has also been sugges ed o be media ed by RXR and
impac ed by TBT (S e nbe g e al., 2008). Thus, he dis up ion o he e inoid acid pa hway
in mollusks is c ucial o he de elopmen o imposex. Un il ecen ly, he molecula
componen s o he e inoic acid signaling pa hway we e hough o be cho da e
inno a ions (Albala and Cañes o, 2009). Howe e , ep esen a i es o impo an
componen s o his pa hway such as he e inoic acid ecep o (RAR) o he e inoic acid
deg ada ing enzyme CYP26 ha e now been ound in p e-cho da e phyla (Albala and
Cañes o, 2009). In e eb a es he pa hway leading o p oduc ion o ac i e e inoids (9-cis
RA and all- ans RA) in ol es he ini ial oxida ion o e inol o e inaldehyde. This
enzyma ic s ep is pe o med by SDR-Rdh gene amily membe s and Adh class genes. In
in e eb a es hough, he ole o ADH3 in e inol oxida ion has been ques ioned (see
Cañes o e al., 2010). In con as o e eb a es, he single copy in e eb a e Adh3 is
la gely exp essed in diges i e issues and no ubiqui ously as would be expec ed i a ole
in e inol me abolism was p esen (Godoy e al., 2007). In ac , unc ionally he enzyme
has been shown o pa icipa e in o maldehyde and ni ic oxide me abolism (Gonzàlez-
Dua e and Albala , 2005). In his s udy we se ou o isola e and cha ac e ize Adh3 in he
TBT-sensi i e gas opod mollusk N. lapillus. Since TBT modula es RXR (a c ucial
componen o he e inoic acid signaling pa hway) and Adh3 has been shown o be down
egula ed by TBT in ascidians (Azumi e al., 2004), we hypo hesized whe he a simila
inding migh be obse ed in N. lapillus. Howe e , no such e ec was de ec ed in he
es ed issues. Also, as pa o an ongoing s udy aimed a dissec ing he e inoid molecula
pa hway in N. lapillus, we analyzed he impac o e inol exposu e in he gene exp ession
o Adh3. Unexpec edly, Adh3 was clea ly down egula ed in emale gonads (a end in
es is is also obse ed bu did no each s a is ical signi icance). Since e inoic acid has
been sugges ed o play a ole in gonad ec udescence in gas opods (S e nbe g e al.,
2008), he epo ed inding could hypo he ically indica e a pa icipa ion o ADH3 in e inol
oxida ion. Al e na i ely, a oxic e ec o e inol in mollusk physiology could ha e led o he
down play o Adh3 exp ession. As esea ch on his opic p og esses, a c ucial ques ion
ela es o he ole and gene po olio o he SDR-Rdh amily in in e eb a es namely
mollusks.
In conclusion, we p o ide he e he molecula cha ac e iza ion o Adh3 in N.
lapillus. Ou da a indica es ha molluskan Adh3 gene exp ession in he gonads and
diges i e gland is no a ec ed by TBT exposu e. In con as , we show ha e inol down
egula es Adh3 in emale gonads. Whe he his esul s om a di ec ole o ADH3 in
e inoid acid me abolism should be in es iga ed in he u u e.

Chap e 3
111
3.1.6 Acknowledgemen s
We acknowledge he inancial suppo o FCT (Po ugal) P ojec
PTDC/MAR/68106/2006. Daniela Lima is a ecipien o an FCT ellowship
(SFRH/BD/41561/2007).
3.1.7 Re e ences
Albala , R., Cañes o, C., 2009. Iden i ica ion o Aldh1a, Cyp26 and RAR o hologs in
p o os omes pushes back he e inoic acid gene ic machine y in e olu iona y ime
o he bila e ian ances o . Chem. Biol. In e ac . 178, 188-96.
An iza -Ladislao, B., 2008. En i onmen al le els, oxici y and human exposu e o ibu yl in
(TBT)-con amina ed ma ine en i onmen . A e iew. En i on. In . 34, 292-308.
Azumi, K., Fujie, M., Usami, T., Miki, Y., Sa oh, N., 2004. A cDNA mic oa ay echnique
applied o analysis o global gene exp ession p o iles in ibu yl in-exposed
ascidians. Ma ine En i on. Res. 58, 543-546.
Be in, C., Oehlmann, J., S oben, E., 1996. TBT-induced imposex in ma ine
neogas opods is media ed by an inc easing and ogen le el. Helgolande
Mee esun. 50, 299-317.
Blys one, C. R., Wilson, V. S., Ha ig, P. C., Ankley, G. T., Fos e , P. M., G ay, C. l., G ay,
L. E., 2008. Fi een yea s a e "Wingsp ead" en i onmen al endoc ine dis up e s
and human and wildli e heal h: whe e we a e oday and whe e we need o go.
Toxicol. Sci. 105, 235-59.
Cañes o, C., Godoy, l., Gonzàlez-Dua e, R., Albala , R., 2003. Compa a i e exp ession
analysis o Adh3 du ing a h opod, u ocho da e, cephalocho da e, and e eb a e
de elopmen challenges i s p edic ed housekeeping ole. E ol. De . 5, 157-62.
Cañes o, C., Albala , R., Pos le hwai , J.H., 2010. Oikopleu a dioica alcohol
dehyd ogenase class 3 p o ides new insigh s in o he e olu ion o e inoic acid
syn hesis in cho da es. Zool. Sci. 27, 128-33.
Cas o, L. F., Lima, D., Machado, A., Melo, C., Hi omo i, Y., Nishikawa, J., Nakanishi, T.,
Reis-Hen iques, M. A., San os, M. M., 2007. Imposex induc ion is media ed
h ough he Re inoid X Recep o signaling pa hway in he neogas opod Nucella
lapillus. Aqua . Toxicol. 85, 57-66.
Chap e 3
112
C é on, R., Zwaan, G., Dohmen, R., 1993. Speci ic de elopmen al de ec s in molluscs
a e ea men wi h e inoic acid du ing gas ula ion. De . G ow h Di e . 35, 357-
364.
deFu , P. L., C ane, M., Inge soll, C., Ta e s ield, l. (eds) 1999. Endoc ine dis up ion in
in e eb a es: endoc inology, es ing, and assessmen . In: P oceedings o he
wo kshops on endoc ine dis up ion in in e eb a es, Noo dwijke hou , SETAC
P ess, Pensacola, The Ne he lands.
Fen , K., 1996. Eco oxicology o o gano in compounds. C i . Re . Toxicol. 26, 1-117.
Gibbs, P. E., B yan, G. W., 1986. Rep oduc i e ailu e in popula ions o he dog-whelk,
Nucella lapillus, caused by imposex induced by ibu yl in om an i ouling pain s. J.
Ma . Biol. Assoc. U.K. 66, 767-777.
Godoy, l., Gonzàlez-Dua e, R., Albala , R., 2007 Analysis o plana ian Adh3 suppo s an
in on- ich a chi ec u e and issue-speci ic exp ession o he u bila e ian ances al
o m. Comp. Biochem. Physiol. B 146, 489-95.
Gonzàlez-Dua e, R., Albala , R., 2005. Me ging p o ein, gene and genomic da a: he
e olu ion o he MDR-ADH amily. He edi y 95, 184-97.
Kanayama, T., Kobayashi, N., Mamiya, S., Nakanishi, T., Nishikawa, J., 2005. O gano in
compounds p omo e adipocy e di e en ia ion as agonis s o he pe oxisome
p oli e a o -ac i a ed ecep o gamma/ e inoid X ecep o pa hway. Mol.
Pha macol. 67, 766-74.
Lima, D., Reis-Hen iques, M. A., Sil a, R., San os, A. I., Cas o, L. F. C., San os, M. M.,
2011. T ibu yl in-induced imposex in ma ine gas opods in ol es issue-speci ic
modula ion o he e inoid X ecep o . Aqua . Toxicol. 101, 221-7.
Molo ko , A., Fan, X. , Del ou , l., Foglio, M. H., Ma as, S., Fa és, J., Pa es, X., Dues e ,
G., 2002. S imula ion o e inoic acid p oduc ion and g ow h by ubiqui ously
exp essed alcohol dehyd ogenase Adh3. P oc. Na l. Acad. Sci. U. S. A. 99,
5337-42.
Nakanishi, T., 2008. Endoc ine dis up ion induced by o gano in compounds; o gano ins
unc ion as a powe ul agonis o nuclea ecep o s a he han an a oma ase
inhibi o . J. Toxicol. Sci. 33, 269-76.
Nishikawa, J., Mamiya, S., Kanayama, T., Nishikawa, T., Shi aishi, F., Ho iguchi, T., 2004.
In ol emen o he e inoid X ecep o in he de elopmen o imposex caused by
o gano ins in gas opods. En i on. Sci. Technol. 38, 6271-6.
Nishikawa, J., 2006. Imposex in ma ine gas opods may be caused by binding o
o gano ins o e inoid X ecep o . Ma . Biol. 149, 117-124.
Chap e 3
113
San os, M. M., Enes, P., Reis-Hen iques, M. A., Kuballa, J., Cas o, L. F. C., Viei a, M. N.,
2009. O gano in le els in sea ood om Po uguese ma ke s and he isk o
consume s. Chemosphe e 75, 661-666.
S e nbe g, R. M., Ho chkiss, A. K., Leblanc, G. A., 2008. Synch onized exp ession o
e inoid X ecep o mRNA wi h ep oduc i e ac ec udescence in an imposex-
suscep ible mollusc. En i on. Sci. Technol. 42, 1345-51.
S e nbe g, R. M., Gooding, M. P., Ho chkiss, A. K., Leblanc, G.A., 2010. En i onmen al-
endoc ine con ol o ep oduc i e ma u a ion in gas opods: implica ions o he
mechanism o ibu yl in-induced imposex in p osob anchs. Eco oxicology 19, 4-23.
Sump e , J. P., 2005. Endoc ine dis up e s in he aqua ic en i onmen : an o e iew. Ac a
Hyd ochim. Hyd obiol. 33, 9-16.
Zgombić-Knigh , M., Ang, H. L., Foglio, M. H., Dues e , G., 1995. Cloning o he mouse
class IV alcohol dehyd ogenase ( e inol dehyd ogenase) cDNA and issue-speci ic
exp ession pa e ns o he mu ine ADH gene amily. J. Biol. Chem. 270, 10868-77.
Chap e 3
114
Chap e 3
115
3.2 Isola ion o he i s p o os ome cy och ome P26 o hologue in he
imposex-sensi i e gas opod Nucella lapillus: molecula and oxicological
insigh s
3.2.1 Abs ac
We epo he e he isola ion o he i s p o os ome cy och ome P26 gene in he
lopho ochozoan gas opod Nucella lapillus. The phylogene ic analysis con i ms ha he
isola ed sequence is pa o CYP26 e olu iona y clade, a clea indica ion on he bila e ian
ances y o he RA signaling pa hway molecula componen s. Gi en he ecen ly epo ed
pi o ole o mammal CYP26 in he con ol o meiosis ini ia ion, we p o ide he e he i s
p o os ome CYP26 issue exp ession p o ile by qPCR, in se e al emale and male issues,
as well as issue exp ession dynamics in gonads be ween ma u e and do man animals.
Addi ionally, conside ing ha he endoc ine dis up o chemical ibu yl in (TBT) has been
epo ed o induce imposex in emale gas opods h ough he modula ion o e inoid
signaling pa hways, he in e e ence o TBT wi h he ansc ip ion le els o CYP26 in a se
o N. lapillus issues was e alua ed. The esul s o he p esen s udy show ha , simila o
e eb a es, NlCYP26 is ubiqui ously exp essed in a b oad ange o issues. In e es ingly,
he exp ession dynamic o CYP26 in emale gonads ollows an opposi e pa e n o ha o
RXR, wi h a dec ease ansc ip ion in ma u e and inc eased ansc ip ion in do man
animals. These esul s sugges he coo dina ed ac ion o NlRXR and NlCYP26 in emale
gonad de elopmen , and ha NlCYP26 could be in ol ed in he deg ada ion o
endogenous RA. Exposu e o TBT signi ican ly dec eased he ansc ip ion le els in penis
o emales a ad anced s ages o imposex, which may sugges a no el ole o NlCYP26 in
imposex de elopmen . O e all, hese esul s ex end he ole o e inoid pa hways in gonad
de elopmen and imposex induc ion in gas opods, suppo ing he hypo hesis o a
phylogene ic conse ed na u e o e inoid signaling wi hin Bila e ia.
3.2.2 In oduc ion
Re inoids ( i amin A and i s analogs) ha e a key ole in se e al biological unc ions
in e eb a es such as egula ion o de elopmen , immune unc ion, ision o ep oduc ion
(Malik, 2000; Blomho and Blomho , 2006; Theodosiou e al., 2010). Al e a ions in
e inoid signaling pa hways cause congeni al mal o ma ions, e ili y p oblems, ision

Chap e 3
116
de ec s, umo and neu odegene a i e diso de s (No ák e al., 2008). Re inoids a e aken
up om he die as ca o enoids, e inol o e inyl-es e s. Whe eas e eb a es ha e an
elabo a e sys em in ol ing e inoid up ake, anspo , s o age, mobiliza ion, ac i a ion and
ca abolism, much less is known in in e eb a es (Theodosiou e al., 2010). Ye , he
p esence o bioac i e e inoids has been epo ed in a ew in e eb a e species and he
p esence o e inoid me abolism and s o age in he gas opod Osilinus linea us has
ecen ly been demons a ed (Ges o e al., 2012). Re inoid signal ansduc ion occu s
essen ially h ough wo ypes o nuclea ecep o s: he e inoid X ecep o s (RXRs) and
he e inoic acid ecep o s (RARs). Whe eas RXR is highly conse ed h oughou
me azoans, RAR was ecen ly iden i ied in a lopho ochozoan genome, al hough a
unc ional cha ac e iza ion is s ill lacking (Albala and Cañes o, 2009).
The ac i e me aboli e o i amin A, e inoic acid (all- ans RA), is a key egula o o
many biological p ocesses such as emb yonic de elopmen and ep oduc ion in mammals
(Niede ei he and Dollé, 2008). Howe e , he homeos a ic con ol o RA le els wi hin a
physiological ange is essen ial as bo h dep essed and excess RA le els ha e been
associa ed in e eb a es wi h se e al pa hologies (Niede ei he and Dollé, 2008). The
main enance o issue’s RA le els is achie ed mos ly by he ac ion o enzymes om he
cy och ome p450 supe amily, he CYP26 amily. In mammals, he CYP26 amily has
h ee membe s, CYP26A1, CYP26B1 and CYP26C1 (Ross and Zol agha i, 2011).
Al hough he CYP26 genes display di e en exp ession p o ile, hey a e able o ca alyze
he oxida ion o all- ans RA and 9-cis RA (CYP26C1) o less ac i e me aboli es, i.e., 4-
hyd oxy and 4 –oxo and 18 – hyd oxyl-RA. While he biological ac i i y o hese
me aboli es is s ill no ully cha ac e ized, he a ailable da a sugges ha hei ac i i y may
be con ex speci ic (Ross and Zol agha i, 2011). In mice, null mu a ions o genes o
CYP26C1 and CYP26B1 a e le hal, hus showing he cen al ole du ing emb yonic
de elopmen (Niede ei he and Dollé, 2008). In ge m cell de elopmen , he sex-speci ic
ime o meiosis en y is unde he con ol o RA (Bowles e al., 2006; Koubo a e al.,
2006). Du ing emb yogenesis, whe eas ge m cells in he o a y en e meiosis, in he es is
ge m cells do no en e meiosis un il pube y. CYP26 enzymes ha e been sugges ed o
ha e a cen al ole in his mechanism, as hey seem o p e en an inc ease in RA le els in
es is, hus delaying he en y in o meiosis. Simila ly, CYP26 seems o be de e minan o
o a y meiosis (Bowles e al., 2006; Koubo a e al., 2006).
Compiling e idences indica e ha mollusks ha e a ully elabo a ed e inoid sys em
(Ges o e al., 2012). This is suppo ed by he p esence o ac i e e inoid me abolism and
he p esence o biological e ec s o e inoids in se e al species (Nowickyj e al., 2008). In
Lymnaea s agnalis RA has been sugges ed o be in ol ed in neu onal egene a ion and
Chap e 3
117
axon pa h inding and emb yo exposu e o e inol, e inal and all- ans RA (in he ange o
10-5 o 10-7M) leads o de elopmen al de ec s cha ac e ized by inc eased a es o emb yos
wi h a es ed de elopmen and abno mal shell and eyes (C é on e al., 1993; Dme ichuk
e al., 2008). A link be ween he dynamics o RXR ansc ip ion in emale and male
gonads o he mud snail Ilyanassa obsole a and he ma u a ion s a us has been
es ablished by S e nbe g e al. (2008), sugges ing a ole o RXR in ep oduc ion o
mollusks. Simila ly, Ges o e al. (2012) ha e ecen ly epo ed a sex-speci ic pa e n o
e inoid s o age and me abolism is gonad/diges i e gland o he gas opod O. linea us.
Fu he mo e, adminis a ion o 9-cis RA leads o an inc ease in male penis leng h in he
p osob anch gas opod N. lapillus as well as penis de elopmen in emales (imposex),
hus implying ha , simila o e eb a es, RA may be in ol ed in mollusks geni alia
o ma ion (Cas o e al., 2007). In ac , he de elopmen o male penis in emale
p osob anch gas opods has been he bes cha ac e ized example o endoc ine dis up ion
in aqua ic ecosys ems. Today, i is well es ablished ha imposex induc ion by he
an i oulan ibu yl in is media ed h ough RXR signaling pa hways (Cas o e al., 2007;
S e nbe g e al., 2010). Hence, p esen da a sugges ha he con ol o e inoid le els
wi hin a physiological ange may be c ucial o bo h e eb a es and in e eb a es.
Recen ly, he sea ch in he unpublished Lopho ochozoans genomes (e.g.,
mollusks and annelids) has hin ed a he p esence o key playe s o he RA machine y in
p o os omes, including a CYP26 o hologue (Albala and Cañes o, 2009). Hence,
conside ing he cen al ole o CYP26 in e eb a es, in he p esen s udy we isola ed he
i s p o os ome CYP26 o hologue in he p osob anch gas opod N. lapillus and p o ide a
issue exp ession p o ile by qPCR in se e al emale and male issues. Fu he mo e, we
in es iga ed he issue exp ession dynamics in gonads a ma u e and do man s ages in
bo h sexes. Addi ionally, since he an i oulan agen TBT has been shown o al e e inoid
signaling in gas opods, a oxicological s udy was pe o med o e alua e he po en ial
in e e ence o TBT wi h he ansc ip ion le els o CYP26 in a se o N. lapillus issues.
3.2.3 Ma e ial and Me hods
3.2.3.1 Field popula ion sampling
Fo he cha ac e iza ion o basal issue exp ession le els, adul N. lapillus we e
collec ed a P aia da Apúlia, a si e loca ed in he No h o Po ugal known o display an
imposex equency below 5% (San os e al., unpublished da a). Specimens we e collec ed
a a single ime poin , aken o labo a o y and analyzed unde a binocula s e eoscope o
Chap e 3
118
he de e mina ion o sex and p esence o imposex in emales (using he imposex scheme
o Be in e al., 1996). As expec ed, imposex equency in hese animals was below 5%.
O gans common o bo h sexes (diges i e gland, gonads, head ganglia complex, en acles,
kidney, and gills), male- (p os a e and penis) and emale-speci ic issues (albumen gland,
capsule gland, spe m inges ing gland and penis o ming a ea) we e emo ed and s o ed
in RNAla e a -80 oC un il u he analysis.
Fo he cha ac e iza ion o ma u e and do man CYP26 gene ansc ip ion le els,
adul s we e sampled be ween June and July 2008 a P aia da Apúlia. Gene ansc ip ion
was de e mined in male and emale gonads (4-6 samples pe sex and ep oduc i e
s a us). The ma u a ion s a us o he animals was de e mined based on ex e nal
mo phological cha ac e is ics. Ma u e emales displayed a e y de eloped gonad and
capsule gland, while do man p esen ed hese o gans unde de eloped and wi h an
o ange/b ownish colo . Males we e classi ied as ma u e when displayed e y de eloped
gonad and spe m was p esen in he seminal esicle, and as do man in he absence o
isible spe m and gonad no de eloped. RNA ex ac ion and cDNA syn hesis we e
pe o med as desc ibed abo e. Since RXR gene ansc ip ion in gonads o he mud snail,
Ilyanassa obsole a (S e nbe g e al., 2008) has been sugges ed o a y acco ding o he
ma u a ion s age, we also de e mined RXR gene ansc ip ion in gonads o ma u e and
do man animals, and con as ed he gene ansc ip ion dynamic wi h ha o CYP26.
3.2.3.2 Expe imen al exposu e o TBT
The expe imen al condi ions a e simila o hose desc ibed in de ail in Lima e al.
(2011). B ie ly, adul N. lapillus we e collec ed in P aia de Apúlia and b ough o
labo a o y, whe e hey we e allowed o acclima e o 1 week p io o he onse o he
expe imen . Abou 35 specimens pe eplica e ( h ee eplica e pe ea men ) we e placed
in 30 L aqua ia illed wi h a i icial sal wa e and wo ea men g oups we e se : sol en
con ol (DMSO a 0.0002%) and TBT Cl a 100 ng Sn/L TBT. A e one and wo mon hs o
exposu e, 16 animals (eigh males and eigh emales) pe ea men we e sac i iced. Sex,
ma u a ion s a us and penis size/imposex we e e alua ed unde a binocula mic oscope.
The se e i y o imposex (measu ed as Vas De e ence Sequence Index-VDSI) was
de e mined using he imposex scheme o Be in e al. (1996). No di e ences in mo ali y
a es we e obse ed be ween ea men g oups.
3.2.3.3 Tissue RNA ex ac ion
RNA ex ac ion in gonads, diges i e gland and CNS was pe o med using he Ki
illus a RNAspin Mini RNA Isola ion, GE Heal hca e (animal issues p o ocol), wi h on
Chap e 3
119
column DNAseI diges ion. Gi en he low amoun o issue and RNA concen a ion in penis
and PFA, RNA was ex ac ed using he ki Qiagen RNeasy® Plus Mic o, which is
adequa e o samples wi h less han 5 mg o issue. The cDNA syn hesis was pe o med
wi h he iSc ip ™cDNA Syn hesis Ki (Bio-Rad) acco ding o he manu ac u e ’s
ins uc ions, using 500 ng o o al RNA o gonad and CNS and 50 ng o o al RNA o
penis and PFA.
3.2.3.4 NlCyp26 isola ion and cha ac e iza ion
We designed a ious se s o degene a e p ime s o isola e Cyp26 sequences om
N. lapillus h ough RT-PCR. Ini ially, we we e able o isola e a agmen wi h
app oxima ely 120 nucleo ides wi h simila i y o Cyp26 sequences wi h p ime s CYP26F3
(5’ TGGGCTGGCCCTTCd nggnga ac 3’) and CYP26R3 (5’gc gccgaacagg gng yw wa
3’). The e ie ed sequence was u he expanded using a speci ic o wa d (5’
TGGAGTTTGCTAGAAAGGGGGCAGA 3’) and a e e se degene a ed p ime (5’
CGCACGCCGCcncc aanggna 3’) loca ed downs eam o he i s agmen . This s a egy
allowed he isola ion o a con ig o e lapping sequence wi h 1079 nucleo ides. We made
a ious a emp s o clone he ull ORF using RACE cDNA and PCR, bu hese we e
unsuccess ul. PCR bands we e di ec sequenced a e DNA band isola ion (GE illus a
GFX).
3.2.3.5 Sequence analysis and phylogene ics
The e ie ed cDNA sequence was assembled and he simila i y o o he known
Cyp26 de e mined wi h he BLAST p og am (h p://www.ncbi.nlm.nih.go /blas ). The
p edic ed amino acid sequence was p oduced using he ansla e ool o he EXPASy
Bioin o ma ics esou ce po al (h p://web.expasy.o g/ ansla e/). Fo he calcula ion o he
phylogene ic ee sequences we e collec ed om Ensembl, GenBank and JGI da abases.
Mul iple sequence alignmen was implemen ed in MEGA5 (Tamu a e al., 2011) wi h he
Clus alW unc ion. The e olu iona y his o y was in e ed using he Maximum-likelihood
me hod. S a is ical suppo was de e mined wi h he boo s ap es (1000 eplica es).
3.2.3.5 qPCR assays
Tissue exp ession le els o NlCyp26 we e de e mined by qPCR (Bio-Rad,
iQ5). B ie ly, 0.8 µL cDNA was added o a eac ion mix u e con aining 1x iQ SYBR G een
supe mix (Bio-Rad) 0.2 µM o each p ime , in a inal olume o 20 µL. In each pla e, a “no
empla e con ol” was included, and samples we e un in duplica e. qPCR p o ile and
p ime s used we e p e iously desc ibed (see Cas o e al., 2007). P ime s sequences and
Chap e 6
222
compounds a e po en induce s o adipogenesis in e eb a es. Mol. Endoc inol.
20, 2141-2155.
Ho iguchi, T., Nishikawa, T., Oh a, Y., Shi aishi, H., Mo i a, M., 2010. Time cou se o
exp ession o he e inoid X ecep o gene and induc ion o imposex in he ock
shell, Thais cla ige a, exposed o iphenyl in chlo ide. Anal. Bioanal. Chem. 396,
597-607.
Jane , G., Lyssimachou, A., Bachmann, J., Oehlmann, J., Schul e-Oehlmann, U., Po e,
C., 2006. Sexual dimo phism in es e i ied s e oid le els in he gas opod Ma isa
co nua ie is: he e ec o xenoand ogenic compounds. S e oids. 71, 435-444.
Jane , G., Po e, C., 2007. Sex s e oids and po en ial mechanisms o non-genomic
endoc ine dis up ion in in e eb a es. Eco oxicology. 16, 145-60.
Jane , G., Na a o, J. C., Po e, C., 2007. Exposu e o TBT inc eases accumula ion o
lipids and al e s a y acid homeos asis in he amsho n snail Ma isa co nua ie is.
Comp. Biochem. Phys. C. 146, 368-74.
le Mai e, A., G imaldi, M., Roecklin, D., Dagnino, S., Vi a -Hannah, V., Balague , P.,
Bou gue , W., 2009. Ac i a ion o RXR–PPAR he e odime s by o gano in
en i onmen al endoc ine dis up o s EMBO epo s 10, 367-373.
Lo ekamp-Swan, T., Je en, A. M., Da is, B. J., 2003. Dual ac i a ion o PPARalpha and
PPARgamma by mono-(2-e hylhexyl) ph hala e in a o a ian g anulosa cells. Mol.
Cell. Endoc inol. 201, 133-141.
Lubzens, E., Young, G., Bobe, J., Ce dà, J., 2010. Oogenesis in eleos s: How ish eggs
a e o med Gen. Comp. Endoc inol. 165, 367-389.
Luu-The, V., T emblay, P., Lab ie, F., 2006. Cha ac e iza ion o ype 12 17be a-
hyd oxys e oid dehyd ogenase, an iso o m o ype 3 17be a-hyd oxys e oid
dehyd ogenase esponsible o es adiol o ma ion in women. Mol. Endoc inol. 20,
437-43.
Lyssimachou, A., Jenssen, B. M., A ukwe, A., 2006. B ain cy och ome P450 a oma ase
gene iso o ms and ac i i y le els in A lan ic salmon a e wa e bo ne exposu e o
nominal en i onmen al concen a ions o he pha maceu ical e hynyles adiol and
an i oulan ibu yl in. Toxicol. Sci. 91, 82-92.
Lyssimachou, A., 2008. An in es iga ion on di e en mechanisms o endoc ine dis up ion
in ish and molluscs.

Chap e 6
223
Lyssimachou, A., Na a o, J. C., Bachmann, J., Po e, C., 2009. T iphenyl in al e s lipid
homeos asis in emales o he amsho n snail Ma isa co nua ie is. En i on. Pollu .
157, 1714-20.
Ma ko , G. V., Ta a es, R., Dauphin-Villeman , C., Demeneix, B. A., Bake , M. E., Laude ,
V., 2009. Independen elabo a ion o s e oid ho mone signaling pa hways in
me azoans. P. Na l. Acad. Sci. USA. 106, 11913–11918.
McAllis e , B. G., Kime, D. E., 2003. Ea ly li e exposu e o en i onmen al le els o he
a oma ase inhibi o ibu yl in causes masculinisa ion and i e e sible spe m
damage in zeb a ish (Danio e io). Aqua . Toxicol. 65, 309–316.
McGinnis, C. L., C i ello, J. F., 2011. Elucida ing he mechanism o ac ion o ibu yl in
(TBT) in zeb a ish. Aqua . oxicol. 103, 25-31.
Nagasaki, S., Suzuki, T., Miki, Y., Akahi a, J., Ki ada, K., Ishida, T., Handa, H., Ohuchi,
N., Sasano, H, 2009. 17Be a-hyd oxys e oid dehyd ogenase ype 12 in human
b eas ca cinoma: a p ognos ic ac o ia po en ial egula ion o a y acid
syn hesis. Cance Res. 69, 1392-9.
Nakayama, K., Oshima, Y., Yamaguchi, T., Tsu uda, Y., Kang, I. J., Kobayashi, M.,
Imada, N., Honjo, T., 2004. Fe iliza ion success and sexual beha io in male
medaka, O yzias la ipes, exposed o ibu yl in. Chemosphe e. 55, 1331-1337.
Nishikawa, J.-I., Mamiya, S., Kanayama, T., Nishikawa, T., Shi aishi, F., Ho iguchi, T.,
2004. In ol emen o he e inoid X ecep o in he de elopmen o imposex
caused by o gano ins in gas opods. En i on. Sci. Technol. 38, 6271-6276.
Obe dö s e , E., McClellan-G een, P., 2000. The neu opep ide APGWamide induces
imposex in he mud snail, Ilyanassa obsole a. Pep ides 21, 1323–1330.
Ogino, Y., Suzuki, K., Ha aguchi, R., Sa oh, Y., Dolle, P., Yamada, G., 2001. Ex e nal
geni alia o ma ion: ole o ib oblas g ow h ac o , e inoic acid signaling, and
dis al u e h al epi helium. Ann. N. Y. Acad. Sci., 13-31.
Pa liko a, N., Ko ne , T. M., A ukwe, A., 2010. Modula ion o acu e s e oidogenesis,
pe oxisome p oli e a o -ac i a ed ecep o s and CYP3A/PXR in salmon in e enal
issues by ibu yl in and he second messenge ac i a o , o skolin. Chem-Biol
In e ac . 185, 119-127.
P ehn, C., Mölle , G., Adamski, J., 2009. Recen ad ances in 17be a-hyd oxys e oid
dehyd ogenases, J. S e oid. Biochem. Mol. Biol. 114, 72-77.
Sama u , E., Roche e-Egly, C., 2011. Nuclea e inoic acid ecep o s: Conduc o s o he
e inoic acid symphony du ing de elopmen . Mol. Cell. Endoc inol. 1-13.
Chap e 6
224
Sandell, L. L., Lynn, M. L., Inman, K. E., McDowell, W., T aino , P. A., 2012. RDH10
oxida ion o i amin A is a c i ical con ol s ep in syn hesis o e inoic acid du ing
mouse emb yogenesis. PloS one 7, e30698. doi:10.1371/jou nal.pone.0030698.
San os, M. M., Cas o, L. F. C., Viei a, M. N., Micael, J., Mo abi o, R., Massanisso, P.,
Reis-Hen iques, M. A., 2005. New insigh s in o he mechanism o imposex
induc ion in he dogwhelk Nucella lapillus. Comp. Biochem. Physiol. C. 141, 101-
109.
San os, M. M., Micael, J., Ca alho, A. P., Mo abi o, R., Booy, P., Massanisso, P.,
Lamo ee, M., Reis-Hen iques, M. A., 2006. Es ogens coun e ac he masculinizing
e ec o ibu yl in in zeb a ish. Comp. Biochem. Phys. C. 142, 151-155.
Simões-Cos a, M., Azambuja, A., Xa ie -Ne o, J., 2008. The sea ch o non‐cho da e
e inoic acid signaling: lessons om cho da es. J. Exp. Zool. 310B, 54-72.
Spoone , N., Gibbs, P. E., B yan, G. W., Goad, L. J., 1991. The e ec o ibu yl in upon
s e oid i e s in he emale dogwhelk, Nucella lapillus, and he de elopmen o
imposex. Ma . En i on. Res. 2, 37-49.
S e nbe g, R.M., Ho chkiss, A.K., LeBlanc, G.A., 2008. The con ibu ion o s e oidal
and ogens and es ogens o ep oduc i e ma u a ion o he eas e n mud snail
Ilyanassa obsole a. Gen. Comp. Endoc inol. 156, 15-26.
Tha che , J. E., Isohe anen, N., 2009. The ole o CYP26 enzymes in e inoic acid
clea ance. Expe . Opinion D ug. Me ab. Toxico., 1-21.
Theodosiou, M., Laude , V., Schube , M., 2010. F om ca o o clinic: an o e iew o he
e inoic acid signaling pa hway. Cell. Mol. Li e Sci. 67, 1423–1445.
Tho n on, J. W., 2003. Nonmammalian nuclea ecep o s: E olu ion and endoc ine
dis up ion. Pu e Appl. Chem. 75, 1827-1839.
Waxman, J. S., Yelon, D., 2011 Zeb a ish e inoic acid ecep o s unc ion as con ex -
dependen ansc ip ional ac i a o s. De elopmen al biology 352, 128-40.