scieee Science in your language
[en] (orig)

High-pressure processing (HPP) of raw and dry-cured ham from experimentally infected pigs as a potential tool for the risk control of Toxoplasma gondii

Abstract

Raw and dry-cured meats have been identified as a potential source of Toxoplasma gondii infection for humans. The present study evaluated the efficacy of an alternative non-thermal food-processing treatment, high hydrostatic pressure, on the viability of T. gondii bradyzoites in raw and dry-cured ham. Meat of pigs experimentally exposed to 4000 oocysts of T. gondii VEG strain was vacuum-packaged and subjected to high pressure processing (HPP). Tap water (6 °C ± 1 °C) was used as the pressure-transmitting fluid, and its temperature during HPP increased 2.7 °C per 100 MPa. The effect was evaluated by bioassay in mice followed by qPCR. In raw ham, 100–400 MPa/1 min did not inactivate T. gondii, whereas 600 MPa/20 min was effective. In dry-cured ham, 600 MPa for 3 or 10 min were not effective and a 20-min treatment was required to render the bradyzoites non-infectious for mice. Our results point toward the potential use of HPP as a tool for risk control of T. gondii and as a food safety guarantee. Industrial relevance text: Under real production conditions, the usual HPP treatments applied by the food industry to control L. monocytogenes and other pathogenic bacteria are 600 MPa of pressure and holding times of 3–10 min. Our study demonstrated, however, that longer treatment times are required to inactivate the parasite and, thus, to guarantee the safety of raw and dry-cured meats in order to reduce the public health risk of toxoplasmosis. Further research is needed to evaluate other HPP conditions, including pulsed cycles, for the inactivation of T. gondii in foods of animal origin. Gracia, María Jesús; Lázaro, Regina; Pérez-Arquillué, Consuelo; Pagán, Rafael; Ramos, Sergio; Garcia, J. Luis; Bayarri, Susana

Read accessible full text

High-pressure processing (HPP) of raw and dry-cured ham from experimentally infected pigs as a potential tool for the risk control of Toxoplasma gondii

Author: Gracia, María Jesús; Lázaro, Regina; Ramos, Sergio; Pagán, Rafael; Bayarri, Susana; Garcia, J. Luis; Pérez-Arquillué, Consuelo
Year: 2020
DOI: 10.1016/j.ifset.2020.102315
Source: https://zaguan.unizar.es/record/99094/files/texto_completo.pdf
Jou nal P e-p oo
High-p essu e p ocessing (HPP) o aw and d y-cu ed ham om
expe imen ally in ec ed pigs as a po en ial ool o he isk con ol
o Toxoplasma gondii
Ma ía Jesús G acia, Regina Láza o, Consuelo Pé ez-A quillué,
Ra ael Pagán, Se gio Ramos, João Luis Ga cia, Susana Baya i
PII: S1466-8564(19)31241-X
DOI: h ps://doi.o g/10.1016/j.i se .2020.102315
Re e ence: INNFOO 102315
To appea in: Inno a i e Food Science and Eme ging Technologies
Recei ed da e: 30 Sep embe 2019
Re ised da e: 5 Feb ua y 2020
Accep ed da e: 13 Feb ua y 2020
Please ci e his a icle as: M.J. G acia, R. Láza o, C. Pé ez-A quillué, e al., High-p essu e
p ocessing (HPP) o aw and d y-cu ed ham om expe imen ally in ec ed pigs as a
po en ial ool o he isk con ol o Toxoplasma gondii, Inno a i e Food Science and
Eme ging Technologies(2020), h ps://doi.o g/10.1016/j.i se .2020.102315
This is a PDF ile o an a icle ha has unde gone enhancemen s a e accep ance, such
as he addi ion o a co e page and me ada a, and o ma ing o eadabili y, bu i is
no ye he de ini i e e sion o eco d. This e sion will unde go addi ional copyedi ing,
ypese ing and e iew be o e i is published in i s inal o m, bu we a e p o iding his
e sion o gi e ea ly isibili y o he a icle. Please no e ha , du ing he p oduc ion
p ocess, e o s may be disco e ed which could a ec he con en , and all legal disclaime s
ha apply o he jou nal pe ain.
© 2020 Published by Else ie .
Jou nal P e-p oo
TITLE:
High-P essu e P ocessing (HPP) o aw and d y-cu ed ham om expe imen ally
in ec ed pigs as a po en ial ool o he isk con ol o Toxoplasma gondii
Au ho names: Ma ía Jesús G acia, Regina Láza oa, Consuelo Pé ez-A quilluéa, Ra ael
Pagána, Se gio Ramosb, João Luis Ga ciac and Susana Baya ia*
A ilia ion:
a Ins i u o Ag oalimen a io de A agón - IA2 (Uni e sidad de Za agoza - CITA),
Ve e ina y Facul y, 50013 Za agoza (Spain)
b Cen o Nacional de Tecnología & Segu idad Alimen a ia CNTA, 31570 Na a a
(Spain)
c P o ozoology labo a o y, Depa amen o de Medicina Ve e iná ia P e en i a,
Uni e sidade Es adual de Lond ina - UEL, Pos al Box 6001, 86050-970 Lond ina, PR,
(B azil)
*Co esponding au ho : D a. Susana Baya i
Add ess: Dp o. P oducción Animal y Ciencia de los Alimen os. Facul ad de
Ve e ina ia. Uni e sidad de Za agoza. C/ Miguel Se e 177, 50013, Za agoza, Spain.
Phone numbe : +34-976-764135
Fax. numbe : +34-976-761612
E-mail: [email p o ec ed]
Abs ac
Raw and d y-cu ed mea s ha e been iden i ied as a po en ial sou ce o Toxoplasma
gondii in ec ion o humans. The p esen s udy e alua ed he e icacy o an al e na i e
non- he mal ood-p ocessing ea men , high hyd os a ic p essu e, on he iabili y o T.
gondii b adyzoi es in aw and d y-cu ed ham. Mea o pigs expe imen ally exposed o
4,000 oocys s o T. gondii VEG s ain was acuum-packaged and subjec ed o high
p essu e p ocessing (HPP). Tap wa e (6ºC±1ºC) was used as he p essu e- ansmi ing
luid, and i s empe a u e du ing HPP inc eased 2.7ºC pe 100 MPa. The e ec was
Jou nal P e-p oo
Jou nal P e-p oo
e alua ed by bioassay in mice ollowed by qPCR. In aw ham, 100-400 MPa/1 min did
no inac i a e T. gondii, whe eas 600 MPa/20 min was e ec i e. In d y-cu ed ham, 600
MPa o 3 o 10 min we e no e ec i e and a 20-min ea men was equi ed o ende
he b adyzoi es non-in ec ious o mice. Ou esul s poin owa d he po en ial use o
HPP as a ool o isk con ol o T. gondii and as a ood sa e y gua an ee.
Key wo ds: Toxoplasma gondii; High-hyd os a ic p essu e p ocessing; HPP; Po k
mea ; D y-cu ed ham.
1. In oduc ion
Toxoplasma gondii is a ood-bo ne pa asi e ha causes human and animal
oxoplasmosis. Human oxoplasmosis can be li e- h ea ening in immunocomp omised
subjec s. In addi ion, ansplacen al ansmission du ing p ima y in ec ion in p egnancy
can esul in blindness, congeni al de ec s, men al e a da ion, o e en e al dea h
(Robe -Gangneux, Aube , & Villena, 2015). Fu he mo e, T. gondii in ec ion has been
implica ed in di e en o ms o beha iou al al e a ion and neu ological diso de s in
humans, sugges ing ha he in ec ion is po en ially mo e se ious han p e iously
supposed (Webs e , Kaushik, B is ow, Glenn, & McConkey, 2013).
The main ou e o T. gondii ansmission is ia consump ion o ood and wa e
con amina ed wi h spo ula ed oocys s, o mea con aining issue cys s. Inges ion o
unde cooked o cu ed mea con aining iable cys s has been sugges ed o be a majo
sou ce o T. gondii in ec ion (Bu olano e al., 1996; Cook e al., 2000; Jiang e al.,
2018; Kappe ud e al., 1996; Thalle , Tamma o, & Pen imalli, 2011).
D y-cu ed ham is a eady- o-ea p oduc (RTE) widely consumed in he Medi e anean
a ea. I is a nonsmoked po k mea p oduc cu ed wi h sal and ni i es, and s abilized
h ough dec eased aw. The en i e p ocess akes a leas 7 mon hs, al hough in some cases
he hams may be aged o mo e han 1 yea . Cu ing has adi ionally been ega ded as
an e ec i e echnology agains T. gondii (Genchi e al., 2017; F anssen e al., 2019).
Se e al s udies ha e poin ed ou ; howe e , ha cu ing may no be enough o inac i a e
T. gondii b adyzoi e cys s (Gómez-Samblás, Vilchez, Race o, Fuen es, & Osuna, 2015;
He e o e al., 2017; Wa nekulasu iya, Johnson, & Holliman, 1998).
Addi ional ea men o mea o elimina e iable T. gondii issue cys s would p o ide a
means o p o ec consume s. Ce ain ood-p ocessing echniques, such as hea ea men ,
eezing, high hyd os a ic p essu e p ocessing (HPP), and i adia ion ha e pa asi e-
inac i a ing po en ial (F anssen e al., 2019).
HPP is a echnology ha is ecei ing a g ea deal o a en ion wo ldwide. Fo he mea
sec o , HPP o e s a aluable al e na i e o he mal pas eu iza ion. Th ee main easons
make he HPP echnology bene icial o mea p oduc s: he inac i a ion o pa hogens
such as Lis e ia monocy ogenes o Salmonella, which allows he expo o mea
p oduc s o coun ies ha equi e he absence o L. monocy ogenes; an inc ease in shel -
Jou nal P e-p oo
Jou nal P e-p oo
li e by inac i a ing spoilage mic oo ganisms; and he p ese a ion o nu i ional quali y
o aw and d y-cu ed mea wi hou hea ea men (Bajo ic, Boluma , & Heinz, 2012;
Hayman, Bax e , O’Rio dan, & S ewa , 2004; Jo é, Ayme ich, G èbol, & Ga iga,
2009; Rendueles e al., 2011).
The e ec i eness o HPP ea men depends p ima ily on he applied p essu e and on
holding ime. To pas eu ize mea and mea p oduc s, p essu e le els o 400-600 MPa
and holding imes o 3-10 min a e applied a low empe a u es, o 6-12ºC. In mos
cases, hese ea men s ha e led o an inac i a ion o mo e han ou log uni s o he
mos common ege a i e pa hogenic and spoilage mic oo ganisms, esul ing in
imp o ed sa e y and inc eased shel -li e (Bajo ic e al., 2012; Hugas e al., 2002;
Hyg ee a & Pandey, 2016; Rendueles e al., 2011). Al hough i is well known ha he
esis ance o mic oo ganisms is highly a iable, depending on he ype o o ganism and
he ood ma ix in ol ed (Rendueles e al., 2011), scan in o ma ion is a ailable on he
subjec o pa asi es in di e en ood p oduc s, pa icula ly in d y-cu ed ham.
S udies on he e ec i eness o HPP in elimina ing oodbo ne pa asi es ha e shown he
sensi i i y o T. gondii (Lindsay, Collins, Jo dan, Flick, & Dubey, 2005; Lindsay,
Collins, Holliman, Flick, & Dubey, 2006; Lindsay e al., 2008), C yp ospo idium
pa um (Collins e al., 2005), Anisakis la ae (B u i e al., 2010; Molina-Ga cía &
Sanz, 2002), T ichinella spi alis (Noeckle , Heinz, Lemkau, & Kno , 2001), Asca is
(Rosypal, Bowman, Holliman, Flick, & Lindsay, 2007), and T ichu is ulpis (Rosypal,
Zajac, Flick, Bowmand, & Lindsay, 2011) in low p essu e anges (100-400 MPa).
HPP could he e o e be an app op ia e ool o educing he isk o T. gondii. Al hough
p e ious s udies ha e indeed e alua ed he e ec o HPP on oocys s o T. gondii
(Lindsay e al., 2005, 2008), li le has been published on he e ec s o HPP on issues
in ec ed wi h T. gondii. Rega ding aw mea , only he s udy conduc ed by Lindsay e al.
(2006) has shown ha T. gondii issue cys s in g ound po k ha e been success ully
inac i a ed by applying 300-400 MPa o 30 s, whe eas 100 and 200 MPa ha e been
ine ec i e. The issues, howe e , did no come om in ec ed animals (na u ally o
expe imen ally), bu had been in en ionally spiked wi h pa asi es.
The p ope ies o he ood ma ix ha e been shown o ha e a g ea in luence on he
le hali y o HPP. D y-cu ed ham, a sal ed and d ied p oduc wi h low aw, has shown
lowe inac i a ion le els o some pa hogens (Salmonella, L. monocy ogenes, and S.
au eus) and spoilage (lac ic acid bac e ia) mic oo ganisms a e HPP han o he mea
p oduc s (Jo é e al., 2009; Rendueles e al., 2011).
To he bes o ou knowledge, no p e ious s udies e alua ing he e ec o high p essu e
on d y-cu ed mea pa asi ized wi h T. gondii ha e been ca ied ou o da e. The e o e,
he objec i e o he p esen s udy was o e alua e he po en ial use o he ac ual HPP
ea men s commonly employed by he mea indus y o isk con ol o T. gondii in
d y-cu ed ham. Fo his pu pose, we e alua ed he e ec s o HPP on he iabili y o T. gondii
b adyzoi es in ec ing aw and d y-cu ed ham made om expe imen ally in ec ed pigs.
Jou nal P e-p oo
Jou nal P e-p oo
2. Ma e ial and me hods
2.1. Animal in ec ion, aw and d y-cu ed ham sampling, and sample p epa a ion o
analysis
Two T. gondii se onega i e whi e pigs we e used (~50 kg, 5 mon hs o age). One pig
was in ec ed o ally wi h 4,000 spo ula ed T. gondii oocys s (VEG s ain). The o he pig
was le unin ec ed and was used as he nega i e con ol. Animal in ec ion and slaugh e
was app o ed by he E hics Commi ee o he Complu ense Uni e si y o Mad id (Re .
PROEX 415/15). The pigs we e housed and main ained unde Biosa e y Class III
condi ions (in he VISAVET acili ies o he Ve e ina y Facul y o Complu ense
Uni e si y o Mad id) un il he s udy was comple ed. Six y days pos in ec ion, he
animals we e slaugh e ed and bo h haunches we e collec ed. One haunch was analysed
on day ze o, and he o he was cu ed o 12 mon hs. The echnological ea men o he
ham was ca ied ou in a cu ed ham p ocessing acili y as desc ibed by He e o e al.
(2017). Wa e ac i i y was de e mined in inal d y-cu ed hams by he Associa ion o
O icial Analy ical Chemis s O icial Me hod 978.18 (AOAC, 1998). Boneless aw and
d y-cu ed ham we e cu in o small pieces, minced, homogenized and e ige a ed.
2.2. High p essu e p ocessing
Fi y g ams o p epa ed samples we e placed in sealable plas ic bags and acuum-
packaged. The sealed bags we e hen placed in addi ional sealable bags and sealed
again. These addi ional bags we e used o p e en any po en ial con amina ion o he
HPP uni . Samples we e s o ed unde e ige a ion un il HPP ea men and analysed
he ea e .
HPP p ocess was pe o med in an indus ial Hipe ba ic 135 high p essu e p ocessing
uni (Hipe ba ic Bu gos, Spain), equipped wi h a 135 L essel, using ap wa e
(6ºC±1ºC) as he p essu e- ansmi ing luid. The wa e empe a u e du ing HPP
inc eased 2.7ºC pe 100 MPa.
A se ies o di e en HPP ea men s we e ca ied ou . HPP was applied o aw mea a
100, 200, 300, and 400 MPa wi h a holding ime o 1 min a each p essu e es ed. In
addi ion, a HPP ea men o 600 MPa was applied du ing a holding ime o 20 min.
High hyd os a ic p essu e was applied o d y-cu ed ham a 600 MPa wi h holding ime
o 3, 10, and 20 min. Each HPP ea men was eplica ed h ee imes. P essu e buildup
was 240 MPa/min, and decomp ession was ins an aneous.
A nega i e con ol and a posi i e con ol we e included o each assay ( aw and d y-
cu ed ham). The nega i e con ol did no con ain T. gondii cys s, while he posi i e
con ol did, bu was no subjec ed o any HPP ea men .
2.3. Mouse bioassay o issues o T. gondii
To de e mine iabili y, we pe o med bioassay on mice, ollowed by eal ime PCR
(qPCR). A e he inocula ion o mice o he sample o be analysed, se ocon e sion
Jou nal P e-p oo

Jou nal P e-p oo
occu ed i he pa asi e was con ained in i . I he pa asi e was iable in he po k sample,
he issue cys s could o m in he b ain o exposed mice (Figu e 1) and issue cys
o ma ion could be con i med by PCR. Fo each HPP- ea ed o con ol sample, a
concen a ion bioassay echnique wi h an acid pepsin diges ion p ocedu e was applied
o aw and d y-cu ed ham, as desc ibed elsewhe e (Baya i e al., 2010; Dubey, 1998).
A 0.5 ml aliquo o diges ion ex ac was inocula ed in ape i oneally in o each o eigh
20-25 g CD1 Swiss emale mice pe sample (Jan ie Labs, Le Genes -Sain -Isle,
F ance). All expe imen s included nega i e con ol mice. The mice came wi h a heal h
ce i ica e a es ing ha hey we e ee om pa hogens. They we e kep a he Cen o de
In es igación Biomédica de A agón (CIBA) in Za agoza (Spain). The inocula ion,
main enance, and eu hanasia o he mice we e pe o med unde he s anda ds o he
E hics Ad iso y Commission o Animal Expe imen a ion and he Biosecu i y
Commission o he Uni e si y o Za agoza, as g an ed by Judgmen No PI55/14. These
guidelines a e in acco dance wi h he P o ocol o In e na ional Guiding P inciples o
Biomedical Resea ch In ol ing Animals (Di ec i e 2010/63/EU).
2.3.1. IFA o mouse se a
Blood samples we e d awn om mice ha su i ed 60 days a e inocula ion. Se a
samples o mice we e analysed by IFA o de ec an ibodies agains T. gondii wi h
polyclonal abbi an imouse immunoglobulins (DakoCy oma ion). Se um om each
mouse was dilu ed 1:10, 1:20, 1:40, 1:80, 1:160, and 1:320. A posi i e and a nega i e
con ol se um om p e ious s udies in ou labo a o y we e included in each es . Final
p epa a ions we e examined wi h an Eclipse 80i luo escence mic oscope (Eclipse 80i,
Nikon ins umen s INC, Ne he lands). Se a samples wi h a i e o 1:10 we e conside ed
posi i e.
2.3.2. DNA ex ac ion and iden i ica ion o T. gondii
Analysis o T. gondii DNA om b ains o se ologically posi i e mice was pe o med by
qPCR o de e mine iabili y o he pa asi e. Fi een mg piece o each b ain we e
homogena ed h ough hand pis el plas ic o a ing plunge s in an eppedo . The DNA
ex ac ion was pe o med using Ul aClean® Tissue & Cells DNA Isola ion Ki Sample
Ca alog No. 12334-S (Mobio Labo a o ies, Inc.) acco ding o he manu ac u e ’s
ins uc ions. Two se s o p ime s o DNA ampli ica ion a ge ing speci ic sequence o
529 epea elemen we e used (ToxoRoc F TAGACGAGACGACGCTTTCC, ToxoRoc
R TCGCCCTCTTCTCCACTCT, and ToxoRepea 500 F
CGCTGCAGGGAGGAAGACGAAAGTTG, ToxoRepea 500 R
CGCTGCAGACACAGTGCATCTGGATT) and ano he se o p ime s o he su ace
an igen ma ke genes (SAG) (ToxoSG1 F TCATCGGTCGTCAATAA, ToxoSG1 R
CTTTGACTCCATCTTTCC). A CFX Connec eal ime PCR ins umen (Bio-Rad
Labo a o ies) was used o he ampli ica ion and de ec ion o T. gondii using Go aq
Sybe g een Mas e Mix (ca alogue # A6002) om P omega. The eac ion olume was
20 ml, and samples we e un in iplica es. The p o ocol consis ed o 7 min a 94 ºC o
enzyme ac i a ion (ho s a ), and 40 cycles o dena u a ion a 94 ºC o 5 s, annealing a
Jou nal P e-p oo
Jou nal P e-p oo
55 ºC o 30 s, and ex ension a 72 ºC o 10 s. The p og am ended wi h a dissocia ion
cu e om 60 o 94 ºC wi h a 0.5 ºC inc ease in e al. Each PCR un included a
nega i e con ol, a posi i e con ol, and a sepa a e eac ion o Ac in DNA copies as
in e nal con ol (IC). A sample was conside ed posi i e i a leas wo o he iplica es
we e posi i e wi h bo h ma ke s. The h eshold cycle (C ) alue used was indica ed by
he ma ke 529 epea elemen (C mus be lowe han 38), and he SAG ma ke se ed
o con i m he esul . Calib a ion cu es we e p epa ed using 15 mg o homogena e
nega i e issues spiked wi h a known numbe o achyzoi es (104, 103, 102, 101, and
100). The samples we e subsequen ly homogenized and p ocessed wi h he comme cial
DNA ex ac ion ki ollowing he manu ac u e ’s ins uc ions in he same way as he
es o he samples.
3. Resul s and Discussion
The esul s o he e ec o high-p essu e p ocessing on T. gondii issue cys s in aw
ham a e p esen ed in Table 1. High-p essu e p ocessing o aw mea a p essu es o 100,
200, 300, and 400 MPa wi h holding ime o 1 min was no e ec i e in educing
in ec i i y o T. gondii. T ea men wi h HPP a 600 MPa o 20 min comple ely
elimina ed in ec i i y o mice. None o he mice inocula ed wi h non-in ec ed aw mea
became in ec ed wi h T. gondii. In ec ion was obse ed in mice inocula ed wi h non-
p essu e- ea ed T. gondii issue cys con aining g ound po k.
Ou esul s di e om hose desc ibed by he only s udy ha has p e iously e alua ed
he applica ion o HPP ea men s agains T. gondii inocula ed in aw mea (Lindsay e
al., 2006). Acco ding o hose au ho s, he HPP ea men has achie ed he inac i a ion
o he pa asi e wi h p essu es a 300-400 MPa and a holding ime o 30 s. These esul s,
di e ing om ou s, could be due o he ac ha he au ho s ha e wo ked wi h g ound
po k in en ionally spiked wi h mouse b ains con aining iable issue cys s; la e samples
ha e been diges ed in acid pepsin solu ion and bioassayed in mice. Since he pa asi e is
con ained in he mouse b ain issue and no in pig muscle, i is possible ha he
diges ion p ocess may ha e a ec ed he iabili y o b adyzoi es o a g ea e ex en
(Dubey e al., 1995; Dubey, 2010; Mendoça, Domingues, da Sil a, Peze ico, &
Langoni, 2004). Ou s udy, on he con a y, used expe imen ally in ec ed animals,
which implies ha T. gondii issue cys s we e loca ed in he muscle issue, which is
mo e esis an o he diges i e p ocess. As he i s in es iga ion o e alua e HPP in
mea om animals expe imen ally in ec ed wi h T. gondii, his s udy holds special
ele ance, since i mo e ai h ully ep oduced he condi ions in which he pa asi e is
ound wi hin he muscula issues.
Ano he possible eason o ou disc epancy wi h he esul s o he esea ch ca ied ou
by Lindsay e al. (2006) is he echnique we used o con i m iabili y. Bioassay is
ega ded as he gold s anda d o he e alua ion o ea men e icacy o pa asi es in
ood (F anssen e al., 2019). Bo h Lindsay e al. (2006) and ou own s udy ha e used
bioassay; howe e , we con i med iabili y by analysing he mouse b ain by q-PCR,
unlike Lindsay e al. (2006), who ha e used his ology. PCR has mo e speci ici y and
Jou nal P e-p oo
Jou nal P e-p oo
sensi i i y in de ec ing he p esence o T. gondii han his ological de ec ion (Es eban-
Redondo e al., 1999; Ops eegh, Scha es, & an de Giessen, 2016). Resea ch on
oodbo ne pa asi es should be imp o ed wi h he goal o s anda dizing expe imen al
app oaches o he e alua ion o inac i a ion me hods, bu also in o de o s anda dize
me hods designed o moni o inac i a ion (F anssen e al., 2019).
In he cou se o he HPP p ocess, p essu e is ansmi ed uni o mly and ins an ly
(Hugas, Ga iga, & Mon o , 2002) wi h li le a ia ion in empe a u e, independen o
ood shape o size (Rendueles e al., 2011). This aspec is o pa icula in e es when
in es iga ing pa hogens such as T. gondii, o which he dis ibu ion o cys s in issues is
ho oughly andom. I has been es ima ed ha he numbe o T. gondii cys s pe g am o
issue om ood animals such as pigs may be less han 1 cys /50 g o issue, and one
cys may con ain a ew o 1000 indi iduals (Es eban-Redondo e al., 1999; Ops eegh e
al., 2016).
High hyd os a ic p essu e usually exe s a s onge des uc i e e ec on o ganisms wi h
a highe deg ee o o ganiza ion and s uc u al complexi y. P oka yo es a e usually mo e
esis an han euka yo es (Yus e, Capellas, Fung, & Mo -Mu , 2001), and i is assumed
ha he des uc ion o pa asi es is achie ed wi h ela i ely low p essu es (Rendueles e
al., 2011). Howe e , he p essu es and imes equi ed o inac i a e T. gondii a e highe
han hose used in p e ious s udies agains issue cys (Lindsay e al., 2006) o oocys s
(Lindsay e al., 2008). They a e also supe io o hose used agains o he pa asi es
(B u i e al., 2010; Collins e al., 2005; Molina-Ga cía & Sanz, 2002; Noeckle e al.,
2001; Rosypal e al., 2007, 2011).
The applica ion o HPP o mea modi ies quali y pa ame e s such as colou , ex u e, and
wa e holding capaci y (Bajo ic e al., 2012). Mea colou is one o he mos impo an
quali y cha ac e is ics o consume s in a pu chase si ua ion. HPP a ec s quali y
pa ame e s o aw mea , pa icula ly depending on he p essu e le el applied, and hus
ypical cha ac e is ics associa ed wi h aw mea such as ex u e and, especially, colou
can be modi ied o a ema kable deg ee. The mea becomes mo e gel-s uc u ed and
pale , losing he ypical appea ance o aw mea (Bajo ic e al., 2012). Thus hampe s
he comme cializa ion o HPP- ea ed aw mea s due o he loss o he ypical aw mea
colou om a consume pe spec i e (Che el & Culioli, 1997). These changes a e
indeed ele an i he p oduc s a e u he p ocessed o e en di ec ly consumed; hey
would, howe e , be sa e and mo e nu i ious han cooked mea , since HPP has no
nega i e impac on nu i ional alue (Bajo ic e al., 2012). Rega ding he
physicochemical e ec o HPP echnology on ood, i is so e and p ese es la ou
be e han a he mal ea men (Schindle , K ings, Be ge , & O lien, 2010). Such
changes in colou and ex u e may e en be desi able in some cases, when he pu pose is
o elabo a e new p oduc s and new o ms o p esen a ion.
The chemical composi ion o ood has been iden i ied as an impo an ac o ha can
in luence he g ea e o lesse esis ance o mic oo ganisms o HPP. The e icacy o
Jou nal P e-p oo
Jou nal P e-p oo
HPP dec eases wi h educed aw (Jo é e al., 2009; Rendueles e al., 2011), as is he case
o he d y-cu ed ham samples e alua ed in his s udy (aw ~0.85).
Fo ou s udy o he e ec o HPP on T. gondii issue cys s con amina ing d y-cu ed
ham, we assayed h ee di e en HPP ea men s. We i s applied wo ea men
condi ions (600 MPa/3 min and 600 MPa/10 min) commonly used by he ood indus y
o con ol L. monocy ogenes and ul il he equi emen s o USDA and Heal h Canada
(Bo e -Cid, Belle i, Ga iga, & Ayme ich, 2011; Hayman e al., 2004; Hugas e al.,
2002). These holding imes a e di ec ly ela ed wi h he wa e ac i i y and a con en o
he d y-cu ed p oduc s and, depending on hese wo cha ac e is ics, HPP is modula ed
be ween 3 and 10 min o ea men (habi ually 5 min) (He eu e al., 2012). We hen
applied a longe ea men , o 600 MPa/20 min. As desc ibed in Table 2, while HPP a
600 MPa o 3 and 10 min did no elimina e T. gondii in ec i i y o mice, 600 MPa o
20 min gua an eed i s inac i a ion. None o he mice inocula ed wi h non-in ec ed d y-
cu ed mea became in ec ed wi h T. gondii. Con e sely, in ec ion was obse ed in mice
inocula ed wi h non-p essu e- ea ed T. gondii issue cys con aining g ound po k.
Such ex ended imes do no end o be employed a he indus y (Bajo ic e al., 2012;
Hyg ee a & Pandey, 2016; Rendueles e al., 2011); ins ead, imes o 3-10 min a e mo e
common (Bo e -Cid e al., 2011; Hayman e al., 2004; Jo é e al., 2009). Six hund ed
MPa o 10 min o holding ime ha e been necessa y o each 3 log-inac i a ion o
p essu e- esis an L. monocy ogenes in Spanish d y-cu ed ham (aw 0.880; pH 5.84)
(Bo e -Cid e al., 2011). This inac i a ion le el is ele an o ul illing he
equi emen s o USDA and Heal h Canada ega ding he con ol o L. monocy ogenes in
RTE ood p oduc s. To he bes o ou knowledge, ou s is he i s s udy o ha e
e alua ed he e ec o HPP on he inac i a ion o T. gondii in d y-cu ed ham om
expe imen ally in ec ed animals.
I is gene ally accep ed ha cu ed mea colou is pa icula ly esis an o HPP. The
majo i y o s udies ha e epo ed no change in edness, he eby suppo ing he
p o ec i e ole o ni i ica ion on mea colou (Bak, Boluma , Ka lsson, Lindahl, &
O lien, 2019). The colou o mea is s ongly ela ed o i s wa e con en (Fe ini,
Comaposada, A nau, & Gou, 2012), and HPP applied o up o 10 min ha e had a
negligible e ec on d y-cu ed ham. Howe e , wi h mo e ex ended ea men imes,
isible changes could appea in he p oduc s (Bajo ic e al., 2012; Bak e al., 2019).
These changes migh a y acco ding o he mea ’s ini ial ex u al cha ac e is ics and
depending on i s p o ein sys em, i s empe a u e, he p essu e applied, and he du a ion
he eo . Juiciness, sp inginess, and chewiness a e inc eased by HPP depending on
ea men ime (Coll-B asas e al., 2019). Longe ea men s inc ease p oduc ion cos s,
since hey limi he numbe o ea men cycles pe hou and educe he kilo p oduc ion
a e pe hou . In o de no o exceed hose imes, one o he solu ions applied bo h in he
mea sec o and in o he sec o s (juices and be e ages, p epa ed dishes, e c.), consis s in
applying mul i-pulsed p essu e cycles (comp ession and decomp ession a es). Mul i-
pulsed HPP could be used o inac i a e spoiling and pa hogenic agen s, he eby helping
o imp o e ood sa e y and quali y. An op imized balance be ween ideal p essu e,
Jou nal P e-p oo
Jou nal P e-p oo
5 h Decembe 2019
Au ho s a emen
Dea edi o s,
Please, below you can ind he indi idual con ibu ion o au ho s o he pape
IFSET_2019_1177, using CRediT oles:
Susana Baya i, as coo dina o o he esea ch p ojec leading o his publica ion,has p oposed
he s udy, has deal wi h he acquisi ion o he inancial suppo , as well as he planning,
execu ion and supe ision o he esea ch ac i i y. She has coo dina ed he mul idisciplina y
eam in eg a ed by he au ho s o his wo k. (CRediT oles: Concep ualiza ion; Da a cu a ion;
Fo mal analysis; Funding acquisi ion; In es iga ion; Me hodology; P ojec adminis a ion;
Resou ces; Supe ision; Visualiza ion; W i ing - e iew & edi ing).
Ma ía Jesús G acia, pa asi ology expe , has p oposed he s udy and has pa icipa ed on he
planning o he ials. She has also con ibu ed o expe imen al asks ela ed o pig in ec ion
and sample analysis (mouse bioassay). She has been esponsible o w i ing he ini ial d a .
(CRediT oles: Concep ualiza ion; Da a cu a ion; Fo mal analysis; In es iga ion; Me hodology;
Visualiza ion; W i ing - o iginal d a ; W i ing - e iew & edi ing).
João Luis Ga cia, pa asi ology expe , has p o ided he Toxoplasma VEG s ain o he s udy
and has pa icipa ed in he expe imen al pig in ec ion design. (CRediT oles: Concep ualiza ion;
Fo mal analysis; In es iga ion; Me hodology).
Ra ael Pagán and Se gio Ramos ha e p o ided expe ise in ood echnology and
ins umen a ion o HPP ea men , and ha e pe o med HPP expe imen s. (CRediT oles:
Concep ualiza ion; Fo mal analysis; In es iga ion; Me hodology; Visualiza ion; W i ing - e iew
&edi ing).
Regina Láza o and Consuelo Pé ez-A quillué, ood sa e y expe s, ha e pa icipa ed in sample
p epa a ion o HPP ea men s and ha e con ibu ed o da a analysis ela ed wi h isk
assessmen . (CRediT oles: Concep ualiza ion; In es iga ion; Me hodology; Visualiza ion;
W i ing - e iew &edi ing).
Since ely you s,
Susana Baya i (Co esponding au ho )
Jou nal P e-p oo

Jou nal P e-p oo
Figu e 1. Toxoplasma gondii cys in mouse b ain
Jou nal P e-p oo
Jou nal P e-p oo
Table 1. E ec o di e en HPP ea men condi ions on Toxoplasma gondii issue cys s
in aw ham
T ea men
Exposu e ime
(min)
Se oposi i e
mice a
Viabili y o
T. gondii b
In ec i i y
o he
sample
Nega i e
con ol
0
0/8
-
-
Posi i e
con ol
0
4/8
4/4
35.61
33.83
34.23
35.02
+
100MPa
1
2/8
1/2
35.29
+
8/8
2/8
31.01
31.43
5/8
1/5
35.75
200MPa
1
2/8
0/2
+
2/8
0/2
3/8
2/3
33.20
31.45
300MPa
1
4/8
2/4
32.46
32.42
+
4/8
0/4
5/8
2/5
34.78
31.51
400MPa
1
2/8
2/2
33.88
32.35
+
3/8
0/3
2/8
0/2
600MPa
20
2/8
0/2
-
3/8
0/3
3/8
0/3
aSe oposi i e mice by IFA/To al o mice.
Jou nal P e-p oo
Jou nal P e-p oo
bPosi i e mice b ain by PCR/To al o se oposi i e mice by IFA; C alues o posi i e
mice b ains (< 38).
Jou nal P e-p oo
Jou nal P e-p oo
Table 2. E ec o di e en HPP ea men condi ions on Toxoplasma gondii issue cys s
in d y-cu ed ham
T ea men
Exposu e
ime
(min)
Se oposi i e
mice a
Viabili y o
T. gondii b
In ec i i y o
he sample
Nega i e
con ol
0
0/8
-
-
Posi i e
con ol
0
5/8
3/5
28.77
29.77
30.58
+
600MPa
3
5/8
0/5
+
3/8
0/3
3/8
1/3
34.84
600MPa
10
4/8
1/4
34.67
+
2/8
0/2
1/8
0/1
600MPa
20
1/8
0/1
-
1/8
0/1
4/8
0/4
aSe oposi i e mice by IFA/To al o mice.
bPosi i e mice b ain by PCR/To al o se oposi i e mice by IFA; C alues o posi i e
mice b ains (< 38).
Jou nal P e-p oo
Jou nal P e-p oo
Highligh s
• Fi s HPP s udy on T. gondii in aw and cu ed ham om expe imen ally
in ec ed pigs
• Viabili y o T. gondii assessed by bioassay in mice ollowed by PCR
• 600 MPa/10 min does no inac i a e T. gondii in d y-cu ed ham while 600
MPa/20 min does
• HPP o aw and d y-cu ed ham is a po en ial ool o he isk con ol o T.
gondii
Indus ial ele ance ex
Unde eal p oduc ion condi ions, he usual HPP ea men s applied by he ood
indus y o con ol L. monocy ogenes and o he pa hogenic bac e ia a e 600 MPa o p essu e
and holding imes o 3-10 min. Ou s udy demons a ed, howe e , ha longe ea men imes
a e equi ed o inac i a e he pa asi e and, hus, o gua an ee he sa e y o aw and d y-cu ed
mea s in o de o educe he public heal h isk o oxoplasmosis. Fu he esea ch is needed o
e alua e o he HPP condi ions, including pulsed cycles, o he inac i a ion o T. gondii in oods
o animal o igin.
Jou nal P e-p oo

Figu e 1