Phospho-regulation of Myosin Regulatory Light Chain in Caenorhabditis elegans embryos during cytokinesis

Phospho-regulation of myosin regulatory light chain in Caenorhabditis elegans embryos during cytokinesis Joana Filipa Silva Saramago Mestrado em Biologia Molecular e Celular Departamento de Biologia 2014 Orientador Ana Xavier Carvalho, PI, Instituto de Biologia Molecular e Celular Coorientador Ana Marta Silva, PhD, Instituto de Biologia Molecular e Celular FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis Todas as correções determinadas pelo júri, e só essas, foram efetuadas. O Presidente do Júri, Porto, ______/______/_________ FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis Acknowledgements Gostaria de agradecer a todos os membros do grupo Cytoskeletal Dynamics, em especial à Ana Xavier Carvalho, pelo voto de confiança, pelo companheirismo, pela solidariedade e pela entreajuda. Pela amizade nos bons e maus momentos. Cresci imenso desde que cheguei há um ano ao nosso laboratório e, sem saber do futuro, espero poder continuar a crescer do vosso lado. Para mim, a ciência tornou-se mais fascinante. Quero também agradecer aos membros do Cell Division Mechanisms por toda a ajuda e companheirismo. Um especial agradecimento aos meus familiares, especialmente aos meus pais. Tudo o que sou hoje devo-vos a vós. Por toda a dedicação, por toda a preocupação, por serem capazes de me aturarem quando ando stressada. Na realidade não poderia pedir mais de vós, são um grande modelo de humildade, amor e capacidade de sacrifício para um bem maior. No futuro espero ser como vocês e ser capaz de retribuir tudo que fizeram por mim. Amo-vos! Ao meu namorado, Jorge Oliveira, por estar presente sempre que preciso. Pelo teu amor e pela tua amizade. Obrigado pelas noites ao meu lado enquanto eu escrevia esta dissertação. Sei que nos completamos. Ao nosso futuro que agora começa! À minha melhor amiga, Ana Júlia, por ser aquela que independentemente do que seja, ser capaz de me animar e de me mostrar o lado positivo da vida. Desde que te conheci que me demonstras as prioridades na vida e como saber reagir ao que realmente é importante. És uma força da natureza. Perdoa-me por nesta fase não ter estado tão presente como desejava. A mim, por ser capaz de aprender e de me tornar cada vez mais forte a cada obstáculo que ultrapasso. À faculdade de ciências da universidade do porto e ao instituto de biologia molecular e celular, por acolherem e financiarem os meus sonhos. FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis Sumário Citocinese é o processo que finaliza a divisão celular durante o qual o conteúdo de uma célula é dividido por duas células-filhas. A maioria das proteínas que se sabe estarem envolvidas em citocinese são altamente conservadas em seres vivos, e de algumas delas já se conhecem bastantes detalhes moleculares baseados em estudos in vitro. Contudo, na situação in vivo, a complexidade do sistema impera e a compreensão do processo continua muito pouco claro a nível molecular. Pensa-se que a proteína miosina não-muscular II seja o motor molecular da citocinese que gera a força necessária para a constrição do anel contráctil. Experiências in vitro demonstram que a atividade da miosina não-muscular II é regulada pela fosforilação da sua cadeia regulatória leve nos resíduos treonina17 e serina18. A fosforilação da cadeia regulatória leve torna a miosina não-muscular II competente para interagir com outras moléculas de miosina não-muscular II e formar filamentos bipolares que permitem a contractilidade da rede de filamentos de actina e miosina. Ainda assim, a contribuição da fosforilação da cadeia regulatória leve da miosina na citocinese contínua controversa. Esta parece ser crucial em células S2 de D. melanogaster mas desnecessária em S. pombe e D. discoideum. No presente estudo, tentamos desvendar o papel da fosforilação dos aminoácidos treonina17 e serina18 da cadeia regulatória leve da miosina durante a citocinese em embriões de C. elegans. Para tal, criámos estirpes de C. elegans que expressam a proteína wild-type MLC-4::GFP, ou a proteína mutada MLC-4 A17A18::GFP (não fosforilável) ou MLC-4 D17E18:GFP (fosfomimética) Todos os transgenes foram desenhados de forma a serem resistentes a ARN de interferência, permitindo a avaliação do processo de citocinese em embriões que expressam a MLC-4 wild-type ou mutantes quer na presença da proteína endógena, quer na sua ausência. A análise da montagem e constrição do anel contráctil demonstraram que a proteína wild-type MLC-4::GFP é capaz de atuar de igual forma à proteína endógena durante a citocinese. Na presença da forma MLC-4 não-fosforilável, a citocinese não ocorre. Em contraste, na presença da forma MLC-4 fosfomimética, a citocinese ocorre de forma semelhante a quando a forma MLC-4 wild-type é expressa. Os nossos resultados sugerem que, durante todo o processo de citocinese, os filamentos bipolares da miosina nãomuscular II mantêm-se ativos pois tornam-se competentes para a contractilidade através fosforilação nos resíduos Treonina17 e Serina18. O conhecimento mais extensivo deste assunto terá implicações importantes para a compreensão dos mecanismos do anel contráctil e abcisão, a fase final da citocinese. Palavras-chave: Citocinese; Miosina não muscular II; Cadeia regulatória leve da miosina; Fosforilação; C. elegans; Embrião unicelular. FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis Abstract Cytokinesis is known as the final step in cell division during which the contents of one mother cell are partitioned into the two daughter cells. Although most of the proteins involved in cytokinesis are known and well conserved among organisms, cytokinesis is still poorly understood at the molecular level. Non-muscle myosin II (NMYII) is thought to be the molecular motor that drives constriction of the contractile ring during cytokinesis. In vitro experiments show that nonmuscle myosin II activity is regulated by phosphorylation of its regulatory light chain (MRLC) on the residues Threonine 17 Serine 18. NMII activation is required for it to become competent to interact with other NMII molecules and form bipolar filaments that allow for acto-myosin contractility. The contribution of MRLC phosphorylation to cytokinesis is however controversial. It seems to be crucial in Drosophila S2 cells but unnecessary in yeast and Dictyostelium. In this study, we intended to gain insight into the role of Threonine17 and Serine18 MRLC phosphorylation during cytokinesis using the Caenorhabditis elegans early embryo as experimental model. To do that, we generated C. elegans strains expressing wild-type, nonphosphorylatable (A17A18) or phosphomimetic (D17E18) MLC-4::GFP mutants, using the MosSCI technique. As transgenes were engineered to be RNA interference (RNAi) resistant, we were able to evaluate cytokinesis in 1-cell embryos expressing wild-type MLC-4::GFP or the mutated forms in the presence or absence of the endogenous protein. Analysis of contractile ring assembly and constriction have shown that wild-type MLC-4::GFP is able to perform as well as the endogenous MLC-4 during cytokinesis and rescues embryonic viability. In the presence of non-phosphorylatable MLC-4, cytokinesis does not happen. In contrast, in the presence of phosphomimetic MLC-4 cytokinesis is completed as when wild-type MLC-4 is expressed. Our results suggest that once NMII bipolar filaments become competent for contractility by MLC-4 phosphorylation on residues Threonine17 and Serine18, they remain in the active state throughout cytokinesis. Further understanding of this issue will have important implications for the understanding of the mechanics of the contractile ring and abscission, the last stage of cytokinesis. Key words: Cytokinesis; Myosin regulatory light chain; non-muscle myosin II; Phosphorylation; C. elegans; One-cell embryo. FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis Table of Contents Movies Index .................................................................................................................. 1 List of Abbreviations ....................................................................................................... 2 1. Introduction ........................................................................................................... 3 1.1. Cytokinesis ........................................................................................................ 3 1.2. Non-muscle myosin II and associated regulatory light chain in the contractile ring ….4 1.3 Caenorhabditis elegans as biological model ........................................................ 7 1.4 RNA interference ............................................................................................... 9 1.5 Mos Single Copy Insertion ................................................................................10 2. Objectives ............................................................................................................12 3. Material and Methods ..........................................................................................13 3.1. C. elegans maintenance ...................................................................................13 3.1.1 Worm maintenance .......................................................................................13 3.1.1. General stock maintenance ........................................................................13 3.1.2. Freezing C. elegans stocks ........................................................................14 3.2. Generation of C. elegans strains ......................................................................14 3.2.1. Design and cloning of transgenes ..............................................................14 3.2.2. Stable integration using MosSCI technique ................................................19 3.2.3. Mating strains .............................................................................................20 3.2.4. Strains generated during this project ..........................................................21 3.3. RNA interference ..............................................................................................22 3.4. Embryonic Viability test ....................................................................................25 3.5. Microscopy .......................................................................................................26 3.5.1. Preparation of samples ..............................................................................26 FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 3.5.2. Imaging conditions .....................................................................................26 3.5.3. Imaging processing ....................................................................................26 3.6. Live-imaging assays .........................................................................................26 3.6.1. Measuring Timing for Contractile Ring Assembly .......................................26 3.6.2. Measuring Contractile Ring rate .................................................................27 4. Results.................................................................................................................28 4.1. MLC-4 gradual depletion in one-cell C. elegans embryos results in cytokinesis slow-down, cytokinesis failure and worm sterility ............................................28 4.2. Wild-Type MLC-4::GFP probe is functional ................................................33 4.3. Generation of strains expressing MLC-4(T17S18AA)::GFP and MLC4(T17S18DE)::GFP ..............................................................................................................36 4.3.1 MLC-4(T17S18AA)::GFP does not rescue embryonic viability .......................37 4.3.2 MLC-4(T17S18AA)::GFP localizes as wild-type protein .................................37 4.3.3 MLC-4(T17S18AA)::GFP expression results in cytokinesis slow-down and cytokinesis failure ...............................................................................................................38 4.3.4 Expression of MLC-4(T17S18DE)::GFP leads to worm sterility .....................41 4.3.5 MLC-4(T17S18DE)::GFP localizes as wild-type protein .................................41 4.3.6 Embryos expressing MLC-4(T17S18DE)::GFP successfully complete cytokinesis .........................................................................................................................43 5. Discussion ...........................................................................................................45 5. 1 MLC-4 gradual depletion in one-cell C. elegans embryos results in cytokinesis slowdown, cytokinesis failure and worm sterility ...........................................................................45 5.2 Wild-Type MLC-4::GFP probe is functional ..........................................................46 5.3 Generation of strains expressing MLC-4(T17S18AA)::GFP and MLC4(T17S18DE)::GFP ...............................................................................................................47 5.4 MLC-4(T17S18AA)::GFP expression in one-cell C. elegans embryos leads to cytokinesis slow-down, cytokinesis failure, embryonic lethality and worm sterility ..................47 5.5 MLC-4(T17S18DE)::GFP expression in one-cell C. elegans embryos complete cytokinesis but are not viable .................................................................................................49 FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 6. Conclusions and Future Perspective ....................................................................51 7. References ..........................................................................................................52 FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 7 Hartshorne, 1985; Sellers et al., 1981; Trybus, 1989). Phosphorylation of MRLC can be performed by several kinases, including Rho kinase (ROCK), AMP-activated protein kinase (AMP kinase), Ca2+-calmodulin-dependent MLC kinase (MLCK) (Sandquist et al., 2008; Kamm and Stull, 2001; Lee et al., 2010), leucine zipper interacting kinase (ZIPK), myotonic dystrophy kinase-related CDC42-binding kinase, and MRCK (Wilkinson et al., 2005; Leal et al., 2003). Only MLCK seems to be MRLC-specific, the other kinases are known to act in different cellular targets (Heissler and Manstein, 2013). MRLC de-phosphorylation by myosin phosphatases has the inverse effect on NMII leading to decreased contractile activity (Piekny and Mains, 2002). Myosin phosphatase activity is itself regulated by a variety of kinases, including Rho kinase (Conti and Adelstein, 2008; Ito el al., 2004) that enhances NMII activation both by inhibiting myosin phosphatase activity and by phosphorylating the MRLC (Kimura et al., 1996; Zhao and Manser, 2005; Matsumura, 2005). The importance of MRLC phosphorylation on residues Threonine 17 and Serine 18, during cytokinesis is not clear. Phosphorylated Threonine 18 and Serine 19 has been detected in cytokinetic furrows of mammalian (DeBiasio et al., 1996; Matsumura et al., 1998; Asano et al., 2009) and D. melanogaster S2 cultured cells (Dean and Spudich, 2006). In S2 cells, expression of a non-phoshorylatable MRLC mutant where residues Threonine 20 and Serine 21 have been mutated to Alanines (correspond to C. elegans Threonine 17 and Serine 18) leads to cytokinesis failure and binucleated cells (Dean and Spudic, 2006). In HeLa cells, expression of nonphosphorylatable MRLC results in slower furrow ingression (Asano et al., 2009). Expression of di-phosphorylated MRLC in HeLa or S2 cells does not cause disruption in cytokinesis kinetics, indicating that cytokinesis occurs normally when NMII is active throughout (Dean and Spudic, 2006; Asano et al., 2009). D. discoideum cytokinesis is successful in the absence of MRLC (Zang et al., 1997; Uyeda et al., 1996) which suggest that fission yeast and D. discoideum use different mechanisms to regulate NMII bipolar formation (Ostrow et al., 1994; De la Roche et al.,2002;). In fact, it has been described that bipolar filament formation in D. discoideum is regulated by phosphorylation of NMII heavy chain (Bosgraaf and van Haastert, 2006). The relevance of heavy chain phosphorylation is however not clearly defined in mammalian cells. 1.3 Caenorhabditis elegans as biological model Caenorhabditis elegans is an excellent experimental model system that has become increasingly used for research in the field of genomics, cell biology, neuroscience and ageing. C. elegans is a small, free-living soil nematode and subsists by feeding on microbes, primarily bacteria. Its maintenance in the laboratory is straightforward and non-expensive, as it can be FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 8 grown on agar plates with E. coli as food source. Other advantages that justify its widespread use are its short life cycle (Figure 6), compact genome, stereotypical development and transparency. Figure 6 - Life cycle of C. elegans at 20 ºC. Time zero corresponds to fertilization. The time spent at each stage is shown in blue. First cell division happens 150 minutes after fertilization. One life cycle is completed in 3 days at 20 ºC. C. elegans mostly exists as a self-fertilizing hermaphrodite (XX) but can also exist as male (XO). Males arise rarely in the natural population (0.1%) by spontaneous non-disjunction of chromosome X in the hermaphrodite germ line. Through mating, due to competition between male sperm and hermaphrodite sperm a higher frequency of males (up to 50%) can be easily achieved. Genetic crosses using C. elegans are straightforward and produce a large number of progeny per adult. Self-fertilization of the hermaphrodite allows for homozygous individuals to generate genetically identical progeny and male mating facilitates the isolation and maintenance of mutant strains as well as moving mutations between strains. Strains can be kept as frozen stocks for long periods of time. C. elegans can switch to a facultative stage called dauer larva that can survive 4 to 8 times the normal 3-week life span (Cassada and Russell, 1975). Despite its simple anatomy, the animal is complex and displays a large range of behaviors including locomotion, foraging, feeding, defecation, egg laying, dauer larva formation, sensory responses to touch, smell, taste and temperature as well as some complex behaviors like male mating, social behavior, learning and memory (Rankin, 2002; de Bono, 2003). FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 9 The C. elegans genome has been completely sequenced and a comprehensive database including genes, phenotypes, mutants, and available strains exists. The C. elegans early embryo is an extremely powerful biological system to conduct quantitative live imaging assays due to the stereotypical embryonic cell divisions. This is of great importance for the study of cell division and more specifically cytokinesis. In contrast to cell cultures, cellular divisions occur within the context of a multicellular organism, which constitutes a strong advantage. Cultured cells divide while adhered to a substrate, which may impose artificial constraints on cytokinesis that do not reflect the situation encountered in the context of a tissue. Moreover, fluorescent versions of the protein of interest can be easily expressed in the embryo for fluorescent live imaging. 1.4 RNA interference RNA interference (RNAi), first discovered and characterized in C. elegans (Fire et al., 1998), constitutes an easy and quick way to study genes by reverse genetics. RNAi is particularly effective in C. elegans embryos because of the architecture of the oocyte-producing gonad. Double-stranded RNAs (dsRNA) can be conveniently administered by injection, feeding or soaking of worms. Introduction of dsRNA triggers the degradation of the corresponding mRNA in the gonad of the C. elegans, while the target protein already existing in the gonad is continually packed into oocytes (Figure 7). As a result, protein levels in newly fertilized embryos gradually decrease between 12 and 48 hours after RNA injection. Importantly, the rate of protein depletion is largely independent of the protein's intrinsic turnover properties, because even proteins with long half-lives are gradually diluted out from the gonad by being packaged into oocytes. This means that embryos gradually more depleted of a specific protein can be readily obtained and gradually more severe phenotypes can be characterized. FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 10 Figure 7 - RNA interference (RNAi) in C. elegans. Injection of dsRNA against the gene of interest triggers the degradation of the corresponding mRNA in the gonad. Protein levels in newly fertilized embryos gradually decrease between 12 and 48 hours after dsRNA injection. 1.5 Mos Single Copy Insertion MosSCI - Mos Single Copy Insertion - is a powerful gene manipulation technique that allows the rapid generation of worm strains expressing tagged transgenes at physiological levels. MosSCI allows transgene insertions in a specific chromosomal site in single copy, under the control of the endogenous promoter and 3’-untranslated regions (Figure 8). The worms are injected with a mix of plasmids, one of them carrying the coding sequence of the tagged transgene of interest and another carrying the coding sequence for a transposase. The transposase excises a Mos1 transposon located in a known and defined locus, generating a double strand break. The break is repaired by transferring the DNA from the extrachromosomal template that includes the transgene of interest into the chromosomal site. Positive integration events can be easily screened and final strains will stably express the transgene at endogenous levels in the female and male germline (Frøkjær-jensen et al., 2009). This method is of particular interest when phenotypic analysis of wild-type versus mutant versions of a protein are the basis of a study. FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 11 Figure 8 - Schematic representation of the MosSCI methodology. A mos1 transposon located in a defined locus can be excised by transposase expression resulting in a double-strand break in the chromosome. Presumably the 3′ ends from the left (l) and right (r) flanks invade and anneal to homologous regions in the extrachromosomal array carrying the tagged transgene of interest. The break can then be repaired by synthesis-dependent strand annealing. The positive selection marker unc-119(+) and the gene of interest are inserted into the genome by gene conversion. The extrachromosomal array contains a source of transposase (hsp::transposase) and two negative selection markers, twk-18(gf) and fluorescent mCherry markers. twk-18(gf) is a temperature-sensitive dominant mutation in a potassium channel, which paralyzes the animals at 25°c. mCherry markers are expressed in the pharynx, body muscle, and nervous system for visual identification of array-carrying animals. (Adapted from Frøkjær-jensen et al., 2009). FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 12 2. Objectives The aim of my work was to understand the role of MRLC phosphorylation during cytokinesis in the C. elegans embryo. It is known that MLC-4 (MRLC in C. elegans) is essential for cytokinesis (Shelton et al., 1999). However, the functional relevance of MLC-4 phosphorylation on the residues Threonine17 and Serine18 (corresponding to Threonine18 and Serine19 in vertebrates) during cytokinesis requires more thorough studies. To test the roles of Threonine 17 and Serine 18 phosphorylation of MLC-4 on cytokinesis in vivo, we will generate C. elegans strains expressing fluorescently tagged non-phosphorylatable Alanine 17 Alanine 18 or phosphomimetic Aspartate 17 Glutamate 18 MLC-4, using MosSCI. To enable functional analysis of the phospho-mutants in the absence of endogenous MLC-4, the transgenes will be engineered to be RNAi resistant. After depletion of endogenous MLC-4 by dsRNA injection, cytokinesis will be evaluated in the 1-cell embryo using quantitative live imaging assays. This study will be essential to enhance our understanding of NMII regulation/activation and bipolar filament formation during cytokinesis and will contribute to further elucidate the mechanics of contractile ring constriction. FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 13 3. Material and Methods 3.1. C. elegans maintenance 3.1.1 Worm maintenance C. elegans strains were grown on a monoxenic culture using E. coli OP50 strain as food source (Brenner, 1974). An initial culture of E. coli OP50 was obtained by streaking out some bacteria from a glycerol stock onto a LB agar plate [10 g/L Bacto-tryptone, 5 g/L Bacto-yeast, 5 g/L NaCl and 15 g/L agar, pH 7.5]. Bacteria colonies were left to grow overnight at 37ºC (Byerly et al., 1976). A single colony of OP50 was inoculated on LB liquid medium and grown overnight at 37 ºC. The bacterial suspension was used for seeding NGM plates. C. elegans strains were maintained on Nematode Growth Medium (NGM) agar (Brenner, 1974). Medium size plates (60 mm diameter) were used for general strain maintenance, and larger plates (100 mm diameter) were used for growing larger quantities of worms for freezing. NGM [3 g/L NaCl, 17 g/L agar and 2.5 g/L peptone] was sterilized by autoclaving at 110ºC for 30 minutes. After cooling 1M CaCl2, 5mg/ml cholesterol in ethanol, 100 mM MgSO4 and 100 mM KPO4 were added. Using sterile procedures, NGM solution was dispensed into plates using a peristaltic pump (Wheaton Science Products). This pump was adjusted in order to dispense a constant amount of NGM agar into each plate. Plates were left to dry at room temperature for 23 days before. Plates were then seeded with 0.05 ml of E. coli OP50 liquid culture for medium NGM plates or 0.1 ml for large NGM plates and left at room temperature for one day before storage. 3.1.1. General stock maintenance C. elegans stocks were maintained between 16°C and 25°C, most typically at 20°C. This variation in temperature periods was useful when planning experiments. Every plate had on the bottom the strain name identification and date. Occasionally, C. elegans stocks became contaminated and a standard alkaline bleach protocol was used to clean the worms up (Eisenmann, 2005). The bleach kills the contaminants and hermaphrodites but soaks onto the plate before the embryos hatch. The next day the larvae crawl onto the E. coli OP50 lawn and are transferred to a clean seeded NGM plate. FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 14 3.1.2. Freezing C. elegans stocks 15 young adults were picked onto each of two 10 cm plates seeded with OP50 and grown until the food lawn had just been depleted. At this point, plates should have plenty of L1s worms, which are best suited to withstand freezing. Plates were rinsed twice with 5mL S-Basal [100nM NaCl, 50mM K2HPO4 (pH 6.0), 5000 mg cholesterol] to loosen worms that were stuck to the agar and collected in a 15 mL conical tube. The worms were spun down for about 1 minute (speed?) in a clinical centrifuge, and washed twice with 15mL S-basal. After the second wash the supernatant was removed leaving 2.5mL S-basal and mixed with an equal amount of freezing medium [100mM NaCl, 50mM KH2PO4 (pH 6.0), 30 % (v/v) glycerol]. Worms were re-suspended and aliquoted in cryovials (1 mL of worm suspension per cryovial) and then stored at -80ºC in a Coolcell container to allow for gradual decrease of temperature. 3.2. Generation of C. elegans strains 3.2.1. Design and cloning of transgenes MLC4(T17S18AA)::GFP and MLC4(T17S18DE)::GFP mutant transgenes were made by mutating the desired residues in a vector carrying a fragment of mlc-4-GFP (8558 bp, Figure 11). Mutagenesis was carried out by using overlap extension PCR with appropriate primers as shown in figure 9 (Heckman, KL & Pease LR, 2007). Initial PCRs using primers a+c and b+d (Table 1) generated overlapping gene segments that were then used as template DNA for another PCR using primers a and d (Table 1). Internal primers b and c correspond to overlapping, complementary sequences and contain nucleotide substitutions. Overlapping strands of products AC, BD hybridize and are extended to generate the full-length product amplified by the flanking primers a and d. Primers a and d include restriction enzyme sites for inserting the final product into an expression vector for cloning purposes. FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 15 Figure 9 - Site-direct mutagenesis by overlap extension PCR method used to create mlc-4 mutant transgenes. Using mutagenic primers (b and c) and flanking primers (a and d), intermediate PCR products (AC and BD) were generated. These PCR products have overlapping fragments carrying the mutations that allow for the generation of the final PCR product (AD). As flanking primers had EcoNI and MluI restriction enzyme recognition sites it was possible to insert the final PCR product in the pUC57 intermediate vector. . FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 16 Table 1 - Primers and PCR conditions used on overlap extension PCR method. Primers a and d include enzymatic restriction sites that allow for the insertion of the final PCR product in pUC57. Primers b and c include mutations on threonine17 and serine18 aminoacids to generate MLC-4 T17S18AA::GFP and MLC-4 T17S18DE::GFP transgenes (b1+c1 and b2+c2, respectively). Phusion DNA polymerase was used. Forward primer sequence a 5’ccccctttccaaggcgacaaacgc 3’ Reverse primer sequence b1 3’gcgaatacgttggcggcagcgcgttgcgg5’ Reverse primer sequence b2 3’gcgaatacgttctcgtcagcgcgttgcgg5’ Forward primer sequence c1 5’ccgcaacgcgctgccgccaacgtattcgc 3’ Forward primer sequence c2 5’ccgcaacgcgctgacgagaacgtattcgc 3’ Reverse primer sequence d 3’ctttactcatctgcagacctccagcctcatccttg5’ PCR conditions Temperature Time 98 ºC 30 seconds 98 ºC 10 seconds ×30 cycles 58 ºC 20 seconds/kb 72 ºC 35 seconds 4 ºC hold In order to purify the mlc-4 amplified band from 1% agarose gel, the NucleoSpin kit (Macherey-Nagel) was used according to manufacturer’s instructions. Both MLC-4 mutant transgenes were first cloned into the intermediate vector pUC57 (Figure 10). FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 23 Figure 13 - Schematic representation of the mlc-4 transgene after correct insertion in the ttTi5605 locus on Chromosome II. Left and right homology regions flank the transgene. Integrated sequence includes the unc-119 gene that permits worm movement and the mlc-4 gene under the endogenous promoter and 3´UTR. The mlc4 coding sequence has a re-encoded region of 562 base pairs that although still coding for the same aminoacids, it is different from the corresponding sequence in the endogenous gene. Depletion of endogenous MLC-4 and not exogenous MLC-4 can be achieved with a dsRNA that targets only that region in the endogenous gene. In order to produce mlc-4 dsRNA, a 638 bp portion of the mlc-4 gene was amplified from C. elegans wild-type N2 genomic DNA using the primers and PCR conditions on Table 5. Table 5: Primers and PCR conditions used to amplify the template for mlc-4 dsRNA production. Phusion DNA polymerase was used. Forward primer sequence 5’ aattaaccctcactaaag gctcccgcaaaaccgtaaac 3’ Reverse primer sequence 3’ taatacgactcactatagg cttaatcggagcatctctaaag 5’ PCR conditions Temperature Time 98 ºC 30 seconds 98 ºC 10 seconds ×30 cycles 58 ºC 20 seconds/kb 72 ºC 35 seconds 4 ºC Hold FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 24 PCR template was purified with the NZYTech PCR clean-up kit eluted on 33 µL of DNA Elution Buffer and quantified with the Nanodrop. For T3 transcription reaction, the Ambion Megascript kit was used and for T7, the NEB T7 High Yield RNA Synthesis kit was used. The protocol described was the same for both kits (Table 6). Table 6: Reagents for transcription of DNA into RNA. Reagents mix 10 µL rNTP mix 2.5 µL 10 x T3 or T7 buffer 10 µL mlc-4 PCR DNA template (~ 1µg total) 2.5 µL T3 or T7 enzyme mix Transcription reactions were assembled at room temperature and components were added in the order on table 6 and incubated at 37 °C for 5 hours. To infer if transcription occurred correctly 1 µL of each reaction was run on a 1% agarose gel. Degradation of DNA template was done by adding 1 µL of DNase (from the Megascript kit) to each reaction and incubated at 37 °C for 15 minutes. The transcript was purified using the Megaclear kit and eluted in 33 µL. 1 µL of the T3 and T7 reactions were run on 1% agarose gel in RNAse free conditions. T3 RNA reaction, T7 RNA reaction and 3x Soaking Buffer (6.3mM NaCl, 14.1mM NH4Cl, 32.7mM Na2HPO4, 16.5 mM KH2PO4 ) were combined on a 1:1:1 ratio. The solution was incubated at 68 °C for 10 min and then at 37 °C for 30 minutes to anneal. The efficiency of annealing was tested by running 1 µL of the annealed sample on a 1% TAE agarose gel. dsRNA concentration was measured on Nanodrop FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 25 3.4. Embryonic Viability test The embryonic viability test was performed to check whether depletion of endogenous mlc-4 led to embryonic lethality. The test was followed as depicted in Figure 14. Figure 14 - Schematic representation of Embryonic Viability Test experiment. Single L4 stage worms injected or not with dsRNA against endogenous mlc-4 were sequentially transferred to fresh plates 25 hours and 38 hours post-injection. 48h hours post-injection, the mother was removed. The day after, all embryos that had been laid should have hatched if viable. Hatched larvae and dead embryos were counted. FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 26 3.5. Microscopy 3.5.1. Preparation of samples Gravid hermaphrodites were dissected and early embryos were mounted on 2% agarose pads and covered with 18 × 18 mm coverslips in M9 medium (Brenner, 1974). 3.5.2. RNImaging conditions Embryos were imaged at 20 °C using an epifluorescence microscope (Zeiss Axiobserver Z1) equipped with DIC optics, a 63× Plan-Apochromat lens (0.55 NA). Acquisition parameters, shutters, and focus were controlled by Zen software (Zeiss). Images of MLC-4::GFP were taken by acquiring five z-planes 1 µm apart, every 10 seconds through the centre of the embryo using an Orca 4.0 flash camera (Hamamatsu). Images of mCherry labeled histone H2B and DIC were taken by acquiring one z-plane every 10 seconds in the centre of the embryo. Exposure times were 50 miliseconds for both GFP and mCherry channels (554 nm and 625 nm LEDs (Colibri 2) used at 30% and 25% of the maximum power, respectively). 3.5.3. Imaging processing Microscopy images were processed and analysed with ImageJ software. To enable visual comparisons, the GFP signal of different images was scaled. Best focused z-plane per time point was chosen for figure display. Graphs were built with GraphPrism software. 3.6. Live-imaging assays 3.6.1. Measuring Timing for Contractile Ring Assembly Interval A is the time between anaphase onset and cortical shallow deformation at the equator of the cell. Interval B is the time between cortical shallow deformation and back-to-back membrane formation. Anaphase onset was the time at which the separation of the two chromosome masses was observed as judged by H2B-mCherry signal. Time of shallow deformation corresponded to the first frame where a deformation is observed at the equator of the cell as judged by the MLC4::GFP signal. Time of back-to-back membrane formation corresponded to the first frame where two juxtaposed plasma membranes were observed as judged by the MLC-4::GFP signal. FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 27 3.6.2. Measuring Contractile Ring rate The diameter of the contractile ring was measured in the section that showed a maximum distance between the two sides of the furrow at each time point. Individual traces of furrow diameter versus time were plotted and averaged. FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 28 4. Results 4.1. MLC-4 gradual depletion in one-cell C. elegans embryos results in cytokinesis slow-down, cytokinesis failure and worm sterility Myosin regulatory light chain (MLC-4 in C. elegans) was previously shown to be essential for cytokinesis in C. elegans embryos since depletion by RNAi resulted in cytokinesis failure and embryonic lethality (Shelton, 1999). To better understand the role of MLC-4 in cytokinesis, we used a strain expressing non-muscle myosin II heavy chain labelled with GFP (NMY-2::GFP) as a contractile ring reporter and the first embryonic division as model. Our lab has established assays to evaluate contractile ring performance at this cell stage (Figure 1): 1) evaluation of ring assembly by measuring interval A - from anaphase to shallow deformation of the membrane that corresponds to the mobilization of ring components to the cell equator, and interval B - from shallow deformation to back-to-back plasma membrane that corresponds to ring maturation and beginning of constriction; 2) evaluation of contractile ring constriction by measuring the distance between the two furrow tips as the ring gets smaller. Figure 1 - Schematic diagram illustrating contractile ring assembly and constriction phases during cytokinesis in the one-cell embryo. Contractile ring assembly was followed by measuring interval A - from anaphase onset to shallow deformation, and interval B - from shallow deformation to back-to-back plasma membrane; contractile ring constriction was evaluated by measuring the distance between the two furrow tips during ring closure. Arrows indicate in order: cortical shallow deformation, back-to-back plasma membrane configuration and accumulation of contractile ring proteins (red) at the tip of the furrow. To evaluate the best depletion level for our analysis, we did an RNAi time course experiment (introduction section 3.3) to gradually reduce MLC-4 levels in embryos and assess its effects in embryonic viability. Worms became sterile and stopped laying eggs 38 hours post dsRNA injection at 20oC. We reduced depletion levels by analyzing embryos laid between 25 and FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 29 38 hours post-injection. At this time frame, the worms were able to lay eggs but none of these were viable, when compared to non-injected control embryos that were 100% viable. We therefore chose to image one-cell embryos during this window of time. MLC-4 depleted embryos failed cytokinesis 25 hours post-injection whereas cytokinesis completed in non-depleted embryos (Figure 2, movie 1 in the middle). This severe phenotype did not allow us to determine the precise roles of MLC-4 during cytokinesis. We looked at earlier time points to reduce depletion levels and found that at 23 hours post-injection all embryos were still able to complete cytokinesis (Figure 2 and 3, movie 1 in the right). Figure 2 - Phenotypic characterization of embryos progressively depleted of MLC-4. Worms expressing NMY2::GFP were injected with dsRNA against mlc-4. One-cell embryos laid at different windows of time after dsRNA injection, were analyzed. At 23 hours post-injection, embryos divided slower. At 25 hours post-injection, embryos failed cytokinesis. At 38 hours post-injection, there were no more embryos to be analyzed because the worms had become sterile. We measured contractile ring assembly and constriction parameters from movies of injected and non-injected embryos at this time point. In control cells, interval A had an average value of 60s and was increased to 300s in MLC-4 depleted embryos. Similarly, interval B that averaged 40s in controls was increased almost four-fold to an average of 150s in depleted embryos (Figure 3B-C). These results indicate that the depletion of MLC-4 has a strong impact on the assembly of the contractile ring. Control embryos completed cytokinesis in approximately 240s after anaphase onset whereas MLC-4 depleted embryos took in average 650s to complete cytokinesis. Additionally, MLC-4 depleted embryos showed a clear slowdown at the last stages of constriction indicating possible abscission problems (Figure 3D-E). We calculated ring constriction rate by linear regression in the 25 µm to 15 µm diameter interval. The average rate of constriction was of 0.16 µm/s in control embryos and 0.09 µm/s in MLC-4 depleted embryos. Together these results suggest that MLC-4 partial depletion strongly delays cytokinesis by affecting both the assembly and constriction of the contractile ring. FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 30 Figure 3 - MLC-4 partial depletion leads to cytokinesis slow-down and failure. (A) Worms expressing NMY2::GFP were injected with dsRNA against mlc-4 and contractile ring assembly and constriction were followed in one-cell FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 31 embryos at 23-25h post-injection, time point at which the embryos were still able to complete cytokinesis. (B) Representative montages of the furrow region during contractile ring assembly for embryos expressing NMY2::GFP that had been depleted or not of MLC-4; red bar and orange bar represent interval A and interval B, respectively. Scale bar, 10s. (C) Contractile ring assembly was evaluated by measuring intervals A and B for embryos expressing NMY2::GFP in the presence (green) or absence of endogenous MLC-4 (purple). (D) Mean contractile ring diameter is plotted versus time for embryos expressing NMY2::GFP in the presence (green) or absence of MLC-4 (purple). Each curve represents the average of embryos (n=7). Time zero corresponds to anaphase onset. Mean of constriction rate (µm/s) is shown for each group (inset graph). (E) Representative montages of the furrow region during contractile ring constriction (blue bars) for embryos expressing NMY2::GFP in the presence or absence of MLC-4. Scale bar, 10s Error bars are 95% confidence intervals. FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 32 NMY-2 and MLC-4 are expected to co-localize throughout cytokinesis as they exist in a protein complex (introduction section 1.2). To investigate the localization relationship between NMY-2 and MLC-4 in the one-cell embryo during cytokinesis, imaging of embryos expressing transgenic NMY-2::GFP or MLC-4::GFP was performed. As shown in Figure 4, panels A and B, NMY-2::GFP localized in the cytoplasm and at the spindle at the time of anaphase onset (A1), at the equatorial cortical region during shallow deformation (A2), at the furrow (A3) and in the contractile ring (tip of the furrow, A4). When MLC-4 was partially depleted, the localization of NMY-2::GFP was similar (Figure 4B), but the signal intensity was weaker, the spindle signal persisted for longer and aggregates were visible in the cytoplasm (A1-A4 panels were compared with panels B1-B4; aggregates are shown in orange boxes As expected, MLC-4::GFP was found to localize identically to NMY-2::GFP in the presence (panels C1-C4) or absence (panels D1D4) of endogenous MLC-4. However, MLC-4::GFP signal intensity increased in embryos depleted for endogenous protein. Figure 4 – Localization of NMY-2::GFP and MLC-4::GFP in one-cell embryos during cytokinesis in the presence or absence of endogenous MLC-4. NMY-2::GFP localizes in the cytoplasm and mitotic spindle (A1,B1), accumulates on the cortical equatorial region (A2,B2), at the furrow (A3,B3), and in the contractile ring (A4,B4) in both control embryos (panels A) and MLC-4 depleted embryos (panels B). MLC-4 depleted embryos show however, reduced NMY2::GFP signal and protein aggregates (orange boxes with different scaling). MLC-4::GFP (panels C and D) localizes as NMY-2::GFP (panels A and B) when endogenous MLC-4 is present (C1-C4) or absent (D1-D4). Mlc-4 depleted embryos show however, increased levels of MLC-4::GFP. FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 39 Figure 7 – MLC-4(T17S18AA)::GFP leads to non-viable embryos and cytokinesis slow-down. (A) Embryonic viability in worms expressing wild-type MLC-4::GFP in the absence of endogenous MLC-4 (red) and nonphosphorylatable MLC-4(T17S18AA)::GFP in the presence (brown) and absence of endogenous MLC-4 at 25-38 hours post-injection. (B) Worms expressing MLC-4(T17S18AA)::GFP were injected with dsRNA against endogenous mlc-4 and contractile ring assembly and constriction was followed in one-cell embryos at 33-35 hours post-injection. (C) FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 40 Representative montages of the furrow region during contractile ring assembly in embryos expressing MLC4(T17S18AA)::GFP in the presence or absence of endogenous MLC-4,; red bar and orange bar represent intervals A and interval B, respectively. (D) Contractile ring assembly was evaluated by measuring intervals A and B in embryos expressing MLC-4::GFP in the absence of endogenous MLC-4 (red) and in worms expressing MLC-4(T17S18AA)::GFP in the presence (brown) or absence (black) of endogenous MLC-4. (E) Mean contractile ring diameter is plotted versus time for embryos expressing MLC-4::GFP in the absence of endogenous MLC-4 (red) and MLC-4(T17S18AA)::GFP in the presence (brown) or absence (black) of endogenous MLC-4. The red curve represents the average of n=10, the brown curve the average of n=10 and the black curve the average of n=8 embryos Time zero corresponds to anaphase onset. Mean of constriction rate is shown for the following groups: embryos expressing MLC-4::GFP in the absence (red) of endogenous MLC-4 at 46-48 hours post-injection, and embryos expressing MLC-4(T17S18AA)::GFP in the presence (brown) or absence (black) of endogenous MLC-4 at 33-35 hours post-injection (inset graph). (F) Representative montages of the furrow region during contractile ring constriction (blue bar) in embryos expressing MLC-4(T17S18AA)::GFP in the presence or absence of endogenous MLC-4. Scale bars, 10s. Error bars are 95% confidence interval of the mean. FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 41 4.3.4 Expression of MLC-4(T17S18DE)::GFP leads to worm sterility As explained in section 4.3, we did not succeed in generating an homozygous strain for the MLC-4(T17S18DE)::GFP transgene. The progeny of heterozygous worms was therefore looked at in more detail. All the embryos laid by heterozygous mothers were viable, which means that homozygous embryos expressing MLC-4(T17S18DE)::GFP can hatch. Some of the progeny grew to become normal looking adult worms - these should be heterozygous for MLC4(T17S18DE)::GFP. Some were incapable of moving - these should be wild-type worms that have not integrated the transgene and therefore have not integrated the unc-119 gene that allows the worms to move (see introduction Figure 6 for details). Some grew but were sterile - these should be the homozygous for MLC-4(T17S18DE)::GFP. When we depleted endogenous MLC-4, the situation was different. Until 38 hours post-injection, very few embryos were laid and none were viable. After 38 hours post-injection, no more embryos were laid because the worms became sterile. Although a more complete genotypic analysis will be necessary, our results indicate that 1) embryos homozygous for MLC-4(T17S18DE)::GFP are viable in the presence of endogenous MLC-4 but adults become sterile. In the absence of endogenous protein these embryos are nonviable; 2) embryos heterozygous for MLC-4(T17S18DE)::GFP are viable in the presence but nonviable in the absence of endogenous MLC-4; 3) wild-type embryos expressing MLC4(T17S18DE)::GFP due to the maternal loading are also viable in the presence but non-viable in the absence of endogenous MLC-4. 4.3.5 MLC-4(T17S18DE)::GFP localizes as wild-type protein The localization of MLC-4(T17S18DE)::GFP was next evaluated (Figure 8B). GFP positive embryos could be 1) heterozygous for MLC-4(T17S18DE)::GFP; 2) homozygous for MLC4(T17S18DE)::GFP, or 3) wild-type expressing MLC-4(T17S18DE)::GFP because of maternal loading. We do not have a straightforward way of distinguishing them. In all of them, MLC4(T17S18DE)::GFP localized as wild-type MLC-4::GFP (sections 4.2, Figure 5B and section 4.3.2, Figure 7B). However, in contrast to what happened in embryos expressing wild type MLC4::GFP or mutant MLC-4(T17S18AA)::GFP (Figure 5B, 7B), the fluorescent signal of MLC4(T17S18DE)::GFP did not always increase after depletion of endogenous MLC-4 (compare Figure 7B with Figure 8B). FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 42 Figure 8 – Embryos heterozygous and homozygous for MLC-4(T17S18DE)::GFP, and wild-type embryos expressing MLC-4(T17S18DE)::GFP due to maternal loading are non-viable and may present prolonged but successful cytokinesis when endogenous MLC-4 is depleted. (A) Embryonic viability in worms expressing wild-type MLC-4::GFP in the absence of endogenous MLC-4 (red) and phosphomimetic MLC4(T17S18DE)::GFP in the presence (grey) or absence of endogenous MLC-4. (B) Worms expressing MLC- FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 43 4(T17S18DE)::GFP were injected with dsRNA against mlc-4 and contractile ring assembly and constriction were followed in one-cell embryos at 27-33 hours post-injection. (C) Representative montages of the furrow region during contractile ring assembly in embryos expressing MLC-4(T17S18DE)::GFP in the presence or absence of endogenous MLC-4; red bar and orange bar represents interval A and interval B, respectively. (D) Contractile ring assembly was evaluated by measuring interval A and B in embryos expressing MLC-4::GFP in the absence of endogenous MLC-4 (red) and in worms expressing MLC-4(T17S18DE)::GFP in the presence (grey) or absence (dark green and yellow, group 1 and group 2 respectively) of endogenous MLC-4. (E) Contractile ring diameter plotted against time for embryos expressing MLC-4::GFP in the absence of endogenous MLC-4 (red) and MLC-4(T17S18DE)::GFP in the presence (grey) or absence (dark green and yellow, group 1 and group 2 respectively) of endogenous MLC-4. The red curve represents the average of n=10, the grey curve the average of n=10, the dark green curve the average of n=6 and the yellow the average of n=4 embryos. Time zero corresponds to anaphase onset. (F) Mean of constriction rate is shown for the following groups: embryos expressing MLC-4::GFP in the absence (red) of endogenous MLC-4 and embryos expressing MLC-4(T17S18DE)::GFP in the absence (dark green and yellow , group 1 and group 2, respectively) of endogenous MLC-4 (inset graph). (G) Representative montages of the furrow region during ring constriction (blue bar) in embryos expressing MLC-4(T17S18DE)::GFP in the presence or absence of endogenous MLC-4. Scale bars, 10 seconds. Error bars are 95% confidence interval of the mean. 4.3.6 Embryos expressing MLC-4(T17S18DE)::GFP successfully complete cytokinesis In order to understand how expression of the phosphomimetic mutant MLC4(T17S18DE)::GFP affects cytokinesis, 1-cell embryos for MLC-4(T17S18DE)::GFP were imaged undergoing first cell division. In the presence of endogenous MLC-4, all embryos expressing MLC4(T17S18DE)::GFP complete cytokinesis with normal kinetics: interval A, interval B and rate of constriction are as those in embryos expressing wild-type MLC4::GFP (Figure 8C-F, movie 4-left). Interestingly, embryos depleted of endogenous MLC-4 completed cytokinesis successfully. The number of embryos laid in these conditions was very low and therefore it became difficult to increase the number of imaged embryos. Nevertheless, quantitative analysis of intervals A, B and constriction rate revealed two distinct results. Out of ten embryos, six show normal kinetics (group 1, movie 4-middle). The remaining four embryos showed a prolonged cytokinesis (group 2, movie 4-right). Interval A was twice as long as in controls. Interval B was also longer (70s compared to 40s). The time required for contractile ring constriction was much extended (cytokinesis was only achieved 450s after anaphase onset); and constriction rate was slow (0.12 µm/s compared to 0.16 µm/s). Curiously, these four embryos also showed prolonged final stages of constriction, indicating that they might have problems during abscission. The two types of behaviour obtained should reflect the different genotypes of embryos expressing the mutant MLC-4(T17S18DE)::GFP (homozygous or heterozygous embryos expressing for the MLC-4(T17S18DE)::GFP and wild- FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 44 type homozygous that expressed the phosphomimetic protein due to maternal loading. We have not been able to associate a specific phenotype to a genotype. FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 45 5. Discussion The study of cytokinesis is a field with increasing importance, since evidence has accumulated over the last decades that cytokinesis failure can lead to several diseases, including cancer. Despite the increasing interest, cytokinesis still remains less understood than other stages of the cell cycle. In the present study, we examined how cytokinesis can be regulated by phosphorylation of the myosin regulatory light chain, an essential interacting partner of nonmuscle myosin II - the motor that helps driving cytokinesis. Our experimental system was the C. elegans early embryo, which has been validated as a great system to quantitatively study cytokinesis in vivo. 5. 1 MLC-4 gradual depletion in one-cell C. elegans embryos results in cytokinesis slow-down, cytokinesis failure and worm sterility NMII is a motor protein capable of generating force and translocating actin filaments. In C. elegans, NMII plays essential roles in multiple cellular and developmental processes starting from cytokinesis in the early embryo, to embryo elongation and later in the development of the gonad (Matsmura, 2005). NMII's critical contribution to cytokinesis has been proved by a variety of approaches, in a variety of systems (Matsmura, 2005). The MRLC is one of the main regulators of the motor activity of NMII, as it binds to NMII's lever arm and when phosphorylated on the residues Threonine17 and Serine18 leads to the unfolding of the molecule, making it competent to establish interactions with other NMII molecules and consequently form bipolar filaments, which are essential for actomyosin contractility (VicenteManzanares, 2009). MLC-4, a MRLC in C. elegans has been described as essential for cytokinesis (Shelton et al., 1999). We confirmed this result by depleting endogenous MLC-4 in 1-cell embryos expressing NMY2::GFP. Embryos fully depleted of MLC-4 did not assemble a contractile ring, and therefore multinucleated cells were generated. We were interested in understanding the contribution of MLC-4 to cytokinesis and for that we performed an RNAi time course experiment. Embryos partially depleted of MLC-4 were able to complete cytokinesis but took longer time than controls to do so. Intervals A and B were prolonged and constriction rate was lower than in controls, which indicates that MLC-4 contributes to both contractile ring assembly and constriction. In partial depletions, there is a reduced amount of endogenous protein MLC-4 available for the activation of NMII molecules, which supposedly results in a decreased number of bipolar filaments. Given FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 46 that NMII filaments are thought to contribute to generate the force that drives contractile ring constriction, a lower number of filaments should result in a slower cytokinesis. In agreement with this, we observed that NMY-2::GFP signal in the equatorial cortex during assembly of the ring and in the contractile ring during constriction was dimmer in MLC-4 partially depleted embryos than in control cells. The observation of NMY-2 aggregates in the cytoplasm might correspond to the extra NMII molecules that did not bind MLC-4. Indeed, biochemical studies have shown that an NMII mutant lacking the regulatory light chain binding site tends to aggregate in vitro (Trybus et al., 1991) and NMII aggregates have been observed in D. melanogaster oocytes and S. pombe upon MRLC deletion (Jordan and Karess, 1997). MLC-4 partially depleted embryos were able to complete their first cell division but were unable to hatch, which means that something went wrong further along during embryonic development. Indeed, it has been shown that MLC-4 is required for embryonic elongation (Gally et al., 2009). 5.2 Wild-Type MLC-4::GFP probe is functional In order to study the role of MLC-4 phosphorylation during cytokinesis, we generated a transgenic C. elegans strain expressing MLC-4 transgene tagged with a GFP probe using the MosSCI technique. The worms obtained expressed both endogenous MLC-4 from chromosome III and transgenic MLC-4 tagged with GFP from the chromosome II Mos-1 locus. To analyse if the transgene was able to functionally replace the endogenous protein, we evaluated embryonic viability of the wild-type MLC-4::GFP strain upon depletion of endogenous MLC-4. Our results showed that MLC-4::GFP transgene is able to rescue embryonic viability. During cytokinesis MLC-4::GFP also performed as well as endogenous MLC-4. All the parameters analyzed for contractile ring assembly and constriction were similar in embryos expressing both endogenous and exogenous MLC-4 and embryos just expressing exogenous MLC-4. MLC-4::GFP localized very similarly to NMY-2::GFP in dividing 1-cell embryos: in the mitotic spindle, cortical equatorial region, furrow tip and mature contractile ring. This localization seems to be conserved among organisms as it has also been observed in D. melanogaster S2 celIs, H. pulcherrimus eggs and HeLa cells (Shelton et al., 1999; Dean and Spudich, 2006; Uehara et al., 2008; Asano et al., 2009). In the absence of endogenous MLC-4, the MLC4::GFP signal intensity increased. This indicates that when the endogenous protein is present, its expression is preferred but upon its depletion the expression of MLC::GFP is forced. Based on all our results, we can conclude that the MLC-4::GFP probe we generated is fully functional as it performs identically to endogenous MLC-4, as far as we can assess. The FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 47 careful characterization of the strain expressing wild-type MLC-4::GFP was very important because this was used as term of comparison for the strains expressing MLC-4 phospho-mutants. 5.3 Generation of strains expressing MLC-4(T17S18AA)::GFP and MLC-4(T17S18DE)::GFP Multiple reports (Vicente-Manzanares et al., 2009) strongly suggest that the regulation of MRLC by phosphorylation on the residues Threonine17 and Serine18 is a key step for NMII regulation in vitro. However, its importance during cytokinesis in vivo is controversial. It seems to be crucial in D. melanogaster S2 cells, H. pulcherrimus eggs and HeLa cells but less important in S. pombe and unnecessary in D. discoideum (Ostrow et al., 1994; De la Roche et al., 2002; Lord and Pollard, 2004; Dean and Spudich, 2006; Uehara et al., 2008; Asano et al., 2009; Sladewski et al., 2009). We decided to test the relevance of the above-mentioned phosphorylation during cytokinesis in our system where we can be sure that the phospho-mutants will be expressed at endogenous levels and we can accurately quantify several cytokinesis parameters. In fact, some of the prior studies conducted in other organisms involved over-expressed MLC-4 phosphomutants, which complicates result interpretation (Uehara et al., 2008; Asano et al., 2009; Sladewski et al., 2009). Threonine17 and Serine 18 have been conserved evolutionarily and these residues are readily identified in all MRLCs we looked at. Similar to what we did for MLC-4::GFP, we aimed to generate worm strains expressing a non-phosphorylatable version (MLC-4::T17S18AA), in which aminoacids 17 and 18 cannot be phosphorylated at any point of the cell cycle, and, a phosphomimetic version (MLC-4::T17S18DE) that mimics a continuous phosphorylation on 17 and 18 residues. We succeeded in generating a strain homozygous for MLC-4::T17S18AA and a strain heterozygous for MLC-4::T17S18DE. Both transgenes were engineered to be RNAi resistant, just like wild-type MLC-4::GFP. 5.4 MLC-4(T17S18AA)::GFP expression in one-cell C. elegans embryos leads to cytokinesis slow-down, cytokinesis failure, embryonic lethality and worm sterility Given the assumed importance of the phosphorylation of MRLC on NMII activation and consequent bipolar filament formation and contractility, we expected embryos expressing MLC- FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 48 4(T17S18AA)::GFP to fail cytokinesis. We assessed cytokinesis phenotypes in 1-cell embryos expressing MLC-4(T17S18AA)::GFP in the presence or absence of endogenous MLC-4. In the presence of endogenous MLC-4, embryos expressing MLC-4(T17S18AA)::GFP had no problems in progressing through cytokinesis and were all viable. MLC-4(T17S18AA)::GFP localized as wild-type MLC-4::GFP, indicating that T17S18 phosphorylation is not necessary for MLC-4 recruitment to the contractile ring. In the absence of endogenous MLC-4, embryos expressing MLC-4(T17S18AA)::GFP were not viable. This was expected because it has previously been shown that expression of such a mutant does not allow for embryonic elongation (Gally et al., 2009). 38 hours after injection of dsRNA against endogenous mlc-4, worms were sterile. 35 hours post-injection, all embryos failed cytokinesis. Cytokinesis failure also occurs when the equivalent non-phoshorylatable MRLC mutant is expressed in D. melanogaster S2 cells and S. pombe. In both cells, only a fraction of cells were incapable of completing cytokinesis (Dean and Spudich, 2006; Sladewski et al.,2009). Curiously, HeLa cells depleted of MRLC do not fail cytokinesis (Asano et al., 2009). The results of these studies are difficult to compare with ours for several reasons: 1) In S2 cells when the equivalent non-phoshorylatable MRLC mutant is expressed cytokinesis fails 25% of cases but also when the endogenous MRLC is depleted in wild-type cells. The level of endogenous MRLC expressed was around 5% (Dean and Spudich, 2006). In this study, the endogenous MRLC still present in low levels which can be enough to enable a fraction of successful cytokinesis. 2) In S. pombe and HeLa cells (Dean and Spudich, 2006; Sladewski et al.,2009), the transgenes are over expressed in presence of endogenous MRLC, which might not reflect the action of phospho-mutants. 33 hours post-injection, when more endogenous MRLC is available, embryos expressing MLC-4(T17S18AA)::GFP completed cytokinesis but this took longer than in controls. Cytokinesis slow-down has also been observed in previous studies in different experimental model systems (Dean and Spudich., 2006; Sladewski et al.,2009; Asano et al., 2009). However, the prolonged phase of contractile ring assembly was not observed in HeLa cells (Asano et al., 2009). This phenotypic evolution looks similar to that observed when endogenous MLC-4 was depleted in embryos expressing NMY-2::GFP. However, when we look at time scales, it became apparent that embryos that express MLC4(T17S18AA)::GFP start failing cytokinesis at a later time point when less endogenous MLC-4 is present. 33 hours post-injection of mlc-4 dsRNA, all embryos not expressing MLC4(T17S18AA)::GFP failed cytokinesis, while embryos expressing MLC-4(T17S18AA)::GFP did not. These results indicate that to some extent, expression of MLC-4(T17S18AA)::GFP is able to compensate for the reduction of endogenous MLC-4 levels, similar to what has been previously described in S. pombe (Le Goff et al., 2000; Naqvi et al., 2000). Unexpectedly, we showed that FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 55 Ma, X., Kovacs, M., Conti, M.A., Wang, A., Zhang, Y., et al. (2012). Nonmuscle myosin II exerts tension but does not translocate actin in vertebrate cytokinesis. Proc. Natl. Acad. Sci. USA 109, 4509–14. Mabuchi, I., and Okuno, M. (1977). The effect of myosin antibody on the division of starfish blastomeres. J. Cell Biol. 74, 251–263. Mabuchi, I., Tsukita, S., Tsukita, S., and Sawai, T. (1988). Cleavage furrow isolated from newt eggs: contraction, organization of the actin filaments, and proteincomponents of the furrow. Proc. Natl. Acad. Sci. U.S.A. 85, 5966–5970. Matsumura, F. (2005). Regulation of myosin II during cytokinesis in higher eukaryotes. Trends Cell Biol. 15, 371–377. Matsumura, F., Ono, S., Yamakita, Y., Totsukawa, G., and Yamashiro, S. (1998). Specific localization of serine 19 phosphorylated myosin II during cell locomotion and mitosis of cultured cells. J. Cell Biol. 140, 119–129. Maupin P. and Pollard T. (1986). Arrangement of actin filaments and myosinlike filaments in the contractile ring and of actin-like filaments in the mitotic spindle of dividing HeLa cells. J. Ultrastruct. Mol. Struct. Res. 94, 92–103. Naqvi, N. I., Wong, K. C., Tang, X., and Balasubramanian, M. K. (2000). Type II myosin regulatory light chain relieves auto-inhibition of myosin-heavychain function. Nat. Cell Biol. 2, 855–858. Ostrow, B.D., Chen, P., and Biology, S. (1994). Expression of a Myosin Regulatory Light Chain Phosphorylation Site Mutant Complements the Cytokinesis and Developmental Defects of. J. Cell Biol. 127, 1945–1955. Piekny, A.J., and Mains, P.E. (2002). Rho-binding kinase (LET-502) and myosin phosphatase (MEL-11) regulate cytokinesis in the early Caenorhabditis elegans embryo. J. Cell Sci. 115, 2271–2282. Pollard, T.D., and Wu, J.-Q. (2010). Understanding cytokinesis: lessons from fission yeast. Nat Rev Mol Cell Biol 11, 149–155. Rankin, C.H. (2002). From gene to identified neuron to behaviour in Caenorhabditis elegans. Nat Rev Genet 3, 622–630. Sagona, A.P., and Stenmark, H. (2010). Cytokinesis and cancer. FEBS Lett. 584, 2652–2661. FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 56 Sandquist, J.C., and Means, A.R. (2008). The C-terminal tail region of nonmuscle myosin II directs isoform-specific distribution in migrating cells. Mol. Biol. Cell 19, 5156–5167. Schroeder, T.E. (1968). Cytokinesis: filaments in the cleavage furrow. Exp. Cell Res. 53, 272–276. Schroeder, T.E. (1970). The contractile ring. I. Fine structure of dividing mammalian (HeLa) cells and the effects of cytochalasin B. Z. Zellforsch Mikrosk. Anat. 109, 431–449 Schroeder, T.E. (1972). The contractile ring II. Determining its Brief Existence, Volumetric Changes, and Vital Role. J. Cell Biol 53, 419-439. Schroeder, T.E. (1975). Dynamics of the contractile ring. Soc. Gen. Physiol. Ser. 30, 305–334. Sellers, J.R., Pato, M.D., and Adelstein, R.S. (1981). Reversible phosphorylation of smooth muscle myosin, heavy meromyosin, and platelet myosin. J. Biol. Chem. 256 , 13137–13142. Selman, G.G., and Perry, M.M. (1970). Ultrastructural changes in the surface layers of the newt’s egg in relation to the mechanism of its cleavage. J. Cell Sci. 6, 207–227. Shelton, C.A., Carter, J.C., Ellis, G.C., and Bowerman, B. (1999). The Nonmuscle Myosin Regulatory Light Chain Gene mlc-4 is Required. J. Cell Biol. 146, 439–451. Sladewski, T.E., Previs, M.J., and Lord, M. (2009). Regulation of fission yeast myosin-II function and contractile ring dynamics by regulatory light-chain and heavy-chain phosphorylation. Mol. Biol. Cell 20, 3941–3952. Stiernagle, T. Maintenance of C. elegans (February 11, 2006), WormBook, ed. The C. elegans Research Community, WormBook, doi/10.1895/wormbook.1.101.1, http://www.wormbook.org Trybus, K.M. (1989). Filamentous smooth muscle myosin is regulated by phosphorylation. J. Cell Biol. 109, 2887–2894. Tucker, J.B. (1971). Microtubules and a contractile ring of microfilaments associated with a cleavage furrow. J. Cell Sci. 8, 557–571. Uehara, R., Hosoya, H., and Mabuchi, I. (2008). In vivo phosphorylation of regulatory light chain of myosin II in sea urchin eggs and its role in controlling myosin localization and function during cytokinesis. Cell Motil. Cytoskeleton 65, 100–115. FCUPIBMC Phospho-regulation of myosin light chain in C. elegans embryos during cytokinesis 57 Uyeda, T.Q., Abramson, P.D., and Spudich, J.A. (1996). The neck region of the myosin motor domain acts as a lever arm to generate movement. Proc. Natl. Acad. Sci. U. S. A. 93, 4459–4464. Uyeda, T.Q., and Spudich, J.A. (1993). A functional recombinant myosin II lacking a regulatory light chainbinding site. Science. 262, 1867–1870. Vicente-Manzanares, M., Ma, X., Adelstein, R.S., and Horwitz, A.R. (2009). Non-muscle myosin II takes centre stage in cell adhesion and migration. Nat. Rev. Mol. Cell Biol. 10, 778–790. Wendt, T., Taylor, D., Trybus, K.M., and Taylor, K. (2001). Three-dimensional image reconstruction of dephosphorylated smooth muscle heavy meromyosin reveals asymmetry in the interaction between myosin heads and placement of subfragment 2. Proc. Natl. Acad. Sci. 98, 4361–4366. Wilkinson, S., Paterson, H.F., and Marshall, C.J. (2005). Cdc42-MRCK and Rho-ROCK signalling cooperate in myosin phosphorylation and cell invasion. Nat Cell Biol 7, 255–261. Woodhead, J.L., Zhao, F.-Q., Craig, R., Egelman, E.H., Alamo, L., and Padron, R. (2005). Atomic model of a myosin filament in the relaxed state. Nature 436, 1195–1199. Young, P.E., Richman, A.M., Ketchum, A.S., and Kiehart, D.P. (1993). Morphogenesis in Drosophila requires nonmuscle myosin heavy chain function. Genes Dev. 7, 29–41. Zang, J.H., Cavet, G., Sabry, J.H., Wagner, P., Moores, S.L., Spudich, J.A. (1997). On the role of myosin-II in cytokinesis: division of Dictyostelium cells under adhesive and nonadhesive conditions. Mol. Biol. Cell. 8, 2617–29 Zarkower, D. Somatic sex determination (February 10, 2006), WormBook, ed. The C. elegans Research Community, WormBook, doi/10.1895/wormbook.1.84.1, http://www.wormbook.org Zhang, P., McGlynn, A.C., West, C.M., Loomis, W.F., and Blanton, R.L. (2001). Spore coat formation and timely sporulation depend on cellulose in Dictyostelium. Differentiation 67, 72–79. Zhao, Z., and Manser, E. (2005). PAK and other Rho-associated kinases--effectors with surprisingly diverse mechanisms of regulation. . Biochem. J. 386, 201–214.